CN101921725B - Converter for inhibiting hen somatostatin action through oral immunization and application thereof - Google Patents
Converter for inhibiting hen somatostatin action through oral immunization and application thereof Download PDFInfo
- Publication number
- CN101921725B CN101921725B CN2010102380863A CN201010238086A CN101921725B CN 101921725 B CN101921725 B CN 101921725B CN 2010102380863 A CN2010102380863 A CN 2010102380863A CN 201010238086 A CN201010238086 A CN 201010238086A CN 101921725 B CN101921725 B CN 101921725B
- Authority
- CN
- China
- Prior art keywords
- gene
- chicken
- transformant
- sst
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- Y02A50/472—
Abstract
The invention discloses a converter which comprises a recipient bacterium and a recombinant vector converted into the recipient bacterium. The recipient bacterium is lactococcus lactis NZ9800, an original carrier of the recombinant vector is pNZ8112, and exogenous target genes of the recombinant vector comprise a hen somatostatin gene, a cholera toxin B subunit gene and a cell wall anchor stator M6 gene. The converter of the invention can enter a hen intestine in an oral taking mode. Compared with injection immunization, the converter lowers the toxicity caused by directly contacting with a circulating system and enhances the vaccine safety. By selecting the combined immunization of an antigen gene and an immune enhancement factor, the invention enhances the body immune response and improves the immune effect.
Description
Technical field
The present invention relates to bioengineering field, relate in particular to a kind of transformant and application thereof of converter for inhibiting hen somatostatin action.
Background technology
The indigenous chicken kind of China is compared with external kind, the characteristics such as have the high degree of adaptability to surrounding environment, anti-low level management, disease resistance is strong, meat is good.But because China's indigenous chicken kind is grown slowly, efficiency of feed utilization is low; a large amount of introducings along with external high productivity energy kind; cruel market competition is sharply descending the quantity of China's indigenous chicken kind; some kind is even in imminent danger or be tending towards extinction, and famous Xiaoshan chicken quantity greatly reduces so that the large meat of build is good as element.Although external chicken kind growth is fast, efficiency of feed utilization is high, but meat flavor is poor, along with growth in the living standard, people more and more pay attention to meat quality, the demand rapid growth of existing market to high-quality lean meat, this transformation to we proposed to cultivate that growth is fast, requirement and the challenge of the good new variety of local flavor, strain.
Improve animal growth rate is that animal produces the target that the researchist makes great efforts always.But improve breeding performonce fo animals by traditional genetic improvement and nutrition regulation means at present and be difficult to have again large progress.In order to improve the production performance of animal, add various forbidden drugs and cause the event of food poisoning to happen occasionally in feed, thereby to study a kind of safe, efficient, thing growth method of actuating that the mankind are had no side effect be the pressing issues that present aquaculture faces.
If immunologic method is applied to the regulation and control of breeding performonce fo animals, selection has inhibiting hormone or the factor and immunostimulant factor amalgamation and expression or co-immunization to strengthen its immunogenicity to growth of animal, come immune animal as antigen, can bring out the create antagonism antibody of this kind hormone or the factor of body, thereby suppress or weaken the physiological function of this hormone or the factor.This technology is expected to improve the production performance of animal, and kind or the strain meaning slow to those growths are especially great, and fool proof without any side effects.
Can not field planting in animal intestinal due to intestinal bacteria, yeast etc., so can not carry out oral immunity, expressed purpose product purification must be carried out injecting immune.The protein purification step has increased production cost and difficulty greatly, makes scale operation target protein preparation be difficult to realize.Simultaneously the injecting immune program is also more loaded down with trivial details, not only will expend larger manpower, to animal stress be also larger with injury.Therefore a kind of to favorable safe, the convenient oral preparations that also can carry out scale operation of growth of animal in the urgent need to developing.
Milk-acid bacteria is a class most widely used essential industry bacterial strain in food, and it comprises tens genus such as Lactococcus lactis, lactobacillus, is acknowledged as safe food-grade microorganisms.Milk-acid bacteria itself is exactly a kind of probiotic bacterium, and energy regulating intestinal canal microenvironment helps digest, and suppresses the harmful intestinal tract microorganism, and control diarrhoea is actuated the thing growth-weight gain.
Summary of the invention
The invention provides a kind of transformant of converter for inhibiting hen somatostatin action, this transformant can be taken in also field planting in the chicken enteron aisle by oral way, the fusion rotein of its secretion can effectively bring out the antibody that produces anti-chicken Somatostatin in the chicken body, thereby suppresses or weaken the endogenous growth chalone to the restraining effect of chicken growth.
A kind of transformant, comprise recipient bacterium and the recombinant vectors that is transformed into recipient bacterium inside, described recipient bacterium is Lactococcus lactis NZ9800, the initial carrier of recombinant vectors is pNZ8112, and the external source goal gene of recombinant vectors comprises the sub-M6 gene of chicken somatostatin gene, b subunit of cholera toxin gene and cell walls grappling.The chicken Somatostatin (No. GenBank: NM_205336) be a kind of 14 peptides, except the hypothalamus secretion, organize also and can produce for Somatostatin, SST by gi tract and pancreas etc.SST not only has restraining effect to tethelin, can also suppress secretion and the release of the gastrointestinal hormone ` that Regular Insulin, thyroxine and some promoting digestion absorb, thereby it is an important factor regulating growth of animal, and it is as immunogen in the present invention.
For the enhancing body immunne response, improve immune effect, connect the b subunit of cholera toxin gene on antigen gene, b subunit of cholera toxin (Cholera toxin B subunit, be called for short CTB, No. GenBank: be U25679) immunostimulant, studies show that it is a kind of avirulent very effective Mucosal Adjuvants, is particularly suitable as the immunity enhancement adjuvant albumen of oral vaccine.
(No. GenBank: M11338) can combine with the albumen on the Lactococcus lactis cytolemma, be secreted into outside born of the same parents after immunogen and immunostimulant are expressed, sub-M6 can be fixed on cell walls the M6 of cell walls grappling by the cell walls grappling.
Initial carrier pNZ8112 contains the promotor NisA that strong promoter is nisin A (Nisin A) (No. GenBank: AY303241) and efficient coding sequence of secretory signal peptide Usp45 (No. GenBank: M60178), signal peptide Usp45 is positioned at the downstream of promotor NisA, and the external source goal gene is connected to the C end of signal peptide.
The base sequence of described somatostatin gene, b subunit of cholera toxin gene, the sub-M6 gene of cell walls grappling, promotor NisA and signal peptide Usp45 is as shown in SEQ ID NO.5～9.
Milk-acid bacteria itself is exactly a kind of probiotic bacterium, and energy regulating intestinal canal microenvironment helps digest, and suppresses the harmful intestinal tract microorganism, and control diarrhoea is actuated the thing growth-weight gain.Milk-acid bacteria field planting or of short duration field planting in vivo is the prerequisite of its performance physiological function.By carrier, goal gene such as immunogen gene are imported in milk-acid bacteria, then make active bacteria formulation and feed, introduce in animal body, thereby the product that produces the external source goal gene causes mucous membrane and humoral immunization.Find after deliberation, the lactobacillus of energy long period field planting easily makes animal produce immunological tolerance to the purpose exogenous genes products in enteron aisle, and does not produce this immunological tolerance phenomenon at the short-and-medium tentative Lactococcus lactis of planting of enteron aisle.
The present invention also provides above-mentioned transformant in the active application of immunity blocking-up chicken Somatostatin, by with secreting, expressing the transformant feeding of external source goal gene product to chicken, Lactococcus lactis will of short duration field planting in the chicken enteron aisle, thereby cause that chicken produces immunity to external source goal gene product, the Somatostatin of namely milk-acid bacteria being expressed produces immunity, produce the antibody of the long chalone of antibiosis, this antibody can weaken or suppress chicken endogenous growth chalone and the restraining effect of chicken growth be reached the purpose of promotion growth.
According to above-mentioned application, the present invention provides again a kind of chicken oral immunity preparation that utilizes above-mentioned transformant preparation, and it comprises substratum and has secreted the transformant of external source goal gene product.Said preparation preparation and use are all very convenient.
Described substratum can for promoting the substratum of Lactococcus lactis bacteria growing, be preferably the GM17 substratum.In use, in above-mentioned oral immunity preparation, transformant concentration is preferably 1 * 10
8Cfu/mL～1 * 10
10Cfu/mL makes the Lactococcus lactis in enteron aisle reach finite concentration, and each feeding amount is 1～2ml.
The present invention also provides a kind of preparation method of above-mentioned chicken oral immunity preparation, comprises the following steps: transformant is placed in substratum, is cultured to OD
600Be 0.3～0.5, add nisin to continue to cultivate 2～3h.
Described nisin is the induced expression thing, adds rear concentration to be preferably 10～20ng/mL.
Transformant of the present invention can enter the chicken enteron aisle by oral way, compares with injecting immune, reduces directly to contact the toxicity that causes with the recycle system, increases the security of vaccine.Select antigen gene/immunostimulant factor (avirulent b subunit of cholera toxin) combined immunization, strengthened immune response, improved immune effect.
Embodiment
GM17 liquid nutrient medium: Tryptones 2%; Yeast extract paste 0.5%; Vc 0.05%; Extractum carnis 0.5%; Sodium acetate 0.15%; Sodium-chlor 0.4%; MgSO
4.7H
2O 0.25%; Glucose 0.5% transfers to pH 6.8.The GM17 solid medium adds 1.6% agar on above-mentioned medium base.
Lactococcus lactis NZ9800 and carrier pNZ8112 are commercially produced product, from the NIZO food research of Holland.
1, the structure of goal gene and clonal expression
(1) structure of CTB-SST mosaic gene
Upstream primer (SEQ ID NO.1):
5’-GG
ACACCTCAAAATATTACTG-3’
The primer structure is: protection base (GG)-Xba I site (sequence in frame)-CTB 5 ' end sub-sequence (underscore sequence)
Downstream primer (SEQ ID NO.2):
5’-TG
ACAGGATGTGAAAGTTTTCCAGAAGAAGTTCTTG CAGCCCGC 
-3’
Primer structure: protection base (TG)-BamH I site (sequence in frame)-SST sequence (underscore)-linker (bold Italic sequence)-CTB 3 ' end sub-sequence (double underline).
Take cholera vibrio gene group DNA (containing the CTB gene) as template, carry out PCR with above-mentioned primer, the PCR condition is: the total reaction system is 50 μ l, wherein contains the DNA profiling of 50ng, 1 * PCR buffer, 1.5mM MgCl
2, 0.2mM dNTP, 0.2 μ M upstream and downstream primer, 2.5U Taq archaeal dna polymerase.The PCR reaction parameter is set to: 94 ℃ of denaturations 1 minute; 94 ℃ of sex change 30 seconds, 50 ℃ of annealing 30 seconds, 72 ℃ were extended 30 seconds, 35 circulations; Then extended 5 minutes after 72 ℃.
With SST, connexon linker and CTB 3 ' end sub-sequence, therefore can directly obtain the CTB-SST mosaic gene due to downstream primer self after PCR.The PCR product is cut rear clone in pET28 carrier (Invitrogen company) with Xba I and BamH I enzyme.
Then will contain the pET28 Plasmid Transformation of CTB-SST in E.coli DH5 α (Takara company) competent cell, be coated with the LB flat board, cultivate 18-20h for 37 ℃, the positive spot enlarged culturing of picking, then extracting plasmid, PCR and enzyme are cut in the plasmid of identifying extracting and are contained goal gene.
(2) structure of CTB-SST-M6 recombinant expression vector
Upstream primer (SEQ ID NO.3):
5’-AA
AGAGTGTTTCCTAGGGG-3’
The primer structure is: protection base (AA)-BamH I site (sequence in frame)-M65 ' end sub-sequence (underscore sequence)
Downstream primer (SEQ ID NO.4):
5’-CG
GTTTTCTTCTTTGCGTT-3’
The primer structure is: protection base (CG)-Hind III site (sequence in frame)-terminator (bold Italic sequence)-M63 ' end sub-sequence (underscore sequence)
Be template with micrococcus scarlatinae genomic dna (containing the M6 gene), carry out PCR (the PCR condition is the same) with above-mentioned primer, can obtain the PCR product of two ends band BamH I and Hind III restriction enzyme site, cut the PCR product with these two kinds of enzyme enzymes, be recombined into CTB-SST gene downstream in the pET28 carrier that contains CTB-SST (the BamH I site by design is connected CTB-SST with the M6 restructuring: (Xba I) CTB-linker-SST (BamH I) and (BamH I) M6-terminator (Hind III)).
Then will contain the pET28 Plasmid Transformation of CTB-SST-M6 mosaic gene in E.coli DH5 α competent cell, be coated with the LB flat board, cultivate 18-20h for 37 ℃, the positive spot enlarged culturing of picking, then extracting plasmid, PCR and enzyme are cut in the plasmid of identifying extracting and are contained goal gene.
The enzyme tangent condition is: 37 ℃ of enzymes are cut and are spent the night; Ligase enzyme and condition: T
4DNA ligase, 16 ℃ of connections are spent the night.Other processes are all carried out according to a conventional method.
2, the clone of CTB-SST-M6 mosaic gene in the intermediate host bacterium and the expression in Lactococcus lactis
(1) clone of CTB-SST-M6 mosaic gene in the intermediate host bacterium
Because the clone copy number of expression vector pNZ8112 (NIZO food research (Holland)) in Lactococcus lactis is very low, expect enough restructuring pNZ8112 plasmids (containing CTB-SST-M6), must make the pNZ8112 plasmid reach enough copy numbers by an intermediate host bacterium E.coli MCl061 (Invitrogen company).
Screen recombinant bacterium (10ug/ml paraxin) with chlorampenicol resistant: contain chloramphenicol resistance gene on pNZ8112, E.coli MCl061 bacterial strain itself is not had a chlorampenicol resistant, and the E.coli MCl061 that only is transformed into the pNZ8112 plasmid could grow containing on the flat board of paraxin.
At first goal gene (CTB-SST-M6) enzyme from the pET28 plasmid is cut (Xba I and HindIII) and get off, rubber tapping is reclaimed, and is recombined in the pNZ8112 that cut with same enzyme T
416 ℃ of connections of DNA ligase are spent the night, and then Transformed E .coli MC1061 competent cell, be coated with the LB flat board, cultivate 18-24h for 37 ℃, the bacterial plaque enlarged culturing that grows on picking paraxin flat board, extracting plasmid then, PCR and enzyme are cut in the plasmid of identifying extracting and are contained goal gene.
(2) expression of CTB-SST-M6 mosaic gene in Lactococcus lactis
after obtaining containing the restructuring E.coli MC1061 of goal gene (CTB-SST-M6), with its enlarged culturing, make restructuring pNZ8112 plasmid wherein obtain enough copy numbers (each host cell is 10～60 parts of copies approximately), then extracting restructuring pNZ8112 plasmid, be transformed in Lactococcus lactis NZ9800 (NIZO food research (Holland)) competent cell, coating contains the GM17 dull and stereotyped (screening recombinant bacterium with chlorampenicol resistant equally) of 10ug/ml paraxin, cultivate 48-60h in 30 ℃, the bacterial plaque enlarged culturing that picking grows, the extracting plasmid, PCR and enzyme are cut in the plasmid of identifying extracting and are contained goal gene.
The Lactococcus lactis that will contain positive recombinant plasmid is transferred in the GM17 liquid nutrient medium that 5ml contains paraxin (final concentration is 10ug/ml), after 30 ℃, 180r/min overnight incubation; To the 10ml fresh culture, 30 ℃ were cultured to OD600 and are about 0.4 by the dilution proportion of 1: 25, and then adding final concentration is that 10ng/ml nisin nisin (Sigma company) induces destination gene expression 2-3h, and bacterium liquid is stand-by.
(3) check purpose albumen
at first the thalline in above-mentioned bacterium liquid is processed with N,O-Diacetylmuramidase, use again ultrasonic disruption, then with the cell solution after ultrasonic disruption is processed with 70% saturated ammonium sulphate after, the centrifugal 30min of 10000g, to be precipitated and dissolved in 50mMol/L pH6.0 phosphoric acid buffer, dialyse with the phosphoric acid buffer of 50mMol/L after activated carbon decolorizing and can't detect the ammonium radical ion to dialyzate, directly go up DEAE-Cellulose 52 post (2cm * 60cm, Pharmacia, in advance with the pH6.0 that contains 30mMol/L NaCl, the phosphoric acid buffer balance of 20mMol/L), carry out linear gradient elution with buffer system (the 20mMol/L pH6.0 phosphoric acid buffer and the 20mMol/L pH6.0 phosphoric acid buffer that contains 300mMol/L NaCl that contain 30mMol/L NaCl), after first using initial damping fluid (the 20mMol/L pH6.0 phosphoric acid buffer that contains 30mMol/L NaCl) to wash post, carrying out NaCl concentration is the linear gradient wash-out of 30-300mMol/L again, elution flow rate is 12mL/h, collect target protein with nucleic acid/Protein Detection instrument monitoring, use the deionized water dialysed overnight, again after freeze concentration in 4 ℃ of preservations, with conventional Western blotting (Western blotting) detection validation, detection method is as follows:
At first use commercial SST antigen (Sigma product) immune rabbit, the primary antibodie that detects for the preparation of Western blotting is two to resist with the goat anti-rabbit igg antibody (Sigma product) of commercial horseradish peroxidase-labeled.For whether testing goal PROTEIN C TB-SST-M6 (the gene size is 1674bp) is expressed by Lactococcus lactis, we use expression product and another kind of known SST fusion rotein (the Salmonellas flagellin encoding gene (H-1 of purifying
d)-Somatostatin is called for short H-1
d-SST, gene size is 1542bp) compare, if can be combined with purified product with the prepared primary antibodie of commodity SST antigen immune rabbit, again can with H-1
d-SST protein binding, and the molecular weight of albumen size conforms to proves in the expression product of purifying to contain target protein CTB-SST-M6.Western blotting result shows: H-1
d-SST and purified product all can be combined with the prepared primary antibodie of commodity SST antigen immune rabbit, demonstrate corresponding protein band (H-1
d-SST molecular weight is 40～50KD, and CTB-SST-M6 is 50～60KD), illustrates that the CTB-SST-M6 fusion rotein is by the Lactococcus lactis successful expression.
3, the antibody production after CTB-SST Lactococcus lactis oral immunity chicken
Choosing at random 40 AA chickens and carried out the recombinant lactic acid bacteria oral immunity, is 1 * 10 with concentration
9The bacterium liquid feeding of cfu/mL is the chick (1 age in days) of birth just, each feeding 1～2ml, 2 times weekly, 3 weeks of feeding.Certainly can change bacterial concentration according to practical situation, generally select 1 * 10
8～1 * 10
10Cfu/mL.
3 weeks, 6 weeks and 8 weeks are extracted chicken blood after first immunisation, separate obtaining chicken serum, for detection of chicken SST antibody production.Adopt the antibody horizontal in ELISA indirect Determination chicken serum, concrete steps are as follows:
With the coated 96 hole immunity plates of the SST antigen (Sigma product) of 0.5mg/ml, every hole adds antigenic solution 100ml, 48 ℃ of coated spending the night, then with containing 1.5%BSA (bovine serum albumin, the Sigma product) PBST solution (the PBS solution that contains 0.05%Tween-20) seals immune plate, 37 ℃ of sealing 2h.Adding extent of dilution is the chicken serum to be measured of 1: 50, wash three times, adding extent of dilution is the goat-anti chicken igg antibody (Sigma product) of the horseradish peroxidase-labeled of 1: 1000 again, then with 10mg 3,3 ', 5,5 '-tetramethyl benzidine (Sigma product, the substrate of enzyme can show blue under the horseradish peroxidase effect) be dissolved in 0.025M phosphoric acid salt citrate buffer solution and add in immune plate each hole every hole 50ml.Add 0.2M H after the substrate colour developing
2SO
4Termination reaction, then the absorbance value (OD value) after developing the color with wavelength 450nm mensuration substrate with enzyme connection determinator, to record sample (being the immune chicken serum sample) OD value (P) compares with negative control (not immune chicken serum sample) OD value (N), if the P/N value is more than or equal to 2.0, institute's this antibody of test sample is positive, and chicken SST antibody production detected result is as shown in the table:
4, the impact of CTB-SST viable lactic acid bacteria preparation active immunity on the chicken production performance
Chosen 20 of antibody positive as immune group from 40 AA chickens of above-mentioned quilt immunity, selected else 20 not immune chickens as a control group.Weigh when the AA chicken is raised to 56 age in days after above-mentioned bacterium liquid active immunity, add up simultaneously day weight gain and the material anharmonic ratio of chicken, result is as shown in the table:
The impact of immunological reagent active immunity of the present invention on AA growth of meat chicken performance
Different subscript letter representation significant differences in same column, a, b represent p＜0.05, a, c represents p＜0.01.
Above data show, the chicken CTB-SST viable lactic acid bacteria preparation that the present invention develops can stimulate chicken to produce the antibody of the long chalone of antibiosis (SST), weakens the tumor growth chalone to the restraining effect that chicken grows, and has improved the speed of growth and the feed conversion rate of chicken.
Claims (6)
1. transformant, comprise recipient bacterium and the recombinant vectors that is transformed into recipient bacterium inside, it is characterized in that: described recipient bacterium is Lactococcus lactis NZ9800, and described recombinant vectors is connected initial carrier pNZ8112 and insert the external source goal gene that initial carrier pNZ8112 connects the C end of signal peptide Usp45 and form by containing promotor NisA with signal peptide Usp45; Described external source goal gene is the sub-M6 genomic constitution of chicken somatostatin gene, b subunit of cholera toxin gene and cell walls grappling as shown in SEQ ID NO.5 ~ 7 by base sequence.
2. a chicken oral immunity preparation that utilizes the described transformant preparation of claim 1, is characterized in that: comprise substratum and the transformant of having secreted described external source goal gene product.
3. chicken oral immunity preparation according to claim 2, it is characterized in that: described substratum is the GM17 substratum.
4. chicken oral immunity preparation according to claim 2, it is characterized in that: described transformant concentration is 1 * 10
8Cfu/mL ~ 1 * 10
10Cfu/mL.
5. the preparation method of chicken oral immunity preparation according to claim 2, comprise the following steps: transformant is placed in substratum, is cultured to OD
600Be 0.3 ~ 0.5, add nisin to continue to cultivate 2 ~ 3h.
6. according to claim 5 preparation method, it is characterized in that: it is 10 ~ 20ng/mL that described nisin adds rear concentration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102380863A CN101921725B (en) | 2010-07-27 | 2010-07-27 | Converter for inhibiting hen somatostatin action through oral immunization and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102380863A CN101921725B (en) | 2010-07-27 | 2010-07-27 | Converter for inhibiting hen somatostatin action through oral immunization and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101921725A CN101921725A (en) | 2010-12-22 |
| CN101921725B true CN101921725B (en) | 2013-06-05 |
Family
ID=43336943
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102380863A Active CN101921725B (en) | 2010-07-27 | 2010-07-27 | Converter for inhibiting hen somatostatin action through oral immunization and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101921725B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996011277A1 (en) * | 1994-10-05 | 1996-04-18 | Dompe' S.P.A. | Microorganisms as therapeutic delivery systems |
| CN101168741A (en) * | 2007-09-28 | 2008-04-30 | 中国疾病预防控制中心传染病预防控制所 | Lactococcus lactis food-sate secretion expression carrier and its preparing method and application |
| EP0871748B1 (en) * | 1995-10-20 | 2009-07-01 | Actogenix N.V. | Delivery of biologically active polypeptides |
-
2010
- 2010-07-27 CN CN2010102380863A patent/CN101921725B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996011277A1 (en) * | 1994-10-05 | 1996-04-18 | Dompe' S.P.A. | Microorganisms as therapeutic delivery systems |
| EP0871748B1 (en) * | 1995-10-20 | 2009-07-01 | Actogenix N.V. | Delivery of biologically active polypeptides |
| CN101168741A (en) * | 2007-09-28 | 2008-04-30 | 中国疾病预防控制中心传染病预防控制所 | Lactococcus lactis food-sate secretion expression carrier and its preparing method and application |
Non-Patent Citations (3)
| Title |
|---|
| Anderson Miyoshi et al.Lactic Acid Bacteria as Live Vectors Heterologous Protein Production and Delivery Systems.《Biotechnology of Lactic Acid Bacteria Novel Applications》.2010, * |
| G.S.G.SPENCER et al.The effect of immunization against somatostatin on growth rates and growth hormone secretion in the chicken.《Camp. Biochem. fhysiol》.1986,第85A卷(第3期), * |
| P.M. NORTON et al.Progress in the development of Lactococcus lactis as a recombinant mucosal vaccine delivery system.《Folia Microbiol》.1995,第40卷(第3期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101921725A (en) | 2010-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101139567A (en) | Double genes knockout Listeria monocytogenes attenuation mutant and constructing method | |
| JP2007131610A (en) | Killed lactobacillus preparation having strengthened immune function and method for producing the same | |
| CN114908029B (en) | Construction and application of II-type grass carp reovirus VP6 recombinant lactobacillus | |
| KR101151004B1 (en) | Vaccine composition for protection and treatment against pathogenic Escherichia coli and Salmonella in cattle by administration of attenuated Salmonella expressing adhesin gene of pathogenic Escherichia coli and vaccination method thereof | |
| CN101386868A (en) | Method for improving expression level of recombinant protein in kluyveromyces | |
| CN1952156A (en) | Recombination and expression for non-antibiotic expression vector of rotavirus Vp6 gene and lactic acid bacteria | |
| CN104894045B (en) | A kind of recombinant Lactobacillus and its preparation method and application of coexpression VP 1 Gene of Foot-and-Mouth Disease virus and immunologic adjuvant ox IL-6 genes | |
| CN103275228A (en) | K99-987P-F41 recombinant protein and application thereof | |
| CN101892189B (en) | Transformant for blocking effect of porcine somatostatin by oral immunization and application thereof | |
| CN110669710B (en) | Recombinant lactococcus lactis and tilapia streptococcus agalactiae vaccine | |
| CN102031262A (en) | Construction method and application of faeG expressing gene engineering probiotic | |
| CN102161974A (en) | Preparation method and application of Vibro harveyi outer membrane protein (ompK) antigen as well as strain for expressing the same | |
| CN102178950A (en) | Subunit vaccine immunologic adjuvant and application thereof | |
| CN102277373B (en) | Schistosoma japonica vaccine expression vector for attenuated salmonella secretion expression and use thereof | |
| US20150190486A1 (en) | Vaccination by means of recombinant yeast by producing a protective humoral immune response against defined antigens | |
| CN101638661B (en) | Construction of recombinant lactic acid bacteria with HN gene and F gene of Newcastle disease virus | |
| CN101921725B (en) | Converter for inhibiting hen somatostatin action through oral immunization and application thereof | |
| CN102363762B (en) | Modified bacillus source and Alpha-amylase gene recombination lactobacillus as well as product and application thereof | |
| CN112175890A (en) | Genetically engineered bacterium for secreting alcohol dehydrogenase by using edible fungi | |
| CN116162637A (en) | Fusion gene, protein encoded by fusion gene and application of fusion gene in fish iridovirus and rhabdovirus bivalent oral vaccine | |
| CN101921726B (en) | Oral transformant for immunizing and blocking chicken inhibin and application thereof | |
| CN102741414B (en) | By recombination yeast oral/method of mucosal vaccination vaccine | |
| CN101906395B (en) | Transformant for blocking chicken myostatin effect by oral immunity and application thereof | |
| CN107988130A (en) | Stablize lactic acid bacteria genetic engineering subunit vaccine strain of expression porcine rotavirus VP4 albumen and preparation method thereof | |
| CN101008014B (en) | Lactic acid galactococcus vector of food grade |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |