CN101914549B - Transcription factor gene induced by dehydration condition and abscisic acid in sunflower, promoter and transgenic plant - Google Patents

Transcription factor gene induced by dehydration condition and abscisic acid in sunflower, promoter and transgenic plant Download PDF

Info

Publication number
CN101914549B
CN101914549B CN 201010229130 CN201010229130A CN101914549B CN 101914549 B CN101914549 B CN 101914549B CN 201010229130 CN201010229130 CN 201010229130 CN 201010229130 A CN201010229130 A CN 201010229130A CN 101914549 B CN101914549 B CN 101914549B
Authority
CN
China
Prior art keywords
plant
nucleic acid
acid molecule
seq
water
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CN 201010229130
Other languages
Chinese (zh)
Other versions
CN101914549A (en
Inventor
利亚·拉克尔·尚
丹尼尔·赫克托·冈萨雷斯
卡洛斯·阿尔贝托·德扎尔
加芙列拉·马里沙·加戈
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Baisesg Co
Original Assignee
Baisesg Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Baisesg Co filed Critical Baisesg Co
Priority to CN 201010229130 priority Critical patent/CN101914549B/en
Publication of CN101914549A publication Critical patent/CN101914549A/en
Application granted granted Critical
Publication of CN101914549B publication Critical patent/CN101914549B/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention determines the characteristics of new transcription factor encoding gene which is induced by dehydration or abscisic acid in sunflower and is in the same source domain relevant to leucine zipper. The transcription factor can be cloned when being used for converting DNA constructor of host cell and plant, thus being beneficial. The transgenic plant containing the transcription factor gene has tolerance and resistance in the adverse environments such as water-forced environment and high salt environment. The invention also provides a nucleic acid promoter sequence; wherein the sequence is induced by dehydration and abscisic acid. The invention provides a constructor, host cell and transgenic plant which contain the transcription factor gene.

Description

Transcription factor gene, promotor and the transgenic plant induced by lack of water condition and dormin in the Sunflower Receptacle
Technical field
The present invention relates to the new gene of the encoding transcription factor of being induced by lack of water and dormin in a kind of Sunflower Receptacle (Helianthus annuus), this transcription factor has the homeodomain relevant with leucine zipper.This transcription factor of clone is favourable in the DNA construct of transformed host cell or plant.The transgenic plant that comprise this transcription factor have resistance to the adverse environment condition of coercing as lack of water with high salt.The nucleic acid promoter sequence also is provided and has comprised construct, host cell and the transgenic plant of this sequence, wherein this sequence is that olighydria or dormin are induced.
Background technology
Homeodomain is many 60 amino acid whose primitives (Gehring, Science 236,1245-1252,1987) that occur in the eukaryotic transcription factor of growth course that relate to.From the many eukaryotes that comprise fungi, Mammals and plant, separated the gene (Gehring, W.J., et al., Annu.Rev.Biochem.63,487-526,1994) that obtains containing the homology frame.The homology frame of plant can be divided into many families (et al.Biochim.Biophys.Acta 1442 (1), 1-19,1998 for Chan, R.L.) according to the sequence conservation inside and outside the homeodomain and structure.The member of one of these families has unique feature: because they comprise the homeodomain relevant with a kind of leucine zipper of the spiral-spirane structure that relates to dimerisation, therefore, its coding is called the protein of Hd-Zip.Hd-Zip is only effectively in conjunction with the DNA of dipolymer form (Sessa, G., et al., EMBO J.12,3507-3517,1993; Palena C.M., et al., Biochem J.341,81-87,1999).Proposed these albumen may relate to regulation and control the growth course relevant to replying of envrionment conditions with plant (et al.Biochim.Biophys.Acta 1442 (1), 1-19 for Chan, R.L., 1998, Carabelli, M., et al., Plant J.4,469-479,1993; Schena, M., et al., Genes Devel.7,367-379,1993).Lack of water is one of modal environment-stress of facing of plant.Although many seed tolerance extreme lacks of water, the growth position of plant but seldom are tolerance.Plant is replied water by the series of genes of expression specificity and coerces, make it adapt to the envrionment conditions (Bray that changes like this, E.A.Trends Plant Sci.2,48-54,1997 y Shinozaki, K.and Yamaguchi-Shinozaki, K.Plant Physiol.115,327-334,1997).Hormone dormin (the ABA) (Shinozaki that in these subfamilies of replying are replied, plays an important role, K.and Yamaguchi-Shinozaki, K.Plant Physiol.115,327-334,1997 y Leung, J.and Giraudat, J.Ann.Rev.Plant Physiol.Plant Mol.Biol.49,199-222,1998).
There is the element of replying ABA in the feature description in the startup zone of the gene that water stress tolerance and resistance are related, i.e. ABRE and reply the element of arid, i.e. DRE.
Figure BSA00000195714600021
Deng disclose Ah cloth that (description) dormin and lack of water induce belong to (Arabidopsis) gene (two kinds) ATHB-7 and ATHB-6 (
Figure BSA00000195714600022
E.et al., The Plant Journal 10:375-381,1996 and Soderman E.et al.Plant Molecular Biology 40:1073-1083,1999).The author does not illustrate that the overexpression of these genes provides the lack of water tolerance.
US NO.5,981,729 disclose a kind of new gene of transcription factor of that induced by lack of water and dormin and coding Arabidopis thaliana (A.Thaliana).This patent does not disclose any reference content about the transgenic plant of carrying gene of the present invention and anti-water stress conditions.
Summary of the invention
Therefore, the nucleic acid molecule that the purpose of this invention is to provide a kind of separated coding transcription factor Hahb-4, its functional activity fragment or varient, this isolated nucleic acid molecule has the nucleotide sequence of SEQ IDNo.1 or its fragment, wherein, this nucleic acid molecule comes from Sunflower Receptacle (Helianthus annuus), and it can be mRNA or the cDNA of SEQ ID No.2, and wherein, this molecule can be in conjunction with the arid transcriptional control zone of 5 '-CAAT (A/T) ATTG-3 ' dna sequence dna or plant variety.
Another object of the present invention provides a kind of carrier, this carrier comprises with being selected from and comprises SEQID No.1, the promotor that the nucleotide sequence of the group of SEQ ID No.2 and fragment thereof is operably connected, wherein, this carrier drives transcription factor Hahb-4, the expression of its functional activity fragment or varient, and wherein said transcription factor Hahb-4, its functional activity fragment or varient can be in conjunction with the arid transcriptional control zones of plant variety, wherein, compare with the wild-type kind of this host cell, the expression of carrier in host cell increased cell to the tolerance of the environment-stress of coercing as water.
Further purpose of the present invention for provide a kind of had to be selected from comprise SEQ ID No.1, the nucleic acid molecule of the sequence of the group of SEQ ID No.2 and fragment thereof is transgenic plant transformed stably, wherein, this nucleic acid molecule encoding transcription factor Hahb-4, its functional activity fragment or varient, and wherein compare with the wild-type kind of this plant, this plant has environment-stress, as arid, salt, perviousness and other, the preferred tolerance of the enhancing that water is coerced, wherein, by transcription factor Hahb-4, the arid transcriptional control zone combination of its functional activity fragment or varient and plant, thus can be unifacial leaf, plant dicotyledonous or any other agricultural plants is the water stress tolerance.
A further object of the present invention is for providing a kind of nucleic acid molecule with the sequence that is selected from the group that comprises SEQ ID No.1, SEQID No.2 and fragment thereof stably plant transformed seed, wherein this sequence of nucleic acid molecules encoding transcription factor Hahb-4, its functional activity fragment or varient.
A further object of the present invention is for providing a kind of nucleic acid molecule with the sequence that is selected from the group that comprises SEQ ID No.1, SEQID No.2 and fragment thereof transformed host cells stably, wherein this nucleic acid molecule encoding transcription factor Hahb-4, its functional activity fragment or varient, wherein host cell is selected from the group that comprises bacterium, fungi, insect, plant and animal cell, preferably, it is vegetable cell.
A further object of the present invention is for providing a kind of method of producing water stress tolerance transgenic plant, and this method comprises with the nucleotide sequence that is selected from the group that comprises SEQ ID No.1, SEQ ID No.2 and fragment thereof stably transformed plant cells or clone and this cell or clone are regenerated as the step of plant.
Another object of the present invention is for providing a kind of isolated nucleic acid molecule that is selected from the group that comprises following nucleic acid molecule:
(a) has the nucleic acid molecule of nucleotide sequence SEQ ID No.3;
(b) has the nucleic acid molecule of nucleotide sequence SEQ ID No.10;
(c) has the nucleic acid molecule of nucleotide sequence of 805～1221 Nucleotide of SEQ ID No.3;
(d) has the nucleic acid molecule of nucleotide sequence of 904～1221 Nucleotide of SEQ ID No.3;
(e) has the nucleic acid molecule of nucleotide sequence of 1011～1221 Nucleotide of SEQ ID No.3;
(f) has the nucleic acid molecule of nucleotide sequence of 15～622 Nucleotide of SEQ ID No.3;
(g) has the nucleic acid molecule of nucleotide sequence of 15～409 Nucleotide of SEQ ID No.10;
(h) has nucleic acid molecule with (a) and (b), (c), (d), (e), (f) or nucleic acid molecule complementary nucleotide sequence (g); With
(i) have at least 150 length of nucleotides and have the nucleic acid molecule of at least 80% sequence identity with (a) and (b), (c), (d), (e), (f), (g) or nucleic acid molecule (h), wherein, described nucleic acid molecule can promote the expression of heterologous nucleic acids molecule in transformant or tissue, and described transformant or tissue are selected from the group that comprises bacterium, fungi, insect, plant or zooblast, embryonic tissue, plant callus and plant seed.
A further object of the present invention provides a kind of nucleic acid construct that contains first nucleic acid molecule that is selected from the group that comprises following nucleic acid molecule:
(a) has the nucleic acid molecule of nucleotide sequence SEQ ID No.3;
(b) has the nucleic acid molecule of nucleotide sequence SEQ ID No.10;
(c) has the nucleic acid molecule of nucleotide sequence of 805～1221 Nucleotide of SEQ ID No.3;
(d) has the nucleic acid molecule of nucleotide sequence of 904～1221 Nucleotide of SEQ ID No.3;
(e) has the nucleic acid molecule of nucleotide sequence of 1011～1221 Nucleotide of SEQ ID No.3;
(f) has the nucleic acid molecule of nucleotide sequence of 15～622 Nucleotide of SEQ ID No.3;
(g) has the nucleic acid molecule of nucleotide sequence of 15～409 Nucleotide of SEQ ID No.10;
(h) has nucleic acid molecule with (a) and (b), (c), (d), (e), (f) or nucleic acid molecule complementary nucleotide sequence (g); With
(i) have at least 80% homology or length with (a) and (b), (c), (d), (e), (f), (g) or nucleic acid molecule (h) and be the nucleic acid molecule of at least 150 Nucleotide, wherein, described first nucleic acid molecule is operably connected to second nucleic acid molecule and 3 ' untranslated zone of coding target protein.Preferably, nucleic acid molecule is the promotor with SEQ ID No.3 or SEQ ID No.10.And, provide by one of above-mentioned at least construct stably transformed host cells and transgenic plant.
A further object of the present invention is for providing a kind of method of expressing at least a target protein in host cell, this method comprises in host cell to be introduced one of above-mentioned construct and makes host cell produce target protein, and wherein this host cell is selected from the group that comprises bacterium, fungi, insect, plant and animal cell.
A further object of the present invention is for providing a kind of method that obtains to express the transgenic plant of at least a target protein, this method comprise with one of above-mentioned nucleic acid construct stably transformed plant cells or clone, make this cell or clone be regenerated as the complete plant of expressing at least a albumen then, wherein, these transgenic plant are selected from the group that comprises unifacial leaf and dicotyledons.
A further object of the present invention is for providing a kind of by at least a above-mentioned construct transgenic plant transformed stably, wherein, target protein is the transcription factor Hahb-4 with the nucleotide sequence that is selected from the group that comprises SEQ ID No.1, SEQ IDNo.2 and fragment thereof, and wherein plant is selected from the group that comprises unifacial leaf and dicotyledons, described plant to as arid, high salt, high osmotic pressure and other condition be environmental stress-tolerance, preferably, this plant has resistance and tolerance to lack of water.Most preferably, arid transcriptional control zone combination by transcription factor Hahb-4, its functional activity fragment or varient and plant, thereby this plant is the water stress tolerance, and the arid transcriptional control zone of described plant is 5 '-CAAT (A/T) ATTG-3 ' dna sequence dna.
By reference to the accompanying drawings and the explanation, above-mentioned and other purpose, feature and the advantage that the present invention may be better understood.
Description of drawings
Explain the present invention by the example in the following drawings, wherein:
Fig. 1 has shown the genome sequence of the Sunflower Receptacle Hahb-4 of the present invention that encodes.Following nucleotide sequence is represented the derivation protein sequence of open reading frame.Represent homeodomain with redness; Represent leucine in the leucine zipper with runic and underscore.The consistence in the Hd-Zip zone that the below of figure shows Hahb-4 and Athb-1 ,-6,7 and 12 Hd-Zip zone.Dash box is represented identical amino acid.
Fig. 2 a has represented the length of RNA ribose probe (arrow) and the zone (+81～+ 429 of polarity and Hahb-4mRNA protection; Dash box) synoptic diagram of Hahb-4 cDNA.
Fig. 2 b has shown the expression of the Hahb-4 of the water stress-inducing that stands different treatment.The seedling of following processing 4 ages in days: the ABA of 100 μ M, 24 hours; Water is coerced, 2 hours; 4 ℃, 24 hours; 42 ℃, 2 hours; 0.5M N.F,USP MANNITOL, 4 hours.
Fig. 2 c has shown the expression of coercing the Hahb-4 that 2h induces at Different Organs place water, analyzes embryo and dry seeds.
Fig. 3 has shown the time-dependent manner at the water stress-inducing Hahb-4 at root, stem and leaf place.Seedling is carried out water coerce processing 0.5 or 1h, perhaps the different time rehydration seed after the 1h arid is handled.Identical filter paper is as contrast and the rRNA probe hybridization (lower plate) of RNA application of sample and transfer.
Fig. 4 has shown the time-dependent manner that the ABA of Hahb-4 replys.Shown in each road, from untreated or handle with 100 μ M ABA the seedling of different time and separate total RNA (20 μ g).In lower plate, identical filter paper is as contrast and the rRNA probe hybridization of RNA application of sample and transfer.
Fig. 5 has shown the time-dependent manner at the water stress-inducing Hahb-4 at root, stem and leaf place.The Different Organs of coercing the plant of processing by contrast, 30 minutes (1), 60 minutes (2) or 90 minutes (3) water prepares RNA.Identical filter paper is as contrast and the rRNA probe hybridization (right panel) of RNA application of sample and transfer.
Fig. 6 has shown that ABA and water stress-inducing specificity are in conjunction with the expression of the nucleoprotein of Hahb-4DNA target sequence.Road 0, only DNA; Road 1, control plant; Road 2, the plant that ABA handles; The plant of processing is coerced in road 3, water; A represents to use the observed two kinds of different migration bands of nuclear extract with B.
Fig. 7 illustrates that the clone is in the figure of the employed strategy of cDNA of the coding Hahb-4 under the CaMV35S promoter regulation.Plasmid p35SHB4 is implemented in the intestinal bacteria (E.coli), and it is used for transforming the CV2260 system of agrobacterium tumefaciens (A.tumefaciens) then.The agrobacterium tumefaciens called after ATH4 that will have the plasmid that comprises the Hahb-4 cDNA that is under the CaMV35S promoter regulation.BD and BI: the right side and left hand edge; Pnos: rouge alkali synthetase gene promotor; Tnos: the terminator sequence of rouge alkali synthetase; Km r: kalamycin resistance gene; The P35S:35ScaMV promotor, gus: β-glucuronidase gene.
Fig. 8 for explanation with 4 ℃ handle 48 hours after the figure of germinating time of the conversion plants (black stripe) of the present invention of per-cent (n=22) of germination plants and unconverted control plant (white ribbon).
Fig. 9 for explanation from the figure with the stem length of millimeter measurement from the control plant (white ribbon) of germinate conversion plant (black stripe) of the present invention and non-conversion 28 days～33 days the time.Two terminal bands have shown and carry out water to coerce the stem of transgenic plant of test long wherein do not have the survival seedling in the group of control plant.
Figure 10 for explanation plant, i.e. non-conversion plant (white ribbon) and transgenic plant (black stripe), growth course in the histogram of amount of the silique that forms.Two terminal bands have illustrated and have stood the amount of silique that water is coerced the transgenic plant of test, wherein do not had the survival seedling in the group of control plant.Irrigating plant when end cycle, and in case when restoring, the record parameters of interest.
Figure 11 is the control plant (white ribbon) of the non-conversion of the different time germination of explanation in the presence of 50mM N.F,USP MANNITOL, behind breaking dormancy and the percentile histogram of transgenic plant (black stripe).
Figure 12 is the non-conversion control plant (white ribbon) of the different time germination of explanation in the presence of 200mM N.F,USP MANNITOL, behind breaking dormancy and the percentile histogram of transgenic plant (black stripe).
Figure 13 is the non-conversion control plant (white ribbon) of the different time germination of explanation in the presence of 300mM N.F,USP MANNITOL, behind breaking dormancy and the percentile histogram of transgenic plant (black stripe).
Figure 14 is the non-conversion control plant (white ribbon) of the different time germination of explanation in the presence of 50mM NaCl, behind breaking dormancy and the percentile histogram of transgenic plant (black stripe).
Figure 15 is the non-conversion control plant (white ribbon) of the different time germination of explanation in the presence of 150mM NaCl, behind breaking dormancy and the percentile histogram of transgenic plant (black stripe).
Figure 16 contrasts the percentile histogram of survival plant (white ribbon) and transgenic plant (black plant) for the non-conversion of explanation in three independent experiments.In first test (1), when plant is ripe (breeding stage) coerce.In second test (2), plant is in favourable growth phase (rosette bang completely).In the 3rd test (3), when germinateing, coerce.
Figure 17 has shown the phenotype of contrast and transgenic plant.(a) phenotype of transgenic plant (first and second rows) and non-conversion plant (third and fourth row) is observable.When maturation these plants being carried out water coerces and handles and water again when life cycle finishes.In b, the phenotype of (right side) plant of transgenosis (left side) and non-conversion is observable.This group plant carries out water and coerces processing when being in vegetative period.In c, the phenotype of carrying out the control plant (right side) of transgenic plant (left side) that water treatment coerces, watered again then and non-conversion when germinateing certainly is observable.(d) in d, shown at growth phase to suffer the extremely phenotype of the transgenic plant of arid.
Figure 18 has shown the nucleotide sequence of the promoter region of Hahb-4 gene, has wherein marked the corresponding sequence of TATA box, has replied water and coerce/sequence of the recognition site of the element of low temperature, ABRE zone and expression Myb and Myc.
Figure 19 is the synoptic diagram of used pBI 101.3 carriers of a plurality of fragments of clone Hahb-4 promotor.Represented β-glucuronidase gene, and the gene to the kalamycin resistance in intestinal bacteria and the agrobacterium tumefaciens is provided.Also marked the replication orgin of intestinal bacteria and agrobacterium tumefaciens.
Figure 20 shows the photo of the expression level that the histological chemistry of contrast in 10 age in days seedling of the construct of the promotor of carrying 0～-400 sequence (805～1221 Nucleotide of SEQ ID No.3) (left side) and 0～-1015 sequences (little allelotrope) (right side) respectively, by the gus gene measures.
Figure 21 is presented at the expression of the gus in the root of Arabidopis thaliana.(a) be presented at the gus expression of gene in the root of 20 ages in days of 0～-400 construct plant transformed.(b) be presented at the gus expression of gene in the root of 20 ages in days of 0～-1015 construct plant transformed.(c) be presented at the gus expression of gene in the 10 age in days roots of 0～-1015 construct plant transformed.
Figure 22 shows the effect that the ABA in the 20 age in days seedling that transform with 0～-400 construct handles.Show control plant in the left side, show the seedling of handling with ABA on the right side.
Figure 23 shows the synoptic diagram of Hahb-4 gene structure.Top: big allelotrope, bottom: little allelotrope.Show the separation and construction of recombinant plasmid and the used oligonucleotide of Plant Transformation that start the zone.
Embodiment
Now, explain the present invention, the feature of new gene Hd-Zip refers to identical content, i.e. the Sunflower Receptacle Hahb-4 gene that the water stress conditions is replied.In homeodomain, Hahb-4 shows and two kinds of associated protein Athb-7 of Arabidopis thaliana and the portion homologous of Athb-12.Albumen Hahb-4 has the homeodomain that is positioned at next-door neighbour's N-terminal.
The invention discloses a clone in the cDNA library.This clone's representative is named as the member of the Htd-Zip family of Hahb-4.Obtain 5 ' and 3 ' by PCR and hold corresponding sequence.Obtain the long 674bp of full cDNA sequence (SEQ ID No.2) by this method, and contain 177 amino acid whose open reading frame (Fig. 1).
Protein and other Hd-Zip protein sequence that contrast is encoded show that it may belong to the subfamily I of Hd-Zip protein, this albumen that is encoded has about 50% identical amino acid with other member of this subfamily except Athb-7 and Athb-12 in homeodomain, have 60% and 53% consistence (Fig. 1) respectively with Athb-7 and Athb-12 in this zone.It should be noted that also the Hahb-4 homeodomain almost is positioned at the N-terminal of this albumen (17～76 amino acid).Therefore, Hahb-4 lacks the terminal adjacent acidic region of N-that exist and homeodomain among other member of Hd-Zip protein family.This feature is also identical with Athb-7 and Athb-12.In order to study the gene structure of Hahb-4 gene, with a plurality of oligonucleotide that the comprise full cDNA genomic dna (genomic dna is SEQ ID No.1) that increased.Between 381 and 382 Nucleotide (amino acid/11 08 and 109) of cDNA, found single intron of 101bp.
The Northern spot analysis shows in the Sunflower Receptacle that Hahb-4 gene of the present invention grows under being in the home condition of control with extremely low horizontal expression.Only obtain faint signal from total RNA of multiple tissue and etap extraction.
By the expression of RNA enzyme protection (RNAse protection) analysis Hahb-4 of (being water, perviousness, salt, cold hot and cold and oxidative stress) under the varying environment condition, the RNA enzyme protection is than Northern technology sensitiveer (Fig. 2).Fig. 2 b explanation does not detect Hahb-4 in the growth 4 age in days seedling under being in normal condition.Yet, in the seed that water is coerced, detect strong signal.N.F,USP MANNITOL also induces Hahb-4 to express, although expression level is lower, may react the reduction (Fig. 2 b) of the water activity that is caused by this compound.Obtain identical result with NaCl.
Because it is many to replying that water is coerced that ABA regulates, therefore also analyzed the influence of this hormone to expressing.Shown in Fig. 2 b, after 24 hours, observation is induced the seedling of handling pouring with 100 μ M ABA.Use 10 μ M ABA also to observe a spot of of transcriptional level but significant the raising.When seedling is in cold (4 ℃) or heat (42 ℃) stress conditions, do not observe detectable effect (Fig. 2 b).The effect that these presentation of results water are coerced is specific.
Fig. 2 c explanation is in that root, stem and the leaf place of the plant of old (21 age in days) have also observed replying the water stress conditions.Plant be in airborne position induce level in seedling, observe induce level similar.On the contrary, root shows quite low transcriptional level under the water stress conditions.
Because ABA also participates in relating to the seed development in the embryo generating process in later stage of arid process, so, the transcriptional level of the Hahb-4 in Sunflower Receptacle embryo (pollinating back 20 days) and the dry seeds analyzed.Do not have picked up signal (Fig. 2 c) in RNA enzyme protection test, the water of this explanation Hahb-4 is coerced the feature for the vegetative period of growing of replying with ABA.
The observed high-caliber time-dependent manner that allows to by Northern experimental analysis transcriptional level of inducing increases under the water stress conditions.Fig. 3 explanation is in the seedling of arid and only just obviously improved the transcriptional level of its Hahb-4 after 30 minutes; Reach maximum value withholding water to reply after 1 hour.After this time, do not observe the further increase of Hahb-4 transcriptional level.The rehydration of seedling has reduced the transcriptional level of Hahb-4 more lentamente, only reduces about 50% (Fig. 3, road 4 and 5) after 2 hours.The effect that ABA handles also is time-dependent manner.As shown in Figure 4, in 1 hour, detect the replying of ABA, and behind 3～6h, reach maximum value.Afterwards, transcriptional level slowly reduces, but after handling 24h, still very high.After sunflower plants rehydration, high Hahb-4 transcriptional level of the present invention restores, and therefore, illustrates that again described gene participates in replying that water is coerced.
At the Different Organs place of the plant in 3 weeks of hydroponics growing, replying that the water of Hahb-4 is coerced also is fast.At root, transcriptional level reaches maximum value (Fig. 5) after handling 60 minutes coercing.
At leaf and stem place, after the processing of longer time, observe maximum and reply.This may be relevant with the fact of being finished the initial perception that water coerces by root, and root synthesizes ABA, and ABA transfers to the airborne position of being in of plant then.This result in conjunction with most probable as a result shown in above-mentioned Fig. 2～4 explanation Hahb-4 express be in the plant that water coerces in the endogenous ABA level relevant.
Use comprise external sequence 5 in conjunction with the Hahb-4 that expresses in the bacterium '-double stranded synthetic oligonucleotide of CAAT (A/T) ATTG-3 ', analyze the appearance of the function DNA of the conjugated protein in the nuclear of Sunflower Receptacle by electrophoretic mobility change test (electrophoretic mobility shift assays).Nuclear extract with the preparation of the seedling of 4 ages in days shows different migration bands, and there are at least two kinds of different protein complexes in conjunction with this sequence (Fig. 6) in this explanation.The amount of two species complexs increases in the extract that the plant of handling with ABA obtains significantly.On the contrary, when plant was coerced by water, only the slower complex body of migration increased.Excessive identical unmarked DNA almost completely stops the formation of two species complexs, but the 5 '-CA that contains debond Hahb-4 of equivalent CT (A/T) A GThe similar dna sequence dna of TG-3 ' sequence but can not (Fig. 6).This result effectively illustrates when ABA exists or under the water stress conditions, at least a functional protein with DNA binding specificity identical with Hahb-4 is synthesized and is transported to nuclear.
Only in the plant that suffers water to coerce or handle with ABA, detect the expression of strong Hahb-4.Heat, cold and oxidative stress are not induced this expression.Salt and osmotic treated only produce a small amount of increase of Hahb-4 transcriptional level.When the rehydration plant, water is coerced effect and is reversed fully.It not is to destroy or the common result who coerces that these feature description Hahb-4 of the present invention expresses that the moisture situation of directly replying vegetal cell and this induce.
As embodiment 3 and shown in Figure 7, for the transgenic plant of the Arabidopis thaliana that obtains overexpression Sunflower Receptacle Hahb-4 of the present invention, use carrier pBI121 and " flower is dipped " method.As a result, obtain the independent system of many transgenic plant, wherein use the PCR positive reaction of specific oligonucleotide, growing plants is patience or resistance in containing the substratum of kantlex.From the independent system that obtains, choose the plant of transgenosis (Hahb-4 gene of the present invention) stably express.As a result, selecting to isozygoty is that F3 analyzes phenotype.
As shown in Figure 8, compare with unconverted control plant, the Arabidopis thaliana transfer-gen plant that carries gene of the present invention germinates very fast.After 14 hours, transformed plant according to the present invention is 85%: 58% with the ratio of the percentage of germination of unconverted plant.
In addition, the stem of conversion of the present invention plant growth is slower, and its maximum height for the control plant of growth under the same conditions (provide normal water acquisition amount-Fig. 9) height 85%.And, suffer the water transgenic plant of coercing and the transgenic plant with normal water acquisition amount to reach identical stem height, this explanation water is coerced the stem growth (Fig. 9) that does not influence transgenic plant of the present invention.Transgenic plant of the present invention not only tolerate water and coerce, and also can normal growth under the condition of lack of water, and are not having important change aspect the phenotype of observing.
The quantity of the silique that forms does not change between wild-type and transgenic plant significantly, and although bennet shortens, this number is slightly high (Figure 10) in transgenic plant.When the transgenic plant that grow under the water stress conditions are compared with the identical plant that grows, form the number higher (Figure 10) of silique the transgenic plant of being coerced under standard conditions.In addition, as shown in table 1, the gross weight of the seed that plant produces that transformed according to the present invention is than the gross weight high about 15% of the seed of unconverted control plant.
Table 1
Transgenic plant Control plant
Average seed is heavy 0.0964 0.0803
SD 0.0350 0.0224
The number of plant 12 12
Because as if the Hahb-4 product works to transcribe the factor and its expression at transcriptional level regulated and control by the acquisition amount of water or existence/shortage, therefore, the research of the conversion plant of having measured overexpression Sunflower Receptacle Hahb-4 of the present invention gene tolerance that water is coerced.
At first, analyzing germination process under the condition of the simulation lack of water that exists as N.F,USP MANNITOL and under the condition of other generation salt stress.Figure 11,12 and 13 has shown the germinating time that plant transformed is compared with control plant according to the present invention.The existence of N.F,USP MANNITOL has postponed germination.This effect is more obvious when the concentration of higher carbohydrate.Yet, even plant transformed also keeps good percentage of germination under the N.F,USP MANNITOL condition of high density.
When germinateing experiment when the NaCl at different concns exists, the result of acquisition is similar to the situation of N.F,USP MANNITOL.Shown in Figure 14 and 15, overexpression Hahb-4 makes plant transformed have higher germinating power in salt culture medium.
It should be noted that the root of the transgenic plant that grow of tested or test greater than the root of control plant under different stress conditions, this represents a kind of phenotype that many stress conditions is all had tolerance.
The development of plants stage of cultivating in a plurality of soil subsequently, is carried out the arid test.Figure 16 has shown three tests of water being coerced survival.Clearly, when comparing with unconverted control plant, observed in conversion plant of the present invention water coerced and had than height endurability.
When plant is subjected to water when coercing in different developmental phases, the tolerance to stress conditions that the plant transformed performance is stronger.Figure 17 has shown the vegetative state after the lack of water condition of having suffered at different growth phases.No matter plant is coerced by water in any stage, and the transgenic plant of carrying Hahb-4 gene of the present invention have stronger tolerance and resistance to above-mentioned condition.
In brief, the invention discloses the acquisition that Arabidopis thaliana transforms plant, this conversion plant overexpression is in the Sunflower Receptacle Hahb-4 gene of the present invention under the regulation and control of 35S cauliflower mosaic virus promoter, i.e. overexpression construct as shown in Figure 7.The initial genes encoding of the present invention that separates from Sunflower Receptacle has the Hd-Zip protein in the albumen territory of the homeodomain type relevant with leucine zipper.Those of ordinary skill in the art can use promotor or the nucleic acid construct of any driving genetic expression of the present invention as can be known, and does not change the spirit and scope of the invention.Can also prepare the nucleic acid construct that gene of the present invention can be expressed in any host cell as bacterium, yeast, fungi, animal and plant sexual cell.In a preferred embodiment of the invention, gene is expressed in vegetable cell and tissue.
The conversion plant of expressing Hahb-4 generally has short stem under the normal growth condition.Shown in Histological research, seeming this feature mainly is owing to suppress cell expansion but do not suppress cell fission.
Except above-mentioned argumentation, with the adult blade ratio of non-conversion plant, the adult blade of transgenic plant is round and shorter.Merge two features and illustrate that as if gene product plays the supressor of cell expansion and elongation.These phenotypic characteristics (short stem and roundleaf) should be directly related with the ability of the tolerances of transgenic plant and opposing lack of water or scarcity as " water saving " mechanism.On the contrary, it is longer to compare the roots of transgenic plant of the present invention with unconverted plant roots.This should illustrate that another kind obtains the appearance of the favourable mechanism of water.
Transgenic plant of the present invention are at different growth phases, the germination stage and in early days with growth phase and all show significant water stress tolerance in the breeding stage in latter stage.When transgenic plant and non-plant transformed all suffered drought condition, the survival rate of transgenic plant was higher than viewed survival rate in the control plant of non-conversion.
By all these results, can draw Hahb-4 gene involved in plant to replying of coercing of water, with and specific function can produce and strengthen plant to the phenotypic alternation of the tolerance of lack of water.
Apparently, these phenotypes change not to the output of plant and the generation adverse influence of germinateing.On the contrary, the seed production of transgenic plant (with weight determination) is higher than the output of unconverted plant.
The transgenic plant that can use Hahb-4 of the present invention production to have commercial benefits, wherein said transgenic plant have the special tolerance that water is coerced.Can expect that the described productive rate that suffers the plant with agronomical value that water coerces is with unconverted and do not suffer the productive rate of kind of this stress conditions identical.As an example, this plant with agronomical value can comprise Sunflower Receptacle, wheat, barley, soybean, potato, corn, sugarcane or paddy rice, but is not limited to this.
What worth emphasis was noted is not have the gene of a large amount of overexpressions when plant is coerced by water, and does not have concrete can make plant have tolerance to arid as Hahb-4 of the present invention about described gene.
According to the present invention, the present inventor has separated the sequence in the startup zone of Sunflower Receptacle Hahb-4, and determines its feature.The information that use obtained in a certain stage is used for used a woman who has recently been widowed's nucleotide pair of design next stage, carries out the separation that Hahb-4 starts the zone by inverse PCR (inverse PCR) technology with three phases.The fragment cloning that will obtain by PCR reaction to pGEM.-T easy carrier (pGEM.-T easy vector) (Promega) on, and manually measure the regional sequence of startup by the repeat region of overlapping each construct.
The sequence of Hahb-4 promotor (SEQ ID No.3) comprises the TATA box at the 24bp place, upstream that is positioned at transcription initiation site corresponding to the 1221bp sequence.The contrast of the sequence that exists in this sequence and the database shows existence and is considered to participation to a plurality of environmental factors, has the zone of homology as the sequence of replying of light, dormin and hormone.As an example, Figure 18 has shown the ABA response element of supposition of ABRE type and drought stress or the low temperature response element of DRE type.
Also identified and united the concensus sequence that participates in the transcription factor that transcription factor replys, as protein (Abe et al., Plant cell 9:1859-1868,1997 of Myb and Myc family; Shinozaki and Yamaguchi-Shinozaki, Plant Physol.115:327-334,1997, be included as a reference) herein.
After separation and the order-checking Hahb-4 promotor, searching relates to the sequence that drives genetic expression.Especially, provide organ specificity and water coerced the sequence of replying with the existence of ABA.For this reason, under the regulation and control of the complete sequence of described promotor or the described sequence of part, transform the Arabidopis thaliana plant with the construct that comprises reporter gene (gus gene).
The complete sequence of promotor is cloned on the construct.For this reason, design two kinds of specific oligonucleotides of hybridizing with the end that starts the zone, and in the PCR reaction of Sunflower Receptacle genomic dna as template, use this two specific specificity oligonucleotide.As the product of amplified reaction, obtain the band of two treaties 1000 and 1200bp.Consider that these test employed growth material and separate from crossbred (contiflor 15), therefore, two bands occur and as if illustrate and have two kinds of different allelotrope in the genome.
Two kinds of PCR product cloning are arrived in the pGEM-Teasy carrier (Promega).Shown in embodiment 4, cut the PCR product and be cloned into (Figure 19) among the carrier pBI101.3 with restriction enzyme BamHI and HindIII.Acquisition respectively comprises two constructs of one of allelotrope of promotor, and wherein said promotor allelotrope drives the gus expression of gene.
Then, the different promoter fragment that will comprise transcription initiation site is cloned among the carrier pBI101.3.In order to clone apart from transcription initiation site promoter fragment far away, use the pBI carrier of modifying, the promotor that this carrier carries the minimum that comprises the TATA box is (90CaMV35S).The clone who obtains is as described below:
Clone 416: the fragment that contains 0～-400 zone (from transcription initiation site upwards to IPCR4) (SEQ ID No.4) of being cloned into the promotor on the HindIII/BamHI of pBI101.3.Clone 416 comprises the 805th～1221 the Nucleotide of SEQ ID No.3.
Clone 1015: the fragment that contains 0～-1015 promoter region (little allelotrope) that obtains with Nucleotide IPCR10 and IPCR8 (being respectively SEQ ID No.5 and SEQ ID No.6) of being cloned into the SalI/BamHI place of pBI101.3.
Clone 1221: the fragment that contains 0～-1221 promoter region (big allelotrope) that obtains with oligonucleotide IPCR10 and IPCR8 (being respectively SEQ ID No.5 and SEQ ID No.6) of being cloned into the SalI/BamHI place of pBI101.3.
Clone 318: the fragment in 0～-300 zone by oligonucleotide IPCR6/IPCR8 (SEQ ID No.7/SEQ ID No.6) amplification of containing promotor (making progress to IPCR6 (SEQ ID No.7) from transcription initiation site) of being cloned into the HindIII/BamHI place of pBI101.3.Clone 318 comprise SEQ ID No.3 from 904～1221 Nucleotide.
Clone 211: the fragment in 0～-211 zone by oligonucleotide IPCR7/IPCR8 (SEQ ID No.8/SEQ ID No.6) amplification of containing promotor (making progress to IPCR7 (SEQ ID No.8) from transcription initiation site) of being cloned into the HindIII/BamHI place of pBI101.3.Clone 211 comprise SEQ ID No.3 from 1011～1221 Nucleotide.
Clone 608: the fragment (coming arrogant allelotrope) the SalI place, the corresponding 608bp of 5 ' promoter region (with IPCR5/IPCR10 (SEQ ID No.9/SEQ ID No.5) amplification) of being cloned into the pBI-90 with minimal promoter.Clone 608 comprise SEQ ID No.3 from 15～622 Nucleotide.
Clone 407: the fragment (coming allelotrope from childhood) the SalI place, the corresponding 407bp of 5 ' promoter region (with IPCR5/IPCR10 (SEQ ID No.9/SEQ ID No.5) amplification) of being cloned into the pBI-90 with minimal promoter.Clone 407 comprise SEQ ID No.10 from 15～409 Nucleotide.
Then, with above-mentioned construct arabidopsis thaliana transformation plant, select plants transformed, and select a plurality of independent systems for separating the homozygote subsystem at the third generation.By histological chemistry and fluorometry, use the homozygote plant of selecting to determine the allelotrope of Hahb-4 promotor and the characteristic of different zones.
0 of promotor～-400 zones are enough to drive the gus gene and express in the cotyledon of 2 days germination seedling.In the young tender seedling that germinateed 10 days, do not detect this expression.
When use comprises the construct of little allelic complete fragment, also observe the gus gene and in the cotyledon of 2 days germination seedling, express.Yet, being different from 0～-400 zone, the gus gene is expressed very strong (Figure 20) at leaf and the root of tender seedling.At last, in the breeding stage, do not detect any gus expression of gene.
Although these presentation of results are expressed at identical organ, the intensity difference that should express.Though the specific expressed institute that drives in cotyledon and blade must sequence be 0～-400 zone, may exist for the important sequence of transcriptional activation in-400～-1015 zones.
When analyzing the expression of gus gene at the root of transgenic plant, found being expressed in lateral-root primordia and continuing stronger at the region intermediate of the lateral root of having grown of the 20 age in days plant roots that driven by 0～-400 construct.In addition, find at the root with 0～-400 construct transgenic plant transformed, in the vascular cylinder cell, also detected gus expression of gene (Figure 21).Germinateed back 10 days, and observed the strongly expressed at, lateral root position main at all and in the stronger expression (Figure 21 c) in foundation zone.
The presentation of results that obtains by the fluorometric investigation method comprises that the startup of startup specific activity construct 0～-400 of construct tool of full fragment is active high 10 times.And as shown in figure 22, ABA can induce construct 0～-400.
Show that for the analysis with a plurality of independent systems of comprising 0～-300 zone or the construct plant transformed in 0～-200 zone gus the etap different of gene in the organ of all researchs all express, and ABA does not induce described startups regional.
The present inventor also discloses and an intron that interrupts the zone of leucine zipper encoding sequence only occurred.This intron length is 101bp, and is positioned at specifically between the sequence of the 6th and the 7th septuploid (108 and 109 amino acid) of coding leucine zipper domain, and the corresponding 5 '-GT.......AG-3 ' rule that occurs in other biological intron.The position of this intron and the synoptic diagram of sequence are as shown in Figure 1.
Therefore, the present invention includes the cDNA (SEQ ID No.2) of Hahb-4 promotor (SEQ ID No.1) and described gene, the protein of the Hd-Zip family of wherein said genes encoding Sunflower Receptacle.This promotor has two allelotrope of having been cloned and having checked order, and allelotrope has difference or not conservative zone around-900 Nucleotide.Big allelotrope comprises the sequence of 1221bp, and little allelotrope comprises the sequence (being respectively SEQ ID No.3 and SEQ IDNo.10) of 1015bp.
The analysis revealed of promotor nucleotide sequence has and participates in various environmental factors, as the zone of the different sequence homologies of light, dormin and hormone response.Promotor of the present invention comprises the element of the stress response that lack of water or low temperature are produced of the ABA response element of supposition of common called after ABRE and called after DRE.Also identified and to have connected the concensus sequence that relates to the transcription factor that environmental factor replys.
When the different zones of analyzing promotor of the present invention active, although the presentation of results that obtains has two supposition element ABRE between 300 Nucleotide of transcription initiation site and upstream, but, this fragment can not drive the activity of reporter gene gus, although this fragment of this explanation is necessary, it is not enough to cause and transcribes.On the contrary, by using first 400 Nucleotide adjacent with position+1, observed germination after 2 days cotyledon and the gus expression of gene of root.It is not very strong expressing, but specific, and can be induced by ABA.
On the other hand, start the full fragment generation in zone at least than the high 10 times expression level of expression level that is produced by 0～-400 fragment.Otherwise this is expressed in the late phase (germination reaches 20 days plant) of growth and is tangible in the central zone of root.
Can use promotor of the present invention (two allelotrope), its fragment or part to drive the expression of any goal gene.Preferably, can in the nucleic acid construct useful for transformed host cell, use promotor of the present invention (two allelotrope or its fragment), the expression of any target protein of wherein said promoters driven.Host cell can be bacterium, yeast, zooblast or vegetable cell.
Also can carrier construction, wherein promoters driven of the present invention Hahb-4 gene of the present invention is expressed in vegetable cell.The transgenic plant that described construct is coerced for acquisition tolerance water are useful.The transgenic plant of carrying Hahb-4 gene of the present invention and promotor of the present invention can be the cash crop that comprise Sunflower Receptacle, wheat, barley, soybean, potato, corn, sugarcane or paddy rice.
The present invention may be better understood according to following examples, but these embodiment do not limit protection domain of the present invention.On the contrary, must be expressly understood that those of ordinary skill in the art can propose many other changes of embodiment, modification and content equivalence of the present invention after reading specification sheets of the present invention, and not depart from the scope of essence of the present invention and/or additional claim.
Embodiment
Embodiment 1: separate and the gene of the protein that belongs to Hd-Zip I family of being defined as encoding New gene Hahb-4 in the Sunflower Receptacle
A. separate the Hahb-4 gene cDNA
In order to separate the partial cDNA Cloning that contains homology frame sequence, (Gonz á lez and Chan as mentioned above, Trends in Genetics 9:231-232,1993, be cited as a reference herein), total DNA in the Sunflower Receptacle stem cDNA library that use makes up in λ gt10 carries out the strategy based on polymerase chain reaction (PCR).By using λ gt10 sequencing primer and obtaining represent the 3 ' sequence (SEQ ID No.2 and Fig. 1) of holding of Hahb-4 transcript with the PCR of the Auele Specific Primer H41 of 81～100 Nucleotide coupling of cDNA sequence (5 '-GGCGGATCCAACAGAAACAACCACCAGG-3 ' (SEQ ID No.11)).According to Frohman (Frohman Cloning PCR products.In The Polymerase Chain Reaction, eds.K.B.Mullis, F.Fr é ， ﹠amp; R.A.Gibas, pages 14-37.Birkhauser, Boston, MA, USA, 1994, be cited as a reference) herein, use specific oligonucleotide IPCR0 5 '-GGCGGATCCCCTGGTGGTTGTTTCTGTT-3 ' (SEQ IDNo.12) and primer Qt and Qo (being respectively SEQ ID No.13 and 14), RNA and polyA by the Sunflower Receptacle stem that coerced by water are carried out the terminal rapid amplifying (RACE) of cDNA, thereby obtain 5 ' end of transcript.
The separation of B.Hahb-4 genome sequence
According to Ochman, Ayala and Hartl (In Methods of Enzymology (ed R.Wu) Vol 218, pages 309-321.Academic Press, San Diego, CA.USA, 1993), use inverse PCR to determine the feature in 5 ' the non-transcribed zone of Hagb-4.Digest the genomic dna of Sunflower Receptacle in the condition lower section of control with Sau3A or HindII.According to the explanation of manufacturer, behind digestion and purifying, in 5U T4DNA ligase enzyme (PromegaCorp., Madison, WI, USA) dna circleization of spending the night under the existence.Increase employed primer to being 5 '-GGCGGATCCCCTGGTGGTTGTTTCTGTT-3 ' (SEQ ID No.12) and 5 '-GCCGAATTCAGATTGAGCAAGAGTATAAC-3 ' (SEQ ID No.15), or 5 '-ACCTTTATAAAGACCACTC-3 ' (SEQ ID No.16) and 5 ' ACGCAATGGTGAGTTGTAC-3 ' (SEQ ID No.17).
The C.DNA sequential analysis
The PCR product cloning is arrived pUC119 or pGEM-Teasy (Promega Corp.).Use fmol order-checking system (Promega Corp.) to obtain to insert the sequence of body by chain termination method.
Embodiment 2: illustrate that lack of water induces the test of Hahb-4
A. vegetable material, growth conditions and water are coerced processing
(Sunflower Receptacle kind contiflor 15 is from the Zeneca of Argentine Balcarce to Sunflower Receptacle (Helianthus annuus L.); Perhaps kind Sunweed, from the Lyons, France -Poulenc) seed carries out surface sterilization, and the filter paper in culture dish was grown 4 days.Then seedling is transferred on the plastic carrier that contains the Hoagland substratum, and grown to always and have 6 blades (about 3 weeks).Apply water and coerce by the seedling of 4 ages in days being transferred to culture dish with dried filter paper or plant being taken out from water culture.Treatment time as shown in the figure.
The B.RNA enzyme protection is analyzed
Analyze for the RNA enzyme protection, according to the explanation (Boehringer Mannheim, Mannheim, Germany) of manufacturer, use the T3 RNA polymerase and [ 32P] CTP is total RNA (15 μ g) (Almoguera C., the et.al. of above-mentioned preparation; Plant molecular Biology 19:781-792,1992) hybridize with the specificity Hahb-4 rna probe that synthesizes by in-vitro transcription.
To comprise+81 and+template (Fig. 1 and SEQ ID No.1) of the corresponding insertion body in coding region between 429 is cloned into the SpeI/BamHI site of pBlue-script SK-.Non-existent BamHI site is derived from the amplification of above-mentioned use oligonucleotide H41 among the cDNA.With this template DNA of EcoRI restrictive diges-tion, make the Nucleotide that contains 63 carriers (from the T3 promotor at the most the site joint the SpeI site and from BamHI to EcoRI site) 411-Nucleotide rna probe transcribe.Condition (the Coca M:A:et.al. of the electrophoretic analysis subsequently of rna probe preparation, hybridization, use RNA enzyme A digestion and protected RNA fragment has more than been described; Plant Molecular Biology 31:863-876,1996, be cited as a reference) herein.
C.Northern analyzes
Substantially as described in Sambrook, Fritsch and the Maniatis (1989), use methane amide and the total RNA of denaturing formaldehyde (20 μ g), agarose/(6%) formaldehyde gel at 1.5% (w/v) is separated, and with sex change RNA application of sample (the Hybond N to nylon membrane that separates; Amersham-Pharmacia, Buckinghamshire, Britain).
Under 65 ℃, 6 * SSC (1 * SSC is 0.15M NaCl, 0.015M Trisodium Citrate, and pH 7.0), 0.1% (w/v) polyvinylpyrrolidone, 0.1% (w/v) bovine serum albumin, 0.1% (w/v) phenanthrene can (water-soluble poly-sucrose) (Ficoll), the hybridization of spending the night in 0.5% (w/v) sodium laurylsulfonate (SDS).With [ 32P] dATP (1 * 10 8Dpm μ g -1), by random labelling (.1989 such as Sambrook) 3 ' non-coding region of mark Hahb-4 cDNA and the corresponding SpeI/EcoRI fragment that does not comprise the Hd-Zip zone of last 177 Nucleotide of coding region, and as probe.Use the film of Bio-Max and intensifying screen (transcreen) (Eastman Kodak, Rochester, the U.S., New York) to the filter paper radioautograph of spending the night.For the amount of total RNA of determining to add in each road, then, except under 62 ℃, hybridizing, to above-mentioned similar condition under survey filter paper again with the 25Sr RNA of broad bean (Vicia faba).
D. He preparation:
Technology (Methods in Plant Molecular Biology.ALaboratory Course Manual according to descriptions such as Maliga, pages 233-260.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA, 1995, quote by reference), prepare nuclear and the nuclear extract of Sunflower Receptacle with the seedling (4 age in days) that contrasts, water is coerced or ABA handles. hereinBy SDS-polyacrylamide gel electrophoresis (PAGE) analysing protein figure, and measure the total concn of protein as (Analytical Biochemistry 79:544-552,1977) as described in the Sedmak J. etc.
E.DNA is in conjunction with test
For electrophoretic mobility shift assay (EMSA), double-stranded DNA (0.3～0.6ng that the hybridization of the aliquots containig (30 μ g) of the nucleoprotein of purifying and oligonucleotide 5 '-AATTCAGA TCTCAATAATTGAGAG-3 ' by complementation and 5 '-GATCCTCTCAATTATTG GATCTG-3 ' (SEQ ID No.18 and SEQID No.19) (binding site of Hahb-4 is labeled underscore) is obtained, 30000c.p.m., by the Klenow fragment of using archaeal dna polymerase add at 3 ' end [ 32P] dATP and be labeled) hatch.Contain 20mM HEPES-NaOH (pH7.6), 40mM NaCl, 0.2mM ethylenediamine tetraacetic acid (EDTA) (EDTA), 1.0mM dithiothreitol (DTT) (DTT), 0.5%Triton X-100, the association reaction thing (20 μ L) of 20% glycerine and 1.5 μ g poly-(dI-dC) was hatched under 25 ℃ 20 minutes, replenish 2.5% (w/v) water-soluble poly-sucrose (Ficoll), and be added to running gel immediately and (be dissolved in 5% acrylamide, 0.08% diacrylamine in 0.5 * TBE and 2.5% glycerine; 1 * TBE is 90mM Tris-boric acid, and pH 8.3,2mM EDTA) on.Gel is with 30mA electrophoresis 1.5 hours in 0.5 * TBE, and is dried before the emissivity autography.
Embodiment 3: make the Arabidopis thaliana that carries Sunflower Receptacle Hahb-4 of the present invention have water and coerce anti- The test of being subjected to property
A. biomaterial
Using intestinal bacteria is that DH5 α and agrobacterium tumefaciens are GV2260.For transforming the plant test, use the seed of the environmental Columbia-0 of Arabidopis thaliana.
B. molecular cloning
In order to clone the Hahb-4 that is in the CaMV35S promoter regulation, by using the corresponding clone of cDNA as template (Gago et al., Plant Cell ﹠amp; Environment 25:633-640 2002, quotes herein as a reference) and use two specific oligonucleotide T1:5 '-GCGGGATCCACCATGTCTCTTCAACAAGTA-3 ' with two terminal hybridization of coding region; (SEQ ID No.20) and T2:5 '-GCCGAGCTCTTAGAACTCCCAACCACCFTTTG-3 ' (SEQID No.21) carry out the PCR reaction.In the method, remove 3 ' and 5 ' zone of the messenger RNA(mRNA) of not encoding, therefore, reduced the effect of possible post-transcriptional control.Design oligonucleotides is introduced the fragment of using this oligonucleotide amplification with the BamHI and the SacI site that allow at plasmid.In addition, locate to add at the oligonucleotide (oligonucleotide T1) of 5 ' cDNA end and be defined as the sequence consistent with optimum translation.Purifying PCR reaction product with this PCR reaction product of above-mentioned enzymic digestion, and uses intestinal bacteria to transform, and the PCR reaction product of enzymic digestion is cloned into be used on pBI 121 carriers transforming.In case obtain the clone that needs, then according to by
Figure BSA00000195714600291
And Willmitzer (
Figure BSA00000195714600292
And Willmitzer, Nucleic Acid Research 16:9977,1998) disclosed method, plasmid DNA is imported in the agrobacterium tumefaciens.Agrobacterium tumefaciens called after ATH4 with pBI121 plasmid that gus gene wherein replaced by Hahb-4.
Clone and detection technique adopt Sambrook, J., Fritsch, E.F. and Maniatis, T. the Molecular Cloning:A Laboratory Manual. second edition of (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
C. Arabidopis thaliana transforms
The employed method of arabidopsis thaliana transformation is the method that immersed (flower is dipped) by the described use of Clough and Bent (Clough and Bent, Plant J.16:735-743,1998).The seed that sterilization is obtained by conversion test, and in the culture dish that contains the MS substratum that adds the 40mg/L kantlex, cultivate seed.(F1) transfers in the soil with resistant plant, and grows to the generation seed.Use the appearance of the transgenosis (Hahb-4 gene) of pcr analysis gained strain (F2), and also analyze the expression of corresponding transcript by Northern.Breeding is expressed genetically modified strain until the subsystem that obtains to isozygoty.
According to Carpenter and Simon disclosed method (Carpenter, C.and Simon, A. (1998) Preparation of RNA.EnIn:Methods in Molecular Biology, vol 82:Arabidopsis Protocols.J.M.Martinez-Zapater and J.Salinas (Eds.), Humana Press Inc., Totowa, New Jersey) total RNA of preparation Arabidopis thaliana.Analyze for Northern, carry out disclosed method (Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A.and Struhl, K. (1983) Current Protocols in Molecular Biology.John Wiley ﹠amp; Sons, N.Y.).
For the Arabidopis thaliana plant that transforms by the round pcr analysis, use Li and the disclosed fast method of Chory to prepare total DNA (Li, J.and Chory, J. (1998) Preparation of DNAfrom Arabidopsis.In:Methods in Molecular Biology, vol.82:Arabidopsis Protocols.J.M.Martinez-Zapater and J.Salinas (Eds.), Humana Press Inc., Totowa, New Jersey).
D. phenotype analytical
D1. the analysis in the culture dish
By wash with 70% (v/v) ethanol 1 minute, chlorine 5%-SDS 1% washed 15 minutes and sterile distilled water wash 3 times the sterilization Arabidopis thalianas seed.Then, seed is suspended in the agar of 8ml 0.1%, and is seeded in the 150mm culture dish of the MS substratum that contains the VITAMIN of adding Gamborg production.Culture dish was placed 2 days at 4 ℃, was placed into then in the incubator of light modulation, temperature adjustment (24 ℃ of illumination 16 hours, 21 ℃ dark 8 hours).Insert white light and Grolux fluorescent tube (available from Sylvania) by the distance, the consecutive position that make plant and 6 fluorescent tube bulbs maintenance 25cm, thereby the artificially obtains required illumination condition (150～200 μ E/m 2).
Under aseptic condition, carry out the operation of vegetable material.The MS substratum is sterilized in autoclave, and adds VITAMIN by filtering subsequently.
D2: the test in the soil
In the flowerpot of diameter 12cm, high 10cm, carry out the test in the soil.According to test, plant about 1～3 Arabidopis thaliana seed in each basin, and equidistantly distribute.Cover flowerpot with transparent plastic material, until emerging, remove plastics then.Each 16 basin is placed in the plastic pallet, and plant is in incubator, growing with above-mentioned disclosing under the identical illumination condition.The water of pouring is added in the plastic pallet.
Coerce test in order to carry out water, add 1,1.5 or 2 liter water during beginning in the dish.When finishing, no longer adds the reproductive cycle any water under all situations.When plant grew 2 pairs of leaves, complete rosette bang or growth colored respectively, these made plant be in water by the pouring condition that keeps incubator to be in extremely low humidity condition and coerce.Can observe water by the final death of the arid of soil and crack, disappearance that blade expands and plant coerces.
Embodiment 4:Hahb-4 promotor, contain this promotor different fragments construct and Separation and the feature of transfer-gen plant that contains the Arabidopis thaliana of described construct.
A. vegetable material, cultivation and treatment condition
Use the sunflower seeds (Helianthus annuus L.) of Contiflor15 (Zeneca).The environmental Columbia-0 of Arabidopis thaliana is used in test for Plant Transformation.
By wash with 70% (v/v) ethanol 1 minute, chlorine 5%-SDS 1% washed 15 minutes and sterile distilled water wash 3 times the sterilization Arabidopis thalianas seed.Then, seed is suspended in the agar of 8ml 0.1%, and is seeded in the 150mm culture dish of the MS substratum that contains the VITAMIN of adding Gamborg production.Culture dish was placed 2 days at 4 ℃, was placed into then in the incubator of regulating light and temperature (24 ℃ of illumination 16 hours, 21 ℃ dark 8 hours).
In the incubator of tunable optical and temperature, cultivate the plant (24 ℃ of illumination 16 hours, 21 ℃ dark 8 hours) of Arabidopis thaliana.Insert white light and Grolux fluorescent tube by the distance, the consecutive position that make plant and 6 fluorescent tube bulbs maintenance 25cm, thereby the artificially obtains required illumination condition (150～200 μ E/m 2).
B. the purifying of DNA of plants
In order to extract total DNA of plant, use by Doyle J.J. and Doyle, J.L. disclosed method (Doyle, J.J.and Doyle, J.L. (1987).Carry out a spot of leaflet tablet tissue the rapid DNA sepn process (Phytochemical Bulletin 19,11-15).
C. the plasmid of Shi Yonging, bacterial strain and molecular cloning method:
Plasmid pGEM.-T easy (Promega) is used for the product that the clone uses the amplified reaction of Taq archaeal dna polymerase (Promega).
Also use pBI101 plasmid (Jefferson et al., EMBO J.6:3901-3907,1987), this plasmid is the derivative of pBIN19 binary vector.It contains the gene (gus) of coding intestinal bacteria β glucuronidase of the polyadenylation signal (no) of tool rouge alkali synthetase.The pBI101 plasmid also comprises makes plant have the nptII gene of kalamycin resistance.Other correlated series of this carrier comprises makes bacterium have gene and the bacterium replication origin RK2 of kalamycin resistance.This plasmid is used for cloning with the single restriction site of the upstream that is positioned at the gus gene, at Arabidopis thaliana the different fragments of Sunflower Receptacle Hahb-4 promotor.
By using bacillus coli DH 5 alpha competence host cell with T-easy or pBI carrier cloning construct earlier, carry out method for transformation or electroporation (Sambrook as the described classics of Sambrook then, J., Fritsch, E.F.and Maniatis, T. (1989) Molecular Cloning:ALaboratory Manual.Second edition.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y).For preparation agrobacterium tumefaciens competent cell and further conversion thereof, use
Figure BSA00000195714600331
The method of describing with Willmitzer (
Figure BSA00000195714600332
, R.and Willmitzer, L. (1988) Storage of competent Agrobacterium cells for transformation was carried out according to.Nucleic Acids Res.16,1977).
The molecular cloning of D.DNA fragment
In order to clone the startup zone of gene of the present invention, described inverse PCR strategy such as Ochman (Ochman, H., Ayala, F.J.and Hartl, D.L. (1993) Use of polymerase chain reaction to amplify segments outside boundaries of known sequences.In:Methods in Enzimology vol 218.R.Wu (Ed.), Academic Press, SanDiego, CA) carry out as follows.
Extract the Sunflower Receptacle genomic dna as mentioned above, get 5 μ g DNA, and use SauIIIA or the HindIII (Promega) of 1～3U for every micrograms of DNA.In the detected back of enzymic digestion (by in the sepharose of 0.7% (p/v), adding aliquots containig), then precipitate fragment by the 3M NaAc (pH5.2) of adding 1/10 volume and the dehydrated alcohol of 2 volumes.
In order to promote the connection again of restriction fragment, react fragment and 5U T4 dna ligase (Promega) that each reaction of adding 2,10 and 20ng obtains with the final volume of 100 μ L.Being reflected at 14 ℃ carried out 16 hours.Precipitation and purifying fragment are used for the template as the PCR reaction.
With reclaim DNA with the fragment of SauIIIA digestion as template, use oligonucleotide IPCR0/IPCR1 (SEQ ID No.12/SEQ ID No.15), the PCR that uses oligonucleotide IPCR2/IPCR3 (SEQ ID No.16/SEQ ID No.17) to carry out in the first step when with the HindIII dna digestion reacts.According to the method for manufacturer's suggestion, the fragment cloning that obtains is arrived
Figure BSA00000195714600341
In-Teasy the carrier (Promega).After detecting the clone, measure corresponding sequence, and design next step needed oligonucleotide.The sequence of used oligonucleotide and position are as shown in figure 23 in next clone's step.
IPCR0[5′-GGCGGATCCCCTGGTGGTTGTTTCTGTTG-3′]
IPCR1[5′-GCCGAATTCAGATTGAGCAAGAGTATAAC-3′]
IPCR2[5′-ACCTTTATAAAGACCACTC-3′]
IPCR3[5′-ACGCAATGGTGAGTTGTAC-3′]
IPCR4[5′-GCGAAGCTTGATGCGAACGAGTGGTTTA]
IPCR5[5′-ATTTCGCAAGTAGTCCATT-3′]
IPCR6[5′-CCCAAGCTTAACCTAAGTCCGCCTTTG-3′]
IPCR7[5′-GGCAAGCTTATCTCAACCGAAAGTGAC-3]
At last, because this technology is suitable for fragment cloning, therefore use with the Sunflower Receptacle genomic dna as template, utilize polymerase chain reaction and two to be designed to and the oligonucleotide (IPCR10:GCGGTCGACACCTGGCACATCGTATCT (SEQID No.5) and IPCR8:CGCGGATCCGAGGGTTTGATAAGTGAT (SEQID No.6)) of the corresponding end hybridization complete fragments sequence knowledge that increases.Extension amplification outcome to pGEM-T easy carrier, is measured its sequence then.
Inverse PCR and structure transform the used strategy of the used recombinant plasmid of plant as shown in figure 23.
The different fragments that will comprise the promotor of transcription initiation site then is cloned into the 101pBI.3 carrier.Selectively, in order to study the promoter fragment far away apart from transcription initiation site, use and carry minimal promoter (the pBI carrier of modification 90CaMV35S) that comprises the TATA box.This carrier also contains the gus gene as indication, therefore, can measure the startup activity of each cloned sequence.
The clone of E.Hahb-4 intron:
In order to clone the Hahb-4 intron, by with the Sunflower Receptacle genomic dna as template and use oligonucleotide IPCR1 (5 '-GCCGAATTCAGATTGAGCAAGAGTATAAC-3 (SEQ ID No.15) and N1 (5 '-GCGGGATCCGTCTGGCAGTTGTTCTTC-3 ' SEQ ID No.22)) to carry out the PCR reaction.With the product of EcoRI and BamHI (site that is provided by Nucleotide) digestion gained, and be cloned into subsequently in the pUC119 plasmid that was digested by same enzyme.After examining the intron that the expection size in some white institute's DCRP, occurs having, its sequence of mensuration as described below.
F. with the construct arabidopsis thaliana transformation plant that obtains in the above step.
The used method of arabidopsis thaliana transformation plant is as Clough and the described immersed method of Bent (flower is dipped) (Clough, S.J.and Bent, A.F. (1998) Floral dip:a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant J.16,735-743).
For each construct, add soil in 10～12 diameters flowerpot that is 10cm and cover with fabric.The fixing cloth that covers, make it invest the soil surface preferably.Then, seed is scattered in the soil preferably, and flowerpot is placed the pallet that covers with transparent nylon paper.Culturing plants under these conditions; After one week, remove nylon paper, and select the strongst plant.
Cultivate this plant until flowering period (about 4 weeks).When bennet exposes (rosette bang of 1～2cm), attention does not injure cauline leaf and downcuts inflorescence.After the above-mentioned cutting 4～6 days, new inflorescence grew.By the time all inflorescences have 4 flowers of not opening at least, transform then.
In order to prepare transformant, Agrobacterium contains in the flask of LB substratum of kantlex that 10ml added 50mg/L Rifampin and 50mg/L at 3,28 ℃ of stir culture 24 hours.These cultures are inoculated in 3 Erlenmeyer flasks that contain the identical substratum of 200ml, and grow to stationary phase (stationary stage) (stirring 12～16 hours down at 28 ℃).By with centrifugal 20 minutes collecting cells of 5500 * g.1 liter contain 300 μ Silwet L-77 (OSISpecialties, the centrifugal precipitation that obtains of resuspending in 5% sucrose solution Inc.), and suspension placed the sedimentation glass with magnetic stirring apparatus.Plant was soaked into 10～60 seconds therein, prevented liquid contact soil simultaneously.Then, flowerpot flatly is placed in the pallet, covers with nylon paper, and be put in the incubator.Second day, flowerpot is placed with normal position, water is added in the pallet, plant strain growth is to seed maturity (4～5 week).
At last, collect the seed of each flowerpot respectively, and manual silique and the soil of cleaning.Seed is put in the refrigerator for further analyzing.
In order to select plants transformed, with the seed disinfection of collecting in the conversion test, and as mentioned above, with the seed kind in the culture dish that contains the MS substratum that has added the 40mg/L kantlex.In in incubator, cultivate first day, most of seed germination (95～99%).
In the time of about 10 days, the cotyledons turn yellow of sensitive plant, and the cotyledon of conversion plant still is green.Plate was placed in incubator 7 days again, during this period, only in plants transformed, could be observed non-evergreen real blade.Non-transformed plant death.Resistant plant is transferred in the flowerpot of soil.In order to prevent the unexpected reduction of humidity, flowerpot is placed in the pallet of water, and cover a week with transparent nylon paper.After this stage, removal covers the paper of flowerpot, and cultivates plant until seed maturity, collects seed, and is placed in the refrigerator for further analyzing.Except selecting also to detect genetically modified appearance by specific PCR the plant by its resistance to kantlex.
At last, obtaining isozygotying of third generation plant by 100% tolerance of planting and observing a plurality of subsystems in containing the plate of kantlex is.
G. the tissue chemical analysis of β-glucuronidase activity of transgenic plant of the present invention
To carry out the histochemical test of β-glucuronidase activity by the Arabidopis thaliana plant of the present invention that kalamycin resistance is selected and PCR reaction evaluation obtains.Na with 50mM pH7 2HPO 4Damping fluid is washed embryo and the organ for test.Then it is transferred to the Na of 50mM pH7 2HPO 4The solution of solution, 0.1%Triton X-100,2mM X-gluc (5-bromo-4-chloro-3-indoles-β-D-glucuronide) carried out vacuum-treat 5 minutes and hatched in the dark under 37 ℃ 2～12 hours.After hatching, at room temperature it was placed 10 minutes in 10% formaldehyde solution, 50% ethanol and 5% acetic acid.Remove formaldehyde, add 70% ethanol, and 4 ℃ of preservations.
With the seedling of 2,10 and 20 ages in days of in the culture dish that contains MS substratum and 0.8% agar, growing with containing the adult plant that grows in the flowerpot of soil and carry out tissue chemical analysis.
H. the fluorometric analysis of β-glucuronidase activity of conversion plant of the present invention:
Be accredited as positive antibiotics resistance by PCR reaction and histochemical test is used for starting by fluoroscopic examination research the regulation and control in zone for the transformed plant of expressing β-glucuronidase.In having the 30mm culture dish of MS-nutrient agar, cultivate 30～50 seeds that respectively are.Suitably after the growth, plant is transferred in the test tube with the MS liquid nutrient medium that adds or do not add ABA, and hatched the different time as following detailed description.After hatching, place liquid nitrogen until use plant.
By (about 2～5mg) homogeneous turn to fine powder and obtain protein extract with vegetable material.Add 500 μ l then and extract damping fluid (50mM Na 2HPO 4PH 7,10mM EDTA, 0.1%SDS, 10mM beta-mercaptoethanol, 1%Trit ó n X-100).Suspension is transferred in the micro-centrifuge tube, and centrifugal 10 minutes at 4 ℃ with 13000 * g.Abandon supernatant liquor, the micro-centrifuge tube that precipitation is housed is placed on ice.
According to Jefferson method (Jefferson, R.A., Kavanagh, T.A.and Bevan, M.W. J.6 (1987) Gus fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants.EMBO 3901-3907) carries out fluorescent reaction.100 μ l protein extracts are joined among 100 μ l methyl alcohol and the 300 μ l substrate MUG (4-methyl umbelliferone acyl β-D-glucuronide).Draw 100 μ l aliquots containigs, and carry out fluorometric assay 0 of time immediately.400 μ l of remainder are hatched in 37 ℃ of water-baths, and in the time of 30,60 and 120 minutes, shift out 100 μ l aliquots containigs.For termination reaction, use 0.9ml 0.2MNa 2CO 3The numerical value of fluorescent reaction is expressed as the function of the concentration of product 4-MU (7-hydroxyl-4 methyl umbelliferone) with product (the pmol)/total protein (mg) of per minute according to the RFU graphic representation.
Use the equipment VersaFuor of Bio-Rad TMFluorescing system, in the disk of 1ml, carry out fluorometric assay.
I. total protein is quantitative
By using Sedmak and Grossberg disclosed method (Sedmak, J.and Grossberg, S. (1977) A rapid, sensitive, and versatile assay for protein using Coomassie brilliant blue G-250.Anal.Biochem.79,544-552) concentration of soluble protein in the mensuration protein extract.Bovine serum albumin (BSA) is as standard model.
J. the mensuration of sequence and analysis
Dna sequence dna for the construct of measuring acquisition, use commercially available device T7 sequencing kit (Amersham Biosciences), this method is based on mulberry lattice method (Sanger, F., Nicklen, S.and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors.Proc.Natl.Acad.Sci.USA 74,5463-5467) and the DNA that only is combined in the step extend/stop.In addition, (Castelar Bs.As.Argentina) examines these sequences for Service given High Complexity Laboratory, INTA with automatic sequencer.
In order to identify the regulating and controlling sequence that starts in the zone, use database PLACE (Higo, K., Ugawa, Y., Iwamoto, M.and Korenaga, T. (1999) Plant cis-acting regulatory DNA elements (PLACE) database:1999.Nucleic Acids Res.27,297-300) and PlantCARE (Rombauts, S., Dehais, P., Van Montagu, M.and Rouze, P. (1999) PlantCARE, a plant cis-acting regulatory element database.Nucleic Acids Res.27,295-296).
When not specifying used technology, use is by Sambrook, J., Fritsch, E.F. and Maniatis, T. ((1989) Molecular Cloning:A Laboratory Manual.Second edition.Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) and Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. ((1983) Current Protocols in Molecular Biology.John Wiley ﹠amp; Sons, N.Y.) disclosed classical way.
Although have illustrated and described the preferred embodiments of the present invention, those of ordinary skills obviously can carry out variations and modifications to the present invention, and do not depart from the scope of the present invention that is limited by additional claim.
Figure ISA00000195714800011
Figure ISA00000195714800021
Figure ISA00000195714800031
Figure ISA00000195714800041
Figure ISA00000195714800051
Figure ISA00000195714800061

Claims (6)

1. isolated nucleic acid molecule that is selected from the following nucleic acid molecule:
(a) by the nucleic acid molecule shown in the nucleotide sequence SEQ ID No.3;
(b) by the nucleic acid molecule shown in the nucleotide sequence SEQ ID No.10; With
(c) by the nucleic acid molecule shown in the nucleotide sequence of 805～1221 Nucleotide of SEQ ID No.3,
Wherein, described nucleic acid molecule can promote the heterologous nucleic acids molecule to express in transformant.
2. nucleic acid construct comprises first nucleic acid molecule that is selected from the following nucleic acid molecule:
(a) by the nucleic acid molecule shown in the nucleotide sequence SEQ ID No.3;
(b) by the nucleic acid molecule shown in the nucleotide sequence SEQ ID No.10; With
(c) by the nucleic acid molecule shown in the nucleotide sequence of 805～1221 Nucleotide of SEQ ID No.3,
Wherein, described first nucleic acid molecule is operably connected to second nucleic acid molecule and 3 ' the untranslated zone of coding target protein.
3. one kind with the described nucleic acid construct of claim 2 transformed host cells stably, and wherein, described host cell is not vegetable cell.
4. the described host cell of claim 3, wherein, described host cell is selected among bacterial cell and the fungal cell.
5. method at least a target protein of host cell inner expression, this method comprises:
In host cell, introduce the described nucleic acid construct of claim 2 and make described host cell produce target protein.
6. method that obtains to express the transgenic plant of at least a target protein, this method comprises:
With the described nucleic acid construct of claim 2 stably transformed plant cells or cell culture;
Make this cell or cell culture be regenerated as the whole plant of expressing at least a albumen.
CN 201010229130 2003-05-02 2003-05-02 Transcription factor gene induced by dehydration condition and abscisic acid in sunflower, promoter and transgenic plant Expired - Lifetime CN101914549B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201010229130 CN101914549B (en) 2003-05-02 2003-05-02 Transcription factor gene induced by dehydration condition and abscisic acid in sunflower, promoter and transgenic plant

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201010229130 CN101914549B (en) 2003-05-02 2003-05-02 Transcription factor gene induced by dehydration condition and abscisic acid in sunflower, promoter and transgenic plant

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN038263742A Division CN101405391B (en) 2003-05-02 2003-05-02 Water deficiency condition and abscisic acid induced transcription factor gene, promoter and transgenic plant in sunflower

Publications (2)

Publication Number Publication Date
CN101914549A CN101914549A (en) 2010-12-15
CN101914549B true CN101914549B (en) 2013-08-21

Family

ID=43322190

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201010229130 Expired - Lifetime CN101914549B (en) 2003-05-02 2003-05-02 Transcription factor gene induced by dehydration condition and abscisic acid in sunflower, promoter and transgenic plant

Country Status (1)

Country Link
CN (1) CN101914549B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114717257B (en) * 2022-04-26 2023-01-24 山东中医药大学 Application of SmHD-Zip12 gene in increasing tanshinone content

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Claudia M. PALENA et al..A monomer–dimer equilibrium modulates the interaction of the sunflower homeodomain leucine-zipper protein Hahb-4 with DNA.《Biochem. J.》.1999,第341卷 *
G. M. Gago et al..Hahb-4, a homeobox-leucine zipper gene potentially involved in abscisic acid-dependent responses to water s tress in sunflower.《Plant, Cell and Environment》.2002,第25卷(第5期), *
Gago G.M. et al..AF339749.《www.nvbi.nlm.nih.gov》.2001, *
Maren Rossak et al..Expression of the FAE1 gene and FAE1 promoter activity in developing seeds of Arabidopsis thaliana.《Plant Molecular Biology》.2001,第46卷(第6期), *

Also Published As

Publication number Publication date
CN101914549A (en) 2010-12-15

Similar Documents

Publication Publication Date Title
Wu et al. CFL1, a WW domain protein, regulates cuticle development by modulating the function of HDG1, a class IV homeodomain transcription factor, in rice and Arabidopsis
Mu et al. Arabidopsis transcription factor genes NF-YA1, 5, 6, and 9 play redundant roles in male gametogenesis, embryogenesis, and seed development
US7632982B2 (en) Drought responsive promoters HVA22e and PLDδ identified from Arabidopsis thaliana
Wehmeyer et al. The expression of small heat shock proteins in seeds responds to discrete developmental signals and suggests a general protective role in desiccation tolerance
US8283521B2 (en) Transcription factor gene induced by water deficit conditions and abscisic acid from Helianthus annuus, promoter and transgenic plants
Bucher et al. The expression of an extensin-like protein correlates with cellular tip growth in tomato
CN102066568A (en) Plants having enhanced yield-related traits and a method for making the same
CN102186877A (en) Plants having enhanced yield-related traits and a method for making the same
US20140344996A1 (en) Methods and means to produce abiotic stress tolerant plants
CN103695438A (en) Arabidopsis MYB family transcription factor AtMYB17 gene as well as coding sequence and application thereof
US7659448B2 (en) Plant regulatory sequences for selective control of gene expression
CN101845437B (en) Promoter with properties of inducing and organizing specific expression
US9181560B2 (en) Chimeric promoters and their uses thereof in plants
CN101914549B (en) Transcription factor gene induced by dehydration condition and abscisic acid in sunflower, promoter and transgenic plant
Kitajima et al. Constitutive expression of the neutral PR-5 (OLP, PR-5d) gene in roots and cultured cells of tobacco is mediated by ethylene-responsive cis-element AGCCGCC sequences
CN106148344B (en) One kind having the active 5 ' UTR sequence of enhancing gene expression in plants and its application
Maghuly et al. Stress regulated expression of the GUS-marker gene (uidA) under the control of plant calmodulin and viral 35S promoters in a model fruit tree rootstock: Prunus incisa× serrula
CN103421814B (en) Application of DWA1 gene for controlling drought resistance of rice and leaf epidermis wax synthesis
Li et al. Integrative analysis of HD-Zip III gene PmHB1 contribute to the plant architecture in Prunus mume
CN105906696A (en) Authentication and application of novel cotton fiber development relevant gene GhEIN3
CN106480069B (en) Cucumber CsERF025 gene and its promote the straight developmental application of cucumber fruits
CN103667316A (en) MYB (myeloblastosis) family transcription factor AtMYB84 gene in Arabidopsis, as well as coding sequence and application thereof
Saeed et al. Promoters of the soybean seed lectin homologues Le2 and Le3 regulate gene expression in vegetative tissues in Arabidopsis
US20100197498A1 (en) Oryza sativa ltp promoters useful for modulating gene expression in plants
KR101594977B1 (en) Constitutive promoter Br15

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CX01 Expiry of patent term

Granted publication date: 20130821

CX01 Expiry of patent term