CN101899466B - Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof - Google Patents
Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof Download PDFInfo
- Publication number
- CN101899466B CN101899466B CN2010102126025A CN201010212602A CN101899466B CN 101899466 B CN101899466 B CN 101899466B CN 2010102126025 A CN2010102126025 A CN 2010102126025A CN 201010212602 A CN201010212602 A CN 201010212602A CN 101899466 B CN101899466 B CN 101899466B
- Authority
- CN
- China
- Prior art keywords
- virus
- japanese encephalitis
- chimeric
- dengue virus
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and a preparation method thereof. The embedded pseudo virus particles are formed by transfectting and expressing recombinant expression plasmids of a cloned dengue virus and Japanese encephalitis virus structural gene in target cells. The preparation method of the embedded pseudo virus comprises the following steps of: (1) constructing the recombinant expression plasmids containing a dengue virus-Japanese encephalitis virus structural protein coding sequence; (2) introducing the recombinant plasmid into the target cells and sieving stably-transfectted cells for cloning; (3) culturing the stably-transfectted cells so as to generate dengue virus-Japanese encephalitis virus embedded pseudo virus particles; and (4) extracting and purifying the embedded pseudo virus particles from cell culture supernatant fluid. The vaccine embedded with the dengue virus-Japanese encephalitis virus antigens can stimulate the organism to generate immune response, further prevents dengue virus and/or Japanese encephalitis virus infectious diseases, and has the advantages of good immune effect, safety and industrial production suitability.
Description
Technical field
The present invention relates to dengue virus and Japanese encephalitis virus embedded pseudo virus particle and preparation method thereof, the invention still further relates to dengue virus and Japanese encephalitis virus embedded pseudo virus particle in the purposes aspect vaccine research.
Background technology
Dengue virus (Dengue virus, DV) and epidemic encephalitis B virus (be called japanese encephalitis virus in the world, Japanese encephalitis virus JEV) is the sub-thread positive chain RNA virus of flaviviridae, is that media is propagated with the mosquito.Singapore hemorrhagic fever due to the DV (Dengue fever; DF), dengue hemorrhagic fever and step on leather shock syndromes (Denguehemorrhagic fever/Dengue shock syndrome; DHF/DSS) be widely current in the torrid zone and subtropical zone, the whole world has 25～3,000,000,000 people to live in the popular district, has every year the people more than 100,000,000 to be infected; Wherein about 1,000,000 people develop into serious DHF/DSS, mortality ratio 5～20% (Chaturvedi UC.J Biosci.2008; 33 (4): 429-441).Areas such as China Hainan, Guangdong, Guangxi, Fujian, Zhejiang and Taiwan all are the emphasis epidemic regions of singapore hemorrhagic fever, and the eruption and prevalence of DF, DHF/DSS repeatedly takes place, and bring to popular district people's health to have a strong impact on.Japanese encephalitis due to the JEV; Claim that also epidemic encephalitis type B (abbreviation encephalitis) mainly is popular in the Asia, the health that is threatening about 3,000,000,000 people, annual about 50,000 people infect; Mortality ratio 29%; The survivor that must cross encephalitis has neural and spiritual sequela more, and China is encephalitis popular key area (Wang H, et al.Jpn J Infect Dis.2009; 62 (3): 331-336).
At present, the DV infection is not still had special treatment means, also not having safely and effectively, vaccine comes out.Though the prevention to encephalitis has inactivated vaccine and attenuated live vaccine; But the inoculation back is prone to take place dissemination cerebrospinal meningitis (Acute Disseminated EncephaloMyelitis; ADEM) and anaphylaxis, the attenuated live vaccine inoculation exists viral vigor to strengthen the risk of causing a disease especially.
Vaccine of the prior art comprises following several kinds:
Inactivated vaccine: like first Japanese encephalitis inactivated vaccine BIKEN/JE
is to be separated first from the Nakayama epidemic isolates of Japan by nineteen thirty-five after the cultivation of mouse brain, Superlysoform deactivation, to process; After using over half a century; Protection is low day by day, and toxic side effect such as ADEM is obvious day by day.
Attenuated live vaccine: the SA14-14-2 attenuated strain of China's 1988 annual proper motions development has been brought into play very big effect in the prevention of encephalitis; Crowd's protection ratio 60-96%; According to WHO statistics in 2005; The use of this attenuated vaccine surpasses 50% of the global Vaccinum Encephalitidis Epidemicae market share, but in the world still there is dispute in its security at present, as yet not by acceptance such as US and Europeans.
The U.S. 00807995 discloses a kind of vaccine composition of attenuation dengue virus.This attenuated virus obtains through continuous passage in P D K cell.Use stepping on leather-1, step on leather-2, step on leather-3 and step on leather-4 virus and can stimulating individual immunity system of attenuation to induce the provide protection of resisting all four kinds of dengue virus serotypes.Because there is the independent risk that strengthens preparation in attenuated virus, thereby limits its application.
Japan 99801764 provides a kind of new inactivated virus particle and enhancing immunity than the efficiency-timed valency of the high about 2-10 of conventional vaccine former, and preparation method thereof.But only be used as the diagnostic reagent of the infection that causes by the japanese encephalitis virus crowd.
(PLoS Pathog.2010 such as Beasley; 6 (2): e1000790) disclosing a kind of is the encephalitis recombiant vaccine of carrier with yellow fever virus YFV-17D, but owing to carried the virus-specific gene of reorganization, has vigor enhanced risk in vivo, has therefore limited the scope of application of this vaccine.
Genetic engineering subunit vaccine: though also do not have dengue vaccine listing, India (Etemad B, et al.2008) and Chinese scholar (Chen S at present; Et al.2007) specific region with 4 kinds of serotype dengue virus E proteins merges, and is built into 4 valency recombinant protein vaccines, in the animal level certain protective role is arranged; In with titre be 1: 47-1: 588; Protection to various DV differs greatly, and comparatively speaking, the protection effect of subunit vaccine is not as the graininess vaccine.
Cuba 200680051377 discloses and has utilized the proteic surperficial conservative region exploitation broad-spectrum antiviral molecule of E (a kind of chimeric protein) to be used to prevent and/or treat the infection that is caused by dengue virus 1-4 and other flaviviruss.But this chimeric protein lacks the grain pattern of virus appearance, and effect is not as complete virion.
The pseudovirus vaccine: pseudovirus (pseudovirus) is not for containing the empty particle structure of nucleic acid; But kept natural viral particulate space conformation, not only can be used for simulating the infection of natural viral, explored the mechanism that virus is invaded sensitive cells the host; VLPs is made up of viral primary structure albumen simultaneously; Containing the special epitope of virus, can stimulate body immune system to produce very strong immunne response, is candidate vaccine very promising, safety.The HPV6,11,16 of Merck company development, 18 tetravalence VLP Gardasil vaccines (prevention cervical cancer) obtain the U.S. FDA permission in June, 2006, become the VLPs vaccine that first puts application on market, are also indicating the developing direction of following vaccine.
In sum, the eager demand security in this area is good, the high-quality vaccine that immunizing potency is high.
Summary of the invention
The object of the invention just provide a kind of good immune effect, safely, be suitable for dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine that industrialization produces and preparation method thereof.The antigen component of this vaccine is chimeric dengue virus and japanese encephalitis virus can stimulate body to produce immunne response, and then prevention dengue virus and/or japanese encephalitis virus infection.
In first aspect of the present invention, the recombinant expression plasmid of a kind of dengue virus and the chimeric pseudovirus of japanese encephalitis virus is provided, inserted following elements in the described expression plasmid:
A) Flavivirus signal coding sequence;
B) the preM/M coding region of whole dengue viruss;
C) preceding 35 the amino acid whose coding regions of dengue virus E protein;
D) 120 amino acid whose codings behind the japanese encephalitis virus E albumen.
In another preferred version, described expression plasmid comprises pcDNA3.1, pcDNA6.0, pCIneo (+), pReceiver etc.
In another preferred version, the insertion element is in series by the order of a-b-c-d in the described expression plasmid.
In another preferred version; Described Flavivirus signal coding sequence is selected from: the nucleotide sequence of the coding japanese encephalitis virus preM/M signal peptide shown in the SEQ ID NO:1, the nucleotide sequence of the coding II type dengue virus preM/M signal peptide shown in the SEQ ID NO:3, and SEQ ID NO:4 shown in the nucleotide sequence of coding west Nile virus preM/M signal peptide.
In another preferred version, described dengue virus is dengue virus serotype I, II, III or IV type.
In second aspect of the present invention, a kind of chimeric pseudovirion is provided, it is expressed after by the described recombinant expression plasmid transfection of claim 1 target cell and forms, and does not contain any Nucleotide.Described target cell comprises: BHK21,293,239T, Cos, Hela etc. derive from Eukaryotic continuous cell line.
In the third aspect of the invention, a kind of drug regimen is provided, it contains pseudovirion and pharmaceutically acceptable adjuvant or the carrier that above-mentioned recombinant expression plasmid is expressed.
In fourth aspect of the present invention, the purposes of reorganization pseudovirion of the present invention is provided, be used to prepare the medicine of prevention singapore hemorrhagic fever and/or Japanese encephalitis.
Aspect the of the present invention the 5th, a kind of method for preparing chimeric pseudovirion is provided, may further comprise the steps:
1) the described recombinant expression plasmid that contains dengue virus and japanese encephalitis virus structural protein encoding sequence of claim 1 is imported target cell;
2) when described target cell is expressed dengue virus and japanese encephalitis virus structural protein, the corresponding microbiotic of resistant gene that carries with plasmid screens transfectional cell, obtains the cell clone of stable transfection;
3) cultivate the cell of stable transfection, thereby produce dengue virus and the chimeric pseudovirion of japanese encephalitis virus;
4) reclaim chimeric pseudovirion.
The invention provides the various compsns that comprise the chimeric pseudovirion of reorganization of the present invention, comprise medicinal compsns, especially vaccine composition.
Drug regimen
The pharmaceutically acceptable buffer reagent of being selected for use when medicinal compsns of the present invention can comprise actual use also comprises other material that is used for intended purpose.The existing numerous buffers in this area is applicable to intended purpose, and those skilled in the art is good at the buffer reagent selected.In some instances, this medicinal combination can contain pharmaceutically acceptable wetting Agent for Printing Inks, and pharmaceutically acceptable various wetting Agent for Printing Inkss all have narration at multiple public publication, comprises like Pharmacopoeia of People's Republic of China (2005 editions).
Described medicinal compsns can be prepared various formulations, like injection, tablet, pill, capsule, sprays etc.Be applicable to local the use and oral pharmaceutical grade other organic or inorganic carrier or thinner.Thinner known in the art comprises aqueous medium, vegetalitas and animal raw fat.Also available stablizer, emulsifying agent, the various buffer reagents of keeping pH and skin penetration enhancer etc. are as subsidiary material.
When the present invention was used as vaccine, the chimeric pseudovirus of reorganization can adopt several different methods to prepare.Generally, by the whole bag of tricks well known in the art, with pharmaceutically acceptable carrier or vector are prepared vaccine of the present invention.Suitable pharmaceutical carrier comprises SPSS, and also available other aseptic water-based and nonaqueous etc. is oozed injection liquid, is pharmaceutically acceptable carrier well known to those skilled in the art.Also can contain other composition when preparing vaccine composition of the present invention, like adjuvant, stablizer, pH regulator agent, sanitas etc.These compositions all are that the technician in vaccine field knows.Adjuvant include, but is not limited to aluminium salt adjuvant, saponin adjuvant, Cerbu adjuvant (Cerbu Biotechnik Gmbh, Gaiberg, Germany) etc.Stablizer comprises (but being not limited to) l-arginine, TKK 021, polyvalent alcohol, amino acid, inorganic salt, PEG etc.
Route of administration and dosage:
When as vaccine, available method well known to those skilled in the art is applied to individuality with reorganization dengue virus of the present invention and the chimeric pseudovirion of japanese encephalitis virus.Usually the approach that adopts route of administration identical with conventional vaccine or simulated virus to infect is used these vaccines.When adopting the form of vaccine composition, except that the embedded virus that contains reorganization, also can comprise pharmaceutically acceptable carrier, adjuvant, stablizer, pH regulator agent etc.
Administration is conventional to be comprised with approach: intramuscular injection, subcutaneous injection, collunarium, intravenous injection, oral administration etc., also can adopt the combination medicine-feeding approach if desired.Giving of vaccine composition can single dose with dosage, but also multiple doses, and can give booster dose to keep the immunizing power of being used individuality.
In the route of administration of being selected for use; Should give the amount of dengue virus and the chimeric pseudovirion of japanese encephalitis virus with " effective dose "; Be enough to cause and used individual immunne response, can effectively protect and used individuality, the infection of opposing dengue virus and/or japanese encephalitis virus.
Described effective dose, the dengue virus that is meant in vaccine composition to be selected for use and the amount of the chimeric pseudovirion of japanese encephalitis virus are that the amount of not having significant side effects by causing the individual immunity protective response is confirmed.With chimeric pseudovirion protein in the vaccine component is the basic calculation effective dose, generally includes about 1-500 μ g protein, preferably is 1-200 μ g, 10-100 μ g more.The available antibody titers in the object of observation and other of comprising reacts to confirm the optimum amount of concrete vaccine; The immunity level that provides through the detection vaccine determines whether to need to strengthen dosage; Use the immunne response that adjuvant or immunostimulant can improve pseudovirion of the present invention, these all are that those skilled in the art knows.
The inventor is through deep research; Set up the chimeric pseudovirus vaccine production technology of dengue virus and japanese encephalitis virus; And successfully made up anti-dengue virus that security is good, immunizing potency is high and/or the chimeric pseudovirus vaccine of japanese encephalitis virus, accomplished the present invention on this basis.Compare with prior art, the present invention has the following advantages:
1. improved immune validity:
1) chimeric pseudovirus surface had both had the neutralizing epitope of dengue virus E protein; Contain the proteic protective antigen of japanese encephalitis virus E district again; Can produce immunocompetence behind the immunity host individuality, be superior to the one-component vaccine on the immunizing potency dengue virus and japanese encephalitis virus.
2) because the tissue of pseudovirus parent preferendum is identical with euvirus with course of infection, therefore can simulate the early infection process of natural viral, the immunne response of effective stimulus body.
2. improved the security of vaccine.
Chimeric pseudovirus of the present invention does not have the special nucleic acid of virus, thereby does not have replication, can not cause the specific cell pathology that dengue virus and japanese encephalitis virus cause yet, and can farthest reduce the risk that vaccine uses.
3. production cost is low.
After having made up recombinant expression plasmid, transformed target cell also screens stable cell clone.When producing, the cell clone that only needs to cultivate stable transfection can produce a large amount of pseudovirions, thereby has shortened the production of vaccine flow process, has improved the production efficiency of vaccine, and the products production cost reduces.
Below in conjunction with the practical implementation instance, further illustrate the present invention.Should be pointed out that these instances only are used for further illustrating the present invention, and be not used in the restriction scope of application of the present invention.The experimental technique of unreceipted actual conditions is translated according to normal condition such as Huang Peitang etc. usually in following examples, the condition described in the molecular cloning experiment guide (third edition, Science Press, 2002), or produce tame condition of being advised by the reagent manufacturing and carry out.
Description of drawings
Fig. 1 is the process synoptic diagram of chimeric pseudovirus recombinant expression plasmid preparation.
Fig. 2 is stable transfection clone's screening process synoptic diagram.
Fig. 3 is anti-G418 clone's a Western blot qualification result, and 4 clone's ability expression specificity antigens are arranged among visible 11 clones among the figure, and they are respectively B8, B11, C4 and C7 clone.
Embodiment
The applicant finds that through a large amount of experiments the structure of dengue virus of the present invention and the chimeric pseudovirus of japanese encephalitis virus must satisfy following condition:
1) complete preM/M structural protein must be arranged.The preM/M structural protein of flavivirus are a kind of stromatin, in the formation of virion, play an important role, any disappearance or phase shift mutation to the preM/M structural protein, and the efficient that forms pseudovirus can significantly descend.
2) back 99 amino acid of deletion dengue virus E protein; Corresponding coding sequence is back 297 Nucleotide of dengue virus E protein; Because contain a coating anchorage zone (amino acid 452-491) and a stem ring district (amino acid 395-450) in this section sequence; The E albumen of expression is stranded on the endoplasmic reticulum, has reduced secretion.Though deletion still can form pseudovirion less than 99 amino acid (as 79,59,39,19), the formation efficient of pseudovirion descends gradually, so preferred range is 79-99 the amino acid in the proteic back of deletion E, more preferably deletes 99.
3) must keep proteic back 198 amino acid of japanese encephalitis virus E; Corresponding coding sequence is proteic back 594 Nucleotide of japanese encephalitis virus E; Because this zone contains the zone of E protein binding target cell, can stimulate body to produce efficient immune.
Can be used for the not special restriction of dengue virus of the present invention, can be any in 4 kinds of blood serum subtypes, and the genome sequence accession number of 4 kinds of hypotypes is following:
I type: U88536
II type: U87411
III type: AY099336
IV type: AF326825
Can be used for japanese encephalitis virus genome sequence accession number of the present invention is: NC_001437.1
When preparation chimeric pseudovirion of the present invention, carry out according to the following steps usually:
1. structure recombinant expression plasmid
This can realize (seeing embodiment 1) through conventional pcr amplification, connection, transformation technology.
2. screen the cell clone (seeing embodiment 2) of stable transfection
After obtaining recombinant expression plasmid, a kind of method of routine is to be introduced into target cell, cultivates transfectional cell, after for some time (as 48 hours), collects culture supernatant, and ultracentrifugation obtains chimeric pseudovirus.Another kind of preferable methods is the cell that adopts behind the pairing microbiotic of resistant gene (like G418) the screening plasmid transfection that plasmid carries; Acquisition has the cell clone of stable resistance; Cultivate again should clone for some time (as 48 hours) after, collect culture supernatant, centrifugally obtain chimeric pseudovirion.
1. the preparation of flavivirus signal coding sequence (S fragment)
(1) according to (the Davis BS etal of the japanese encephalitis virus signal peptide sequence shown in the SEQ NO; J Virol 2001; 75 (9): 4040-4047) design a pair of oligonucleotide fragment: S1:ATAGGCTAGCGCCATGGGCAAGAGATCGGCGGGCTCAATCATGTGGCTCGCAA GCTTGG (SEQID No: 5); S2:GCGTGTGGTTAAATGGAATGCTCCTGCGTAAGCTATGACAACTGCCAAGCTT GCGAGC (SEQ ID No:6), synthetic by the synthetic portion of the Dalian TakaRa DNA of company;
(2) the synthetic S fragment (5 of S1 chain ' end has the EheI restriction enzyme site) of primer extension: because of S1; 3 of S2 oligonucleotide fragment ' end has designed the complementary sequence of 14bp; Can adopt primer extension to generate the S fragment, the aminoacid sequence of this segment encoding is shown in SEQ ID No:2.Concrete operations are: the synthetic oligonucleotide fragment is mixed with 100 μ M concentration with sterile distilled water, respectively gets 2 μ l and place 0.25mlEp pipe, add PrimerStar archaeal dna polymerase (TakaRa) 1 μ l; DNTPs (TakaRa; 2.5mM/each) 1.5 μ l, 5 * buffer, 5 μ l replenish ddH
2O to 25 μ l.Pcr amplification appearance (BioRad) go up by 94 ℃ 30 seconds; 50 ℃ 30 seconds, 2 circulations of 72 ℃ of amplifications in 30 seconds, 1.2% agarose (Shanghai give birth to worker) gel electrophoresis; Press TakaRa glue and reclaim test kit specification sheets recovery purpose fragment, obtain flavivirus signal coding sequence (S fragment)
2. the pcr amplification of dengue virus II type preM/M albumen coded sequence
(1) described dengue virus II type is that the GenBank accession number is the virus strain of U87411, with SV Total RNA Isolation test kit (Promega), presses the test kit specification sheets and extracts dengue viral rna; With the RT-PCR method (referring to work such as Sa nurse Brooker; Huang Peitang etc. translate " molecular cloning experiment guide " third edition, Science Press, 2002) (amplification preM/M albumen (SEQ ID No:9) encoding sequence (M fragment); Used dna primer is following: M1; TTCCATTTAACCACACGCAACGGAGAA (SEQ ID No:7) and M2, TGTCATTGAAGGAGCGACAGCT GTCAGTA (SEQ ID No:8), primer is synthetic by Dalian TakaRa;
(2) rt rt (RT) test kit is the Promega product, is template with the viral RNA, is that primer carries out RT and obtains cDNA first chain with downstream M2, and RT reacts as follows:
10×RT buffer 4μl
MgCl
2(25mM) 2μl
dNTP(25mM/each) 1μl
Primer M2 (10 μ M) 1 μ l
RNasin(40μg/ml) 1μl
Reversed transcriptive enzyme (AMV, 10U/ μ l) 1 μ l
Total RNA(0.6μg/μl) 10μl
RNase free H
2O 20μl
42 ℃ of water-baths are 1 hour behind the mixing, then 75 ℃ 10 minutes, with the deactivation reversed transcriptive enzyme.
(3) pcr amplification is a template with cDNA first chain that RT in (2) obtains, and carries out pcr amplification with the M1-M2 primer, reacts as follows:
RT reaction mixture (cDNA) 1 μ l
5×PCR buffer(TaKaRa) 10μl
MgCl
2(25mM)(TaKaRa) 5μl
dNTP(25mM/each)(TaKaRa) 1μl
Primer M1 (10 μ M) 1 μ l
Primer M2 (10 μ M) 1 μ l
PrimerStar(10U/μl) 1μl
dH
2O 30μl
total 50μl
Behind the mixing, put pcr amplification appearance (BioRad) go up by 94 ℃ 30 seconds, 52 ℃ 30 seconds, 25 circulations of 72 ℃ of amplifications in 60 seconds, 1.2% agarose (worker is given birth in Shanghai) gel electrophoresis press TakaRa glue and is reclaimed test kit specification sheets recovery purpose fragment;
3. the pcr amplification of dengue virus II type E albumen coded sequence
Extract the dengue virus geneome RNA with the total RNA extraction reagent box; Encoding sequence (E fragment) with RT-PCR method amplification E albumen (SEQ ID No:12); Used dna primer is E1:AGC TGTCGCTCCTTCAATGACA (SEQ ID No:10) and E2:GCGGGAATTCAC TTCCTTTCTTGAACCAGTTAAG (SEQ IDNo:11) as follows, E2 5 ' end has the EcoRI restriction enzyme site.Rt and pcr amplification are undertaken by the step 2 of present embodiment 2, and difference is primer is changed.
4.SME segmental pcr amplification and clone
(1) amplification utilizes S, M, the intersegmental complementary sequence of E sheet, in the PCR of 0.25ml reaction tubes, respectively adds S, M, E fragment 1nM, is that primer carries out pcr amplification with S1/E2, and amplification condition is following:
5×PCR buffer(TaKaRa) 10μl
MgCl
2(25mM)(TaKaRa) 5μl
S fragment (1mM) 1 μ l
M fragment (1mM) 1 μ l
E fragment (1mM) 1 μ l
dNTP(25mM/each)(TaKaRa) 2μl
Primer S1 (10 μ M) 1 μ l
Primer E2 (10 μ M) 1 μ l
PrimerStar(10U/μl) 1μl
dH
2O 27μl
total 50μl
Behind the mixing, put pcr amplification appearance (BioRad) go up by 94 ℃ 30 seconds, 50 ℃ 30 seconds, 25 circulations of 72 ℃ of amplifications in 3 minutes, 1.2% agarose (worker is given birth in Shanghai) gel electrophoresis press TakaRa glue and is reclaimed test kit specification sheets recovery SME fragment;
(2) enzyme cut with the SME fragment that is connected recovery through EheI (TaKaRa)/EcoRI (TaKaRa) double digestion, insert eukaryon expression plasmid pCIneo (+) EheI/EcoRI site (Promega);
Endonuclease reaction: SME fragment (45ng/ μ l) 10 μ l
10×buffer B(TakaRa) 5μl
EheI(5U/μl) 2μl
EcoRI(5U/μl) 2μl
dH
2O 31μl
total 50μl
The rearmounted 37 ℃ of water-baths of mixing 4 hours, 1.2% agarose (worker is given birth in Shanghai) gel electrophoresis is pressed TakaRa glue and is reclaimed the SME fragment after the test kit specification sheets reclaims double digestion;
The double digestion reaction system of pCI-neo (Promega) plasmid is the same, reclaims plasmid;
Ligation: 10 * ligation buffer (Promega), 1.5 μ l
PCI-neo (the EheI/EcoRI enzyme is cut, 25ng/ μ l) 1 μ l
SME fragment (the EheI/EcoRI enzyme is cut, 68ng/ μ l) 5 μ l
T4 ligase(Promega，10U/μl) 1μl
dH
2O 6.5μl
total 15μl
The rearmounted 16 ℃ of water-baths of mixing 16 hours, 75 ℃ of 5min deactivation ligase enzymes;
(3) transform
The competent preparation of escherichia coli DH5 α is referring to molecular cloning experiment guide (third edition, Science Press, 2002); Get 4 μ l and connect product in 100 μ l DH5 α competent cells, mixing, 30min in the ice bath; Suffered a shock 90 seconds for 42 ℃, put 2min in the ice bath, mixture is added in the 900 μ l LB substratum (TakaRa); 37 ℃ of shaking culture 1 hour, coating AMP (100 μ g/ml, southwest restriction) lightweight is dull and stereotyped; Cultivated 18 hours for 37 ℃, select AMP resistance bacterium colony and carry out the plasmid extraction and identify the correct person's called after of sequence pCI-SME.
5. the pcr amplification of japanese encephalitis virus E protein I II district encoding sequence
Described japanese encephalitis virus is Beijing-1 strain (the GenBank accession number is NC_001437.1); Extract japanese encephalitis virus Beijing-1 strain RNA with the total RNA extraction reagent box; With the RT-PCR method (referring to work such as Sa nurse Brooker; Huang Peitang etc. translate " molecular cloning experiment guide " third edition; Science Press, 2002) encoding sequence (J fragment) in amplification E protein I II district (SEQID No:15), used dna primer is J1:GGGCGAATTCATGTGTACAGAAAAATTCTCGTTC (SEQ ID No:13) and J2:GACCTCTAGATCAAGCATGCACATTGGTCGCTAA (SEQID No:14) as follows; The J1 primer contains the EcoRI site, and the J2 primer contains the XhoI site.Rt and pcr amplification carry out referring to the scheme of present embodiment 2.
6. the structure of mosaic gene and clone
The J fragment that is obtained in the present embodiment 5 is cut through the EcoRI/XhoI enzyme; Insert among the eukaryon expression plasmid pCI-SME of preparation in 4 (3); Transform escherichia coli DH5 α competence; Select AMP resistance bacterium colony and carry out plasmid and extract and identify, the correct mosaic gene of sequence is shown in SEQ ID No:17, and this plasmid can be expressed chimeric pseudovirus albumen (SEQ ID No:16).Referring to Fig. 1, Fig. 1 is the building process of chimeric pseudovirus recombinant expression plasmid, contains the recon called after pCI-SMEJ of correct mosaic gene.
Embodiment 2 chimeric pseudovirus recombinant expression plasmid transfection target cells and stable transfection clone's screening
1. embodiment 1 described recombinant expression plasmid pCI-SMEJ is pressed liposome reagent specification sheets (Lipofectamine
TM2000, Invitrogen) transfection BHK21 cell (Baby hamsterkidney) (ATCC#:CCL-10) was cultivated 20 hours with the DMEM substratum (GIBCO) that contains 10% calf serum (Hyclone).
2. with 0.25% pancreatin (GIBCO) digestion transfectional cell; With reference to works such as Sa nurse Brookers, Huang Peitang etc. translate " molecular cloning experiment guide " (third edition, 2002 years; Science Press) clone's limiting dilution assay is cultivated with the DMEM substratum that contains 0.6mg/ml G418 (Sigma) and 10% calf serum; After 10 days, occur clonal growth in the culture plate, the picking clone carries out enlarged culturing.
3. collect the mono-clonal culture supernatant; Getting 100 μ l lyophilizes concentrates; SDS-PAGE method with reference to " molecular cloning experiment guide " is carried out electrophoresis, and electrotransfer is done one with the antiserum(antisera) of mouse anti dengue virus II type and resisted to nitrocellulose filter; The anti-mouse of rabbit of horseradish peroxidase (HR) mark (middle mountain company) makes the two anti-immunoblottings (Western blot) that carry out and identifies have the specific antigens expresser to clone for stable transfected cells.Accompanying drawing 2 has shown stable transfection clone's screening process; Accompanying drawing 3 has shown the Western blot qualification result to 11 stable transfections clone, has 4 clones can the expression specificity antigens among visible 11 clones, is respectively B8, B11, and C4 and C7 clone, B8 wherein, B11, C4, C7 are the full name of cell clone.
The preparation process of embodiment 3 chimeric pseudovirion vaccines
1. the stable transfection clone who obtains among the recovery embodiment 2; With the DMEM substratum enlarged culturing that contains 10% calf serum; After reaching required cell concentration, the DMEM culture medium culturing of using 2% calf serum instead was collected supernatant once in per 48 hours; Centrifugal 30 minutes of 6000g (Sigma 3T3 whizzer) retains supernatant.
2. the centrifugal purification of chimeric pseudovirion: in culture supernatant, add PEG8000 (worker is given birth in Shanghai, and final concentration is 7.1%) and NaCl (Shanghai life worker, final concentration is 2.7%); 4 ℃ of joltings are spent the night (16-20 hour), centrifugal 1 hour of 4 ℃ of 50000g, and deposition is with TNE buffer (the 10mM Tris of 1/100 volume; 1mM EDTA; 100mM NaCl, pH 8.0) resuspended, process concentrating virus liquid.
The preparation of TNE buffer is following: take by weighing 1.21g Tris (worker is given birth in Shanghai); 0.37g EDTA (worker is given birth in Shanghai) and 5.84gNaCl (worker is given birth in Shanghai) are in a large beaker; Add the 500ml dissolved in distilled water,, add zero(ppm) water to 1000ml with NaoH (worker is given birth in Shanghai) the adjusting pH value to 8.0 of 1M; Packing, 15 pounds of high pressure 15 minutes.
3. the density gradient centrifugation purifying of chimeric pseudovirion: according to different these facts of pseudovirion with residual cell fragment density; The employing density gradient centrifugation separates; Even cell debris is big or small identical with virus clone, in density gradient, also can it be separated.
(1) with 0.1M PBS is sucrose (worker is given birth in the Shanghai) solution of diluent preparing different concns: 57%, 55%, 53%, 50%, 40%, 30% (W/V) constant gradient solution 60%; Promptly take by weighing 60,57,55,53,50,40 respectively, 30g sucrose in the 100ml saline bottle, add 1M PBS solution (compound method is referring to the molecular cloning experiment guide) 10ml, add zero(ppm) water to 100ml, 10 pounds of high pressure 15 minutes, 4 ℃ of refrigerators are preserved.
(2) the special-purpose 15ml centrifuge tube of Beckman whizzer swing bucket rotor is 6, loads 60%, 57%, 55%, 53%, 50%, 40%, 30% sucrose solutions such as (W/V) respectively from high to low, and TV is 14ml altogether.And the lowest layer carries liquid (60% sucrose solution) and is no less than 4ml, is centrifuged to the pipe end to prevent virion.When adding every layer of liquid, add slowly along tube wall, it is good that obvious differentiation band is arranged between each layer.
(3) slowly add concentrating virus liquid on top layer, about 1ml has obvious differentiation band with 30% sucrose solution.
(4) centrifuge tube is packed in the sleeve, cover tight blind nut, hang on swing bucket rotor, insert whizzer, 4 ℃, the centrifugal 6h of 110000g.
(5) take out centrifuge tube, have or not in the differentiation band of each gradient sucrose of first visual inspection protein precipitation or obviously protein band occur, again with the 1ml syringe will distinguish in being with throw out gently sucking-off as sample.
(6) detect the pseudovirion purity and the amount of each district's band through Western blot, confirm the main negative area band of pseudovirus after, prepare the purifying pseudovirion in a large number ,-80 ℃ store for future use.
The experimentation on animals of embodiment 4 chimeric pseudovirus vaccines
For confirming the immune curative effect of chimeric pseudovirus, we have detected the provide protection of chimeric pseudovirus vaccine to BalB/c mouse opposing japanese encephalitis virus lethal hit.
Confirming of lethal hit virus quantity: for testing japanese encephalitis virus to the required virus quantity of BalB/c mouse lethal hit; At first will through viral plaque measurement (Schaechter ' sMechanisms of Microbial Disease; 4th edition; 2007, Engleberg, DiRita& Dermody.) japanese encephalitis virus Beijing-1 strain be diluted to 1 * 10 with PBS
3～1 * 10
7(plaque forming unit pfu), is expelled to the BalB/c mouse intracranial in 4 ages in week to pfu/ml, and 10 every group, 20 μ l/, negative control is used PBS.As a result, the injection 3 days after 1 * 10
5～1 * 10
7Pfu/ml injection groups mouse is all dead; 1 * 10
3The pfu/ml injection groups has 90% survival; 1 * 10
4The pfu/ml injection groups has 20% survival, finally confirms 1 * 10
5Pfu/ml is the righttest lethal dose.
Chimeric pseudovirion vaccine therapy scheme: the experiment be divided into 4 groups, 10 every group 4 the week age BalB/c mouse.
| Subcutaneous injection in first day | Inject back 14 days (subcutaneous) | Inject back 28 days (encephalic) | Injected back 35 days | |
| Normal control | PBS 500μl | PBS 500μl | PBS 20μl | The japanese encephalitis virus antibody test |
| The virus control group | PBS 500μl | PBS 500μl | 10 5The pfu japanese encephalitis virus | |
| The |
10
5The chimeric pseudovirion of |
10
5The chimeric pseudovirion of |
10 5The pfu japanese encephalitis virus | |
| The |
10
5The chimeric pseudovirion of |
10 5The chimeric pseudovirion of pfu | PBS 20μl | The japanese encephalitis virus antibody test |
Every mouse in vaccine control group and immune group is through subcutaneous injection 10
5The chimeric pseudovirion of pfu in injection back 14 days, injects 10 once more
5The chimeric pseudovirion of pfu is as supplementary immunization, and normal control group and virus control group are then injected the PBS damping fluid.In injection back 28 days, every intracranial injection of mouse 10 of virus control group and vaccine therapy group
5The japanese encephalitis virus of pfu is attacked, and normal control group and vaccine control group are then injected PBS.
1. the observation of chimeric pseudovirus immunity curative effect
(1) behind the injected in mice pseudovirion, observes growing state every day, states such as feed, activity, record death time.
(2), detect antibody titers in the mice serum with EUSA (ELISA) method (referring to the molecular cloning experiment guide) subcutaneous injection second time pseudovirus 21 days.
2. experimental result
(1) the pseudovirion vaccine is to the protection situation of mouse
We observe, and the virus control group is carrying out 10
5Pfu japanese encephalitis virus encephalic is attacked in back 3 days, none survival of mouse, and mortality ratio is 100%; After vaccine immunity group mouse was attacked by encephalitis in the day that receives same dosage, except that 1 in attacking death in back 4 days, all the other are all survived, protection ratio 90%.
(2) chimeric pseudovirus vaccine influence that mouse immune is replied
The antibody titer of Japanese ence phalitis Viruses in ELISA detection mice serum, the normal control group of the antibody titer of vaccine control group raises 16 times as a result.
| Serum antibody titer (ELISA) | |
| The |
1∶800 |
| The |
1∶12800 |
In this example, made up following II type dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine according to the described method of embodiment 1-3, its difference is that the length of II dengue virus E protein is different, and the efficient that produces pseudovirion is following:
| The length that keeps the E protein gene | Keep the proteic amino acid length of E | The length of disappearance E PROTEIN C-terminal amino acid | Can produce pseudovirion | Pseudovirus produces efficient |
| 1428 | 476 | 19 | Not | 0 |
| 1368 | 456 | 39 | Not | 0 |
| 1308 | 436 | 59 | Ability | 4.2×10 3 pfu/ml |
| 1248 | 416 | 79 | Ability | 9.4×10 5 pfu/ml |
| 1188 | 396 | 99 | Ability | 1.5×10 6 pfu/ml |
In the present embodiment; Made up I type dengue virus and Japanese encephalitis virus embedded pseudo virus particle recombinant expression plasmid by embodiment 1; Difference is only to use the preM/M gene of I type dengue virus and E protein gene (99 amino acid whose encoding sequences of disappearance C-end) to replace II type dengue virus; Adopt the method for embodiment 2 and 3 to prepare pseudovirion then, press the scheme administration that the vaccine immunity group is identical among the embodiment 4 again, carry out experimentation on animals.
As a result, back 14 days of 2 pseudovirions immunity with 10
5The japanese encephalitis virus of pfu is attacked, and protection ratio is 80%.
In the present embodiment; Earlier made up III type dengue virus and Japanese encephalitis virus embedded pseudo virus particle recombinant expression plasmid by the embodiment of the invention 1; Its difference is only to use the preM/M gene of III type dengue virus and E protein gene (99 amino acid whose encoding sequences of disappearance C-end) to replace II type dengue virus; Adopt the method for embodiment 2 and 3 to prepare pseudovirion then, press the scheme administration that the vaccine immunity group is identical among the embodiment 4 again, carry out experimentation on animals.
As a result, back 14 days of 2 pseudovirions immunity with 10
5The japanese encephalitis virus of pfu is attacked, and protection ratio is 75%.
In the present embodiment; Made up IV type dengue virus and Japanese encephalitis virus embedded pseudo virus particle recombinant expression plasmid according to embodiment 1 described method; Difference is only to use the preM/M gene of IV type dengue virus and E protein gene (99 amino acid whose encoding sequences of disappearance C-end) to replace II type dengue virus; Method by embodiment 2 and 3 prepares pseudovirion then, adopts the scheme administration that the vaccine immunity group is identical among the embodiment 4 again, carries out experimentation on animals.
As a result, back 14 days of 2 pseudovirions immunity with 10
5The japanese encephalitis virus of pfu is attacked, and protection ratio is 84%.
< 110>Military Medical Univ No.3, P.L.A
< 120>dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof
<130>100521
<140>20100421
<141>2010-04-21
<160>17
<170>PatentIn version 3.2
<210>1
<211>72
<212>DNA
< 213>japanese encephalitis virus
<400>1
atgggcaaga gatcggcggg ctcaatcatg tggctcgcaa gcttggcagt tgtcatagct 60
tacgcaggag ca 72
<210>2
<211>24
<212>PRT
< 213>japanese encephalitis virus
<400>2
Met Gly Lys Arg Ser Ala Gly Ser Ile Met Trp Leu Ala Ser Leu Ala
1 5 10 15
Val Val Ile Ala Cys Ala Gly Ala
20
<210>3
<211>48
<212>DNA
< 213>dengue virus II type
<400>3
atgagatctg caggcatgat cattatgctg attccaacag tgatggcg 48
<210>4
<211>57
<212>DNA
< 213>west Nile virus
<400>4
atgggaggaa agaccggaat tgcagtcatg attggcctga tcgccagcgt aggagca 57
<210>5
<211>59
<212>DNA
< 213>artificial sequence
<400>5
ataggctagc gccatgggca agagatcggc gggctcaatc atgtggctcg caagcttgg 59
<210>6
<211>58
<212>DNA
< 213>artificial sequence
<400>6
gcgtgtggtt aaatggaatg ctcctgcgta agctatgaca actgccaagc ttgcgagc 58
<210>7
<211>27
<212>DNA
< 213>dengue virus II type
<400>7
ttccatttaa ccacacgcaa cggagaa 27
<210>8
<211>29
<212>DNA
< 213>dengue virus II type
<400>8
tgtcattgaa ggagcgacag ctgtcagta 29
<210>9
<211>166
<212>PRT
< 213>dengue virus II type
<400>9
Phe His Leu Thr Thr Arg Asn Gly Glu Pro His Met Ile Val Ser Arg
1 5 10 15
Gln Asp Lys Gly Lys Ser Leu Leu Phe Lys Thr Lys Asp Gly Thr Asn
20 25 30
Met Cys Thr Leu Met Ala Met Asp Leu Gly Glu Leu Cys Glu Asp Thr
35 40 45
Ile Thr Tyr Lys Cys Pro Phe Leu Lys Gln Asn Glu Pro Glu Asp Ile
50 55 60
Asp Cys Trp Cys Asn Ser Thr Ser Thr Trp Val Thr Tyr Gly Thr Cys
65 70 75 80
Thr Thr Thr Gly Glu His Arg Arg Glu Lys Arg Ser Val Ala Leu Val
85 90 95
Pro His Val Gly Met Gly Leu Glu Thr Arg Thr Glu Thr Trp Met Ser
100 105 110
Ser Glu Gly Ala Trp Lys His Ala Gln Arg Ile Glu Thr Trp Ile Leu
115 120 125
Arg His Pro Gly Phe Thr Ile Met Ala Ala Ile Leu Ala Tyr Thr Ile
130 135 140
Gly Thr Thr His Phe Gln Arg Val Leu Ile Phe Ile Leu Leu Thr Ala
145 150 155 160
Val Ala Pro Ser Met Thr
165
<210>10
<211>22
<212>DNA
< 213>dengue virus II type
<400>10
agctgtcgct ccttcaatga ca 22
<210>11
<211>34
<212>DNA
< 213>artificial sequence
<400>11
gcgggaattc acttcctttc ttgaaccagt taag 34
<210>12
<211>396
<212>PRT
< 213>dengue virus II type
<400>12
Met Arg Cys Ile Gly Ile Ala Asn Arg Asp Phe Val Glu Gly Val Ser
1 5 10 15
Gly Gly Ser Trp Val Asp Ile Val Leu Glu His Gly Ser Cys Val Thr
20 25 30
Thr Met Ala Lys Asn Lys Pro Thr Leu Asp Phe Glu Leu Ile Lys Thr
35 40 45
Glu Ala Lys Gln Pro Ala Thr Leu Arg Lys Tyr Cys Ile Glu Ala Lys
50 55 60
Leu Thr Asn Thr Thr Thr Asp Ser Arg Cys Pro Thr Gln Gly Glu Pro
65 70 75 80
Ser Leu Asn Glu Glu Gln Asp Lys Arg Phe Val Cys Lys His Ser Met
85 90 95
Val Asp Arg Gly Trp Gly Asn Gly Cys Gly Leu Phe Gly Lys Gly Gly
100 105 110
Ile Val Thr Cys Ala Met Phe Thr Cys Lys Lys Asn Met Lys Gly Lys
115 120 125
Ile Val Gln Pro Glu Asn Leu Glu Tyr Thr Ile Val Ile Thr Pro His
130 135 140
Ser Gly Glu Glu His Ala Val Gly Asn Asn Thr Gly Lys His Gly Lys
145 150 155 160
Glu Val Lys Ile Thr Pro Gln Ser Ser Ile Thr Glu Ala Glu Leu Thr
165 170 175
Gly Tyr Gly Thr Val Thr Met Glu Cys Ser Pro Arg Thr Gly Leu Asp
180 185 190
Phe Asn Glu Met Val Leu Leu Gln Met Glu Asp Lys Ala Trp Leu Val
195 200 205
His Arg Gln Trp Phe Leu Asp Leu Pro Leu Pro Trp Leu Pro Gly Ala
210 215 220
Asp Thr Gln Gly Ser Asn Trp Ile Gln Lys Glu Thr Leu Val Thr Phe
225 230 235 240
Lys Asn Pro His Ala Lys Lys Gln Asp Val Val Val Leu Gly Ser Gln
245 250 255
Glu Gly Ala Met His Thr Ala Leu Thr Gly Ala Thr Glu Ile Gln Met
260 265 270
Ser Ser Gly Asn Leu Leu Phe Thr Gly His Leu Lys Cys Arg Leu Arg
275 280 285
Met Asp Lys Leu Gln Leu Lys Gly Met Ser Tyr Ser Met Cys Thr Gly
290 295 300
Lys Phe Lys Val Val Lys Glu Ile Ala Glu Thr Gln His Gly Thr Ile
305 310 315 320
Val Ile Arg Val Gln Tyr Glu Gly Asp Gly Ser Pro Cys Lys Ile Pro
325 330 335
Phe Glu Ile Met Asp Leu Glu Lys Arg His Val Leu Gly Arg Leu Ile
340 345 350
Thr Val Asn Pro Ile Val Thr Glu Lys Asp Arg Pro Val Asn Ile Glu
355 360 365
Ala Glu Pro Pro Phe Gly Asp Ser Tyr Ile Ile Ile Gly Val Glu Pro
370 375 380
Gly Gln Leu Lys Leu Asn Trp Phe Lys Lys Gly Ser
385 390 395
<210>13
<211>34
<212>DNA
< 213>artificial sequence
<400>13
gggcgaattc atgtgtacag aaaaattctc gttc 34
<210>14
<211>34
<212>DNA
< 213>artificial sequence
<400>14
gacctctaga tcaagcatgc acattggtcg ctaa 34
<210>15
<211>198
<212>PRT
< 213>japanese encephalitis virus
<400>15
Met Cys Thr Glu Lys Phe Ser Phe Ala Lys Asn Pro Ala Asp Thr Gly
1 5 10 15
His Gly Thr Val Val Ile Glu Leu Ser Tyr Ser Gly Ser Asp Gly Pro
20 25 30
Cys Lys Ile Pro Ile Val Ser Val Ala Ser Leu Asn Asp Met Thr Pro
35 40 45
Val Gly Arg Leu Val Thr Val Asn Pro Phe Val Ala Thr Ser Ser Ala
50 55 60
Asn Ser Lys Val Leu Val Glu Met Glu Pro Pro Phe Gly Asp Ser Tyr
65 70 75 80
Ile Val Val Gly Arg Gly Asp Lys Gln Ile Asn His His Trp His Lys
85 90 95
Ala Gly Ser Thr Leu Gly Lys Ala Phe Ser Thr Thr Leu Lys Gly Ala
100 105 110
Gln Arg Leu Ala Ala Leu Gly Asp Thr Ala Trp Asp Phe Gly Ser Ile
115 120 125
Gly Gly Val Phe Asn Ser Ile Gly Lys Ala Val His Gln Val Phe Gly
130 135 140
Gly Ala Phe Arg Thr Leu Phe Gly Gly Met Ser Trp Ile Thr Gln Gly
145 150 155 160
Leu Met Gly Ala Leu Leu Leu Trp Met Gly Val Asn Ala Arg Asp Arg
165 170 175
Ser Ile Ala Leu Ala Phe Leu Ala Thr Gly Gly Val Leu Val Phe Leu
180 185 190
Ala Thr Asn Val His Ala
195
<210>16
<211>784
<212>PRT
< 213>artificial sequence
<400>16
Met Gly Lys Arg Ser Ala Gly Ser Ile Met Trp Leu Ala Ser Leu Ala
1 5 10 15
Val Val Ile Ala Tyr Ala Gly Ala Phe His Leu Thr Thr Arg Asn Gly
20 25 30
Glu Pro His Met Ile Val Ser Arg Gln Asp Lys Gly Lys Ser Leu Leu
35 40 45
Phe Lys Thr Lys Asp Gly Thr Asn Met Cys Thr Leu Met Ala Met Asp
50 55 60
Leu Gly Glu Leu Cys Glu Asp Thr Ile Thr Tyr Lys Cys Pro Phe Leu
65 70 75 80
Lys Gln Asn Glu Pro Glu Asp Ile Asp Cys Trp Cys Asn Ser Thr Ser
85 90 95
Thr Trp Val Thr Tyr Gly Thr Cys Thr Thr Thr Gly Glu His Arg Arg
100 105 110
Glu Lys Arg Ser Val Ala Leu Val Pro His Val Gly Met Gly Leu Glu
115 120 125
Thr Arg Thr Glu Thr Trp Met Ser Ser Glu Gly Ala Trp Lys His Ala
130 135 140
Gln Arg Ile Glu Thr Trp Ile Leu Arg His Pro Gly Phe Thr Ile Met
145 150 155 160
Ala Ala Ile Leu Ala Tyr Thr Ile Gly Thr Thr His Phe Gln Arg Val
165 170 175
Leu Ile Phe Ile Leu Leu Thr Ala Val Ala Pro Ser Met Thr Met Arg
180 185 190
Cys Ile Gly Ile Ala Asn Arg Asp Phe Val Glu Gly Val Ser Gly Gly
195 200 205
Ser Trp Val Asp Ile Val Leu Glu His Gly Ser Cys Val Thr Thr Met
210 215 220
Ala Lys Asn Lys Pro Thr Leu Asp Phe Glu Leu Ile Lys Thr Glu Ala
225 230 235 240
Lys Gln Pro Ala Thr Leu Arg Lys Tyr Cys Ile Glu Ala Lys Leu Thr
245 250 255
Asn Thr Thr Thr Asp Ser Arg Cys Pro Thr Gln Gly Glu Pro Ser Leu
260 265 270
Asn Glu Glu Gln Asp Lys Arg Phe Val Cys Lys His Ser Met Val Asp
275 280 285
Arg Gly Trp Gly Asn Gly Cys Gly Leu Phe Gly Lys Gly Gly Ile Val
290 295 300
Thr Cys Ala Met Phe Thr Cys Lys Lys Asn Met Lys Gly Lys Ile Val
305 310 315 320
Gln Pro Glu Asn Leu Glu Tyr Thr Ile Val Ile Thr Pro His Ser Gly
325 330 335
Glu Glu His Ala Val Gly Asn Asn Thr Gly Lys His Gly Lys Glu Val
340 345 350
Lys Ile Thr Pro Gln Ser Ser Ile Thr Glu Ala Glu Leu Thr Gly Tyr
355 360 365
Gly Thr Val Thr Met Glu Cys Ser Pro Arg Thr Gly Leu Asp Phe Asn
370 375 380
Glu Met Val Leu Leu Gln Met Glu Asp Lys Ala Trp Leu Val His Arg
385 390 395 400
Gln Trp Phe Leu Asp Leu Pro Leu Pro Trp Leu Pro Gly Ala Asp Thr
405 410 415
Gln Gly Ser Asn Trp Ile Gln Lys Glu Thr Leu Val Thr Phe Lys Asn
420 425 430
Pro His Ala Lys Lys Gln Asp Val Val Val Leu Gly Ser Gln Glu Gly
435 440 445
Ala Met His Thr Ala Leu Thr Gly Ala Thr Glu Ile Gln Met Ser Ser
450 455 460
Gly Asn Leu Leu Phe Thr Gly His Leu Lys Cys Arg Leu Arg Met Asp
465 470 475 480
Lys Leu Gln Leu Lys Gly Met Ser Tyr Ser Met Cys Thr Gly Lys Phe
485 490 495
Lys Val Val Lys Glu Ile Ala Glu Thr Gln His Gly Thr Ile Val Ile
500 505 510
Arg Val Gln Tyr Glu Gly Asp Gly Ser Pro Cys Lys Ile Pro Phe Glu
515 520 525
Ile Met Asp Leu Glu Lys Arg His Val Leu Gly Arg Leu Ile Thr Val
530 535 540
Asn Pro Ile Val Thr Glu Lys Asp Arg Pro Val Asn Ile Glu Ala Glu
545 550 555 560
Pro Pro Phe Gly Asp Ser Tyr Ile Ile Ile Gly Val Glu Pro Gly Gln
565 570 575
Leu Lys Leu Asn Trp Phe Lys Lys Gly Ser Met Cys Thr Glu Lys Phe
580 585 590
Ser Phe Ala Lys Asn Pro Ala Asp Thr Gly His Gly Thr Val Val Ile
595 600 605
Glu Leu Ser Tyr Ser Gly Ser Asp Gly Pro Cys Lys Ile Pro Ile Val
610 615 620
Ser Val Ala Ser Leu Asn Asp Met Thr Pro Val Gly Arg Leu Val Thr
625 630 635 640
Val Asn Pro Phe Val Ala Thr Ser Ser Ala Asn Ser Lys Val Leu Val
645 650 655
Glu Met Glu Pro Pro Phe Gly Asp Ser Tyr Ile Val Val Gly Arg Gly
660 665 670
Asp Lys Gln Ile Asn His His Trp His Lys Ala Gly Ser Thr Leu Gly
675 680 685
Lys Ala Phe Ser Thr Thr Leu Lys Gly Ala Gln Arg Leu Ala Ala Leu
690 695 700
Gly Asp Thr Ala Trp Asp Phe Gly Ser Ile Gly Gly Val Phe Asn Ser
705 710 715 720
Ile Gly Lys Ala Val His Gln Val Phe Gly Gly Ala Phe Arg Thr Leu
725 730 735
Phe Gly Gly Met Ser Trp Ile Thr Gln Gly Leu Met Gly Ala Leu Leu
740 745 750
Leu Trp Met Gly Val Asn Ala Arg Asp Arg Ser Ile Ala Leu Ala Phe
755 760 765
Leu Ala Thr Gly Gly Val Leu Val Phe Leu Ala Thr Asn Val His Ala
770 775 780
<210>17
<211>2355
<212>DNA
< 213>artificial sequence
<400>17
atgggcaaga gatcggcggg ctcaatcatg tggctcgcaa gcttggcagt tgtcatagct 60
tacgcaggag cattccattt aaccacacgc aacggagaac cacacatgat tgtcagcaga 120
caggataaag ggaaaagcct tctgtttaag acaaaggatg gcacgaacat gtgtaccctc 180
atggccatgg accttggtga attgtgtgaa gacacaatca cgtataaatg tccctttctc 240
aagcagaacg aaccagaaga catagattgt tggtgcaact ccacgtccac atgggtaact 300
tatgggacgt gcacaaccac aggagagcac agaagagaaa aaagatcagt agcgctcgtt 360
ccacatgtgg gaatgggatt ggagacacga actgaaacat ggatgtcatc agaaggagcc 420
tggaaacatg cccagagaat tgaaacttgg atcctgagac atccaggctt taccataatg 480
gcagcaatcc tggcatacac cataggaacg acacatttcc aaagagtcct gattttcatc 540
ctactgacag ctgtcgctcc ttcaatgaca atgcgctgta taggaatagc aaatagggac 600
ttcgtggaag gggtttcagg aggaagctgg gttgacatag tcttagaaca cggaagctgt 660
gtgacgacga tggcaaaaaa caaaccaaca ctggactttg aactgataaa aacagaagcc 720
aaacaacccg ccactctaag gaagtactgc atagaggcta agctgaccaa cacgacaaca 780
gattcgcgct gcccaacaca aggggaacct agcctgaatg aagagcagga caaaaggttt 840
gtctgcaaac attctatggt agacagagga tggggaaatg gatgcggatt gtttggaaaa 900
ggaggcatcg tgacctgtgc tatgttcaca tgcaaaaaga atatgaaagg aaaaattgtg 960
cagccagaaa acttggaata caccatcgtg ataacacctc actcagggga agaacatgca 1020
gtcggaaata acacaggaaa acatggcaag gaagtcaaaa taacaccaca gagctccatc 1080
acagaagcgg aactgacagg ctatggcact gttacgatgg agtgctctcc gagaacgggc 1140
ctcgacttca atgagatggt gttgctgcaa atggaagata aagcttggct ggtgcacaga 1200
caatggttcc tagacctgcc gttaccatgg ctgcccggag cagatacaca aggatcaaat 1260
tggatacaga aagagacatt ggtcactttc aaaaatcccc atgcaaaaaa acaggatgtt 1320
gttgtcttag gatcccaaga gggggccatg cacacagcac tcacaggggc tacggaaatc 1380
cagatgtcat caggaaacct actgttcaca ggtcatctta agtgcaggct gagaatggac 1440
aaactacagc ttaaagggat gtcatactct atgtgtacag ggaagtttaa agtcgtgaag 1500
gaaatagcag aaacacaaca tggaacaata gtcattagag tacaatatga aggagacggc 1560
tctccatgca agatcccttt tgagataatg gatctggaaa aaagacatgt cttaggtcgt 1620
ctgattacag tcaacccaat tgtaacagaa aaggacaggc cagtcaacat agaagcagaa 1680
cctccattcg gagacagcta cattatcata ggagtggagc cgggacaact gaagcttaac 1740
tggttcaaga aaggaagtat gtgtacagaa aaattctcgt tcgcgaaaaa tccggcggac 1800
actggccacg gaacagttgt cattgaacta tcctactctg ggagtgatgg cccctgcaaa 1860
attccgattg tctccgttgc gagcctcaat gacatgaccc ccgttgggcg gctggtgaca 1920
gtgaaccctt tcgtcgcgac ttccagtgcc aactcaaagg tgctggtcga gatggaaccc 1980
cccttcggag actcctacat cgtggttggg aggggagaca agcagatcaa ccaccattgg 2040
cacaaagctg gaagcacgct aggcaaggcc ttttcaacaa ctttgaaggg agctcaaaga 2100
ctggcagcgt tgggcgacac agcctgggac tttggctcca ttggaggggt cttcaactcc 2160
ataggaaaag ccgttcacca agtgtttggt ggtgccttca gaacactctt tgggggaatg 2220
tcttggatca cacaagggct aatgggtgcc ctactactct ggatgggcgt caacgcacga 2280
gaccgatcaa ttgctttggc cttcttagcc acaggaggtg tgctcgtgtt cttagcgacc 2340
aatgtgcatg cttga 2355
Claims (9)
1. dengue virus (Dengue virus; DV) and japanese encephalitis virus (Japanese encephalitis virus; JEV) recombinant expression plasmid of chimeric pseudovirus is characterized in that: contain the chimeric encoding sox be made up of following elements in the described expression plasmid:
A) Flavivirus signal coding sequence;
B) the preM/M coding region of dengue virus;
C) preceding 396 the amino acid whose coding regions of dengue virus E protein;
D) 198 amino acid whose coding regions behind the japanese encephalitis virus E albumen;
Said chimeric fgs encoder gene is pressed the order series connection of a-b-c-d by inserting element.
2. the recombinant expression plasmid of dengue virus according to claim 1 and the chimeric pseudovirus of japanese encephalitis virus is characterized in that: said recombinant expression plasmid is to be made up by plasmid pcDNA3.1 or pcDNA6.0 or pCIneo (+) or pReceive r to form.
3. the recombinant expression plasmid of dengue virus according to claim 1 and the chimeric pseudovirus of japanese encephalitis virus; It is characterized in that: the Flavivirus signal coding sequence of said chimeric encoding sox is selected from: the nucleotide sequence of the coding japanese encephalitis virus preM/M signal peptide shown in the SEQ ID NO:1; The nucleotide sequence of the coding II type dengue virus preM/M signal peptide shown in the SEQ ID NO:3, the nucleotide sequence of the coding west Nile virus preM/M signal peptide shown in the SEQ ID NO:4.
4. the recombinant expression plasmid of dengue virus according to claim 1 and the chimeric pseudovirus of japanese encephalitis virus is characterized in that: described dengue virus is dengue virus serotype I or II or III or IV type.
5. chimeric pseudovirion, it is characterized in that: the chimeric protein self-assembly by expressing behind the described recombinant expression plasmid transfection of claim 1 target cell forms, and does not contain any Nucleotide.
6. chimeric pseudovirion according to claim 5 is characterized in that: described target cell comprises the BHK21 that derives from Eukaryotic continuous cell line or 293 or 293T or Cos or Hela.
7. dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine, it is characterized in that: it contains the described chimeric pseudovirion of claim 6 and pharmaceutically acceptable adjuvant or carrier.
8. the described chimeric pseudovirion of claim 5 is used for preventing the purposes of singapore hemorrhagic fever and/or Japanese encephalitis medicine in preparation.
9. the preparation method of a chimeric pseudovirion is characterized in that following steps are arranged:
1) the described recombinant expression plasmid that contains dengue virus and japanese encephalitis virus structural protein encoding sequence of claim 1 is imported target cell;
2) when described transfection target cell is expressed dengue virus and japanese encephalitis virus structural protein, the corresponding microbiotic of resistant gene that carries with plasmid screens transfectional cell, obtains the cell clone of stable transfection;
3) cell of cultivation stable transfection produces dengue virus and the chimeric pseudovirion of japanese encephalitis virus;
4) reclaim chimeric pseudovirion.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102126025A CN101899466B (en) | 2010-06-29 | 2010-06-29 | Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102126025A CN101899466B (en) | 2010-06-29 | 2010-06-29 | Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101899466A CN101899466A (en) | 2010-12-01 |
| CN101899466B true CN101899466B (en) | 2012-05-23 |
Family
ID=43225385
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102126025A Active CN101899466B (en) | 2010-06-29 | 2010-06-29 | Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101899466B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102127554B (en) * | 2010-12-22 | 2012-07-25 | 南京农业大学 | Japanese encephalitis particle vaccine and preparation method and application thereof |
| CN102363751A (en) * | 2011-03-24 | 2012-02-29 | 中山大学 | Dengue virus (DENV)-like particle as well as preparation method and application thereof |
| CN102199617A (en) * | 2011-05-03 | 2011-09-28 | 中国人民解放军第三军医大学 | Dengue virus subunit vaccine and preparation method thereof |
-
2010
- 2010-06-29 CN CN2010102126025A patent/CN101899466B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| 庄敏，等.病毒嵌合疫苗的研究进展.《国外医学免疫学分册》.2007,第27卷(第3期),137－141. * |
| 李静,等.分子生物学技术在黄病毒属病毒疫苗研制中的应用及该类疫苗的研究进展.《中国生物制品学杂志》.2009,第22卷(第1期),88-93. * |
| 胡珍，等.双价D-J假病毒真核表达载体的构建.《重庆微生物学会第九届会员代表大会暨学术年会（论文摘要集）》.2009,38. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101899466A (en) | 2010-12-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Martínez-Flores et al. | SARS-CoV-2 vaccines based on the spike glycoprotein and implications of new viral variants | |
| Ikegami et al. | Rift valley fever vaccines | |
| CN102101888B (en) | Novel polypeptide for resisting tumors caused by EB (Epstein-Barr) viruses, and application and preparation method thereof | |
| KR20140096343A (en) | Vaccines directed against human enteroviruses | |
| EP1633853A2 (en) | Severe acute respiratory syndrome dna vaccine compositions and methods of use | |
| CN115190911B (en) | Composition having immunogenicity against SARS coronavirus 2, its preparation method and use | |
| CN107406856A (en) | Hand, foot and mouth vaccine and its method of preparation and use | |
| CN110325206A (en) | For managing the polypeptide of virus infection | |
| CN111556896A (en) | Cross immunity antigen vaccine and its preparation method | |
| CN101899466B (en) | Dengue virus and Japanese encephalitis virus embedded pseudo virus particle vaccine and preparation method thereof | |
| EP3481848A1 (en) | Genomic sequences encoding for an attenuated mutant zika virus | |
| WO2014210358A1 (en) | Methods and compositions for dengue virus vaccines | |
| CN101879312A (en) | Broad spectrum type influenza vaccine and preparation method thereof | |
| CN101293098A (en) | Recombined cattle O type foot and mouth disease virus amalgamation protein vaccine | |
| CN113862284A (en) | Gene for coding recombinant avian influenza virus HA protein, virus-like particle, vaccine, preparation and application | |
| CN103667199B (en) | The method of external preparation rotavirus bilayer viruslike particle | |
| CN100519583C (en) | SARS neutralization antibody and application | |
| US20230321219A1 (en) | SEVERE ACUTE RESPIRATORY SYNDROME CORONAVIRUS [SARS-CoV-2]-VIRUS-LIKE PARTICLE [VLP] VACCINE: COMPOSITIONS, DELIVERY STRATEGIES, METHODS AND USES | |
| CN117305329A (en) | Monkey poxvirus nucleic acid vaccine and application thereof | |
| CN102516394B (en) | CMG 2mutant and Fc fusion protein, its encoding gene and its application | |
| CN103374549A (en) | Novel EV71 virus strain and application thereof | |
| CN102787119A (en) | Products and methods for treatment and/or prevention of virus infections | |
| CN101611144B (en) | Recombinant viral proteins and particles | |
| CN102199617A (en) | Dengue virus subunit vaccine and preparation method thereof | |
| CN105400799B (en) | A kind of hot embedded virus of encephalitis/Huang and its preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |