CN101899438A

CN101899438A - Multiplex PCR primer for amplifying human EGFR gene and design method thereof

Info

Publication number: CN101899438A
Application number: CN2010101482997A
Authority: CN
Inventors: 陈超; 饶文波; 姬婧; 朱娟莉; 宗廷勇; 李颖; 朱雅清; 訾静; 张健; 杨莎莎; 王惠惠; 张锦超; 边婷
Original assignee: SHAANXI BEIMEI GENE CO Ltd
Current assignee: Shaanxi Bai Mei Medical Inspection Co., Ltd.
Priority date: 2010-04-16
Filing date: 2010-04-16
Publication date: 2010-12-01
Anticipated expiration: 2030-04-16
Also published as: CN101899438B

Abstract

The invention relates to a multiplex polymerase chain reaction (PCR) primer for amplifying a human epidermal growth factor receptor (EGFR) gene and a design method thereof. The design method comprises the following steps of: 1, designing a primer library of the human EGFR genes by using primer design software; 2, screening the primers in the primer library; 3, judging advantage and disadvantage of competitiveness of retained primers, performing the step 4 for the primers with competitiveness disadvantage, and performing the step 5 for the primers with competitiveness advantage; step 4, rescreening the primers with competitiveness disadvantage; 5, amplifying the primers with competitiveness advantage by using a term-PCR method; and 6, removing redundant primers in amplification primers to obtain the multiplex PCR primer. In the invention, the technical problems of segment loss, low amplification efficiency and complex amplification system existing in the design method of the conventional primer are solved; and the primer and the design method have the advantages of reducing the phenomenon of segment loss in the multiplex PCR system and optimally utilizing the resource.

Description

A kind of multiple PCR primer of amplifying human EGFR gene and method of design thereof

Technical field

(Epidermal growth factor receptor, EGFR) the multiplex PCR field of gene are specifically related to a kind of multiple PCR primer and method thereof of human EGFR gene to the present invention relates to human epidermal growth factor EGFR.

Background technology

(non-small cell lung cancers NSCLC) is one of modal malignant tumour in the world today to nonsmall-cell lung cancer, although operation and chemotherapy technology improve constantly, advanced lung cancer patient's prognosis is still very poor.Along with the raising of molecular engineering, produced antitumor drug in recent years at molecular target.These medicines are with strong points, killing tumor cell that can be special, and effect is remarkable.Wherein with EGF-R ELISA (Epidermal growth factor receptor, EGFR) be that the molecular targeted treatment junket cancer propylhomoserin kinase inhibitor of target spot is outstanding day by day in nonsmall-cell lung cancer treatment, this class targeted drug is called tyrosine kinase inhibitor (tyrosine kinases inhibitor, TKI), Gefitinib (Gefitibib wherein, commodity are called Iressa) and erlotinib (Erlotinib, commodity are called Tarceva) treatment extensively promote in a plurality of countries.Yet in the clinical trial and treatment of Gefitibib and Erlotinib, only some NSCLC crowd responds to medicine.Find in the research nearly all there being the somatic mutation of EGFR gene among the patient of medicaments insensitive, therefore research pay attention to day by day suddenling change.With the EGFR receptor tyrosine kinase is a kind of new selection that the target spot antitumor drug has become the advanced lung cancer treatment, and studies show that women, non-smoking, gland cancer, asian patients EGFR gene mutation rate height, therefore molecular targeted dependency and be the center of optimizing the lung cancer molecular therapy to patient's individualized treatment, therefore be the key of selecting reasonable chemotherapy to patient's the EGFR gene sequencing and the detection of transgenation, avoid the patient is used invalid powerful medicine and expensive therapeutic trial.Because EGFR can activate Tyrosylprotein kinase, thereby opens the downstream signal path.Therefore, EGFR becomes an especially important target spot of nonsmall-cell lung cancer targeted therapy research of tumour.Discover the coding region of some lung cancer patient EGFR genes in recent years in a large number, mainly be on exon 18-21, can undergo mutation, and these sudden changes are relevant with the clinical efficacy of medicines such as Gefitinib and erlotinib, promptly relevant with drug responsiveness, reason may be because these sudden changes have changed the structure of ATP-binding domain in the EGFR born of the same parents, has improved the binding ability of EGFR to Gefitinib.Though these targeted drugs cost an arm and a leg to some crowd's curative effect very much,, not only delay the waste that the state of an illness also causes huge expenses for medicine if patient does not carry the EGFR sudden change and takes this type of medicine.Therefore, whether carry the EGFR transgenation medication fore worker inspection survey patient and seem particularly important, it is an important auxiliary means of clinical nonsmall-cell lung cancer diagnoses and treatment, the accurate validity of predictive molecule targeted drug treatment, be convenient to clinical accurate medication, significantly improve curative effect of medication, patient is benefited to greatest extent, the patient medical expense that can avoid simultaneously non-rational use of drug to cause increases and the waste of social medical resource, reducing the timeliness loss and the financial loss of unnecessary treatment, also is the developing direction of following tumour individualized treatment.So how detecting these EGFR transgenations relevant with drug responsiveness rapidly and accurately becomes people and cultivates problem to be solved.EGFR transgenation and Gefitinib clinical efficacy have certain dependency, indexs such as the progression of disease time of EGFR mutant and overall survival rate all significantly are better than wild-type, prompting mutant patient is better through the prognosis of pharmacological agent, and disclosing the EGFR transgenation is the principal element that influences prognosis.The EGFR gene is positioned at the short arm of a chromosome 7p12-14 district No. 7, is made up of 28 exons.Its Tyrosylprotein kinase functional zone are by exons 1 8-24 coding, and the EGFR transgenation of Fa Xianing＞90% is positioned at exons 1 9-21 up to now.Most (85.9%) EGFR transgenations occur in

exons

19 and 21, and wherein occurring in exons 19,44.2% above half (55.8%) transgenation is exon 21 transgenation.Exons 19 base deletions mainly are the base deletion sudden changes of 746-752 bit codon, and the point mutation of exon 21 mainly is that the T-G conversion appears in the 851st bit codon.Therefore need only 18-21exon is all increased, just can be for any one provides template with the detection of the relevant sudden change of treatment nonsmall-cell lung cancer on the EGFR gene.

Polymerase chain reaction (Polymerase Chain Reaction is called for short PCR) is the method for a kind of external rapid amplifying DNA, is used to amplify specific dna fragmentation, can make the increase Protocols in Molecular Biologies of millions of copies of target gene fragment in a few hours.A reaction often has 25-35 circulation, and a circulation comprises 3 steps, and at first making the template DNA two strands is strand 94-95 ℃ of sex change, then at a lower temperature, primer is combined, then under the effect of the guiding of primer and Taq enzyme, in 72 ℃ of synthetic template DNA complementary strands with template.Can regard the outer special dna replication dna of organism as.General PCR only uses a pair of primer, produces a nucleic acid fragment by pcr amplification.Multiplex PCR (multiplex PCR), claim multi-primers PCR or composite PCR again, it is to add primer more than two pairs in same PCR reaction system, amplifies the PCR reaction of a plurality of nucleic acid fragments simultaneously, its reaction principle, reaction reagent is identical with general PCR with operating process.Multiplex PCR is improved on the basis of regular-PCR, adds Auele Specific Primer in a PCR reaction system, at the different zones of a plurality of dna profilings or the same template segmental round pcr of a plurality of purposes that increases.In primary first-order equation, just can increase simultaneously a plurality of target sequences of a gene of multiplex PCR.Therefore, utilize the primer collection of the every kind of target sequence that can increase, just can pass through a plurality of target sequences of single pcr amplification.Multiplex PCR is just to be proposed by Chamberlain 1988 at first, within these short 22 days, and the application that it has been succeeded in a plurality of fields of DNA detection.Specifically comprise: it is polymorphic to detect transgenation, disappearance etc., quantitative test (realtimePCR), reverse transcription PCR.Henegariu has designed multiplex PCR in 1997 and has optimized agreement step by step, how to instruct the reaction system of multiplex PCR.But the problem of multiplex PCR maximum still is present on the primer design.Compare with general PCR, multiplex PCR amplifies all drug metabolism genes involved fragments (EFGR 18exon, 19exon, 20exon, 21exon) of EGFR simultaneously in same PCR reaction tubes, the disposable amplification of finishing template is for the downstream gene somatotype detects service.The systematicness of multiplex PCR is mainly reflected in it can disposablely according to demand amplify all genes involveds.In the present invention, 4 exons have covered all drug metabolism genes involveds of EGFR; Detect simultaneously in same reaction tubes, will save time greatly, save reagent, the reduction of expenditure spending provides more diagnostic messages more accurately for clinical; Detecting all sites only needs one amount to get final product, and the sample of saves valuable is realized trace detection so in a large number.Because it is consistent that the design of primers of multiplex PCR requires to follow the primer of general PCR generally.As, primer itself can not have stable secondary structure (hair clip and dimer), between the primer stable secondary structure or the like can not be arranged.But multiplex PCR will be put the primer more than two pairs together, and amplifies all purpose fragments, and this has higher requirement again to primer, the interaction between the primer is required strict more.This is not the problem of " 1+1=2 ", often is " 1+1＜2 ".Because often be to increase can both well work when segmental each primer of purpose increases separately, amplify band purpose fragment clearly, band just occurs when still mixing and lose phenomenon.Also have competitive relation between each primer, surging primer may be covered the weak tendency primer, causes fragment loss.What is more, and primer interacts and produces serious primer dimer, and basic amplification does not go out the fragment of clauses and subclauses.

Xu Dingbang has invented " a kind of PCR method of omnipotent primer and reaction solution thereof and the application in multiplex PCR " in 2004, the patent No. is: 02160387.1.He with the design of primers of multiplex PCR is: with a pair of 3 ' zone and the leading primer of template complementary, the omnipotent primer identical with a pair of and leading primer 5 ' zone increases in same PCR reaction.The problem that amplification efficiency is subjected to primer and the influence of template joint efficiency can be solved like this, the design of multiple PCR primer can be applied to.But this technical scheme all is high Tm value at universal primer with above the leading selection of primers, may only be suitable for the goal gene that he increased---exciting sphaeroprotein of people and glyceraldehyde-3-phosphate dehydrogenase (G3PDH).Reaction system is more complicated also, comprises in the multiplex PCR system: a pair of 3 ' zones and the identical omnipotent primer of leading primer of template complementary and a pair of and leading primer 5 ' zone.Though the result to multiplex PCR increases, the necessity of the existence of omnipotent primer remains to be discussed very much.

And applicant Jian Han invented a kind of better multiple PCR method on the basis in above-mentioned patent in 2006---and " The Templex PCR " (complexity-PCR, tem-PCR).Its principle as shown in Figure 1.Fig. 1 (A): in order to improve the segmental efficient of PCR amplifying target genes in initial cycle, tem-PCR has designed the slot type primer of gene specific.The primer full name is among Fig. 1: and the outside, upstream primer (Fo, forwardout); The inboard primer (Fi, forward in) in upstream; Downstream interior side primer (Ri, reverse in); The outside, downstream primer (Ro, reverse out); Upstream universal primer (FS, forward SuperPrimer); Downstream universal primer (RS, reverse SuperPrimer).

Reference:

1、Jian?Han，David?C.Swan，Sharon?J.Smith，et?al.Simultaneous?Amplification?and?Identification?of?25?HumanPapillomavirus?Types?with?Templex?Technology[J].JOURNAL?OF?CLINICAL?MICROBIOLOGY.2006，44(11)：4157-4162.

2、Han?J.Molecular?Differential?Diagnoses?of?Infectious?Diseases：Is?the?Future?Now？[A].AdvancedTechnologies?in?Diagnostic?Microbiology.Advanced?Technologies?in?Diagnostic?Microbiology[C].New?York.Springer?Publishing?Company，2006：472-504.

3、John?Brunstein，Eva?Thomas.Direct?Screening?of?Clinical?Specimens?for?Multiple?Respiratory?PathogensUsing?the?Genaco?Respiratory?Panels?1?and?2[J].Diagn?Mol?Pathol.2006，15(3)：169-173.

4、Haijing?Li，Melinda?A.McCormac，R.Wray?Estes，et?al.Simultaneous?Detection?and?High-ThroughputIdentification?of?a?panel?of?RNA?viruses?Causing?Respiratory?Tract?Infections.[J].Journal?of?ClinicalMicrobiology.2007，45(7)：2105-2109.

5、Shumei?Zou，Jian?Han，Leying?Wen，et?al.Human?Influenza?A?Virus(H5N1)Detection?by?a?Novel?MultiplexPCR?Typing?Method[J].Journal?of?Clinical?Microbiology.2007，45(6)：1889-1892.

The primer that Fig. 1 (B) is different is being brought into play different effects respectively at the three phases of tem-PCR.The tem-PCR the first step is the enrichment stage, adopts the gene-specific primer of lower concentration to seek template with the sufficiently long time.The segmental amplification situation of each purpose depends in fact which primer is used.May there be four kinds of amplified production: Fo/Ro altogether, Fi/Ro, Fi/Ri, and Fo/Ri.The enrichment stage generally needs 10 circulations.Tem-PCR second step is a marking phase, and at this moment annealing temperature is brought up to 72 ℃, have only about 40 bases inboard primer (Fi and Ri) can work.After 10 circulations, the final stage of marking phase, all PCR products all are labeled the universal primer sequence.At last, the 3rd step of tem-PCR is the amplification stage, and the universal primer of high density is being brought into play significant feature in this step, is used for the sequence of rapid amplifying tape label.

Tem-PCR is except having a pair of 3 ' zone and the leading primer of template complementary (also just being equivalent to Fi, Ri among Fig. 1) the omnipotent primer (Fs, the Rs that also just are equivalent to Fig. 1) identical with a pair of and leading primer 5 ' zone as Xu Dingbang, also there is a pair of slot type primer (the just Fo of last figure, Ro) in side outside leading primer (Fi, Ri) pairing region.Gene fragment of every like this amplification just needs 4 with template paired primer and a pair of universal primer.The 4 kinds of situations that just have these 4 primers make up in twos that (Fi/Ri Fo/Ri) becomes the upstream and downstream primer amplification to go out to comprise required target gene fragment for Fo/Ro, Fi/Ro.Than the independent situation of Xu Dingbang, this design has increased the probability that amplifies goal gene greatly, and reduces the possibility of fragment loss.Be particularly suitable for the segmental multiplex PCR amplification of a large amount of unknown purposes.But there is the bulk redundancy primer in tem-PCR system complexity in the system; Article 4, primer (Fi, Ri, Fo, Ro) two are combined into the upstream and downstream primer, though there are 4 kinds of situations to occur in theory, in fact may have only dominant a pair of primer to have an effect; The cost height, the required primer that detects each site is the twice of general PCR.In addition, Jian Han says Fi, Ri, and Fo, the solubility of Ro is low as far as possible, reduces the influence of background signal, but it is unclear to hang down what degree on earth; Exist too many various primers in the reaction system, unfavorable to the gene type in downstream, experiment such as quantitative.Generally speaking, the method for tem-PCR method and Xu Dingbang is not suitable for the multiplex PCR of a small amount of gene fragment.

Summary of the invention

There are fragment loss, low, the amplification system complicated technology problem of amplification efficiency in the primer design method for the multiplex PCR that solves amplifying human EGFR gene, the invention provides a kind of multiple PCR primer and method of design thereof of amplifying human EGFR gene.

Technical solution of the present invention:

A kind of primer of multiplex PCR of amplifying human EGFR gene, the sequence of described primer is:

A kind of method of design of multiple PCR primer of amplifying human EGFR gene, this method may further comprise the steps:

Step 1] utilize that the primer storehouse of primer-design software design human EGFR gene, the base number of described primer primer that the storehouse comprises are that 20-24 is individual, the melting temperature (Tm) Tm of primer is that 56-63 ℃, the GC% of primer are 40%-60%;

Step 2] primer in the primer storehouse to be screened, reservation can not form the primer of primer dimer;

Step 3] judge that institute keeps the competition quality state of primer, the above-mentioned GC% that keeps primer is compared with the base number: the GC% of and inboard primer identical when the base number average of primer is less than the GC% of outside primer, when perhaps incomplete same when the base number of primer and base number inboard primer lacks a base than outside primer, be judged as the bad primer of race condition, carry out step 4; Otherwise be judged as the excellent primer of race condition, carry out step 5];

Step 4] screen the bad primer of race condition once more, concrete steps are: repeating step 2], to the primer that kept according to step 3] judge once more;

Step 5] utilize the tem-PCR method that the excellent primer of race condition is increased: the annealing temperature in the enrichment stage of described tem-PCR method is 60-65 ℃, marking phase is 94 ℃ of sex change, 72 ℃ of two-step pcrs that annealing is extended, and the annealing temperature in amplification stage is 50-60 ℃;

Step 6] remove the redundant primer in the amplimer, obtain multiple PCR primer.

Above-mentioned steps 1] in used primer-design software be primer3.0, primer5.0 or oligo6.0.

Above-mentioned steps 2] adopt software AutoDimer that the primer in the primer storehouse is screened.Just between the primer by software primer3.0 acquisition the overlapping region can not be arranged, to reduce the possibility that primer dimer forms to greatest extent.

Above-mentioned steps 5] described in the annealing temperature in enrichment stage be 63 ℃; The annealing temperature in described amplification stage is 52 ℃.

Above-mentioned steps 2] in the base number of the primer that can not form primer dimer that keeps be 22 or 23.

Above-mentioned steps 1] in the primer storehouse melting temperature (Tm) Tm of primer be 60 ℃.

Above-mentioned steps 6] in redundant primer that remove to change in the primer of back may further comprise the steps:

6.1] at first outside primer concentration is reduced and reduce gradually until being zero;

6.2] remove the universal primer among the tem-PCR once more;

6.3] be general PCR program with the tem-PCR red tape operation, obtain net result.

The present invention has the following advantages:

1, the present invention introduces the determining step to the good and bad state of competition of primer in the primer design method of the multiplex PCR of amplifying human EGFR gene, obtains competing excellent primer, reduces the phenomenon that segment is lost in the multiplex PCR system, the resources optimization utilization.

2, the invention provides a kind of primer of multiplex PCR of amplifying human EGFR gene, amplify four exons of 18-21 of EGFR gene simultaneously, improve amplification efficiency, reduce cost.The product of amplification back multiplex PCR is convenient to the transgenation that detected downstream can instruct clinical personalized medicine.

3, the present invention has added the redundant primer of removing in the amplimer in the method for design of the multiple PCR primer of amplifying human EGFR gene, obtain this step of multiple PCR primer, the three step program optimizations of existing tem-PCR are gone on foot the PCR program to the simplest one, and primer is optimized to 8 from final 18, and program is simple, save cost.

4, the present invention foreshortens to 20 minutes with the multi-PRC reaction time with the rapid reaction enzyme, can quick gene test for the downstream provide the high quality template.

Description of drawings

The principle schematic of the tem-PCR that Fig. 1 builds for Korea Spro of the initial institute of the present invention foundation;

Fig. 2 is 18exon in of the present invention, the thermograde figure when 18exon out increases separately;

Fig. 3 is 19exon in of the present invention, the thermograde figure when 19exon out increases separately;

Fig. 4 is 20exon in of the present invention, the thermograde figure when 20exon out increases separately;

Fig. 5 is 21exon in of the present invention, the thermograde figure when 21exon out increases separately;

Fig. 6 is the annealing temperature figure that hybrid template is groped Fs and Rs for the present invention with four inboard fragments of 60 ℃ of four exons;

Fig. 7 gropes interior outside primer and universal primer scale map in the system for the present invention;

Fig. 8 is amplification efficiency comparison diagram under 18exon of the present invention and all primer differing tempss of 19exon;

Fig. 9 is amplification efficiency comparison diagram under 20exon of the present invention and all primer differing tempss of 21exon;

Figure 10 is amplification efficiency comparison diagram under all primer differing tempss of four exons of the present invention;

Figure 11 identifies stripe size figure for the present invention;

Figure 12 gropes figure for the present invention to the new primer thermograde of 18exon;

Figure 13 for the present invention renew primer after four whole primer thermogrades of exon grope figure;

Figure 14 gropes tem-PCR universal primer and interior outside primer scale map again for the present invention;

Figure 15 further optimizes the tem-PCR information drawing for the present invention;

Figure 16 is four exon figure of simple method amplification of the present invention;

Figure 17 optimizes primer concentration figure for the present invention;

Figure 18 utilizes fast PCR amplification enzyme optimization figure for the present invention;

Figure 19 is the experiment effect figure of final optimization pass of the present invention.

Embodiment

Be used for one group of primer of multiplex PCR should be able to specificity in conjunction with target sequence, and should the phase mutual interference, thus the target sequence of amplification q.s.Multiplex PCR a plurality of goal gene that can increase simultaneously have the advantage of saving time, reduce cost, raising the efficiency, and particularly save precious experiment sample.Because multiplex PCR requires to carry out the specific amplification in a plurality of sites in same reaction system, thereby technical difficulty increases.An ideal multi-PRC reaction system is not the simple mixing of single PCR, need carry out multianalysis, experiment repeatedly at target product, sets up suitable reaction system and reaction conditions.A large amount of experiments show that the technical problem underlying of multiplex PCR is primer design, combination and concentration optimization.Present research is mainly carried out aspect two in the primer optimization to multiplex PCR: on the one hand be that primer design is carried out comparison between sequence, reduce complementation and pairing probability between the primer; Be in experiment, the concentration conditions of each site primer to be groped on the other hand, adjust the relative concentration of respectively organizing primer, amplification efficiently to reach each site balance.Usually need to set up an effective with multiple PCR program behind very careful design of primers and the multi-turns screen.The problem that often runs in the multiplex PCR is that the amplification between the different target fragment is unbalanced, even some fragment in multiple system is at all without any effective amplification, and its circulation ratio is relatively poor simultaneously.Multiplex PCR program for a success, need to consider following factors, specifically comprise the consumption of temperature, template DNA and the TaqDNA polysaccharase in each step in balance between concentration, magnesium ion concentration and the dNTP concentration of working concentration, PCR damping fluid of primer, the PCR circulation.The annealing temperature among the PCR and the optimum combination of buffer solution system be necessary for the specificity that guarantees multiplex PCR very much, needs the ratio that keeps certain between magnesium ion concentration and the dNTP concentration, and the adjustment of primer concentration simultaneously also is necessary.Therefore, to the key factor during just becoming the multiplex PCR system sets up determined of the final concentration of each primer.For fear of between the primer and the possible cross complementary between primer and the non-specific template, need carry out detailed design and analysis to primer.In ideal conditions, all primers in the multiplex PCR are to all there being identical amplification efficiency, the identical amplification efficiency of different primers can by guarantee in when design separately annealed realize always (length of control primer at 18-28bp and GC content at 45-60%, and between the different primers and primer self all do not have higher homology.The concentration of the every cover primer under the common situation in the multiplex PCR realizes by experience.Existing multiplex PCR is to adopt many primer that is complementary with the To Template base sequence to be realized multiplex amplification to adding simultaneously in the PCR reaction tubes, all the time utilize and primary template complementary primer in the whole pcr amplification process, in fact, every pair of primer extends then with the template pairing separately, each PCR is unrelated, because primer self structure, and template joint efficiency and primer concentration the omnidistance variation of reaction each to primer between differ greatly, the amplification efficiency of each PCR also can't be consistent, even can produce the defective that some " weak tendency PCR " quilt " surging PCR " is covered, can't produce enough products.Therefore, in order to utilize Urogastron EGFR gene, need one group of primer that is used for by the multiplex PCR amplifying human EGFR gene of exploitation such as real-time analysis people such as DNA chips.

The present invention carries out design of primers according to tem-PCR (The Templex PCR), searches out easy multiplex PCR of the present invention in optimum experimental.Concrete grammar is as follows:

(1) utilize primer-design software to design a primer storehouse:

Utilize primer storehouse of online primer-design software primer3.0 design.Selected parameter is during design: the Tm optimum of primer is 60 ℃, minimum 57 ℃, and maximum 63 ℃; Length the best 22, the shortest by 19, the longest by 27; GC% is 40%～60%; Other are system default value.

Concrete primer sequence is:

The primer amplification Position Number	Concrete sequence
		exon?18?up1	acatttgtccttccaaatgagc
exon?18?up2	atttgtccttccaaatgagctg
		exon?18?up3	gaggtgacccttgtctctgtgt
exon?18?up4	agagaaggcgtacatttgtcct
		exon?18?up5	ctgaggtgacccttgtctctgt
exon?18?up6	ggtgacccttgtctctgtgttc
		exon?18?up7	ctgaggtgacccttgtctctg
exon?18?up8	gacccttgtctctgtgttcttg
		exon?18?down1	tacagcttgcaaggactctgg
exon?18?down2	tatacagcttgcaaggactctgg
		exon?18?down3	ggaaatatacagcttgcaaggac
exon?18?down4	acagcttgcaaggactctgg
		exon?18?down5	acactggagtttcccaaacact
exon?18?down6	ttcccaaacactcagtgaaaca
		exon?18?down7	tcccaaacactcagtgaaacaa
exon?18?down8	aaacactggagtttcccaaaca
		exon?18?down9	cccaaacactcagtgaaacaaa
exon?18?down10	acactggagtttcccaaacact
		exon?18?down11	ctgtgaattggtctcacaggac
exon?18?down12	cctttggtctgtgaattggtct

exon19?up1	tgccagttaacgtcttccttct
		exon19?up2	tcacaattgccagttaacgtct
exon19?up3	gccagttaacgtcttccttctc
		exon19?up4	atgaaatgatccacacggactt
exon19?up5	tgccagttaacgtcttccttct
		exon19?up6	tcacaattgccagttaacgtct
exon19?up7	gccagttaacgtcttccttctc
		exon19?up8	ttgccagttaacgtcttccttc
exon19?up9	tgccagttaacgtcttccttct
		exon19?up10	tcacaattgccagttaacgtct
exon19?up11	gccagttaacgtcttccttctc
		exon19?up12	ttgccagttaacgtcttccttc
exon19?down1	acacagcaaagcagaaactcac
		exon19?down2	agctgccagacatgagaaaag
exon19?down3	ccacacagcaaagcagaaact
		exon19?down4	cacacagcaaagcagaaactca
exon19?down5	atgaaatgatccacacggactt
		exon19?down6	agctgccagacatgagaaaag
exon19?down7	tgccagttaacgtcttccttct
		exon19?down8	acacagcaaagcagaaactcac
exon20?up1	taaacgtccctgtgctaggtct
		exon20?up2	tgactccgactcctcctttatc
exon20?up3	ctcctttatccaatgtgctcct

exon20?up4	ctcctcctttatccaatgtgct
		exon20?up5	taaacgtccctgtgctaggtct
exon20?up6	ctaggtcttttgcaggcacag
		exon20?up7	cctgtgctaggtcttttgcag
exon20?up8	acgtccctgtgctaggtcttt
		exon20?up9	gcattcatgcgtcttcacct
exon20?up10	atcgcattcatgcgtcttc
		exon20?up11	gcattcatgcgtcttcacc
exon20?up12	catgcgtcttcacctggaa
		exon20?down1	catggcaaactcttgctatcc
exon20?down2	atatccccatggcaaactctt
		exon20?down3	ccgtatctcccttccctgatta
exon20?down4	cttatctcccctccccgtatct
		exon20?down5	tgactccgactcctcctttatc
exon20?down6	atatccccatggcaaactctt
		exon20?down7	taaacgtccctgtgctaggtct
exon20?down8	ccgtatctcccttccctgatta
		exon21?up1	acagcagggtcttctctgtttc
exon21?up2	gagcttcttcccatgatgatct
		exon21?up3	gcttcttcccatgatgatctgt
exon21?up4	cacagcagggtcttctctgttt
		exon21?down1	gaaaatgctggctgacctaaag
exon21?down2	tgacctaaagccacctccttac

exon21?down3	ctgacctaaagccacctcctt
		exon21?down4	ctgacctaaagccacctccttac
exon21?down5	gaaaatgctggctgacctaaag
		exon21?down6	tgacctaaagccacctccttac
exon21?down7	aagcagctctggctcacactac
		exon21?down8	agcagctctggctcacactac

(2) to the screening of the process of the primer in the primer storehouse

From the upstream (up) of each exon (exon) and downstream (down) primer, respectively choose two primers.Vie each other when seeking template in order to reduce primer, institute's invito thing at first can not have the overlapping region on template, utilizes AutoDimer to analyze, guarantee screen and do not have primer dimer between the primer.The concrete primer sequence such as the following table of preliminary screening:

Annotate: the capitalization in the above table is represented external general arm in addition, and it is selected from reference (AtakanAydin, Mohammad R.Toliat, Sylvia

, Christian Becker, PeterN ü rnberg.New universal primers facilitate Pyrosequencing.Electrophoresis, 2006:27,394-397)

(3) primer that utilizes the checking of tem-PCR method design experiment to be filtered out

3.1 calculate the preliminary screening primer in tem-PCR enrichment stage four kinds of amplified production sizes

Our various combination that four site-specific nature primers of tem-PCR have been discussed may produce four kinds of amplified production: Fo/Ro, Fi/Ro, Fi/Ri, and Fo/Ri in front.Identify in fact the sort of combination take place, must according to primer in template the position and add the universal primer sequence length calculate amplification sheet degree length under every kind of situation respectively.Judge the length of amplified production by 3% agarose electrophoresis result, judge by the segmental length of pcr amplification product whether pairing primer is to being amplified again: in electrophorogram, if exist primer to making up the segmental length of pairing pcr amplification product, then this primer is to being amplified; If do not exist, then not amplification.

Calculation result is as follows:

	18exon	19exon	20exon	21exon
					Fo/Ro(out)	490bp	441bp	582bp	396bp
Fi/Ro	386bp	225bp	466bp	384bp
					Fi/Ri(in)	324bp	191bp	409bp	237bp
Fo/Ri	425bp	407bp	523bp	249bp

3.2 determine the annealing temperature in tem-PCR enrichment stage

Though in the design primer, the Tm value of every primer setting all almost is 60 ℃ (being no more than 1 ℃ up and down), but all there are error in the Tm value of computed in software and reality, need further checking of experiment, thereby seek out best annealing elongating temperature when being PCR.But, there is no need to grope all the four kinds of combined situation in 3.1, only need grope the exon in both of these case that exon out that Fo/Ro produces and Fi/Ri produce and just enough verify the primer of four site-specific natures.

Be to grope each the suitableeest annealing temperature respectively below to primer with thermograde PCR:

PCR experiment bill is as follows:

Every pipe 15ul reaction system is: g.DNA 60ng; Fi-Ri/Fo-Ro final concentration 400nM; 2 * TaqPCR Mastermix:7.5ul; DdH2O:4.8ul.

The response procedures of PCR is: pre-94 ℃ of 3min of sex change; 94 ℃ of 30s then, 50-72 ℃ of thermograde 40s, 72 ℃ of 50s, totally 35 circulations; Last 72 ℃ of 5min.

3% agarose-gel electrophoresis (following PCR product is all identified by this method) result is referring to shown in Fig. 2-5.

Be rearranged as following form according to this Fig. 2-5:

Ta ℃ of system	50	50.6	51.7	53.5	56	59.2	62.9	66	68.5	70.2	71.5	72
													18i	√	√	√	√	√	√	√	√	√	√	√	√

18o

√

19i

√

19o

√

20i

√

20o

√

21i

√

21o

√

Annotate: Ta in every pipe when being thermograde PCR the annealing temperature of annealing stage (annealingtemperature, Ta).√ represents in the last table, the clear and specific band nothing but of band in electrophorogram.

In the time of can knowing that from last table annealing temperature (Ta) when finding out PCR is within 56-63 ℃, all fragments can increase out, and band is clear.Thereby the first step enrichment step annealing temperature range that can determine tem-PCR is exactly 56-63 ℃, can draw 63 ℃ in conjunction with Fig. 2-5 and be optimum annealing temperature (Ta).

3.3 determine the tem-PCR optimum annealing temperature in the 3rd amplification stage in step;

Tem-PCR the 3rd amplification stage in step be exactly universal primer in action, we by as annealing temperature when determining that with the method that four in fragments of 60 ℃ are done hybrid template universal primer Fs and Rs are PCR.

Experimental technique is in detail:

200ul reacts total system (every pipe 15ul packing): four in fragment PCR products of 18-21 mixed solution: 1ul; Fs-Rs (100uM): each 1ul; 2 * Taq PCR Mastermix:100ul; DdH2O:97ul;

The PCR response procedures is:

94 ℃ of pre-sex change 3min, 94 ℃ of 30s then, 44-65 ℃ of thermograde 40s, 72 ℃ 40s35 circulation, last 72 ℃ of 5min.

Experimental result such as Fig. 6, as can be seen, non-specific band is minimum in the time of 52 ℃.Therefore, determine that the annealing temperature that tem-PCR the 3rd goes on foot is 52 ℃

3.4 adopt various interior outside primers and universal primer ratio to realize tem-PCR

Because, just require Fi among the tem-PCR, Fo, the primer concentration of Ri and Ro is low as far as possible, we do not know but what hang down on earth.Can only oneself grope out by experiment.Outside primer and universal primer ratio in groping in the system, concrete grammar is as follows:

The anti-system of every pipe 50ul comprises: g.DNA 120ng; Inboard primer mixture: 2ul (12.5uM/1.25uM/0.125uM/12.5nM/1.25nM); Outside primer mixture: 2ul (12.5uM/1.25uM/0.125uM/12.5nM/1.25nM); Fs-Rs (10uM): each 2ul; 2 * Taq PCR Mastermix:25ul; DdH2O:12ul.

The PCR program is:

(i) 94 ℃ of pre-sex change 3min, (ii) the enrichment stage (94 ℃ of 30s, 60 ℃ of 90s, 72 ℃ of 60s, totally 10 circulations), (iii) marking phase (94 ℃ of 30s, 72 ℃ of 90s, totally 10 circulations), (94 ℃ of 20s, 52 ℃ of 40s, 72 ℃ of 50s (iv) increase the stage, totally 35 circulations), (v) extend the stage (72 ℃ of 3min).

Experimental result is groped interior outside primer and universal primer ratio in the system for Fig. 7.Be followed successively by as interior outside primer and universal primer ratio in from left to right the swimming lane among Fig. 7: M (Marker), 1: 1.25,1: 12.5,1: 125,1: 1250,1: 12500.But, from Fig. 7 we as can be seen, 18exon is not no matter there is purpose fragment (386bp) to occur in that swimming lane, tem-PCR the failure of an experiment must be analyzed reason.

(4) primer of selecting is changed

4.1. analysis failure cause:

In the superincumbent experiment, we find that 18exon loses fragment in multiplex PCR.Its reason concrete analysis is as follows:

4.1.1. amplification efficiency under all primer differing tempss of each exon is compared:

May each goal gene have four kinds of purpose fragments in the first step enrichment stage of tem-PCR and be amplified out, but being actually that on earth is amplified out?

If in a pipe the amplification gene all relevant primers all equivalent add (such as, 18exon, just 18exon Fi, Fo, Ri, Ro, Fs and Rs primer are all added), we just can by observe fragment that reality increases out be determined to the end which primer is preponderated, make pairing fragment be amplified out.

Test design is:

Every pipe 15ul reaction system comprises: g.DNA (24ng/ul): 1.5ul; Fi-Ri (10uM): each 0.6ul; Fo-Ro (10uM): each 0.6ul; Fs-Rs (10uM): each 0.6ul; 2 * Taq PCRMastermix:7.5ul; DdH2O:2.4ul.

The PCR program:

Test-results is: Fig. 8 (18 and all primer differing tempss of 19exon under amplification efficiency relatively) and Fig. 9 (20 and all primer differing tempss of 21exon under amplification efficiency comparison).

In addition, also done the primer that tem-PCR is all equivalent (10uM) add and to carry out thermograde PCR, experimental result such as Figure 10 (amplification efficiency relatively under four all primer differing tempss of exon).

Be difficult to each segmental difference in size of finding directly perceived from Fig. 8～Figure 10, need run glue again and determine these segmental sizes.In order to address this problem, the PCR product that I determine purpose clip size in 3.2 mixes as homemade Marker, and leakage of electricity swimming result is Figure 11 (an evaluation stripe size) again.From Figure 11, just as can be seen: 18exon has only Fi/Ro and Fi/Ri to be amplified out, and 19exon also has only Fi/Ro and Fi/Ri to be amplified out, and 20exon has only Fi/Ri to be amplified out, and 21exon has only Fi/Ro and Fi/Ri to be amplified out.

To sum up we draw a method of judging whether the tem-PCR primer increases, may further comprise the steps:

1] primer equivalent is added in the same PCR pipe carries out pcr amplification reaction;

2] by electrophoresis determining step 1] the middle segmental length of pcr amplification product;

3] judge by the segmental length of pcr amplification product whether pairing primer is to being amplified: in electrophorogram, if exist primer to making up the segmental length of pairing pcr amplification product, then this primer is to being amplified; If do not exist, then be not amplified.

Each exon all can have amplification the time separately Fi/Ri just the in fragment be amplified out, but when all primers all put together, 18exon in had just lost.Why is this on earth? must from primer sequence, seek basic reason.

4.1.2 relatively to the primer sequence analysis:

Analyze 18exon and lose problem, should be from the essential attribute of primer sequence.4 primers of each of 18-21exon are compared as follows table from GC%, Tm value, length:

Last table is analyzed: because the base number of the primer of my preliminary screening has only 21 and 22 two kind of situation, can in the multiplex PCR system, be amplified out 19,20, there are following two kinds of situations in 21exon, the first, the base number of inboard primer is Duoed 1 base than outside primer primer, and (such as 19Ri is 22 bases and 19Ro is 21 bases; 20Ri 22, and 20Ro 21; 21Ri 22, and 21Ro 21), this sheet degree can be amplified; The second, the base number of medial and lateral primer all is 22, but the GC% of inboard primer is higher than outside primer (scope is also within 10%), and this sheet degree can be amplified.In a word may this two aspects factor can cause inboard primer in conjunction with the capacity superiority of template in outside primer, and then guarantee that not having the sheet degree when amplification multiplex PCR sheet is spent loses.And the GC% of 18Ri low by 4% than 17Ro will cause inboard primer to account for inferior position in conjunction with template.

4.2. change the primer result again:

According to analytical results just now, from the primer storehouse, select 18exon Ri and the Ro that makes new advances again.Its sequence such as following table:

Annotate: 18new Ri: length 23, GC%47.83; Amplifying the segmental length of 18exon in is: 281bp.18new Ro: length 22, GC%40.91; Amplifying the segmental length of 18exon out becomes: 408bp.

(5) primer after changing is tested once more:

5.1 the new primer thermograde of 18exon is groped:

Every pipe 15ul reaction system comprises: g.DNA (24ng/ul): 1.5ul; Fi-Ri/Fo-Ro (10uM): each 0.6ul; 2 * Taq PCR Mastermix:7.5ul; DdH2O:4.8ul.

The PCR response procedures is:

94 ℃ of pre-sex change 3min, 94 ℃ of 30s then, 50-72 ℃ of thermograde 40s, 72 ℃ of 40s totally 35 circulations, last 72 ℃ of 5min.

The results are shown in Figure 12-Figure 13.Figure 12 gropes for the thermograde that new primer amplification is gone out 18exon in and 18exonout.Figure 13 B is the competition amplification that relevant primer (18exon Fi, Ri, Fo, Ro, Fs and the Rs) equivalent of 18exon adds that will increase; Figure 13 A is the competition amplification that all primer equivalent are added.

As can be seen from Figure 13A, more renew after the primer, all primer competitions can not cause losing of 18exon again, prove and change the primer success.And new as can be seen primer anneals to extend at 60 ℃ and 63 ℃ all good effect.

5.2 tem-PCR test again:

Every pipe 15ul reaction system comprises: g.DNA (24ng/ul): 1.5ul; Fi/Ri (the various concentration of having diluted): each 0.6ul; Fo/Ro (the various concentration of having diluted): each 0.6ul; Fs-Rs (10uM): each 0.6ul; 2 * Taq PCR Mastermix:7.5ul; DdH2O:up to 15ul.

The PCR response procedures is:

The result is referring to Figure 14 (groping again shown in tem-PCR universal primer and the interior outside primer ratio).In Figure 14 from left to right the situation of swimming lane and the amount such as the following table of primer:

From Figure 14, can draw to draw a conclusion:

In the 4th swimming lane, there are 4 faint bands to occur, illustrate once more and successfully change the new primer of 18exon.How to improve the sharpness of band, increase the efficient of PCR? before observing once more each is to primer thermograde figure, discovery is in the time of 63 ℃, and is generally good than 60 ℃, therefore considers the 60 ℃ 63 ℃ once more experiments becoming new primer of the first step amplification by old primer.Simultaneously band is faint, and maximum possibility is exactly to be used for later amplification in enormous quantities at the product that marking phase does not produce enough tape labels, and therefore considering increases the cycle number of marking phase, the corresponding simultaneously amplification step cycle number that reduces.

5.3. further optimize tem-PCR

The anti-system of every pipe 50ul: g.DNA (24ng/ul): 5ul; Inboard primer mixture: 1.6ul * (1.25uM/0.125uM/12.5nM); Outside primer mixture: 1.6ul * (1.25uM/0.125uM/12.5nM/1.25nM/0.125nM); Fs-Rs (10uM): each 2ul; 2 * Taq PCR Mastermix:25ul; DdH2O:12.8ul.

The PCR program is (enrichment step annealing temperature improves, and the marking phase cycle number increases, and extends the step cycle number and reduces):

(i) 94 ℃ of pre-sex change 3min, (ii) the enrichment stage (94 ℃ of 30s, 63 ℃ of 90s, 72 ℃ of 60s, totally 10 circulations), (iii) marking phase (94 ℃ of 30s, 72 ℃ of 90s, totally 15 circulations), (94 ℃ of 20s, 52 ℃ of 40s, 72 ℃ of 50s (iv) increase the stage, totally 30 circulations), (v) extend the stage (72 ℃ of 3min).

Experimental result such as Figure 15 (further optimizing the tem-PCR condition).In the situation of Figure 15 swimming lane from left to right and the amount such as the following table of primer:

As can be seen from Figure 15, the really amplification efficiency of tem-PCR is increased after optimizing.Above in the swimming lane of various primer gradients, have only swimming lane 1, swimming lane 4,

swimming lane

7,10 4 purpose bands of swimming lane all to occur, and present enhanced trend gradually.And the Fi/Ri primer concentration in these swimming lanes all is 400pM * 1/10, and the concentration of Fo/Ro primer reduces gradually, even does not have.It is best in these various ratios just when as can be seen from the results, Fo/Ro does not have.Therefore, can propose audaciously, there is no need to use outside primers F o/Ro, the existence of outside primer, here the multiplex PCR effect of influence the best on the contrary.

(6) remove the redundant primer of changing in the primer of back

Redundant primer is the primer that does not have the main effect of performance in the tem-PCR amplification system.Because 4 site-specific nature primers in the tem-PCR system (Fi, Ri, Fo, though Ro) two be combined into the upstream and downstream primer and have 4 kinds of situations to occur in theory, in fact may have only dominant a pair of primer to have an effect, this will cause redundancy.In addition, as if universal primer also there is no need.

6.1 preliminary experiment

Result from 5.3 there is no need to use outside primer as can be seen, so just there is no need to have re-used the program of tem-PCR, even there is no need to use universal primer.Therefore, also exist the preliminary simplification experiment that another one has only the inboard Fi/Ri of whole exon in the swimming lane in Figure 15 13.

The PCR system of this experiment is: (50uL altogether) g.DNA (24ng/ul): 5ul (120ng); Inboard primer mixture 1.6ul (12.5uM); 2 * Taq PCR Mastermix:25ul; DdH2O: mend 50uL.

The PCR program considered at that time that inboard primer all was the long segment that has added mark, and higher annealing temperature is arranged, and can adopt two-step approach PCR.Specific procedure is: 94 ℃ of pre-sex change 3min, 94 ℃ of 30s then, 72 ℃ of 50s, totally 35 circulations, last 72 ℃ of 5min.

From the swimming lane 13 of Figure 15 as can be seen, uppermost long segment is clear inadequately.May be that two-step approach PCR program is not suitable for here.Therefore need to be optimized the PCR program

6.2 further optimize the PCR program

Top program does not well amplify long segment, may be that the annealing elongating temperature of primer two-step approach is too high, and the part primer can not be followed the template combination well.Therefore, circulation is extended in the annealing that increases by one 63 ℃ in the superincumbent PCR program, allows primer fully with the template combination.

The anti-system of every pipe 50ul comprises: g.DNA (24ng/ul): 5ul; Inboard primer mixture Fi/Ri (12.5uM): 1.6ul; 2 * Taq PCR Mastermix:25ul; DdH2O:16.4ul.

The PCR program is:

94 ℃ of pre-sex change 3min; 94 ℃ of 20s then, 63 ℃ of 40s, 72 ℃ of 50s totally 10 circulations; 94 ℃ of 20s then, 72 ℃ of 90s, totally 25 circulations; Last 72 ℃ of 3min, 4 ℃ of ever.

Figure 16 (four exons of simple method amplification) is this experimental result.The left side of Figure 16 is this sample experimentally, and the right is self-control Marker.As can be seen from the figure, though, also there is the primer dimer problem, 4 fragments can clearly be found out, prove that light adds 8 primers and 4 exon amplifications can be come out fully.

6.3 optimization primer concentration

All having a large amount of primer dimers in the result of upper experiment, may be that primer concentration is too high, can correspondingly reduce primer.Experimental design is as follows:

The anti-system of every pipe 50ul comprises: g-DNA 120ng; Inboard primer mixture Pi (20uM/10uM/5uM/1uM) 1.6ul; 2 * Taq mastermix:25ul; Moisturizing is to 50uL.

The PCR program is the same with 6.2.

Experimental result such as Figure 17 (optimization primer concentration), from the 2nd swimming lane to 5 swimming lane lower gradually primer concentration (20uM, 10uM, 5uM, 1uM).But,, losing of purpose minimal segment arranged though primer dimer has reduced along with the reduction of primer concentration.Therefore, the primer concentration of our reaction system does not need to have reduced again.

6.4 further optimize the PCR program

Above PCR program in 6.3 more complicated that still seems, further being optimized for the regular-PCR program can have better result?

Reaction system in this experiment is same as 6.3.PCR is programmed to: 94 ℃ of pre-3min that become; 94 ℃ of 20s, 63 ℃ of 40s, 72 ℃ of 50s totally 35 circulations; Last 72 ℃ of 3min, 4 ℃ of ever.

Experimental result such as Figure 17 are from the 1st swimming lane of left side number.As can be seen, the expanding effect of this program is best.

6.5. adopt Fast PCR Master Mix to shorten the multiplex PCR total reaction time;

It all is the general T aq mastermix that uses day root that top all that do are tested used enzyme, and the multiplex PCR experiment of finishing of amplification at least also needs two and one-half-hours.For the shortening time is adopted the efficient SapphireAmp Fast of TaKaRa PCR Master Mix.SapphireAmp ^TMFast PCR Master Mix is suitable for fast PCR (extension speed is 10 seconds/kbp) the premixed type goods of 2 times of concentration of all ingredients (enzyme, Buffer, dNTPMixture etc.) of reaction, and DNA Polymerase has used well behaved HotStart enzyme.Use Fast PCR Master Mix can shorten the multiplex PCR total reaction time effectively, realize rapid amplifying.

Concrete experimental technique is as follows:

Every pipe 25ul reaction system comprises: g-DNA 120ng; Inboard primer mixture Fi-Ri final concentration is 400nM; 2 * Fast PCR mastermix:12.5ul; Water complements to 25ul.

The PCR program has designed three altogether:

Program one is: 94 ℃ of pre-sex change 1min; 98 ℃ of 5s, 63 ℃ of 5s, 72 ℃ of 5s totally 35 circulations; Last 72 ℃ of 3min, 4 ℃ of ever.

Program two is: 94 ℃ of pre-sex change 3min; 94 ℃ of 5s, 63 ℃ of 5s, 72 ℃ of 10s totally 35 circulations; Last 72 ℃ of 3min, 4 ℃ of ever

Program three is: 94 ℃ of pre-sex change 1min; 94 ℃ of 5s, 55 ℃ of 5s, 72 ℃ of 5s totally 35 circulations; Last 72 ℃ of 3min, 4 ℃ of ever

Experimental result such as Figure 18 utilize the enzyme of fast PCR, and the program one above testing successively from left to right is to program three.Wherein the second swimming lane band effect is best, is the final experimental program of our enzyme that utilizes fast PCR.

(7) obtain best primer of multiplex PCR and using method

Amplify the characteristics that 18,19,20,21 exons just can detect the relevant sudden change of nearly all drug metabolism as long as the present invention is directed to the EGFR gene, with present minimum primer, the simplest program, most economical means are designed the multiplex PCR that 8 following primers are realized EGFR.

7.1, common 2 * Taq mastermix method: PCR reaction solution preparation

2×Taq?PCR?Master?Mix 25μL

Template DNA * (human genomic DNA) X μ L

Article 8, primer mixture (each 12.5 μ M) 1.6 μ L

Sterilization ddH ₂O Up to 50 μ L

Template DNA is recommended consumption 120ng in the 50 μ LPCR reaction systems.

The PCR reaction conditions is

94℃ 3min

72℃ 3min

4℃ ∞

7.2, efficient Sapphire Amp Fast PCR Master Mix method

The PCR reaction solution is formulated as:

SapphireAmp?Fast?PCR?Master?Mix 25μL

Template DNA * (human genomic DNA) X μ L

Article 8, primer mixture (each 12.5 μ M) 1.6 μ L

Sterilization ddH ₂O Up to 50 μ L

Template DNA recommendation consumption is 120ng in the 50 μ LPCR reaction systems.

The PCR reaction conditions is:

The result is as Figure 19 (multiplex PCR net result figure).This is 3% agarose electrophoresis figure, and each swimming lane is respectively from left to right: sample, self-control mix Marker, DL2000Marker.

Fragment is successively from top to bottom for the fragment that is amplified: 409bp 20exon; 281bp 18exon; 237bp21exon; 191bp, 19exon.

Claims

1. the primer of the multiplex PCR of an amplifying human EGFR gene, it is characterized in that: the sequence of described primer is:

2. the method for design of the multiple PCR primer of an amplifying human EGFR gene, it is characterized in that: this method may further comprise the steps:

3. the method for design of the multiple PCR primer of amplifying human EGFR gene according to claim 2 is characterized in that: described step 1] in used primer-design software be primer3.0, primer5.0 or oligo6.0.

4. according to the method for design of the multiple PCR primer of claim 2 or 3 described amplifying human EGFR genes, described step 2] adopt software AutoDimer that the primer in the primer storehouse is screened.

5. the method for design of the multiple PCR primer of amplifying human EGFR gene according to claim 4 is characterized in that: described step 5] described in the annealing temperature in enrichment stage be 63 ℃; The annealing temperature in described amplification stage is 52 ℃.

6. the method for design of the multiple PCR primer of amplifying human EGFR gene according to claim 5 is characterized in that: described step 2] in the base number of the primer that can not form primer dimer that keeps be 22 or 23.

7. according to the method for design of the multiple PCR primer of claim 6 amplifying human EGFR gene, it is characterized in that: described step 1] in the primer storehouse melting temperature (Tm) Tm of primer be 60 ℃.