CN101899419A

CN101899419A - Insect baculovirus expression system and method for expressing E2 protein using same

Info

Publication number: CN101899419A
Application number: CN2009100518842A
Authority: CN
Inventors: 孙兵; 查业
Original assignee: Shanghai Institutes for Biological Sciences SIBS of CAS
Current assignee: Center for Excellence in Molecular Cell Science of CAS
Priority date: 2009-05-25
Filing date: 2009-05-25
Publication date: 2010-12-01
Anticipated expiration: 2029-05-25
Also published as: CN101899419B

Abstract

The invention provides an insect baculovirus expression system and a method for expressing E2 protein using same, and more particularly provides recombinant baculovirus which has the preservation number of CCTCC No: V200909; and the invention provides a host cell transformed by the recombinant baculovirus, and a method for producing recombinant E2 protein with the host cell.

Description

Insect baculovirus expression system and express the proteic method of E2 with it

Technical field

The present invention relates to the genetically engineered field, be specifically related to a kind of baculovirus expression box of reorganization, contain its virus, and the method for using this expressing viral reorganization hepatitis C virus albumen E2.

Background technology

Hepatitis C virus (HCV) is the sub-thread positive chain RNA virus of tool coating, belongs to flaviviridae family.HCV knownly uniquely can cause chronically infected RNA viruses (except that retrovirus), according to estimates, among the about 1.7 hundred million HCV the infecteds in the whole world, 60%-80% is chronic carrier at present, and persistent infection finally develops into the probability of liver cirrhosis/liver cancer up to 3.5%-20%.A high proportion of chronic infection rate like this means that under possible virus immunity escape mechanism body often can't excite or keep effective antiviral immunity reaction.More and more evidences shows, make cellular immunization bring into play main effect therein, promptly set up in early days at the CD8CTL of a plurality of HCV epitopes, polyspecific and the strong cellular immunization barrier of CD4Th cell in infection, most important for the control and the virus sweep of acute infection.

The HCV genome is about 9.6kb, the polyprotein precursor that is about 3000 amino-acid residues of encoding, under the effect of host signal peptase and virus self proteins encoded enzyme, generate 4 kinds of structural protein (C, E1, E2, p7) and 6 kinds of Nonstructural Proteins (NS2-NS5B), wherein E1, E2 are envelope glycoprotein, are the main target antigens of neutralizing antibody.E1 and E2 belong to I type conformity membrane albumen, comprise a bigger N terminal membrane outskirt and a C end hydrophobicity membrane spaning domain.At it separately under the guiding of N end stream signal peptide, be positioned to finish on the endoplasmic reticulum N-glycosylation of height, and by after the host signal peptase cutting, non-covalently be stranded on the endoplasmic reticulum in conjunction with forming sophisticated heterodimer, when viral eruption and membrane structure together be wrapped in virus surface.This native conformation of E1/E2 be modified at that virus combines with cell receptor, cytolemma fusion and enter in the virus infection such as cell and play crucial effects

At present to the HCV acceptor and with limited known to the interaction still of HCV envelope protein.Known possible acceptor molecule comprises four transmembrane protein family member CD81, the I of B family type scavenger receptor (SR-BI), low density lipoprotein receptor (LD L.R) and mannose binding lectin L-SIGN and DC-SIGN, E2 albumen then are the subunits with their direct interaction.It is wherein, external that interior experiment has confirmed that also CD81 and SR-BI are bringing into play directly effect in the HCV invasion procedure, also confirmed gradually with their interactional site information on the E2 albumen with body.Further research to HCV acceptor and virus intrusion mechanism is significant for the development of HCV vaccine and specific drugs.

Mechanism in view of E2 albumen and receptors bind, by the E2 albumen of great expression near native configurations, immunoscreening obtains at the neutralizing antibody of E2 protein receptor in conjunction with epi-position, injects in the body, be E2 albumen capable of blocking and the path that combines of cell receptor, thereby play the purpose of treatment third liver.

Usually the preparation system that antigen adopted is a prokaryotic expression system, prokaryotic expression system possesses high-throughput expresses, be easy to expanded reproduction, low-cost, the thalline breeding rapidly, advantages such as no post transcriptional modificaiton and expressing protein can be labeled, yet the albumen that prokaryotic system gives expression to often lacks better space configuration and basic glycosylation modified, differ greatly with native protein, it is low that this causes discerning natural epi-position ability with the prepared monoclonal antibody of prokaryotic system expressed proteins immune animal in some cases, unfavorable to the screening neutrality antibody, and can not be used for developing therapeutic antibodies.Simultaneously, because the singularity of viral protein adopts intestinal bacteria (as BL21) prokaryotic system to express, E2 can be degraded in the expression process to a great extent.

Therefore, exploitation presses for the method for a kind of stably express in a large number near natural E2 at the proteic third liver therapeutic antibodies of E2.

Bac to Bac system is one of insect cell one baculovirus expression system of recent development, be to utilize transfer vector pFastBac to transform the intestinal bacteria DH10Bac that contains baculovirus shuttle vectors Bacmid, foreign gene is incorporated among the Bacmid by the locus specificity transposition.Bacmid contains complete insect polyhedron baculovirus AcMNPV genome, can in intestinal bacteria, hang down to copy to duplicate and separate with stable, again can the direct transfection insect cell, obtain virus particle, through screening reorganization Bacmid, the direct transfection insect cell obtains pure recombinant virus, simultaneously efficiently expressing exogenous gene.This insect system has the ability with the similar posttranslational modification of most of higher eucaryotes, processing and transfer foreign protein, and the expressed proteins level is higher than the mammalian cell expression amount up to 1～500mg/L simultaneously.

Yet, still need to be convenient in process of production the recombinant protein of separation and purification and cultural method that can scale operation.

Summary of the invention

Therefore, the purpose of this invention is to provide a kind of can the proteic recombinant virus of successful expression HCV E2, and with the method for its large-scale production of recombinant proteins.

In one aspect of the invention, provide a kind of recombinant baculovirus, it is deposited in Chinese typical culture collection center, and preserving number is CGMCC No.CTCC-V200909.

In an embodiment aspect this, this virus contains recombinant expression cassettes, and the shaft-like expression cassette of described reorganization contains: viral polyhedrin promotor P10, GP67 signal peptide sequence, E2 albumen coded sequence, zymoplasm restriction enzyme site joint, humanized IgG-Fc encoding sequence and Sv40PolyA.

In a preference aspect this, the GP67 signal peptide is between polyhedrin and E2 albumen coded sequence.In another preference aspect this, zymoplasm restriction enzyme site joint and humanized IgG-Fc encoding sequence is connected to described E2 albumen coded sequence downstream in turn.

In a preference aspect this, the E2 albumen of E2 albumen coded sequence coding SEQ ID NO:2.E2 albumen can be its recombinant forms also, or has more than at least 70% with it, and is preferred more than 80%, preferred 90%, the reorganization E2 functional protein of preferred homogeny more than 95%.It also can be the fragment of its any E2 of having function.

In another aspect of the present invention, a kind of production reorganization E2 is provided proteic method, may further comprise the steps:

With above-mentioned recombinate shape virus infection insect cell, the reorganization E2 albumen that separation and purification produces.

In a preference aspect this, insect cell is removed the cell of uniting by repeating suspension culture.

In another preference aspect this, insect cell is the highfive insect cell.Also can use any other insect cell compatible with baculovirus, or even the eukaryotic cell of protokaryon or other kind.

In another aspect of the present invention, a kind of reorganization E2 albumen is provided, be E2-zymoplasm restriction enzyme site joint-humanized IgG-Fc fusion rotein.

In a preference aspect this, between described proteic zymoplasm restriction enzyme site joint and humanized IgG-Fc fragment, the XhoI restriction enzyme site is arranged.In another preference, the segmental aminoacid sequence of humanized IgG-Fc is SEQ ID NO:7.

Description of drawings

Figure 1A has shown the structure collection of illustrative plates of shuttle vectors pFastBacHTb of the present invention.

Figure 1B has shown the signal peptide numbered sequence at the proteic aminoacid sequence of E2 of the present invention, its two ends, the sequence of multiple clone site, the encoding sequence of zymoplasm restriction enzyme site or protein purification label (Fc).

Fig. 2 has shown that the present invention uses the proteic schema of insect system expression E2.

Fig. 3 has shown that pFastBacHTb-signal-Fc carrier enzyme cuts back recovery figure (BamH1﹠amp; The Xho1 double digestion).

Fig. 4 has shown the result after E2-zymoplasm restriction enzyme site joint fusion gene PCR runs the glue cutting.

The checking of bacterium liquid illustrated after Fig. 5 had shown the gene constructed pFastBacHTb of the going into carrier of E2-thrombin.

Fig. 6 has shown pFastBac-E2 plasmid double digestion (BamH1﹠amp; Xho1) back diagram.

Fig. 7 takes out the glutinous grain of gained reorganization back E2 in being, with M13 universal primer PCR gained result.

Fig. 8 takes out the glutinous grain of gained reorganization back E2 in being, 50V, and 150min runs gained result behind 0.8% glue.

Fig. 9 has shown the relatively diagram that insect cell Highfive infects the front and back state.

After Figure 10 has shown virus infection attached cell 48h, cracking endochylema, western-blot method, the result of detection Fc label.

After Figure 11 has shown the ProteinG column purification, gained E2 protein sample.

Figure 12 has shown the HCV virus model, prepared E2 albumen of insect system and HCV native protein competitive assay.

Embodiment

For the proteic method of scale operation E2 of succeeing, the inventor finds, E2 albumen and human IgG Fc are merged, and makes this albumen can be stabilized expression, is secreted in cell peripheral or the cell, can just can conveniently collect by easy purification procedures.

Human IgG Fc fragment derives from the Fc fragment of pWS3 plasmid, has utilized the characteristic of its stably express viral protein in the present invention.

E2 albumen used in the present invention is recombinant expressed from the insect cell baculovirus.

The preparation of recombinant virus can be by the various known approach preparation of this area.Bacto Bac system that the present invention is preferred, the carrier B acmid that utilization can be shuttled back and forth between intestinal bacteria and insect cell transforms baculovirus with the proteic sequence of E2, thereby can express E2 albumen at the insect cell camber.

According to the present invention, can adopt the conventional molecular biology in the technical ability of this area, microbiology and DNA recombinant technology.These technology prove absolutely in the literature, as referring to Maniatis ﹠amp; Sambrook, Fritsch, " Molecular Cloning:A Laboratory Manual (1982); " DNA Cloning:APractical Approach, " volume I and II (D.N.Glover ed.1985); " OligonucleotideSynthesis " (M.J.Gait ed.1984); " Nucleic Acid Hybridization " [B.D.Hames ﹠amp; S.J.Higgins eds. (1985)]; " Transcription and Translation " [B.D.Hames ﹠amp; S.J.Higgins eds. (1984)]; " Animal Cell Culture " [R.I.Freshney, ed. (1986)]; " Immobilized Cells And Enzymes " [IRL Press, (1986)]; B.Perbal, " APractical Guide To Molecular Cloning " (1984).Therefore, if be defined as follows in this paper following term.

" dna molecular " refers to the polymerized form of deoxyribonucleotide (VITAMIN B4, guanine, thymus pyrimidine or cytosine(Cyt)), with its single stranded form or double-stranded spiral form.This term only refers to the firsts and seconds structure of molecule, does not limit its any concrete three grades of forms.So this term comprises particularly at line style dna molecular (as, restricted fragment), virus, the double-stranded DNA of finding in plasmid and the karyomit(e).Structure discussed here, the just DNA non-transcribed chain that provides by common practice 5 ' to the sequence of 3 ' direction (that is, have with the mRNA homologous sequence chain).

" RNA molecule " refers to the polymerized form of ribonucleotide (VITAMIN B4, guanine, thymus pyrimidine or uridylic), with its single stranded form or double-stranded spiral form.This term only refers to the firsts and seconds structure of molecule, does not limit its any concrete three grades of forms.So this term comprises particularly at line style RNA molecule (as, restricted fragment), the single stranded RNA of finding in the virus.The sequence that provides is in this article completely all translated into genome normal chain dna form.But should be understood that it is the positive chain RNA form in the genome of HCV, could translate and express then by being transcribed into mRNA.

" carrier " refers to a kind of replicon, as plasmid, has a liking for thalline or clay, and they can be in conjunction with another dna fragmentation, thereby produces duplicating of institute's binding fragment." replicon " be a kind of gene element (as, plasmid, karyomit(e), virus), its function is the independent unit of dna replication dna in the body, if can duplicate under himself control." replication orgin " refers to participate in DNA synthetic dna sequence dna." expression control sequenc " is control and regulates the dna sequence dna of transcribing and translate another dna sequence dna.Encoding sequence be in the cell when RNA polymerase is transcribed into mRNA with encoding sequence, and transcribe and translate that the control sequence operability is connected and under their control, be translated into the coded albumen of encoding sequence.

Usually, adopt the expression vector contain promoter sequence to promote the dna fragmentation of the insertion that is connected with the host effectively to transcribe and translate.Expression vector generally includes replication orgin, promotor, terminator, and the special gene of having the ability to provide Phenotypic Selection in transformant.Can and be cultivated by the methods known in the art fermentation by host transformed, to reach the optimum cell growth.

DNA " encoding sequence " is when placing suitable adjusting sequence control down, transcribing and be translated as the double chain DNA sequence of polypeptide in the energy body.' (amino) end is initiator codon, is translation termination at 3 ' (carboxyl) end 5 on the border of encoding sequence.An encoding sequence can comprise, but is not restricted to, protokaryon sequence, the cDNA of eukaryotic mrna, genomic dna sequence and the synthetic dna sequence dna of eucaryon (as, Mammals) DNA.Polyadenylation signal and Transcription Termination subsequence are usually located at 3 ' ends of encoding sequence." cDNA " refers to copy-DNA or complementation-DNA, and it is the reverse transcription reaction product of mRNA transcript.

The control sequence of transcribing and translating is the adjusting sequence of DNA, as promotor, and enhanser, polyadenylation signal, terminator etc., they provide the expression of encoding sequence in host cell." cis element " is a kind of nucleotide sequence, is also referred to as " consensus sequence " or " motif ", and it can go up to be in harmonious proportion and reduce the expressed proteins interaction of specific gene site with those." signal sequence " also can be included in the encoding sequence.This sequence encoding is positioned at a kind of signal peptide of polypeptide N-end, and itself and host cell are got in touch and with this Peptide T position in suitable cell.Found that signal sequence can combine with many protokaryons and Eukaryotic native protein.

" promoter sequence " is a kind of DNA regulation domain, can be in cell in conjunction with RNA polymerase with cause transcribing of downstream (3 ' to) encoding sequence.The present invention definition, its 3 ' end of promoter sequence for the initiation site of transcribing and upstream (5 ') but direction extend the initiation detection level (being higher than background) that comprises minimum quantity transcribe necessary base and element.In promoter sequence, can find transcription initiation site and responsible and RNA polymerase bonded protein binding zone (consensus sequence).Eukaryotic promoter is frequent, but always is not, contains " TATA " box and " CAT " box.Prokaryotic promoter except-10 and-35 consensus sequences, also contain SD (Shine-Dalgarno) sequence.

Term " oligonucleotide " refers to a kind of molecule of being made up of two or more (best more than three) deoxyribonucleotides.Its definite size is determined by several factors, depends on the final function and the use of this oligonucleotide.The term that this paper uses " primer " refers to a kind of oligonucleotide, no matter be purifying natural oligonucleotide with Restriction Enzyme digestion, still the synthetic oligonucleotide that produces, when it is placed under the synthesis condition of primer extension product, as when having Nucleotide and inductor such as DNA polymerase and suitable temperature and pH, can be used as and cause the synthetic point, and institute's inductive primer extension product and nucleotide chain are complementary.Primer can be strand also can be double-stranded, but must sufficiently long enable when inductor exists, to cause the synthetic of required extension products.The definite length of primer depends on many factors, comprises temperature, primer source and used method.For example, diagnostic use depends on that the complicacy of target sequence, oligonucleotide primer comprise 15-25 or more Nucleotide usually, though it also can comprise Nucleotide still less.

The selected primer of this paper must be complementary substantially with the different chains of specific target DNA sequence.This meaning, primer must be hybridized with their chains separately are complementary fully.Therefore, primer sequence need not to reflect the definite sequence of template.For example, one section incomplementarity nucleotide fragments can be attached to 5 ' end of primer, and the chain complementation therewith of the rest part of primer sequence.In addition, as long as the sequence of primer sequence and hybridization with it enough whens complementation, incomplementarity base or longer sequence may be interspersed within the primer, have formed extension products synthetic template like this.

Term used herein " restriction enzyme " and " Restriction Enzyme " refer to can on the specific nucleotide sequence or near the enzyme of cutting double-stranded DNA.

" DNA recombinant technology " refers to merge the technology of two allogeneic dna sequence DNA molecules, and this is the result of the different organism DNA of external connection usually.Recombinant DNA molecules generates with the genetically engineered experiment usually.The term of synonym comprises " gene splicing ", " molecular cloning " and " genetically engineered ".The product of these operations is " recombinant chous " or " recombinant molecule ".

When this DNA was introduced in the cell, cell was just by external or allogeneic dna sequence DNA " conversion " or " transfection ".Transfering DNA may or not be integrated (covalently bound) in the genome of cell.For example prokaryotic organism, in yeast and the mammalian cell, transfering DNA may be maintained on free type element such as carrier or the plasmid.For eukaryotic cell, the cell of stable conversion is that the DNA of conversion has been incorporated into the cell in the karyomit(e), will entail daughter cell by THE REPLICATION OF CHROMOSOME like this.The evidence of this stability is that this eukaryotic cell can be set up clone and the clone by the daughter cell group one-tenth that contains transfering DNA." clone " is by a cell or mitotic division ancestors deutero-a group cell." clone " can be permitted the clone of a primary cell of polybasic at external stable growth.A kind of biology is as plant or animal, with being called " genetically modified " biology after the foreign DNA conversion.

The term that this paper uses " host " not only comprises prokaryotic organism, also comprises eukaryote such as yeast, plant and animal cell.Prokaryotic hosts can comprise intestinal bacteria (E.coli), Salmonella typhimurium (S.tymphimurium), Bacterium prodigiosum (Serratia marcesens) and Bacillus subtilus (Bacillus subtilis).Eucaryon host comprises yeast such as Pichia pastoris (Pichia pastoris), mammalian cell and insect cell, and vegetable cell such as Arabidopis thaliana (Arabidopsis thaliana) and tobacco (Tobaccum nicotiana).

It is paired that Nucleotide in two dna sequence dnas determining length has at least 75% (be preferably 80%, best is 90% or 95%), and then these two dna sequence dnas are " basic homologies ".The basic homology of sequence can for example being under the determined rigorous condition of special system, be carried out sequence and relatively identify by standard software or the Southern hybrid experiment with sequence library.Clearly the hybridization conditions of Shi Heing is seen the al. as Maniatis er within those skilled in the art's ability, and is the same; DNA Cloning, Vols.I ﹠amp; II, the same; NucleicAcid Hybridization, the same.

" allos " zone in the dna structure be in bigger dna molecular natural can not with one section zone of this larger dna molecular association.Therefore, when this allos regional code one mammalian genes, this gene often side joint the DNA of mammalian genes group that can side joint in the biological gene group of source.Another example is, this encoding sequence himself in nature be do not have (as, the genome encoding sequence among the cDNA comprises intron, or has comprised the codon different with nature gene in the composition sequence).The allos zone that the sudden change of equipotential (gene) variation or natural generation does not produce the said DNA of this paper.

In addition, the present invention also comprises a part or the fragment of E2 albumen or raq gene." fragment " of this paper or " part " refer to a gene or a polypeptide, and at least 10 residues usually on the length are preferably at least 20 residues, and that best is at least 30 residues (as 50), but must be less than all complete sequences.These gene fragments can make with the method known to those skilled in the art, the restrictive diges-tion by naturally occurring raq gene or reorganization raq gene or E2 protein gene for example, by determining the DNA recombinant technology of segmental carrier, or make by chemosynthesis with coding E2.

According to the known conventional Northern hybridization technique of those of ordinary skills, can adopt standard Nothern trace to test to determine the relative quantity of the mRNA in the cell or tissue.In addition, according to the known conventional Southern hybridization technique of those of ordinary skills, the existence and the copy amount that can adopt standard Southern trace to test to confirm interest genes.Northern trace and Southern trace have all been used hybridization probe, promptly radiolabeled cDNA, or the oligonucleotide of the individual continuous nucleotide length of at least 20 (be preferably at least 30, be more preferably at least 50, best is at least 100).The probe of DNA hybridization can come mark with a kind of in the known many different methods of those of ordinary skills.

The most frequently used marker is radioelement, enzyme in these researchs, being exposed under the UV-light can fluorescigenic chemical agent, etc.Known have many fluorescent materials to can be used for mark.They comprise, as, fluorescein, rhodamine, auramine, Texas red (Texas Red), AMCA indigo plant and fluorescent yellow.A kind of special detecting material be make in the goat pass through the crosslinked anti--rabbit antibody of isothiocyanate and fluorescein.Protein can be with radioelement or enzyme labelling.Radio-labeling can detect with present getable method of counting.Preferable isotropic substance can be selected from ³H, ¹⁴C, ³²P, ³⁵S, ³⁶Cl, ⁵¹Cr, ⁵⁷Co, ⁵⁸Co, ⁵⁹Fe, ⁹⁰Y, ¹²⁵I, ¹³¹I and ¹⁸⁶Re.

Enzyme labelling is useful too, and available colorimetric, spectrophotometer, spectrophotofluorometer, rheometer or gas dosing technology are measured.By making enzyme and selected particle crosslinked with bridging molecule (as carbodiimide, diisocyanate, glutaraldehyde etc.) reaction.Many enzymes that can be used for this method are known and have been adopted.Preferably peroxidase, beta-Glucuronidase, β-D-Polyglucosidase, beta-D-galactosidase, urase, notatin and peroxidase and alkaline phosphatase.United States Patent (USP) NO.3,654,090,3,850,752 and 4,016,043 li mark substance and method that also discloses other.

Term " immunocompetence " or " immunogenicity " refer to the ability by natural, reorganization or intravital specificity humoral of synthetic inducing peptide Mammals and/or cellullar immunologic response.Term used herein " antigenicity aminoacid sequence ", " antigenic polypeptide " or " antigenic peptide " refer to cause the aminoacid sequence that mammalian immune is replied, and no matter are to combine (as I or II class major histocompatibility antigen molecule) separately or with accessory molecule.

Term used herein " immunne response " comprises cellularity and/or body fluid immunne response, and they are enough to suppress or protect from infection; Or prevent or the outbreak of the disease that suppresses to cause by microorganism (especially pathogenic microbes); And/or suppress, reduce or prevent the hyperplasia of tumour cell; And/or the quantity of reduction tumour cell or the quality of tumour; And/or the possibility of reduction tumprigenicity formation.

Term " antigen " and " epi-position " are well known in the art, and referring to can be by the macromolecular part of immune a kind of composition (as antibody or T cell antigen receptor) specific recognition.Epi-position can be by the antibody recognition in the solution, as relative with other molecule free.When epi-position combines with I or the main histocompatibility complex of II class molecule, just can be by T-cell antigen receptor identification epi-position." CTL epi-position " be exactly when epi-position be present in MHC I quasi-molecule bonded cell surface on the time, (be generally CD8 by cytotoxic T lymphocyte ⁺Cell) Shi Bie epi-position.

Term used herein " isolating " refer to describe be in a kind of natural formation environment of compound the allied compound (as recombinant virus, peptide etc.) under the different condition." isolating " is included in a kind of allied compound in the sample and is in all cpds that enrichment state and/or a kind of therein allied compound have part or reach purifying basically substantially.

The various compositions that comprise recombinant baculovirus of the present invention

The present invention also provides the various compositions that comprise recombinant baculovirus of the present invention (comprising medicinal compositions).

The various compositions that comprise recombinant baculovirus of the present invention can comprise by the selected buffer reagent of the practical use of recombinant baculovirus; Also can comprise other material that is applicable to intended purpose.Those skilled in the art are good at the buffer reagent selected, and known in the art have numerous buffers to be applicable to intended purpose.In some example, said composition can contain pharmaceutically acceptable vehicle, and known in the art have multiple and need not to go through at this.Pharmaceutically acceptable various vehicle comprises as " Remington: pharmacy and pharmacy practice " the 19th edition (1995) Mack Publishing Co. at the existing detailed description of multiple publication.

Medicinal compositions can be prepared into various formulations, as granula, tablet, pill, suppository, capsule, suspension, spraying, suppository, transdermal drug (as paster etc.), ointment, lotion etc.Be applicable to pharmaceutical grade other organic or inorganic carrier and/or thinner of oral or local use, can be used for preparing the various compositions that comprise therapeutical active compound.Thinner known in the art comprises aqueous medium, vegetalitas and animality oil ﹠ fat.The salt of also available stablizer, wetting agent and emulsifying agent, change osmotic pressure or keep the various buffer reagents of suitable pH value and skin penetration enhancer etc. as complementary material.

Recombinant baculovirus of the present invention can be used as immunoscreening at the proteic neutralizing antibody of E2.The E2 protein injection that the present invention produces is gone in the animal body, can produce polyclonal antibody in a large number, and can screen monoclonal antibody by ordinary method.Usually, by the whole bag of tricks well known in the art, prepare vaccine of the present invention with suitable pharmaceutical carrier and/or vehicle.Suitable carriers is a Sterile Saline.Also can use other water-based and non-aqueous isotonic sterile injection liquid and water-based and non-aqueous sterile suspensions (known all is pharmaceutically acceptable carrier, also is well-known to those skilled in the art) for this reason.

Provide following embodiment purpose for explanation various specific embodiments of the present invention, to the restriction of the present invention without any form.

The preparation of embodiment 1 recombinant baculovirus

The reorganization donor plasmid structure:

Shown in Figure 1B, the proteic encoding sequence of E2 is from NCBI (http; The gene order of the HCV1b type hepatitis C virus surface glycoprotein E2 that include the website of //www.ncbi.nlm.nih.gov/) is chosen E2 extracellular region sequence clone.Use the cDNA genome of HCV1b to synthesize its encoding sequence as template, its sequence is SEQ ID NO:1.Aminoacid sequence such as SEQ ID NO:2.Utilize the restriction enzyme digestion recombinant clone to go into the multiple clone site of transfer vector pFastBacHTb (this laboratory provides) (zymoplasm restriction enzyme site) this sequence.Fc fragment in this plasmid derives from the Fc fragment of pWS3 (available from Sigma company), and its sequence is seen Figure 1B as shown in SEQ ID NO:7.From this plasmid, clone the Fc fragment with forward primer 5 '-CCGCTCGAGACATGCCCACCGTGCCCA-3 ' (SEQ ID NO:3) and reverse primer 5 '-CCCAAGCTTTTTACCCGGAGACAGGGA-3 ' (SEQ ID NO:4), and be built into the pFastBac carrier, at zymoplasm restriction enzyme site joint sequence CTGGTGCCGCGCGGCTCT (SEQ IDNO:6) afterwards.This plasmid also contains a signal peptide sequence; be positioned at before the E2 protein sequence, its sequence is ATGCTACTAGTAAATCAGTCACACCAAGGCTTCAATAAGGAACACACAAGCAAGAT GGTAAGCGCTATTGTTTTATATGTGCTTTTGGCGGCGGCGGCGCATTCTGCCTTTG CG (SEQID NO:5).

The construction step of plasmid:

1. clone E2 extracellular region full length sequence

Template is the cDNA genome from the HCV1b of Shanghai Institute Pasteur, according to the raq gene sequence that www.ncbi.nlm.nih.gov searches, adopts software Primer Premier to design its extracellular region primer.Introduce zymoplasm enzyme cut-grafting head in the primer.

Forward primer: CGCGGATCCGAGACCCGTGTGACAGG (SEQ ID NO:8)

Reverse primer: CCGCTCGAGAGAGCCGCGCGGCACCAGCCATTTGATTGCA (SEQ ID NO:9)

Introduce blood coagulation restriction enzyme site (Ler-Val-Pro-Arg-Gly-Ser) in the antisense primer, direct and raq gene links.

Adopt the PCR system (50ul) of pfu polysaccharase to carry out PCR, condition is 94 ℃ of pre-sex change of 5m; 94 ℃ of 45s sex change; 60 ℃ of 45s annealing; 72 ℃ of 1m45s extend; 33 circulations.Agarose PAGE gum concentration is 1% (mg/ml)

2.E2 gene reclaim, gene reclaims the back and runs the glue checking, proves the single gene fragment that has obtained the purpose size, BamHI ﹠amp; XhoI restriction enzyme 37 degree enzymes are cut and are spent the night, and reclaim enzyme and cut gene fragment.

3.pFastBacHTb carrier (BamHI﹠amp; XhoI) reclaim behind the double digestion

4. enzyme Qie Jiyin and enzyme are cut carrier 10ul linked system, and 16 degree connect 5-8h

5. will connect product and transform DH5 α, 6 clones of picking carry out bacterium liquid PCR checking.The picking positive clone strain carries out a small amount of extracting of bacterium liquid.

This plasmid map such as Figure 1A.

The quick extraction agent box of a small amount of plasmid that adopts Shen, Shanghai energy lottery industry Bioisystech Co., Ltd to provide, operation steps is as follows:

(1) get bacterium liquid 2-3ml, high speed centrifugation 12000rpm, 1min collects thalline.

(2) abandon supernatant, add 100ul Solution I solution, vibrating to bacterium thoroughly suspends.

(3) add 200ul SolutionII solution, gentleness is put upside down (promptly adding a pipe mixing one pipe) 5-10 time immediately, and room temperature leaves standstill 2min.

(4) add 400ul Solution III solution, gentleness is put upside down (promptly adding a pipe mixing one pipe) 5-10 time immediately, and room temperature leaves standstill 2min.

(5) the centrifugal 10min of 15000rpm (need not low-temperature centrifugation), supernatant moves in the 3S adsorption column, and room temperature leaves standstill 2min.

(6) the centrifugal 1min of 12000rpm outwells the liquid in the collection tube, and adsorption column is put into same collection tube.

(7) add 700ul Wash Solution solution in adsorption column, the centrifugal 1min of 12000rpm outwells the liquid in the collection tube, and adsorption column is gone in the same collection tube.

(8) repeating step 7 once

(9) 12000rpm is centrifugal 2 minutes, removes liquid as far as possible, outwells the liquid in the collection tube.

(10) the 3S post is placed the centrifuge tube of clean 1.5ml, add 30ulTEsolution in the film central authorities of 3S post, 55-65 ℃ of water-bath placed 2 minutes, and centrifugal 1 minute of 12000rpm discards the 3S post, is plasmid in the centrifuge tube ,-20 ℃ of preservations.

Fig. 3 is the gene rubber tapping figure behind the pFastBacHTb carrier double digestion, and carrier is 5600bp, and stripe size is correct.

Fig. 4 is raq gene rubber tapping figure, and size is 1kb, and stripe size is correct.

Fig. 5 transforms DH5a for the plasmid after making up, the result of 4 clone bacterium liquid checking, and the result shows that 4 clones are all positive.

Fig. 6 spends double digestion (BamHI﹠amp at night for taking out gained plasmid 37 for a short time; XhoI), run the glue checking.The result shows that institute cuts to such an extent that gene size is correct, and promptly restriction enzyme site is correct.

2. the preparation of recombinant cosmid:

The reorganization pFastBac carrier that the obtains mode by gene recombination is transformed among the intestinal bacteria DH10Bac (from the biochemical cell Wang Gang of institute group), obtains the host e. coli cell of reorganization.

37 degree, shaking table 250rpm cultivates intestinal bacteria, makes E2 encoding sequence and humanized IgG Fc sequence be recombined into the mini-attTn7 site of the glutinous grain of Bacmi under the transposase effect.Described transposase is provided by the helper plasmid pMON7124 that carries among the intestinal bacteria DH10Bac.Then, intestinal bacteria are coated with cultivation on the Luria substratum.

Picking hickie bacterium colony adds 50 μ g/ml kantlex, 7 μ g/ml gentamicins, 10 μ g/ml tsiklomitsins screening resistant strain containing microbiotic (screening kantlex, gentamicin and tetracyclin resistance) LB cultivation amplification plasmid; 37 ℃ are shaken bacterium and cultivate 24h.High speed centrifugation collection bacterium liquid precipitate (14000g * 1min).

With the abundant resuspended precipitation of 300 μ l Solution I; 300 μ l Solution II are to clarification, and room temperature is placed 5min; 300 μ l Solution III gently mix to forming white precipitate; Place 5-10min on ice.

The centrifugal 10min of 14000g, supernatant liquor are transferred to the EP pipe that adds 800 μ l Virahols, mix gently, place 5～10min on ice.15min14000g is centrifugal, adds 500 μ l, 70% ethanol, centrifugal 5 minutes of 14000g; Repeating step, the as far as possible suction goes supernatant to place air more, 40 μ lddH ₂The O dissolving DNA can be stored in-20 ℃.

3. the preparation of recombinant baculovirus:

(1) the domestication process of suspension cell:

The insect cell Highfive (from the biochemical cell Wang Gang of the institute group of the Chinese Academy of Sciences) that treats adherent culture reached for 3 generations, and cell is obvious division phase, and the visual field is limpid; Adherent cell collecting reaches 250ml serum bottle (rolling bottle), cell density 4 * 10 ⁵, final volume 50ml; The low temperature shaking table, 27 degree, 130rpm cultivated 2-3 days; The rolling bottle cell is moved into the 10cm culture dish, and level left standstill 5 minutes, and the cell granulations of uniting is deposited in the culture dish bottom; Draw the supernatant suspension cell, place the 250ml serum bottle again, cell density 4 * 10 ⁵, final volume 50ml; The low temperature shaking table, 27 degree, 130rpm cultivated 2-3 days; Repeat to unite cell precipitation step 3 time, suspension cell can present the homodisperse state of individual cells, thereby improves efficiency of infection greatly.250ml rolling bottle cell, in low speed centrifuge, with 960rpm centrifugal 4 minutes, supernatant discarded; Cell is resuspended, and with 4 * 10 ⁵Cell density reaches the big rolling bottle of 3L, and final volume is 400ml, and in low temperature shaking table 27 degree, 130rpm is cultured to 2 * 10 ⁶Cell/ml.

(2) transfection of insect cell:

27 degree constant incubators are cultivated the insect cell of above-mentioned domestication, and cell state is good, reaches each hole 9 * 10 of six orifice plates (Corning Incorporated) ⁵Cell, the adherent time is greater than 1h; With obtained glutinous grain and liposome Cellfectin in the above-mentioned steps ^TM(the tall and handsome holder Invitrogen of King Company) mixes, and is covered in six orifice plate insect cell surfaces, in conjunction with 5h; After changing liquid, cultivate 72h, it is 10 that the results supernatant promptly gets virus titer ⁷First-generation recombinant baculovirus; Lysate (laboratory self-control, glycerine (100%) 30ml; Tris-Cl (pH6.8,1M), 15ml; EDTA, 0.22g; SDS, 6g; Tetrabromophenol sulfonphthalein 0.03g; DTT 0.6mol/L) cracking endochylema, and the ultrasonication cell (work 4 ", intermittence 3 ", 4 circulations) and, discharge albumen, the proteic expression of western-blot testing goal; First-generation recombinant baculovirus is infected attached cell once more, and collecting supernatant behind the 48h, promptly to get virus titer be 10 ⁸S-generation recombinant baculovirus, add 2% foetal calf serum, keep in Dark Place in 4 the degree.S-generation virus autographa california nuclear polyhedrosis virus AcNPV/E2-Fc is preserved in Chinese typical culture collection center on April 30th, 2009, and preserving number is CTCC-V200909.

4. the recombinant virus checking of successfully packing:

(1) checking of glutinous grain success reorganization:

Select 3-5 pure white positive colony, glutinous grain is carried out the PCR checking, the results are shown in Figure 7 with the M13 universal primer.As the glutinous grain of extracting as described in the step 2,50V, 150min, 0.8% sepharose (simple Entech Inc.), five groups of bands are complete; The result as shown in Figure 8.

(2) checking of glutinous grain success infection: the glutinous grain of 2-4 pipe is transfection six orifice plate cells respectively, and the observation infection state, and the result as shown in Figure 9.Behind the cell infection, the volume increase also is the cavity transparence.

Proteic preparation of embodiment 2:E2-Fc and checking

1.E2-Fc the expression of target protein:

Good highfive cell to the density of domestication that the 250ml serum bottle is cultivated gained among the embodiment 1 is 2 * 10 ⁶Cells/ml; For positive-virus, infect suspension cell (M.O.I=2) in the serum bottle with win the second place, in low temperature shaking table 27 degree, 130rpm cultivates 72h, avoids uviolizing; In low speed centrifuge, with 2500rpm centrifugal 5 minutes, supernatant was amplification back virus; With the virus after the amplification, cells infected density is 2 * 10 ⁶Big bottle suspension cell (M.O.I=4), in low temperature shaking table 27 degree, 130rpm cultivates 72h, avoids uviolizing; As indicated above observe tangible infection and characterize after, collect a big bottle cell and move to centrifugal bottle, in refrigerated centrifuge 4 degree, with the centrifugal 20min of 6000rpm; Collect supernatant,, collect supernatant once more, promptly get the target protein E2-Fc of secreting, expressing via the 0.45um membrane filtration.

2.E2-Fc purifying:

The E2-Fc albumen that obtains is crossed ProteinG post (GEhealthcare) purifying by AKTA purifying instrument (GE healthcare) and is obtained, and single step purification can obtain more single purpose size strip, SDS-PAGE, the exactness of western-blot checking band.The result is shown in Figure 10 (western-blot) and Figure 11 (SDS-PAGE).

The biological function verification test of embodiment 3E2-Fc

The competitive trials of the natural E2 structural protein of E2-Fc albumen and HCV:

Use Huh7.5.1 cell model (coming from Shanghai Sheng Ke institute Institute Pasteur) HVC virus culture (coming from Shanghai Sheng Ke institute Institute Pasteur), viral secretory is in cell peripheral or be present in the born of the same parents, simultaneously, expressing viral HCV native protein, for example E2 structural protein.

In 96 orifice plates (corning), insert above-mentioned Huh7.5.1 cell, (at P2 Lab, 37 degree are under the 5%CO2 condition) HVC virus culture, 48h; Behind PBS rinse cell 3 times, add 2% Paraformaldehyde 96 stationary liquid and make cell fixation, thereby keep HCV native protein E2.The people is anti--E2 antibody (this antibody by Denis doctor Burton of U.S. Scripps institute present contain the people anti--cells and supernatant of E2 antibody, 1: 100 times of dilution) respectively with treat Reichl's test E2-Fc (0.15mg/ml), uncorrelated albumen RBD-Fc is (from this laboratory, concentration 0.3mg/ml) (negative control) 37 degree incubated in vitro 1h, behind PBS rinse fixed cell 3 times, add mixtures incubated, use two anti-(0.5ug/ml) to detect afterwards available from the anti-people's of goat of Invitrogen company red fluorescence mark.

Test-results as shown in figure 12.Irrelevant albumen and the uncontested ability of natural HCV structural protein, fixing HCV albumen mortise E2 antibody, so show strong fluorescence; E2-Fc albumen with fixedly the HCV protein competition combine E2 antibody, be shown as extremely weak fluorescence.

Test-results as shown in figure 12.Irrelevant albumen RBD-Fc and the uncontested ability of natural HCV structural protein, fixing HCV albumen mortise E2 antibody, so show strong fluorescence; E2-Fc albumen with fixedly the HCV protein competition combine E2 antibody, be shown as extremely weak fluorescence.

The experimental result explanation, E2-Fc and natural HCV structural protein E2 form competition, and anti-E2 specific antibody has specificity to it, so biologically active.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉insect baculovirus expression system and express the proteic method of E2 with it

<130>092115

<160>7

<170>PatentIn?version?3.3

<210>1

<211>999

<212>DNA

＜213〉hepatitis C virus (Hepatitis virus C) E2 albumen

<400>1

gagacccgtg?tgacaggggg?gcagatagcc?agaaatgcct?actcgctcac?gaccctcttt 60

tcatctgggt?cggctcagaa?catccagctc?ataaacacca?acggtagctg?gcacatcaac 120

aggactgccc?tgaactgcaa?tgactccctc?aacaccgggt?ttcttgccgc?gctgttctac 180

acgcacaagt?tcaacgcgtc?cggatgtcca?gagcgcttgg?ccagctgccg?ccccattgac 240

aagttcgatc?aggggtgggg?tcccatcact?tatgctgagc?agggcggcca?ggaccagagg 300

ccttattgct?ggcactacgc?acctaaacca?tgtggtattg?tatccgcgtc?gaaggtgtgt 360

ggtccagtgt?attgtttcac?cccaagccca?gttgtagtgg?ggacgaccga?tcggttcggt 420

gtccctacgt?atagctgggg?ggagaatgag?acagacgtgc?tgctccttaa?caacacgcgg 480

ccgccgcaag?gcaactggtt?cggctgtacg?tggatgaacg?gcactgggtt?caccaagaca 540

tgcgggggcc?ccccgtgtaa?catcgggggg?ggcggcaata?acaccttgac?ctgccctacg 600

gactgtttcc?ggaagcaccc?cgcggccact?tacacaaaat?gtggttcggg?accttggctg 660

acacccaggt?gcttggtaga?ctacccatac?aggctctggc?actacccctg?cactgccaac 720

tttaccatct?tcaaggttag?gatgtatgta?gggggcgtgg?agcacaggct?cgatgctgca 780

tgcaattgga?cccgagggga?acgttgcaac?ttggaggata?gggatagatt?ggagctcagc 840

ccgctactgc?tgtctacaac?agagtggcag?gtgctgccct?gttctttcac?caccctaccg 900

gctctgtcca?ctggtttaat?tcatctccat?cagaacatcg?tggacgtgca?atacctgtac 960

ggtatagggt?cggcagttgt?ttcctttgca?atcaaatgg 999

<210>2

<211>363

<212>PRT

＜213〉hepatitis C virus E2 albumen (Hepatitis virus C)

<400>2

Glu?Thr?Arg?Val?Thr?Gly?Gly?Gln?Ile?Ala?Arg?Asn?Ala?Tyr?Ser?Leu

1 5 10 15

Thr?Thr?Leu?Phe?Ser?Ser?Gly?Ser?Ala?Gln?Asn?Ile?Gln?Leu?Ile?Asn

20 25 30

Thr?Asn?Gly?Ser?Trp?His?Ile?Asn?Arg?Thr?Ala?Leu?Asn?Cys?Asn?Asp

35 40 45

Ser?Leu?Asn?Thr?Gly?Phe?Leu?Ala?Ala?Leu?Phe?Tyr?Thr?His?Lys?Phe

50 55 60

Asn?Ala?Ser?Gly?Cys?Pro?Glu?Arg?Leu?Ala?Ser?Cys?Arg?Pro?Ile?Asp

65 70 75 80

Lys?Phe?Asp?Gln?Gly?Trp?Gly?Pro?Ile?Thr?Tyr?Ala?Glu?Gln?Gly?Gly

85 90 95

Gln?Asp?Gln?Arg?Pro?Tyr?Cys?Trp?His?Tyr?Ala?Pro?Lys?Pro?Cys?Gly

100 105 110

Ile?Val?Ser?Ala?Ser?Lys?Val?Cys?Gly?Pro?Val?Tyr?Cys?Phe?Thr?Pro

115 120 125

Ser?Pro?Val?Val?Val?Gly?Thr?Thr?Asp?Arg?Phe?Gly?Val?Pro?Thr?Tyr

130 135 140

Ser?Trp?Gly?Glu?Asn?Glu?Thr?Asp?Val?Leu?Leu?Leu?Asn?Asn?Thr?Arg

145 150 155 160

Pro?Pro?Gln?Gly?Asn?Trp?Phe?Gly?Cys?Thr?Trp?Met?Asn?Gly?Thr?Gly

165 170 175

Phe?Thr?Lys?Thr?Cys?Gly?Gly?Pro?Pro?Cys?Asn?Ile?Gly?Gly?Gly?Gly

180 185 190

Asn?Asn?Thr?Leu?Thr?Cys?Pro?Thr?Asp?Cys?Phe?Arg?Lys?His?Pro?Ala

195 200 205

Ala?Thr?Tyr?Thr?Lys?Cys?Gly?Ser?Gly?Pro?Trp?Leu?Thr?Pro?Arg?Cys

210 215 220

Leu?Val?Asp?Tyr?Pro?Tyr?Arg?Leu?Trp?His?Tyr?Pro?Cys?Thr?Ala?Asn

225 230 235 240

Phe?Thr?Ile?Phe?Lys?Val?Arg?Met?Tyr?Val?Gly?Gly?Val?Glu?His?Arg

245 250 255

Leu?Asp?Ala?Ala?Cys?Asn?Trp?Thr?Arg?Gly?Glu?Arg?Cys?Asn?Leu?Glu

260 265 270

Asp?Arg?Asp?Arg?Leu?Glu?Leu?Ser?Pro?Leu?Leu?Leu?Ser?Thr?Thr?Glu

275 280 285

Trp?Gln?Val?Leu?Pro?Cys?Ser?Phe?Thr?Thr?Leu?Pro?Ala?Leu?Ser?Thr

290 295 300

Gly?Leu?Ile?His?Leu?His?Gln?Asn?Ile?Val?Asp?Val?Gln?Tyr?Leu?Tyr

305 310 315 320

Gly?Ile?Gly?Ser?Ala?Val?Val?Ser?Phe?Ala?Ile?Lys?Trp?Asp?Tyr?Ile

325 330 335

Val?Ile?Leu?Phe?Leu?Leu?Leu?Ala?Asp?Ala?Arg?Val?Cys?Ala?Cys?Leu

340 345 350

Trp?Met?Met?Leu?Leu?Ile?Ala?Gln?Ala?Glu?Ala

355 360

<210>3

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉Fc forward primer

<400>3

ccgctcgaga?catgcccacc?gtgccca 27

<210>4

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉Fc reverse primer

<400>4

cccaagcttt?ttacccggag?acaggga 27

<210>5

<211>114

<212>DNA

＜213〉artificial sequence

<220>

＜223〉signal peptide sequence

<400>5

atgctactag?taaatcagtc?acaccaaggc?ttcaataagg?aacacacaag?caagatggta 60

agcgctattg?ttttatatgt?gcttttggcg?gcggcggcgc?attctgcctt?tgcg 114

<210>6

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉zymoplasm restriction enzyme site joint sequence

<400>6

ctggtgccgc?gcggctct 18

<210>7

<211>223

<212>PRT

＜213〉artificial sequence

<220>

＜223〉human IgG-Fc fragment

<400>1

Thr?Cys?Pro?Pro?Cys?Pro?Ala?Pro?Glu?Leu?Leu?Gly?Gly?Pro?Ser?Val

1 5 10 15

Phe?Leu?Phe?Pro?Pro?Lys?Pro?Lys?Asp?Thr?Leu?Met?Ile?Ser?Arg?Thr

20 25 30

Pro?Glu?Val?Thr?Cys?Val?Val?Val?Asp?Val?Ser?His?Glu?Asp?Pro?Glu

35 40 45

Val?Lys?Phe?Asn?Trp?Tyr?Val?Asp?Gly?Val?Glu?Val?His?Asn?Ala?Lys

50 55 60

Thr?Lys?Pro?Arg?Glu?Glu?Gln?Tyr?Asn?Ser?Thr?Tyr?Arg?Val?Val?Ser

65 70 75 80

Val?Leu?Thr?Val?Leu?His?Gln?Asp?Trp?Leu?Asn?Gly?Lys?Glu?Tyr?Lys

85 90 95

Cys?Lys?Val?Ser?Asn?Lys?Ala?Leu?Pro?Ala?Pro?Ile?Glu?Lys?Thr?Ile

100 105 110

Set?Lys?Ala?Lys?Gly?Gln?Pro?Arg?Glu?Pro?Gln?Val?Tyr?Thr?Leu?Pro

115 120 125

Pro?Ser?Arg?Asp?Glu?Leu?Thr?Lys?Asn?Gln?Val?Ser?Leu?Thr?Cys?Leu

130 135 140

Val?Lys?Gly?Phe?Tyr?Pro?Ser?Asp?Ile?Ala?Val?Glu?Trp?Glu?Ser?Asn

145 150 155 160

Gly?Gln?Pro?Glu?Asn?Asn?Tyr?Lys?Thr?Thr?Pro?Pro?Val?Leu?Asp?Ser

165 170 175

Asp?Gly?Pro?Phe?Phe?Leu?Tyr?Ser?Lys?Leu?Thr?Val?Asp?Lys?Ser?Arg

180 185 190

Trp?Gln?Gln?Gly?Asn?Val?Phe?Ser?Cys?Ser?Val?Met?His?Glu?Ala?Leu

195 200 205

His?Asn?His?Tyr?Thr?Gln?Lys?Ser?Leu?Ser?Leu?Ser?Pro?Gly?Lys

210 215 220

<210>8

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉E2 forward primer

<400>8

cgcggatccg?agacccgtgt?gacagg 26

<210>9

<211>

<212>DNA

＜213〉artificial sequence

<220>

＜223〉E2 reverse primer

<400>9

ccgctcgaga?gagccgcgcg?gcaccagcca?tttgattgca 40

Claims

1. a recombinant baculovirus is characterized in that, described baculovirus is deposited in Chinese typical culture collection center, and preserving number is CGMCC No.CTCC-V200909.

2. recombinant baculovirus as claimed in claim 1 is characterized in that described recombinant baculovirus contains recombinant expression cassettes, and the shaft-like expression cassette of described reorganization contains:

Virus polyhedrin promotor P10, GP67 signal peptide sequence, E2 albumen coded sequence, zymoplasm restriction enzyme site joint, humanized IgG-Fc encoding sequence and Sv40PolyA.

3. recombinant baculovirus as claimed in claim 2 is characterized in that, described GP67 signal peptide is between polyhedrin and E2 albumen coded sequence.

4. recombinant baculovirus as claimed in claim 2 is characterized in that, described zymoplasm restriction enzyme site joint and humanized IgG-Fc encoding sequence is connected to described E2 albumen coded sequence downstream in turn.

5. recombinant baculovirus as claimed in claim 2 is characterized in that, the E2 albumen of described E2 albumen coded sequence coding SEQ ID NO:2.

6. produce the proteic method of reorganization E2 for one kind, it is characterized in that, may further comprise the steps:

With the described recombinate shape virus infection insect cell of claim 1, the reorganization E2 albumen that separation and purification produces.

7. method as claimed in claim 6 is characterized in that, described insect cell is removed the cell of uniting by repeating suspension culture.

8. method as claimed in claim 7 is characterized in that, described insect cell is the highfive insect cell.

9. a reorganization E2 albumen is characterized in that described albumen is E2-zymoplasm restriction enzyme site joint-humanized IgG-Fc fusion rotein.

10. reorganization E2 albumen as claimed in claim 9 is characterized in that, between described proteic zymoplasm restriction enzyme site joint and humanized IgG-Fc fragment the XhoI restriction enzyme site is arranged.