CN101886140A

CN101886140A - Multiple PCR detection kit for virus hepatitis pathogens and preparation and application thereof

Info

Publication number: CN101886140A
Application number: CN2010102203534A
Authority: CN
Inventors: 刘晓颖; 邵俊杰; 张敬敬; 王迅
Original assignee: SHANGHAI BLOOD CENTER
Current assignee: SHANGHAI BLOOD CENTER
Priority date: 2010-07-06
Filing date: 2010-07-06
Publication date: 2010-11-17
Anticipated expiration: 2030-07-06
Also published as: CN101886140B

Abstract

The invention belongs to the field of biological science, in particular to a multiple PCR detection kit for virus hepatitis pathogens and preparation and application thereof. The multiple PCR detection kit comprises one or combination of two to seven of seven primer pairs, and the seven primer pairs specifically correspond to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalovirus, herpes simplex virus type 1, herpes simplex virus type 2 and herpes simplex virus type 6 respectively. The multiple PCR detection kit can be effectively used for detecting virus hepatitis pathogens, and has the advantages of simple and convenient production method and use and operation, high accuracy, and capacities of saving time, reagents and expenditure and providing more accurate diagnostic information for clinical service.

Description

Multiple PCR detection kit and preparation and application at the viral hepatitis pathogenic agent

Technical field

The invention belongs to bio-science field, be specifically related to a kind of multiple PCR detection kit and preparation and application at the viral hepatitis pathogenic agent.

Background technology

Viral hepatitis serious threat human health also is the common disease and the frequently-occurring disease of China.Chronic hepatitis can be made progress and is hepatic fibrosis, and develops into liver cirrhosis, whole latter stage hepatopathy etc.In each Clinical types hepatitis, the simple infection rate is 61.4%, and the superinfection rate is 32.4%, and the triple infection rate is 6.5%.Rough estimation, China is used for the direct medical cost of hepatitis symptomatic treatment every year above 1,000 hundred million yuans.Except that first, second, third, hepatitis that hepatitis E virus caused, confirmed already at present that Human cytomegalic inclusion disease virus (HCMV), hsv (HHV) etc. all can cause viral hepatitis.The viral overwhelming majority who causes viral hepatitis can propagate via blood transfusion.Blood transfusion medical science is important support means indispensable in the modern medicine, and along with the development of clinical treatment technology and the raising of social senilization's degree, its importance further highlights.

Simultaneously, potential virus is the important factor that threatens blood safety always.Because the usage quantity of blood products is big, applied range, so its social influence also is huge.The virus infection of in normal blood donor, hiding, also have the huge hepatitis of number, and in these clinical type hepatitis, 10～20% acute, chronic hepatitis cause of disease is not clear in addition.Therefore strengthen the safety that the etiological diagnosis technology not only can improve blood products, also will provide reliable basis, have bigger development prospect for the correct diagnosis of viral hepatitis clinically.

At present, mainly concentrate both ways at the detection of pathogenic agent, the one, by immunization method as, ELISA etc. detect pathogen antigen/antibody, the 2nd, detect pathogen nucleic acid by molecular biology method such as PCR.All there is the common shortcoming in these detection methods, and it is long to detect spended time exactly, and once experiment only can obtain a kind of result.And for the viral hepatitis pathogenic agent except that HBV, HCV have conventional detection method, a lot of pathogenic agent all lack detection means effectively.

Common round pcr is only used a pair of primer, produces a nucleic acid fragment by pcr amplification, is mainly used in the evaluation of single virulence factor etc.And corresponding with it, multiplex PCR (multiplex PCR), claim multi-primers PCR or composite PCR again, this technology is to add primer more than two pairs in same PCR reaction system, amplify the PCR reaction of a plurality of nucleic acid fragments simultaneously, its reaction principle, reaction reagent and operating process are identical with general PCR.

Detect when multiple PCR technique can be used for multiple pathogenic micro-organism or identify, the somatotype evaluation of some inherited disease and oncogene etc.The characteristics of multiple PCR technique comprise: high efficiency, and in same PCR reaction tubes, detect multiple pathogenic micro-organism simultaneously, or the goal gene that a plurality of types are arranged is carried out somatotype, particularly just can detect multiple pathogenic agent with a sample; Systematicness, multiplex PCR are suitable for the detection of pathogenic agent in groups very much; Economical and convenient, multiple pathogenic agent detects in same reaction tubes simultaneously, will save time greatly, saves reagent, and the reduction of expenditure spending provides more diagnostic messages more accurately for clinical.Because this technology has above-mentioned advantage, therefore obtain those skilled in the art's attention gradually.

Yet, in the actual application of multiple PCR technique, owing in same reaction tubes, add many primers, therefore the specificity that how to improve primer is avoided non-specific amplification, how to be reduced the dimer that forms between many primers, concentration how to regulate and control the PCR reaction reagent and reaction conditions thereof, make it to reach problems such as effective amplification, all limited the application of multiple PCR technique each purpose fragment.

Summary of the invention

The objective of the invention is to overcome the defective of prior art, a kind of multiple PCR detection kit and preparation and application at the viral hepatitis pathogenic agent is provided.

The present invention adopts following technical scheme to solve the problems of the technologies described above:

A kind of multiple PCR detection kit at the viral hepatitis pathogenic agent, this detection kit comprise following seven kinds of primer centerings one or both to seven kinds combination, described seven kinds of primers are to special corresponding to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and hsv 6 types respectively.

Preferable, also contain the standard virus positive reference substance of corresponding above-mentioned various combinations in the described multiple PCR detection kit, described positive reference substance contains the plasmid of corresponding viral fragment for the formation that links to each other with pGEM-T Easy carrier of the pcr amplified fragment with above-mentioned virus; Concrete, described positive reference substance is the standard virus positive reference substance that corresponds respectively to corresponding to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and hsv 6 types, and described standard virus positive reference substance will be for using corresponding to the primer of various viruses link to each other with the pGEM-T Easy carrier plasmid of formation of the product that carries out pcr amplification.

Preferably, also contain dNTP, Mg in the described multiple PCR detection kit ²⁺(1.5-5mM), RT-PCR reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor, DEPCH ₂O and agarose; Above-mentioned substance also can obtain by commercially available approach.

Described seven kinds of primers also can be to be assemblied in the test kit after two kinds to the seven kinds combined hybrid to packing separately; When mix the assembling primer to the time, mix primer is to being the mixed of 1-2: 1-2: 1-2: 1-2: 1-2: 1-2: 1-2 according to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and the right mole number of these seven kinds of primers of hsv 6 types.

Preferable, described primer is followed successively by the final concentration in reaction system: 200nmol/L, 200nmol/L, 200nmol/L, 200nmol/L, 200nmol/L, 200nmol/L and 200nmol/L.

Preferably, in the test kit of the present invention, the sequence of described seven pairs of Auele Specific Primers is respectively as shown in following table:

Second aspect present invention provides a kind of method that is used for the identification and detection of multiple viral hepatitis pathogenic agent, and this method comprises:

1) gathers the sample viral nucleic acid;

2) form the PCR reaction system, this PCR reaction system comprises multi-primers, dNTP, Mg ²⁺, reverse transcription-pcr reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor and DEPCH ₂O;

3) viral nucleic acid, the positive reference substance that makes in the step 1) joined step 2 respectively) in the mixed solution that makes, make the PCR reaction solution;

4) use PCR reaction solution of the present invention, carry out the nucleic acid fragment after pcr amplification reaction obtains increasing;

5) nucleic acid fragment that obtains after the amplification in the step 4) is carried out electrophoresis and identify, get final product the hepatitis virus kind that is contained in the judgement sample.

Preferable, step 2) in, the concentration of described multi-primers is that the concentration of 100～500nmol/L, described dNTP is 150-400mmol/L, Mg ²⁺Concentration be that 1.5-5mmol/L, RNase inhibitor are 1-5U.

Preferable, in the step 3), described viral nucleic acid comprises DNA and RNA, and the viral nucleic acid that adds in the described PCR reaction solution is 1-5ug.

Preferable, in the step 4), the condition of described pcr amplification reaction is: 50 ℃ of 30min, and 95 ℃ of 15min, 94 ℃ of 30s then, 55 ℃ of 1min, 72 ℃ of 3min hocket 35 and circulate, and extend 10min at 72 ℃ then.

Preferable, in the step 5), described electrophoresis identifies that being to use the agarose weight percent is that 1～1.5% sepharose carries out electrophoresis and identifies.

Among the present invention, described sample viral nucleic acid as template can separate preparation according to existing extracting method by those skilled in the art.Preferred method for separating and preparing use QIAamp MinElute Virus Spin kit can purify DNA also can purifying RNA, the reagent specification sheets is seen in concrete operations.Mainly comprise lytic virus, cross post isolated viral nucleic acid, wash-out impurity is collected nucleic acid.

Among the present invention, dNTP, Mg in the described PCR reaction system ²⁺, reverse transcription-pcr reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor and DEPCH ₂O all can be obtained by commercially available approach by those skilled in the art.

Third aspect present invention provides the Auele Specific Primer that is used to detect multiple viral hepatitis pathogenic agent, and its sequence is as shown in SEQ ID NO:1-14.

Fourth aspect present invention provides a kind of virus-positive reference substance, and described virus-positive reference substance constitutes the plasmid that contains corresponding viral fragment for the pcr amplified fragment with above-mentioned virus links to each other with pGEM-T Easy carrier.

Preferable, described virus-positive reference substance is to be made by the preparation method who comprises the steps:

1, separates viral nucleic acids such as hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, hsv 6 types;

2, form the PCR reaction system, this PCR reaction system comprises multi-primers, dNTP, Mg ²⁺, reverse transcription-pcr reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor and DEPCH ₂O;

3, with make in the step 1 viral nucleic acid join in the mixed solution that step 2 makes, make the PCR reaction solution;

4, carry out pcr amplification reaction and reclaim the PCR product, carry out electrophoresis then and identify;

5, pGEM-T Easy carrier ligation: the PCR product that makes in the step 4 is connected in the pGEM-TEasy carrier, then through transform, positive colony is identified, enzyme is cut and identified and the extracting plasmid can make the virus-positive reference substance.

Preferable, in the step 4, at the reaction conditions of the pcr amplification reaction of RNA viruses be: 50 ℃ of 30min, 95 ℃ of 15min, 94 ℃ of 30s then, 55 ℃ of 30s, 72 ℃ 30 hockets 30 and circulates, and extends 10min at 72 ℃ then; Pcr amplification reaction condition at dna virus is: 95 ℃ of 15min, and 94 ℃ of 30s then, 55 ℃ of 30s, 72 ℃ of 30s hocket 30 and circulate, and extend 3min at 72 ℃ then.

Preferable, in the step 5, the step of described carrier ligation is: add the PCR purified product of 2 μ l, the pGEM-T Easy carrier of 1 μ l, 2 * T of 5 μ l in sterilization Eppendorf pipe ₄Dna ligase connects the T of buffer, 1 μ l fast ₄The ddH of dna ligase and 1 μ l ₂O, then with ligation pipe mixing, 4 ℃ of overnight incubation.

In the step 5, described conversion, positive colony are identified, enzyme is cut evaluation and extracting plasmid step can be determined according to prior art by those skilled in the art.

Preferable, the concrete steps of described conversion are:

(1) gets 1 100 μ l competent cell suspension (freezing in this way preservation liquid then needs to thaw on ice), add 10 μ l ligation liquid;

(2) after above sample shook up, ice bath 30min flicked mixing every 3 minutes;

(3) 42 ℃ of water-baths were placed 90 seconds, fast pipe were transferred to 2min in the ice bath;

(4) add the 0.8mlLB liquid nutrient medium in aforementioned tube, make cumulative volume reach 0.9ml, shake up the back in 37 ℃, 180 * g shaking culture 90min makes the recipient bacterium state that restore normal growth, and expresses the antibiotic resistance gene product;

(5) with inoculum 4000 * g, centrifugal 2min abandons 800 μ l supernatants, gets 50 μ l after all the other are beaten and spare and is coated with LB (Amp ^rDull and stereotyped);

(6) treat bacterium liquid fully by after the substratum absorption, inversion culture plate overnight incubation in 37 ℃ of incubators.

Preferable, the concrete steps that described positive colony is identified are:

1. the toothpick picking of sterilization transforms the single bacterium colony of intestinal bacteria on the flat board, is inoculated in the 3mlLB liquid nutrient medium (to contain penbritin 100 μ g/ml), and 37 ℃, 200rpm/min spends the night;

2. adopt the plasmid extraction test kit, extract plasmid and electrophoresis and identify.

Preferable, described enzyme is cut the concrete steps of identifying and is:

I. endonuclease reaction:

In the 0.5ml Eppendorf pipe of sterilization, add following solution in order and form the endonuclease reaction system:

10 * enzyme is cut buffer	??2μl
10 * enzyme is cut buffer	??2μl	Reorganization Plasmid	??4μl
Restriction enzyme EcoR I	??2μl	Reorganization Plasmid	??4μl
Restriction enzyme EcoR I	??2μl	Restriction enzyme Hind III	??2μl
??ddH ₂O	??10μl	Restriction enzyme Hind III	??2μl

II. flick and make it several times to mix, instantaneous centrifugal on whizzer, seal the centrifugal mouth of pipe with film;

III.37 ℃ of water-bath spent the night;

IV. get above-mentioned endonuclease reaction thing solution 10 μ l, sepharose (1.0%) electrophoresis is observed the endonuclease reaction situation;

V. select an enzyme and cut positive, draw plate and cultivate, and in sterile glycerol Guan Zhongbao kind;

VI. the evaluation of checking order of preliminary evaluation is good bacterium.

Advantage of the present invention and beneficial effect:

In the present invention, utilize the character of virus characteristic and nucleic acid.Detect based on these characteristics and character viral hepatitis in the goods such as blood virus have a situation.Compare with other method for detecting virus, the present invention has several tangible advantages and beneficial effect.

1. have high efficiency, systematicness and economical and convenient; 2. many kinds of pathogenic agent detect in same reaction tubes simultaneously, but big time saver and reagent, and reduction of expenditure spending provides more diagnostic messages more accurately for clinical.

Description of drawings

The detected result electrophorogram of Fig. 1 positive reference substance.

The detected result electrophorogram of Fig. 2 hepatitis B virus sample.

The detected result electrophorogram of Fig. 3 human cytomegalic inclusion disease virus sample.

The detected result electrophorogram of Fig. 4 herpes simplex virus type 1 sample.

Embodiment

Further set forth the present invention below in conjunction with embodiment.Should be understood that embodiment only is used to illustrate the present invention, but not limit the scope of the invention.The reagent of the experimental technique of unreceipted actual conditions and undeclared prescription is according to people such as normal condition such as Sambrook among the embodiment, molecular cloning: the condition of the condition described in the test handbook (New York:Cold Spring HarborLaboratory Press, 1989) or manufacturers's suggestion is carried out or is disposed.

The invention provides a kind of multiple PCR detection kit at the viral hepatitis pathogenic agent, this test kit comprises: one or both of seven kinds of primer centerings are to seven kinds combination, and these seven kinds of primers are to special corresponding to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and hsv 6 types respectively.The use-pattern of above-mentioned primer is for being used in combination separately or multiple primer forms mixture and uses later on.

In addition, test kit of the present invention can also comprise reaction solution, polysaccharase, and the standard virus positive reference substance.This standard virus positive reference substance contains the segmental plasmid of corresponding viral nucleic acid for formation that the pcr amplified fragment of above-mentioned viral nucleic acid is linked to each other with pGEM-T Easy carrier.

In this test kit, the implication of described " multiple primer formation mixture " is meant that different primers mixes the mix primer that forms according to mass ratio (mol ratio); The implication of described " being used in combination separately " is meant different primers to respectively independent packaging, selects pointedly during use and mixes, and comprises also that two or more combinations with seven kinds of different primer centerings mix in advance to select to use after the back forms mix primer again.

Embodiment 1 is at the preparation of the multiple PCR detection kit of viral hepatitis pathogenic agent:

1, the preparation of virus-positive reference substance:

1) viral nucleic acid of separation hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, hsv 6 C-type virus Cs;

2) form the PCR reaction system, this PCR reaction system comprises multi-primers, dNTP, Mg ²⁺, reverse transcription-pcr reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor and DEPCH ₂O; Wherein, described multi-primers sequence and product size are referring to shown in the table 1;

The sequence of seven pairs of Auele Specific Primers of table 1 and amplified production size

3) with make in the step 1) viral nucleic acid join step 2) in the mixed solution that makes, make the PCR reaction solution;

4) carry out pcr amplification reaction and reclaim the PCR product, carry out electrophoresis then and identify; Reaction conditions at the pcr amplification reaction of RNA viruses is: 50 ℃ of 30min, and 95 ℃ of 15min, 94 ℃ of 30s then, 55 ℃ of 30s, 72 ℃ 30 hockets 30 and circulates, and extends 10min at 72 ℃ then; Pcr amplification reaction condition at dna virus is: 95 ℃ of 15min, and 94 ℃ of 30s then, 55 ℃ of 30s, 72 ℃ of 30s hocket 30 and circulate, and extend 3min at 72 ℃ then;

5) pGEM-T Easy carrier ligation: the PCR product that makes in the step 4) is connected in the pGEM-TEasy carrier, then through transform, positive colony is identified, enzyme is cut and identified and the extracting plasmid can make the virus-positive reference substance.Wherein, the step of carrier ligation is: add the PCR purified product of 2 μ l, the pGEM-T Easy carrier of 1 μ l, 2 * T of 5 μ l in sterilization Eppendorf pipe ₄Dna ligase connects the T of buffer, 1 μ l fast ₄The ddH of dna ligase and 1 μ l ₂O, then with ligation pipe mixing, 4 ℃ of overnight incubation.

Wherein, the Connection Step of PCR product fragment and pGEM-T Easy carrier is the use dna ligation kit, and the operation instruction in the reference reagent box is carried out.

Wherein, the concrete steps of described conversion are:

(1) gets 100 μ l competent cell suspensions, add 10 μ l ligation liquid;

(2) after above sample shook up, ice bath 30min flicked mixing every 3 minutes;

Wherein, the concrete steps identified of described positive colony are:

Wherein, described enzyme is cut the concrete steps of identifying and is:

I. endonuclease reaction:

III.37 ℃ of water-bath spent the night;

In the present embodiment, described sample viral nucleic acid as template can separate preparation according to existing extracting method by those skilled in the art.Method for separating and preparing use QIAamp MinElute Virus Spin kit can purify DNA also can purifying RNA, the reagent specification sheets is seen in concrete operations.Mainly comprise lytic virus, cross post isolated viral nucleic acid, wash-out impurity is collected nucleic acid.

The preparation of embodiment 2, multiplex PCR detection architecture and assembling:

1, primer is synthetic:

Primer is synthetic by the ABI of u.s.a. applied biosystem company, seven kinds of primers are special respectively corresponding to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and hsv 6 C-type virus Cs to (SEQ ID NO:1～14), specifically as shown in table 1.With the primer of corresponding each type virus to hybrid packed, when hybrid packed, mix primer is to being 1: 1: 1 according to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and the right mole number of these seven kinds of primers of hsv 6 types: 1: 1: 1: 1 mixed.Simultaneously, with the standard virus positive reference substance of the corresponding various combinations that make among embodiment packing separately respectively.

With dNTP, Mg ²⁺(1.5-5mM), RT-PCR reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor, DEPCH ₂O and agarose, and the standard virus positive reference substance of preparation among the embodiment 1 are formed multiplex PCR detection architecture test kit after also having the synthetic primer to packing.

The detection of embodiment 3, positive reference substance:

The multiple PCR detection kit that obtains in the Application Example 2 detects the hepatitis A virus in the positive reference substance that makes among the embodiment 1, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus 1,2 types, hsv 6 types.

Detection method is as follows:

Form the PCR reaction system, this PCR reaction system comprises multi-primers, dNTP, Mg ²⁺, reverse transcription-pcr reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor and DEPCH ₂O; The positive reference substance that makes among the embodiment 1 is joined respectively in the above-mentioned mixed solution, make the PCR reaction solution; Use this PCR reaction solution, carry out the nucleic acid fragment after pcr amplification reaction obtains increasing respectively; It is that 1～1.5% sepharose carries out electrophoresis and identifies that the nucleic acid fragment that obtains after the amplification is used the agarose weight percent, the hepatitis virus kind that is contained in can judgement sample.

In the PCR reaction solution, the final concentration of multi-primers is that the concentration of 200nmol/L, dNTP is 150mmol/L, Mg ²⁺Concentration be that 1.5mmol/L, RNase inhibitor are 3U.The condition of pcr amplification reaction is: 50 ℃ of 30min, and 95 ℃ of 15min, 94 ℃ of 30s then, 55 ℃ of 1min, 72 ℃ of 3min hocket 35 and circulate, and extend 10min at 72 ℃ then.

Wherein, dNTP, the Mg in the PCR reaction system ²⁺, reverse transcription-pcr reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor and DEPCH ₂O.

Detected result as shown in Figure 1.

In the positive reference substance of six kinds of viral hepatitis, checking multiplex PCR amplification system.Wherein, the primer of HHV1, HHV2 is a universal primer.Agarose gel electrophoresis shows that using the multiplex PCR amplification system all has positive band in the positive colony reference substance of viral hepatitis pathogenic agent, and stripe size conforms to expected results (expected results is as shown in table 1).Above presentation of results, this amplification system can effectively be increased in the positive sample product, and band is clear, and specificity is good.

The detection of embodiment 4, hepatitis B virus sample:

Using multiplex PCR detection architecture of the present invention, is example with the hepatitis B virus sample, checking multi-PRC reaction system, and reaction conditions is with embodiment 3, and the result is as shown in Figure 2.In the seropositivity sample of hepatitis B virus, use the multiplex PCR amplification, detect the existence of viral hepatitis pathogenic agent.Agarose gel electrophoresis shows that quoting the multiplex PCR amplification system has positive band in the hepatitis B virus sample, and stripe size conforms to expected results.Above presentation of results, this amplification system can effectively be increased in the positive sample product, and band is clear, and specificity is good.

The detection of embodiment 5, human cytomegalic inclusion disease virus sample:

Using multiplex PCR detection architecture of the present invention, is example with the human cytomegalic inclusion disease virus sample, checking multi-PRC reaction system, and reaction conditions is with embodiment 3, and the result is as shown in Figure 3.

In the positive sample of human cytomegalic inclusion disease virus, use the multiplex PCR amplification, detect the existence of viral hepatitis pathogenic agent.Agarose gel electrophoresis shows that using the multiplex PCR amplification system has positive band in the human cytomegalic inclusion disease virus sample, and stripe size conforms to expected results.Above presentation of results, this amplification system can effectively be increased in the positive sample product, and band is clear, and specificity is good.

The detection of embodiment 6, herpes simplex virus type 1 sample:

Using multiplex PCR detection architecture of the present invention, is example with the herpes simplex virus type 1 sample, checking multi-PRC reaction system, and reaction conditions is with embodiment 3, and the result is as shown in Figure 4.

In the positive sample of herpes simplex virus type 1, use the multiplex PCR amplification, detect the existence of viral hepatitis pathogenic agent.Agarose gel electrophoresis shows that using the multiplex PCR amplification system has positive band in the herpes simplex virus type 1 sample, and stripe size conforms to expected results.Above presentation of results, this amplification system can effectively be increased in the positive sample product, and band is clear, and specificity is good.

Claims

1. multiple PCR detection kit at the viral hepatitis pathogenic agent, this detection kit comprise seven kinds of primer centerings one or both to seven kinds combination, described seven kinds of primers are to special corresponding to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and hsv 6 types respectively.

2. the multiple PCR detection kit described in claim 1 at the viral hepatitis pathogenic agent, it is characterized in that, also contain the standard virus positive reference substance that corresponds respectively to corresponding to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and hsv 6 types in the described multiple PCR detection kit, and described standard virus positive reference substance will be for using corresponding to the primer of various viruses link to each other with the pGEM-T Easy carrier plasmid of formation of the product that carries out pcr amplification.

3. the multiple PCR detection kit at the viral hepatitis pathogenic agent described in claim 1 is characterized in that, also contains dNTP, Mg in the described multiple PCR detection kit ²⁺, RT-PCR reaction solution, reversed transcriptive enzyme and archaeal dna polymerase single stage method enzyme mixed solution, RNase inhibitor, DEPCH ₂O and agarose.

4. the multiple PCR detection kit at the viral hepatitis pathogenic agent described in claim 1 is characterized in that, described two kinds to seven kinds primers are assemblied in the test kit being separated from each other.

5. the multiple PCR detection kit described in claim 1 at the viral hepatitis pathogenic agent, it is characterized in that, be assemblied in the test kit after described two kinds to the seven kinds combined hybrid, and mix primer is to being 1～2: 1～2 according to hepatitis A virus, hepatitis B virus, hepatitis C virus, human cytomegalic inclusion disease virus, herpes simplex virus type 1, herpes simplex virus type 2 and the right mole number of these seven kinds of primers of hsv 6 types: 1～2: 1～2: 1～2: 1～2: 1～2 mixed.

6. as arbitrary described multiple PCR detection kit in the claim 1～5, it is characterized in that the sequence of described seven pairs of Auele Specific Primers respectively is shown in SEQ ID NO:1～14 at the viral hepatitis pathogenic agent.

7. method that is used for the identification and detection of multiple viral hepatitis pathogenic agent, this method comprises:

1) gathers the sample viral nucleic acid;

4) the PCR reaction solution that obtains in the use step 3) carries out the nucleic acid fragment after pcr amplification reaction obtains increasing;

8. the method for the identification and detection that is used for multiple viral hepatitis pathogenic agent described in claim 7 is characterized in that step 2) in, the concentration of described multi-primers is that the concentration of 100～500nmol/L, described dNTP is 150-400mmol/L, Mg ²⁺Concentration be that 1.5-5mmol/L, RNase inhibitor are 1-5U.

9. the method for the identification and detection that is used for multiple viral hepatitis pathogenic agent described in the claim 7, it is characterized in that, in the step 4), the condition of described pcr amplification reaction is: 50 ℃ of 30min, 95 ℃ of 15min, 94 ℃ of 30s then, 55 ℃ of 1min, 72 ℃ of 3min hocket 35 and circulate, and extend 10min at 72 ℃ then.

10. the Auele Specific Primer that is used to detect multiple viral hepatitis pathogenic agent is right, a kind of for seven kinds of primer centerings of the following stated:

1) it is right to be specific to the primer of hepatitis A virus:

One of them sequence is: TTAGCATGGAGCTGTAGGA;

Another sequence is: AATGCATCCACTGGATGAGAG;

2) it is right to be specific to the primer of hepatitis B virus:

One of them sequence is: TCTTCAACCACCAGCACGG G;

Another sequence is: GAACCACTGAACAAATGGCA;

3) it is right to be specific to the primer of hepatitis C virus:

One of them sequence is: GTGATGGGAAGCTCCTACGG;

Another sequence is: GGGGTCCAGGTCACAACA;

4) it is right to be specific to the primer of human cytomegalic inclusion disease virus:

One of them sequence is: GCCGGATTGTGGATTTCGT;

Another sequence is: CAAACGCAAATCAGCATCCT;

5) it is right to be specific to the primer of herpes simplex virus type 1:

One of them sequence is: TAGCTGGTGTGTTCGGTGTG;

Another sequence is: CACCACCGACCTCAAGTACA;

6) it is right to be specific to the primer of herpes simplex virus type 2:

One of them sequence is: TAGCTGGTGTGTTCGGTGTG;

Another sequence is: CACCACCGACCTCAAGTACA;

7) it is right to be specific to the primer of hsv 6 types:

One of them sequence is: GTGGGGGAACCTGTGCCTGA;

Another sequence is: TTGTACTGCGTGTGGTATCT.