CN101885757B - Avian influenza hemagglutinin, epitope peptide, monoclonal antibodies for resisting avian influenza hemagglutinin and epitope peptide, and applications of monoclonal antibodies - Google Patents

Abstract

The invention discloses an avian influenza hemagglutinin, an epitope peptide, monoclonal antibodies for resisting the avian influenza hemagglutinin and the epitope peptide, and applications of the monoclonal antibodies. The epitope peptide of the invention comprises an amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4. The invention further provides the monoclonal antibodies which can be specifically combined with the hemagglutinin protein of the avian influenza virus, and the combination can be blocked by the epitope peptide sequence. The antibodies have important application value in the aspect of specific diagnosis of the avian influenza virus. Because the antibodies provided by the invention specifically aim at the epitope sequence of the avian influenza virus, the cross reactivity of the immune reaction is greatly reduced, and the antibodies are especially suitable for rapid diagnosis of avian influenza diseases.

Description

Avian flu virus hemagglutinin, epitope peptide and anti-their monoclonal antibody and application thereof

Technical field

The present invention relates to avian flu virus hemagglutinin, its epitope peptide and anti-their monoclonal antibody, and their application in preparation avian influenza virus vaccine and diagnostic reagent.

Background technology

Bird flu is exactly the viral influenza of bird, is a kind of transmissible disease from respiratory system to multiple symptoms such as serious whole body septicemia that is caused bird by A type influenza virus, and mortality ratio was very high after bird infected.Generally, this poultry disease can not cause human beings'health and seriously influence.Took place in Hong Kong when the susceptible example of the first highly pathogenic bird flu virus H 5 N 1 people in 1997,2003 with and subsequent the susceptible example of 2005-2006 people from the whole world constantly take place successively, caused the fear in the world.H5N1 virus becomes the focus in the world with its high mortality with to the danger that the people infects.The main method that birds flu-preventing is propagated in the crowd is a vaccine immunity.The method cycle of traditional preparation process influenza vaccines is long, can not satisfy the prevention requirement of bird flu short period of time outburst.

Along with development of biology, various new generation vaccines arise at the historic moment.Epiposition vaccine is the composition vaccine that under this overall situation, produces.Because be small peptide, immunogenicity is little, is difficult for causing side reaction.If epitope specificity is high, and is more pointed, immune effect is better than whole protein or whole virus vaccine.

Hemagglutinin HA albumen is the important target protein that bird flu virus produces neutralizing antibody and vaccine development, because of its height variability, causes the immunologic escape of virus and the inefficacy of vaccine.HA albumen with biological function is formed by connecting through disulfide linkage HA1 and two subunits of HA2.Receptors bind zone (receptorbinding domain RBD) in the HA1 subunit is the main position that combines host cell, also is the position occurred frequently of HA protein mutation.Around the RBD structural domain, be relatively more conservative HA sequence, the H5N1 HA protein sequence similarity of different strains is up to 93%.Therefore, seek the top priority that the conservative neutralizing epitope of HA albumen becomes the development epiposition vaccine.Wenxin Luo (Biochem.J. (2008) Immediate Publication; Doi:10.1042/BJ20080083) etc. the people uses neutralizing antibody 8H5 (also being the monoclonal antibody to Vietnam's strain) screening that a strain has a cross neutralization effect 12 peptide phage libraries at random, obtains some simulation neutralizing epitopes.People (J Virol.2007Dec such as Nikolai V.Kaverin; 81 (23): 12911-7.) use anti-Vietnam strain (VN04) monoclonal antibody that different H5N1 strains are carried out hemagglutination-inhibition test through the recombinant virus system and carry out the epitope mapping analysis.The result just finds the site of several keys, and almost whole HA albumen has been contained in these sites, does not have concrete specific aim.People such as Angeline PC Lim use anti-Vietnam strain (VN04-2) monoclonal antibody, utilize H5N1 virus appearance particle (virus-like particles) (H5N1-VLP) to eight strain H5N1:A/Vietnam/1203/04, A/DK/Vietnam/376/05; A/BhGs/Qing Hai/65/05, A/CK/Ivory Coast/1787/06, A/Zhe Jiang/16/06; A/DK/Guangzhou/20/05; A/Indonesia/CDC597/06, A/Indonesia/5/05, A/CK/Indonesia/R60/05; Carried out neutralization test widely, found that 140 rings are important neutralizing epitope zones in the HA sequence.The 130-140 zone of bird flu HA has been reported in this research first.

Big country is cultured as a large agricultural country and fowl by China, has the population in the world 1/5, becomes bird flu virus propagation and popular center, and the prevention and control of H5N1 are had the important strategic meaning.And China is vast in territory, though the geographic distance between the residing area of isolating strain very remote, and the modern vehicles can make virus disseminating become very fast.Because strain exists certain areal variation on sequence, some difference may cause the change of strain neutralizing epitope sequence, thereby escapes host's immune attack.Therefore in the bird flu prevention, should pay attention to the characteristics of local strain, be also noted that the characteristics of strain overseas with input possibility.

Also be not directed against the research of CONTINENTAL AREA OF CHINA bird flu virus epitope peptide sequence at present.Therefore, the protective antigen of the avian influenza strain of CHINESE REGION is provided, with and accurate epitope peptide sequence and its corresponding monoclonal antibody, and be applied to very necessity of vaccine production and diagnostic reagent preparation.

Summary of the invention

One object of the present invention just provides the epitope peptide sequence of avian flu virus hemagglutinin; Said epitope peptide can stop avian flu virus hemagglutinin to combine with said antibodies specific, and this epitope peptide is used in the screening of the monoclonal antibody of bird flu virus.

Another purpose of the present invention provides can stimulate body to produce the albumen that bird flu virus is had immunoprotective antibody.

A further object of the present invention provides to above-mentioned proteic monoclonal antibody.

A further object of the present invention provides the application of albumen in preparation birds flu-preventing vaccine of above-mentioned immune protective.

A further object of the present invention provides the application of said monoclonal antibody in preparation diagnosis bird flu detection reagent.

Popular H5N1 clade mainly contains four big types in the world at present; The clade 2.3.4 of the special class Fujian clade of appearance and evolution in the Asia; Continue the clade 2.2 of the class Qinghai clade of popular and expansion in Europe, the Middle East and Africa etc.; The clade 2.1 that continues to spread in Indonesia, and the Clade1 of the classics that exist in Vietnam and Hong Kong.The present invention (comprises Qinghai strain isolated QH through the many strains to China; Xinjiang strain isolated XJ; Anhui isolate A H, Hong Kong strain isolated HK) molecular epidemiology and the molecular biology research of the hemagglutinin (HA) of bird flu virus find that QH H5N1 and XJ H5N1 belong to Clade 2.2; AH H5N1 belongs to Clade 2.3.4; HK H5N1 belongs to Clade 1.Be used for our these strains of research and contained at the main clade of China's popular, therefore the neutralizing epitope of discovering through us is the specific epitopes that is fit to China's actual conditions, and is pointed.

The present invention finds that the HA albumen of these virus strain can cause body to produce protection antibody, is the first-selected protective antigen of preparation vaccine, and finds that HA protein 10 0-110 zone and 130-140 zone are important neutralizing epitope zone, i.e. epitope peptide sequence.Thus,

The invention provides a kind of epitope peptide sequence, it contains just like the aminoacid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQID NO:3 or the SEQ ID NO:4.Wherein, SEQ ID NO:1 derives from the proteic aminoterminal of the HA 98-107 amino acids sequence of Hong Kong strain isolated HK; SEQ ID NO:2 derives from the proteic aminoterminal of the HA 98-107 amino acids sequence of Xinjiang strain isolated XJ; SEQ ID NO:3 derives from the proteic aminoterminal of the HA 136-145 amino acids sequence of Hong Kong strain isolated HK, and SEQ ID NO:4 derives from the proteic aminoterminal of the HA 136-145 amino acids sequence of Xinjiang strain isolated XJ.

In an optimized technical scheme, said epitope peptide sequence is shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or the SEQ ID NO:4.The equal ability of this 4 peptide species specific inhibition bird flu virus combines with its neutrality antibody.

Preferably, the present invention further provides the polypeptide of aminoacid sequence shown in SEQ ID NO:5, and this polypeptide is a kind of HA albumen that is located away from the bird flu virus in Xinjiang, i.e. the HA full length sequence of the described Xinjiang of preamble strain isolated XJ.The present invention provides a kind of SEQ of coding ID NO:5 the nucleotide sequence of said polypeptide again.The present invention also provides a kind of expression vector that contains said nucleotide sequence.Preferably, wherein said carrier is the insect viruses expression vector.

The polypeptide of aminoacid sequence shown in the SEQ ID NO:1-SEQ ID NO:5 can produce the protection antibody to bird flu virus by the stimulating organism body.Therefore these polypeptide have great importance in birds flu-preventing infects, and are preferred vaccine antigens; The invention provides the application of these polypeptide in preparation birds flu-preventing vaccine.Wherein SEQ ID NO:1-SEQ ID NO:4 can be used as epiposition vaccine, has the specificity height, prepares the advantage simple, that cost is low.

The present invention further provides monoclonal antibody, and these antibody can combine with the hemagglutinin specificity of bird flu virus, and this combination can be blocked by above-mentioned epitope peptide sequence.These antibody have important use value aspect the specific diagnosis of bird flu virus.Therefore the invention provides the application of these antibody in preparation diagnosis bird flu detection reagent.Because antibody provided by the invention is the epitope sequences that specificity is directed against bird flu virus, has greatly reduced immunoreactive cross reactivity, is particularly useful for the quick diagnosis of bird flu disease.

Description of drawings

Fig. 1 baculovirus eukaryotic protein expression system experiment flow synoptic diagram

Fig. 2 HA-PacGP67 plasmid enzyme restriction of recombinating is identified electrophorogram

Light microscopic figure before and after Fig. 3 sf9 cell infection recombinant baculovirus

Fig. 4 HA protein SDS-PAGE evaluation figure that recombinates

Fig. 5 HA albumen Western-blotting evaluation figure that recombinates

Fig. 6 HA albumen blood clotting test-results of recombinating

Fig. 7 monoclonal antibody and several kinds of proteic cross reaction results of reorganization HA

The calmodulin binding domain CaM of Fig. 8 neutralizing antibody is identified figure

Fig. 9 peptide blocking test identifies that the different sources peptide is to the difference with a kind of affinity of antibody

The ELISA result of Figure 10 mutain antagonist avidity

Figure 11 human and bird fluenza infect serum in the ELISA of antibody

Embodiment

Below in conjunction with accompanying drawing the present invention is further described, but these descriptions are not construed as limiting the invention, protection scope of the present invention is as the criterion with claims.

Through network software SignalP 3.0 Server and TMHMM and bibliographical information, can dope the proteic signal peptide of HA and stride the film district.With XJ is example, and the 17th to 532 amino-acid residue of HA albumen aminoterminal is extracellular fragment, and this section is participated in host immune response, is the target sequence of research avian influenza protective antigen.

Can from the dna profiling of bird flu virus, amplify the aim sequence of this section through the method for PCR, also can obtain the aim sequence of this section through automatic dna synthesizer.After obtaining these target sequences, connect among expression vector, and it is changed over to can express in the segmental host cell of this purpose.Induce host cell expression purpose fragment under suitable condition,, just obtained the HA albumen of reorganization through proteic recovery and purifying.Also can carry out proteic automatic synthesizing of this HA, obtain highly purified HA albumen through the polypeptide automatic DNA synthesizer DNA.

After obtaining highly purified target protein HA, adopt those skilled in the art's Monoclonal Antibody technology on top of, i.e. hybridoma technology can obtain the monoclonal antibody of HA.Particularly, with the target protein immune mouse of purifying, separate its splenocyte earlier.Use cell-fusion techniques that splenocyte and myeloma cell are merged, form hybridoma.Filter out the hybridoma that can produce with the antibody of target protein generation specific immune response afterwards, positive findings means that this hybridoma can synthesize and secrete the antibody of specific anti-HA.

Behind the hybridoma of isolating the above-mentioned antibody of secretion, the present invention also will further identify proteic concrete that zone of these antibody and HA specific immunoreation takes place.The present invention suppresses experiment principle according to the immunity competition and identifies work.At first from the HA protein sequence, select the epitope peptide sequence of some alternative 6-20 amino-acid residue length, obtain these small peptides (its aminoacid sequence such as SEQ ID NO:1～SEQID NO:4 and SEQ ID NO:7-SEQ ID NO:19) through synthetic.Observing which small peptide then can combine with HA is proteic by the above-mentioned antibody of specific inhibition.The short peptide sequence that can produce blocking effect is exactly the epitope peptide sequence of HA, and this sequence has just been represented the proteic antigenic determinant of HA.

After identifying the proteic antigenic determinant of HA, the present invention also will estimate the above-mentioned antibody proteic cross reactivity approaching to various homologys.According to the result, the present invention has confirmed that further which antigenic determinant is a high degree of specificity.

The present invention also uses above-mentioned epitope peptide and HA full-length proteins difference immune mouse, all can induce the generation neutrality antibody; Preferably, when combining two kinds of epitope peptides to carry out immunization, obtained than the better effect of single epitope peptide, and more near the immune effect of full-length proteins.

The present invention prepares the two mutants pseudovirus through site-directed point mutation, has further verified the epi-position that HA albumen 100-110 amino acids is formed through immunological experiment, is the sequence of very important detection virus variation.

The present invention also uses the monoclonal antibody that is obtained and has carried out the detection that immunosuppression is tested to infecting serum, and the result shows that these monoclonal antibodies can provide infecting the specific detection of serum.

To sum up, the invention provides the HA albumen of Chinese bird flu virus strain isolated, and the epitope peptide sequence of antigenic determinant representative on the HA albumen.These albumen or peptide are significant in the propagation of control bird flu virus.At first HA albumen can be prepared into and prevent and treat avian influenza virus vaccine.Because the characteristic of the areal distribution of strain, the special preferred pin of this vaccine is to the geographic Susceptible population of China.In addition, can also use the epiposition vaccine of the polypeptide preparation control bird flu virus that has epitope sequences, this vaccine has specificity height, simple, the economic advantage of preparation.

Method with HA protein Preparation avian influenza virus vaccine can adopt the ordinary skill in the art, for example is equipped with conventional pharmacopedics dressing, like vehicle, sanitas etc.Formulation can be the regular dosage form in pharmacopedics field, for example solution, suspension-s, emulsion etc.Vaccination ways can be injection, oral, atomizing suction, local application etc.Object of inoculation is a Mammals, preferably is the people.

Monoclonal antibody provided by the invention has the specificity of height to bird flu virus HA albumen.Therefore, significant on the specific diagnosis of avian influenza.The application of monoclonal antibody provided by the invention in preparation avian influenza diagnostic kit can be taked the conventional technology in this area, for example enzyme linked immunological adsorption technology, immunosuppression experiment, colloidal gold technique etc.

On the basis of the above-mentioned disclosure of this paper, the present invention is carried out more detailed introduction below in conjunction with specific embodiments and embodiment.

The proteic acquisition of bird flu virus HA can obtain reorganization HA albumen through engineered method, and wherein its encoding sox can obtain through two kinds of approach, promptly

1.DNA the synthetic nucleotide sequence shown in SEQ ID NO:6 of automatic DNA synthesizer DNA.Conventional dna synthesizer gets final product.

2. through polymerase chain reaction (PCR), obtain the nucleotide sequence shown in the SEQ ID NO:6.

Obtain to carry out the Recombinant Protein Expression program according to the Protocols in Molecular Biology of routine behind the purpose nucleotide sequence.

Embodiment 1:

Obtain reorganization HA gene and the specific procedure of the recombinate proteic expression of HA, purifying, evaluation through the PCR approach.

Baculovirus eukaryotic protein expression system express recombinant HA albumen is adopted in this research.The HA albumen of this system expression has native conformation has activity.Its main flow process is as shown in Figure 1.

1, the amplification of PCR approach is to obtain reorganization HA gene fragment

1.1 template preparation:

1.1.1 separation and Culture high pathogenic avian influenza H5N1 virus

Extract the plasmid enzyme restriction evaluation 1.1.2 extract virus total RNA

1.1.3 rt synthesizes cDNA article one chain

1.1.4 the HA fragment PCR reclaims, and connects into pCR-Blunt II-Topo carrier, as template

1.2 pcr amplification: (this increases in the amino-acid residue scope 17-532aa of HA length)

1.2.1 primer sequence:

Upper reaches P1:cgggatccgatcagatttgcattggttac

Downstream P2:gcggccgcctagtgatgatgatgatgtatttggtaagttc

1.2.2 use instrument: TaKaRa TP600

1.2.3 PCR reaction system: 50 μ l

ddH ₂O 34μl

10×buffer 5μl

dNTP 4μl

MgCl ₂ 3μl

P1 1μl

P2 1μl

Taq archaeal dna polymerase 1 μ l

Template DNA 1 μ l

1.2.4 reaction conditions: 95 ℃ of 5min

72℃ 10min

4 ℃ of preservations

1.3 ligation:

Use previously selected BamHI and NotI restriction enzyme, will transmit carrier (transfer vector) PacGP67b, carrier information is please with reference to rhabdovirus expression vector system operation handbook (Baculovirus ExpressionVector System Manual Http:// www.pharmingen.com).Enzyme is cut and is reclaimed.Identify through order-checking, the correct HA gene fragment of order-checking is connected with carrier segments.

Reaction system: 10 μ l

PCR fragment 6 μ l

Carrier segments 2 μ l

10×buffer 1μl

T4 ligase enzyme 1 μ l

1.4 recombinant vectors carries out transfection after cutting evaluation (shown in Figure 2) correctly through enzyme.

Fig. 2 cuts evaluation figure for HA-PacGP67b recombinant plasmid enzyme, DNA band conform to purpose HA gene fragment (shown in the arrow) between 1000-2500bp.

1.5 transfection:

1.5.1 with 2 * 10 ⁶The sf9 cell moves in the 60mm plate, leaves standstill 5min.

1.5.2 with 0.5 μ g linear DNA (BD BaculoGold ^TM554739) with 2 μ g HA-PacGP67b recombinant plasmid mixings, leave standstill 5min, add transfection buffer B liquid (BD BaculoGold ^TM554806) 1ml.

1.5.3 exhaustion sf9 cell conditioned medium adds 1ml transfection bufferA liquid.

1.5.4 on cell, slowly add the transfection buffer B liquid that contains plasmid, 27 ℃, 4h.

The cell conditioned medium 1.5.54 exhaust after hour changes to fresh insect cell substratum.

1.5.65 it back harvested cell supernatant is PI ₁

Judge according to the sf9 cellular form whether recombinant virus successfully infects.Normal sf9 cell is less at (shown in Fig. 3 .1) volume before the transfection, and division growth is vigorous; Sf9 cell (shown in Fig. 3 .2) volume becomes big after infecting recombinant virus, stops division, and cell is floating more.

2, the expression of HA, purifying, evaluation

2.1 the proteic expression of reorganization HA:

2.1.1 with PI ₁Continue to expand malicious three generations and become PI ₃After, adopt the plaque method to detect the recombinant virus titre.

2.1.2 work as virus titer greater than 10 ⁸During/pfu, promptly can be used for expressing protein.

2.1.3 inoculate 2 * 10 ⁷The sf9 cell adds 500 μ l virus liquid in the 150mm dish.

2.1.4 the collecting cell supernatant gets final product after three days.

2.2 the proteic purifying of reorganization HA:

2.2.1 cell conditioned medium is with 4 ℃ of PBS dialysis, 10h.

2.2.2 PEG 8000 concentrate dialysates.

2.2.3 liquid concentrator is crossed Ni+ post (GE His Trap HP)

Shown in Figure 4 is the proteic SDS-PAGE electrophorogram of reorganization HA behind the purifying.Arrow is depicted as reorganization HA albumen (rHA),

Shown in Figure 5 is that the proteic Western-blotting of reorganization HA behind the purifying identifies figure.Antibody is that anti-His (left figure) anti-HA resists (right figure) more.Arrow is depicted as rHA albumen, and this figure proof reorganization HA of the present invention has the immunocompetence of natural HA.

Shown in Figure 6 is the hemagglutination test result of various rHA (reorganization hemagglutinin) albumen and different blood cell.What from top to bottom use successively is chicken blood, human blood, mouse blood.Has hemagglutination activity by the visible reorganization HA albumen of rhabdovirus system expression, Ni+ column purification that uses of figure.(what from top to bottom use successively is QH-HA (Qinghai strain isolated hemagglutinin), AH-HA (Anhui strain isolated hemagglutinin), and QH-HA, the QH-HA after pancreatin is handled, QH-HA, XJ-HA (Xinjiang strain isolated hemagglutinin), control is not for adding proteic negative control)

Through identifying, shows that expressed proteins molecular weight of the present invention is 66kd, using that anti--His monoclonal antibody and anti--HA be how anti-all can be at the 66kd specific band of mixing out, and anti--HA is the HA1 subunits of anti-another bands of mixing out for degrading how.In hemagglutination test, purified proteins has hemagglutination activity too.

4 recombinant protein: QH-HA have been obtained altogether, XJ-HA, AH-HA; HK-HA (Hong Kong strain isolated hemagglutinin), they are respectively from A/Bar-headed Goose/Qinghai/10/05 H5N1, A/Xinjiang/2006 H5N1; A/Anhui/2005 H5N1, A/Hongkong/2003 H5N1.

Embodiment 2: MONOCLONAL ANTIBODIES SPECIFIC FOR

1. immune animal:

The female Balb/c mouse (buying from Chinese Academy of Medical Sciences animal) of selecting cleaning level 6-8 age in week for use is as immune object.Monoclonal antibody preparation method according in " Immunization Update learns a skill and uses " (editing Ahmedabad year) (combined publication society of China Concord Medical Science University of Beijing Medical University, 1998) book carries out.Specific as follows:

Initial immunity Ag 1～50 μ g/0.8～1.0ml adds the Fu Shi Freund's complete adjuvant

Subcutaneous multi-point injection (0.2ml/ point)

After ↓ 3 weeks

Immunizing dose is the same for the second time, adds freund 's incomplete adjuvant

Subcutaneous or ip (ip dosage should not surpass 0.5ml)

After ↓ 3 weeks

Immunizing dose is the same for the third time, does not add adjuvant, ip (blood sampling is surveyed it and tired the detection immune effect after 5～7 days)

After ↓ 2～3 weeks

Booster immunization, dosage 50～500 μ g are advisable ip or iv

After ↓ 3 days

Getting spleen merges

2. cytogamy:

The myeloma cell SP2/0 (purchasing the cell centre in China Concord Medical Science University) of growth 2.1 take the logarithm, centrifugal 5 minutes of 1000rpm abandons supernatant, counts behind the full nutrient solution suspendible cell that toos many or too much for use, and gets required cell count, the full nutrient solution washing 2 times of toing many or too much for use.

2.2 prepare the immune spleen cell suspension simultaneously, the full nutrient solution washing 2 times of toing many or too much for use.

2.3 the full nutrient solution that in the 50ml plastic centrifuge tube, toos many or too much for use is washed 1 time, 1200rpm, 8 minutes with myeloma cell and splenocyte by the mixed of 1: 10 or 1: 5 together.

2.4 abandon supernatant, with the dropper residual liquid that exhausts, in order to avoid influence the concentration of PEG.

2.5 at the bottom of the attack centrifuge tube, make cell precipitation loosening slightly gently.

2.6 at room temperature merge:

2.6.1 add the 1ml PEG1500 of preheating in 30 seconds, the limit edged stirs.

2.6.2 acted on for 90 seconds.

2.6.3 add the incomplete nutrient solution of preheating, stop the PEG effect, every 1ml, 2ml, 3ml, 4ml, 5ml and 10ml of adding respectively at a distance from 2 minutes.

2.6.4 centrifugal, 800rpm, 6 minutes.

2.7 the HAT condition is cultivated, to obtain hybridoma cell strain

Merge the back cell precipitation and add 3ml IMDM1640,10ml foetal calf serum (Sigma product), 50 * HAT 1ml adds feeder cell suspension 2ml, mixing again.The methylcellulose gum semisolid medium that adds above-mentioned preparation is poured into behind the mixing in the plate of diameter 3.5cm, each plate 2ml.37 ℃, 5%CO ₂Incubator is cultivated 1w.

Pass through aforesaid method; We have obtained altogether 3 kinds of proteic 41 strain of hybridoma of HA, wherein, QH HA albumen (QH-HA) are obtained 12 strain of hybridoma; XJ HA albumen (XJ-HA) is obtained 18 strain of hybridoma, HKHA albumen (HK-HA) is obtained 11 strain of hybridoma.Antibody and four kinds of HA albumen (QH-HA, XJ-HA, HK-HA, AH-HA) ELISA result that they produce are as shown in Figure 7.Among Fig. 7, ordinate zou is the OD value, and X-coordinate is various monoclonal antibody cell clones.This result shows that some antibody is different for the combination of these HA, and its recognition site possibly be located in these HA aminoacid sequence different at different position and different.

Embodiment 3: antibody is to the evaluation of the toxic neutralising capacity of virocyte

1. the packing of recombinant virus:

Reorganization WSN virus (the Generation ofinfluenza A viruses entirely from cloned cDNAs of system according to people such as GABRIELE NEUMANN use; PNAS; 1999; 96:9345-93 50); We utilize the reverse genetic operating system of 12 plasmids, and hemagglutinin hemagglutinin (HA) and the neuraminic acid zymoprotein neuraminidase (NA) of A/Bar-headed Goose/Qinghai/1/05 (H5N1) is building up among the rna expression plasmid pHH21, together with A/WSN/33 (H ₁N ₁) inner other 6 the segmental rna expression plasmids of virus: pHH21-PB2, pHH21-PB1, pHH21-PA, pHH21-NP, pHH21-M, pHH21-NS, and A/PR/8/34 (H ₁N ₁) 3 protein expressing plasmid: pcDNA-PB2, pcDNA-PB1, the pcDNA-PA of virus, and totally 12 plasmid transfection simultaneously 293T cells such as the NP protein expressing plasmid PCAGGS/MCS-NP of A/WSN/33.Behind 3 days frozen 3 times of 293T cell and nutrient solution thereof after the transfection, be inoculated in mdck cell (preserve this chamber) or chicken embryo, through HA verification experimental verification virus titer, the result shows recombinant virus HA ^QhNA ^Qh/ WSN packs successfully, can well in MDCK and chicken embryo, breed.Profit uses the same method XJ-HA, and HK-HA, AH-HA are packaged into reorganization WSN virus and are used for neutralization test.This virus has and the identical hemagglutinin in natural bird flu virus coating surface, but does not have the highly pathogenic of street strain, can be in P2 level laboratory operation.

2. neutralization test:

2.1 the mensuration of viral malicious valency (micromethod)

2.1.1 the preparation of virus in monolayer, adds virus inoculation and keeps liquid behind 37 ℃ of absorption 1h, put incubator and cultivate; Day by day observe; Treat that (Cytopathogenic effect CPE) reaches more than 75% cytopathy, results viral suspension freeze thawing or ultrasonication; With the centrifugal 10min of 3000r/min; Get supernatant, quantitatively being distributed into the 1ml bottle, to put-70 ℃ of preservations subsequent use, and the virus of selecting for use must be that pair cell has more stable virulence.

Put one bottle in the virus that-70 ℃ of refrigerators preserve 2.1.2 viral malicious valency is measured to get, virus is done 10 times of dilutions of going forward one by one on 96 well culture plates be 10 ^-1, 10 ^-2, 10 ^-11..., every hole viral suspension amount is 50 μ l, and each extent of dilution is done 8 holes, and every hole adds 100 μ l cell suspensions, and last column of every block of plate is established the contrast of 8 porocytes, and the concentration of preparation cell suspension is degree so that cell covers with individual layer in 24h.Put 5%CO to culture plate ₂37 ℃ of cultivations of incubator, from 48-14h observation of cell pathology day by day, the record result.

Press Reed and Muench Liang Shi method and calculate TCID50 (implication: this viral dilution 10 ^3.8Inoculate 100 μ l and can make 50% cell generation pathology).

2.2. in and the experiment

2.2.1 heat labile nonspecific reaction factor is got rid of in being treated to of serum or antibody, the serum that is used for neutralization test must be handled through heat inactivation.The serum of various different sourcess must adopt treatment of different temperature, and mice serum is 60 ℃; Human serum is 56 ℃.Be 20-30min heat-up time, when heating more than 60 ℃, for preventing protein coagulating, should do suitably dilution with saline water earlier.

2.2.2 dilute serum or antibody are got the serum of inactivation treatment; On the trace Tissue Culture Plate of 96 holes; Make a series of doubling dilutions with diluent; Make its extent of dilution be respectively 1: 2,1: 4,1: 8,1: 16,1: 32,1: 64 of former serum, every hole content is 50 μ l, and each extent of dilution is done 4 holes.

2.2.3 virus dilution is got the viral liquid that-70 ℃ of refrigerators are preserved, by doing 200TCID50 dilution (mix with equivalent serum, its malicious valency is 100TCID50) through the malicious valency of measuring.

2.2.4 the every hole of virus infection adds 50 μ l virus liquid, seals lid, places 37 ℃ of incubators and 1h.Virus is mixed with serum or antibody, 37 ℃ of effect 1h.According to the stable on heating virus of difference, operative temperature should be different to some extent with the time.

2.2.5 add cell suspension when the preparation cell suspension, its concentration is to cover with individual layer degree of being in 24h: take out in the serum-virus He behind the 1h, every hole adds 100 μ l cell suspensions.Put 5%CO ₂37 ℃ of incubators are cultivated, and cultivate 48h certainly and begin observed and recorded day by day, and 14h stops.Termination time should decide according to the speed of pathological changes caused by virus.

2.2.6 set up contrast to be warranty test result's accuracy, each test all must be provided with following contrast, and is particularly when carrying out the neutralization test of this kind virus for the first time, particularly important.

Positive and negative serum contrasts: the positive and negative serum and serum to be checked carry out parallel test, and positive serum cytopathy do not occur to correlating, and negative serum cytopathy occurs to correlating

2.2.7 virus returns test: test on each piece plate at every turn and all set up the virus control hole, with virus work 0.1,1,10,100,1000TCID50 dilution, each extent of dilution is done 4 holes earlier, and every hole adds 50 μ l.Every then hole adds 100 μ l cell suspensions.0.1TCID50 it is should not cause cytopathy, and 100TCID50 must cause cytopathy, otherwise should test untenable.

2.2.8 serum toxicity is to taking a picture: have or not any toxic action for checking the pair cell of seized serum own, it is necessary setting up seized serum toxicity contrast.The serum to be checked (the minimum extent of dilution that is equivalent to seized serum in the neutralization test) that promptly in histocyte, adds the low power dilution.

2.2.9 normal cell is to taking a picture: i.e. the cell suspension hole of virus inoculation and serum to be checked not.Normal cell causes testing error to correlate form and the characteristic of life that in whole neutralization test, keeps good always for avoiding culture plate itself, should on every block of plate, all set up this contrast.

2.3 the result judges and virus recurrence test is worked as in calculating, the positive, feminine gender, normal cell, just can be judged when serum toxicity contrasts all establishments taking a picture.

100% cytopathic effect occurs in the seized serum of definition (or standard) hole (Cytopathogenic effect CPE) is judged to feminine gender, and it is positive that the preserver appears in 50% above cell 2.3.1 the result judges; The result of fixed virus dilute serum neutralization test calculates, and is to calculate to protect 50% cell hole not produce cytopathic serum dilution, and this extent of dilution is the antibody neutralization of this part serum or antibody and tires.

2.4 neutralization test result:

We determine 6 kinds of monoclonal antibodies and have the neutralization activity in the monoclonal antibody from 41.The neutralization test result of antibody is as shown in table 1 below, and QH-HA, XJ-HA, AH-HA, HK-HA represent these four kinds of HA genes of transfection WSN virus that obtains recombinating respectively.

In the table 1. and experimental result

No: expression not neutralization is active

Judge the active size of neutralization according to the size of numerical value.Because the fine difference of QH-HA and XJ-HA protein conformation causes QHmAb2 to the QH-HA activity that do not neutralize, but there is neutralization active to XJ-HA.Because QH, XJ, AH H5N1 belongs to Clade 2, and HK H5N1 is Clade 1, and XJmAb10 can have powerful neutralization activity to same clade, and QHmAb6 can have neutralization active to the Different Evolutionary branch, is that a strain has the active neutralizing antibody of extensive intersection.In the research to the bird flu virus evolutionary process, we find to produce, and to have the active neutralizing antibody of powerful neutralization be the principal character of people source H5N1, and powerful like this neutralization activity can make human H5N1 to this clade produce effectively protection.And,, existing a large amount of similar hypotypes in their bodies as the natural reservoir (of bird flu viruses) of bird flu virus for bird, they cause producing in the fowl body and have branch and intersect active neutralizing antibody rather than to the specific antibody of a certain specific clade.XJmAb10 can be applied to the infection mitigation of human Clade 2 virus strain, and QHmAb6 then can be used for the H5N1 prevention of poultry.

Embodiment 4: antibody suppresses (HI) test (micromethod) to the evaluation-blood clotting of the neutralising capacity of viral blood coagulation activity

1, test operation:

In 96 hole hemagglutination plates, add 50 μ l saline water in every hole, the red corpuscle control wells adds 100 μ l; In the 1st hole, add treated serum to be checked 50 μ l subsequently, take out 5 μ l behind the mixing and be added in the 2nd hole, the rest may be inferred; Up to the 10th hole, discard 50 μ l, this moment, the extent of dilution of serum to be checked was respectively 1: 8; 1: 16 ..., 1: 4096.Except that the red corpuscle control wells, every hole adds the AIV virus liquid 50 μ l of 4 times of HAUs again, and at this moment, the 11st hole is the virus control hole, and the 12nd hole is the saline water control wells.Room temperature (25 ℃) effect 20min.Every then hole adds 50 μ l, 1% chicken erythrocyte suspension, viewing test result behind the rearmounted 37 ℃ of effect 30min of vibration mixing, and the contrast red corpuscle will manifest button-type and be sunken at the bottom of the hole

2, the result judges:

Suppress to tire with the blood clotting of the highly diluted multiple of the serum that can suppress 4 times of HAU virus antigens fully as seized serum.Criterion is that HI tires that to be judged to HI test when being less than or equal to 3log2 negative; It is suspicious that the HI valency equals 4log2, needs revision test; The HI valency is positive during more than or equal to 5log2.To there be the fine hair allantoic fluid of blood clotting valency to carry out the HI test, and carry out HI respectively with standard positive serum simultaneously and get rid of test with micromethod.

3. HAU is measured---blood clotting (HA) test (micromethod)

3.1 test operation:

On " V " type 96 hole Sptting plates, every hole adds 50 μ l saline water, in the 1st hole, adds 50 μ l bird flu virus to be measured (avian influenza viruses; AIV) behind the liquid mixing, take out 50 μ l and be added in the 2nd hole behind the mixing, take out 50 μ l again and be added in the 3rd hole; The rest may be inferred; Behind the 11st hole mixing, discard 50 μ l, this moment, the extent of dilution of viral liquid was followed successively by 1: 2～1: 2048, and the 12nd hole adds 50 μ l saline water and contrasts as red cell suspension.Every then hole all adds 50 μ l, 1% chicken erythrocyte suspension, behind the vibration 15s mixing, puts observations behind 37 ℃ of 0.5h.The interpretation as a result of the group that can make an experiment does not take place under the agglutinative condition in the red cell suspension contrast:

++ ++: be defined as the agglutinative red corpuscle and be at the bottom of the even coverage hole of film like, then shrinkage is agglomerating during strong aggegation;

+++: is defined as at the bottom of the relatively more even coverage hole of agglutinative red corpuscle, and considerably less erythrocyte sedimentation is arranged;

++: be defined as at the bottom of the agglutinative red corpuscle coverage hole, but central authorities have a small amount of erythrocyte sedimentation to become dot;

+: be defined as red corpuscle and be sunken to central authorities at the bottom of the hole, but still have the RCA that is dispersed on every side;

-: be defined as red corpuscle and all be sunken to central authorities at the bottom of the hole, but do not have the RCA that is dispersed on every side;

The hemagglutinative titer of viral liquid to be checked is the high dilution of the virus that can make red corpuscle 100% aggegation (++ ++).

The antibody HI that records according to aforesaid operations tires as shown in table 2.QH-HA, XJ-HA, AH-HA, HK-HA represent these four kinds of HA genes of transfection WSN virus that obtains recombinating respectively.

Table 2.

No: do not have blood clotting to suppress active

Embodiment 5: the blocking experiment of epitope peptide

1. experimental principle: utilize the competitive ELISA method, detection of peptides antagonist and protein bound blocking effect.Thereby judge the calmodulin binding domain CaM of antibody.Through this external peptide blocking experiment, can obtain the identified region information of lot of antibodies at short notice, for antibody brought at the screening operation of virus levels convenient.Epitope peptide sequence provided by the invention is as shown in table 3, and it all takes from the protein sequence of bird flu virus HA, adopts conventional Peptide synthesizer to synthesize automatically and gets final product.

The epitope peptide that table 3 is alternative

HK, AH, XJ, QH represent A/Hongkong/2003 H5N1 HA (HK-HA) respectively; A/Anhui/2005H5N1 HA (AH-HA); A/Xinjiang/2006 H5N1 HA (XJ-HA); A/Bar-headedGoose/Qinghai/10/05 H5N1 HA (QH-HA); Other expression is different from any strain that contains this common sequence of above-mentioned four strains.

The peptide blocking experiment is divided into two portions.Screening for the first time can identify the identified region of antibody rapidly.Method is the peptide blocking-up corresponding antibody and the proteic combination of selecting corresponding source for use, like use P1, and P4, P7, P10 screening Qinghai antibody uses P3, P4, P8, P11 screening Xinjiang antibody uses P2, P5, P7, P10 screens Hong Kong antibody.The programmed screening purpose is for identifying that the different aminoacids residue is to the difference of the blocking effect of same antibody in the same epitope peptide.The standard of selecting is to go up H5N1 HA sequence according to GenBank, selects otherness bigger amino-acid residue in region to compare.Divide into groups with the position, be respectively the 99-103 group (P1, P2, P3), the 136-141 group (P4, P5), the 170-174 group (P6, P7, P8) with the 226-231 group (P9, P10, P11).

2. experimental procedure:

2.1. encapsulating HA albumen (2 μ g/ml) spends the night for 4 ℃.

2.2. antibody (10 μ g/ml) and peptide (100 μ g/ml) are hatched 4 ℃ to spend the night.

2.3. the mixed solution of antibody and peptide is added in the good antigen hole of sealing, 37 ℃, 1h.

2.4. wash 5 times

2.5. add the anti-mouse IgG of HRP-, 37 ℃, 1h.

2.6. wash 5 times

2.7. colour developing, the value of reading.

3. interpretation of result: experimental port adds the mixed solution of antibody and corresponding peptides, and positive hole only adds antibody.The difference in experimental port and positive hole is used for passing judgment on the barrier effect of peptide antagonist, and difference is big more, and barrier effect is big more.

For the first time The selection result shows that (like Fig. 8, peptide blocking-up (positive contrast) is not used in the no-P representative, and the calmodulin binding domain CaM of most of antibody and whole neutralizing antibody all concentrates on the HA1 front end.Showing that this zone is the position that the high sudden change of bird flu HA albumen reaches immunologic escape, also is the zone of neutralizing epitope.

The programmed screening result shows (as shown in Figure 9), and Fig. 9 show peptide resistance experimental identification different sources peptide is to the difference with a kind of affinity of antibody.Use is carried out programmed screening with a kind of antibody to different peptides, identifies the variation of antibody to different aminoacids avidity.Be followed successively by from left to right: 1.P1, P2, P3 are to QHmAb2 and QH-HA bonded blocking effect, and three kinds of small peptides can both clearly be blocked their combination (P＜0.01), but difference useless between three peptides.2.P4 P5 is to QHmAb3 and QH-HA bonded blocking effect, two kinds of small peptides can both be blocked their combination, but the barrier effect of P4 is better than P5 (P＜0.01).Secondly 3.P6 P7, P8 are to QHmAb5 and QH-HA bonded blocking effect, three kinds of small peptides can both clearly be blocked their combination (P＜0.01), but the barrier effect of P7 is the most obvious, are P8, the barrier effect of P6 a little less than.4.P9 P10, P11 are to QHmAb12 and QH-HA bonded blocking effect, three kinds of small peptides all can not clearly be blocked their combination, but P11 has barrier effect (P＜0.05).More than experiment is the mean+SD of three parallel laboratory tests.P1, P2 and P3 peptide can both combine with proteic by the significance blocking antibody, but significant difference not between their threes has broad spectrum and intercrossing as this position of epitope peptide.P4 and P5 peptide can both antagonist have the blocking-up of significance, explain that SSWSDH and SSWSSH are the epitope peptides to this site specific.And the blocking effect between P4 and the P5 peptide has significant difference, because they from two Different Evolutionary branches, explain that this position has the clade specificity.

Embodiment 6: the immunoreation (ELISA method) of two mutants reorganization pseudovirus and monoclonal antibody

Three point mutation body: QHA102V, QHA172T, QHI229L have been made up according to QH-HA and XJ-HA in three different loci of HA.Use respectively different identified regions (100-110,130-140,170-180, monoclonal antibody 220-230) (QHmAb2, QHmAb5, QHmAb12, XJmAb13) with these HA albumen epi-position effects (shown in figure 10).Find that 102 site mutations can significantly reduce the combination of QHmAb2 (calmodulin binding domain CaM is 100-110) and XJmAb13 (calmodulin binding domain CaM is 130-140), QHmAb2 and XJmAb13 significantly descend to QHA102V avidity.Prove that 102 site mutation can cause the change of HA conformation, explain that the 100-110 epi-position is the sequence of very important detection virus variation.

Embodiment 7: the neutralization of two mutants reorganization pseudovirus suppresses experiment

In order further to verify the importance of key amino acid in these epi-positions, we are with four kinds of point mutation bodies (QHA102V, QHS140D; QHA172T; QHI229L) be cloned in the reorganization WSN virus system, carry out the HI test, observe the change of antibody these mutated viruses effects.The result shows that QHmAb6 and XJmAb10 can both produce effectively protection to 102 and 140 site mutation, and other neutralizing antibody is HI effect disappearance (specifically seeing " no " that represent with runic in the table 4) then.Further proved the importance of these two sites in the immune evasion variation, and the protectiveness of these two kinds of neutralizing antibodies.。

The blood clotting of the reorganization pseudovirus antagonist in table 4 mutational site suppresses (HI) experimental result

Embodiment 8: the checking of the immunological effect of neutralizing epitope immunized mice

1. the immunization of mouse is for the further neutralizing effect of checking epitope peptide, according to peptide blocking test result, and with Pa-Pf, HK, XJ full-length proteins immune mouse.

Initial immunity Ag 500 μ g add the Fu Shi Freund's complete adjuvant, and (method and dosage are the same for general 0.8～1ml) subcutaneous multi-point injection (0.2ml/ point), 1 week back immunity for the second time.After 1 week, employing is plucked eyeball and is got blood.This method, an average mouse is got blood 1ml, can obtain serum 500 μ l.

2。The antibody activity of the serum of immunized mice is identified

Get immune serum and on the recombinant virus level, do the neutralization experiment respectively, method is with embodiment 3.Table 5 result shows that the epitope peptide immune serum in 100-110 and 130-140 zone has tangible neutralization, explains that these two zones are neutralizing epitopes.

In the table 5 peptide immune serum and experimental result

No: neutralization is not active

The neutralization is here tired to making all maximum dilution multiples of the antibody of survival of mdck cell.

In table 5; Use totally 8 small peptides (Pa-Pf) and two rHA albumen (HK-HA and XJ-HA) immune mouse of Hong Kong strain and Xinjiang Strain; Its immune serum result that tires is: in the peptide immune serum, Hong Kong strain Pc peptide immunizing potency is the highest, and Xinjiang group Pb+Pd peptide immunizing potency is the highest.

In with experimental result be: the Pc immune serum is tired the highest to the neutralization of WSN reorganization Hong Kong virus, the Pb+Pd immune serum is tired the highest to the neutralization of WSN recombinant Sinkiang virus.

Embodiment 9: the immunosuppression experiment detects infected person serum

The monoclonal antibody that utilization the present invention obtains, reorganization HA albumen adopt the immunosuppression experiment that H 5 N 1 avian influenza infected person serum is detected.

Select three kinds of infected person serum for use: No. 99 H5N1 vaccine immunity serum, southern H5N1 infected patient serum and northern H5N1 infected patient serum.No. 99 immune serums are for using type the 99th volunteer's of Vietnam's strain vaccine immunity a serum, and southern patients serum is the convalescence bird flu patients serum who picks up from Anhui Province, and northern patients serum is for picking up from the dead patients serum of Xinjiang province bird flu.

Method is the competitive ELISA method; Promptly hatch with serum and the various antigens that encapsulate earlier, flush away serum adds neutralizing antibody hatches, and adding HRP-sheep anti mouse two resists hatches the back colour developing; Only add the antibody hole with increase serum not and compare, observe serum in the barrier effect of antibody.

Shown in figure 11, when antibody was neutralizing antibody, infection serum obviously blocking antibody combined with proteic.As infect serum and can block XJmAb10 and QHmAb6 and QH-HA, XJ-HA, the proteic combination of AH-HA and HK-HA, but can not block nonneutralizing antibody HKmAb2 to these proteic combinations.Contain the natural antibody to influenza virus in the healthy subjects serum, non-specific combination can take place with bird flu virus in these antibody, thus also have blocking effect, but this blocking effect right and wrong are special.

Infect serum to the blocking effect of XJmAb10 at QH-HA, three kinds of albumen effects of XJ-HA and AH-HA are obvious, and HK-HA is not acted on.Because the calmodulin binding domain CaM of XJmAb10 is 130-140 (shown in Figure 9), and this zone also HK-HA and QH-HA just, the place that XJ-HA and AH-HA aminoacid sequence difference are maximum.Serum is just in time explained this regional amino acid whose high degree of specificity to the different barrier effect of XJmAb10.

Infect serum to the blocking effect of QHmAb6 (to 100-110 and 130-140 peptide fragment) at QH-HA, all obvious among XJ-HA, AH-HA and the HK-HA.The blocking-up result who infects serum has further proved the neutralization of our antibody.

In the virus evolution process, there are two kinds of strength to affect its evolution direction, virulence and infectivity.In order to invade new species; It can beat to open a gap rapidly in new species thereby virus must improve its virulence is able to base oneself upon; The species specificity that must reduce it simultaneously is that its infectivity in same kind reduces; Just might break through the kind restriction when not too special and become, realize that its species of striding are propagated the selection of kind.In order to obtain maximum distensibility at same species, the virulence that virus must reduce it make it the host can with its symbiosis, improve its infectivity simultaneously at these species.Therefore, we for the mankind's protection, can not stress simply to improve paniculate intersecting protective, but should stress to improve same branched protection ratio when developing vaccine.On the contrary; For bird; We should accept to allow bird flu virus true at the evolution spatial that bird has oneself, and what we did is not that high pathogenic avian influenza H5N1 is eliminated, and we can eliminate yet; It is propagated high to the fowl species specificity that the evolution direction that we should guide it is striden species by highly pathogenic, height, and the direction that virulence is low is evolved.The XJmAb10 that we find is exactly to the powerful neutralizing antibody at human popular Clade 2, and in the China's Mainland also just Clade 2 occupy absolute advantage.Therefore, it and it neutralizing epitope has very high promotional value in China, and its application will be significant to state's human and bird fluenza prevention.QHmAb6 can be applied to the H5N1 prevention of poultry within Chinese territory, and it can improve the cross protection power of poultry to the Different Evolutionary branch, reduces case fatality rate, helps bird flu virus evolving naturally in poultry.

According to The above results, QHmAb6, XJmAb10 have using value in the diagnostic kit of preparation avian influenza serum.

KLPI090214_2.txt

Sequence table

< 110>Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences

China Sickness Prevention Control Center Virus Disease Prevention Control Institute

< 120>avian flu virus hemagglutinin, epitope peptide and anti-their monoclonal antibody and application thereof

<130>KLPI090214

<160>19

<170>PatentIn version 3.3

<210>1

<211>10

<212>PRT

<213>Avian influenza virus

<400>1

Lys Ala Asn Pro Ala Asn Asp Leu Cys Tyr

1 5 10

<210>2

<211>10

<212>PRT

<213>Avian influenza virus

<400>2

Lys Ile Asn Pro Val Asn Asp Leu Cys Tyr

1 5 10

<210>3

<211>10

<212>PRT

<213>Avian influenza virus

<400>3

Asn Ser Trp Ser Ser His Glu Ala Ser Leu

1 5 10

<210>4

<211>10

<212>PRT

<213>Avian influenza virus

<400>4

Ser Ser Trp Ser Asp His Glu Ala Ser Ser

1 5 10

<210>5

<211>568

<212>PRT

<213>Avian influenza virus

<400>5

Met Glu Lys Ile Val Leu Leu Leu Ala Ile Val Ser Leu Val Lys Ser

1 5 10 15

Asp Gln Ile Cys Ile Gly Tyr His Ala Asn Asn Ser Thr Glu Gln Val

20 25 30

Asp Thr Ile Met Glu Lys Asn Val Thr Val Thr His Ala Gln Asp Ile

35 40 45

Leu Glu Lys Thr His Asn Gly Lys Leu Cys Asp Leu Asp Gly Val Lys

50 55 60

Pro Leu Ile Leu Arg Asp Cys Ser Val Ala Gly Trp Leu Leu Gly Asn

65 70 75 80

Pro Met Cys Asp Glu Phe Leu Asn Val Pro Glu Trp Ser Tyr Ile Val

85 90 95

Glu Lys Ile Asn Pro Val Asn Asp Leu Cys Tyr Pro Gly Asn Phe Asn

100 105 110

Asp Tyr Glu Glu Leu Lys His Leu Leu Ser Arg Ile Asn His Phe Glu

115 120 125

Lys Ile Gln Ile Ile Pro Lys Ser Ser Trp Ser Asp His Glu Ala Ser

130 135 140

Ser Gly Val Ser Ser Ala Cys Pro Tyr Gln Gly Arg Ser Ser Phe Phe

145 150 155 160

Arg Asn Val Val Trp Leu Ile Lys Lys Asn Asn Thr Tyr Pro Thr Ile

165 170 175

Lys Arg Ser Tyr Asn Asn Thr Asn Gln Glu Asp Leu Leu Val Leu Trp

180 185 190

Gly Ile His His Pro Asn Asp Ala Ala Glu Gln Thr Arg Leu Tyr Gln

195 200 205

Asn Pro Thr Thr Tyr Ile Ser Val Gly Thr Ser Thr Leu Asn Gln Arg

210 215 220

Leu Val Pro Lys Leu Ala Thr Arg Ser Lys Val Asn Gly Gln Ser Gly

225 230 235 240

Arg Met Glu Phe Phe Trp Thr Ile Leu Lys Pro Asn Asp Ala Ile Asn

245 250 255

Phe Glu Ser Asn Gly Asn Phe Ile Ala Pro Glu Asn Ala Tyr Lys Ile

260 265 270

Val Lys Lys Gly Asp Ser Thr Ile Met Lys Ser Glu Leu Glu Tyr Gly

275 280 285

Asn Cys Asn Thr Lys Cys Gln Thr Pro Tle Gly Ala Ile Asn Ser Ser

290 295 300

Met Pro Phe His Asn Ile His Pro Leu Thr Ile Gly Glu Cys Pro Lys

305 310 315 320

Tyr Val Lys Ser Asn Arg Leu Val Leu Ala Thr Gly Leu Arg Asn Ser

325 330 335

Pro Gln Gly Glu Arg Arg Arg Lys Lys Arg Gly Leu Phe Gly Ala Ile

340 345 350

Ala Gly Phe Ile Glu Gly Gly Trp Gln Gly Met Val Asp Gly Trp Tyr

355 360 365

Gly Tyr His His Ser Asn Glu Arg Gly Ser Gly Tyr Ala Ala Asp Lys

370 375 380

Glu Ser Thr Gln Lys Ala Ile Asp Gly Val Thr Asn Lys Val Asn Ser

385 390 395 400

Ile Ile Asp Lys Met Asn Thr Gln Phe Glu Ala Val Gly Arg Glu Phe

405 410 415

Asn Asn Leu Glu Arg Arg Ile Glu Asn Leu Asn Lys Lys Met Glu Asp

420 425 430

Gly Phe Leu Asp Val Trp Thr Tyr Asn Ala Glu Leu Leu Val Leu Met

435 440 445

Glu Asn Glu Arg Thr Leu Asp Phe His Asp Ser Asn Val Lys Asn Leu

450 455 460

Tyr Asp Lys Val Arg Leu Gln Leu Arg Asp Asn Ala Lys Glu Leu Gly

465 470 475 480

Asn Gly Cys Phe Glu Phe Tyr His Arg Cys Asp Asn Glu Cys Met Glu

485 490 495

Ser Val Arg Asn Gly Thr Tyr Asp Tyr Pro Gln Tyr Ser Glu Glu Ala

500 505 510

Arg Leu Lys Arg Glu Glu Ile Ser Gly Val Lys Leu Glu Ser Ile Gly

515 520 525

Thr Tyr Gln Ile Leu Ser Ile Tyr Ser Thr Val Ala Ser Ser Leu Ala

530 535 540

Leu Ala Ile Met Val Ala Gly Leu Ser Leu Trp Met Cys Ser Asn Gly

545 550 555 560

Ser Leu Gln Cys Arg Ile Cys Ile

565

<210>6

<211>1756

<212>DNA

<213>Avian influenza virus

<400>6

gttcaatctg tcaaaatgga gaaaatagtg cttcttcttg caatagtcag tcttgttaaa 60

agtgatcaga tttgcattgg ttaccatgca aacaactcga cagagcaggt tgacacaata 120

atggaaaaga acgtcactgt tacacacgcc caagacatac tggaaaagac acacaacggg 180

aagctctgcg atctagatgg agtgaagcct ctaattttaa gagattgtag tgtagctgga 240

tggctcctcg ggaacccaat gtgtgacgaa ttcctcaatg tgccggaatg gtcttacata 300

gtggagaaga tcaatccagt caatgacctc tgttacccag ggaatttca acgactatgaa 360

gaactgaaac acctattgag cagaataaac cattttgaga aaattcagat catccccaaa 420

agttcttggt cagatcatga agcctcatca ggggtgagct cagcatgtcc ataccaggga 480

aggtcctcct tttttagaaa tgtggtatgg cttatcaaaa agaacaatac atacccaaca 540

ataaagagaa gttacaataa taccaaccaa gaagatcttt tggtactgtg ggggattcac 600

catccaaatg atgcggcaga gcagacaagg ctctaccaaa acccaaccac ctatatttcc 660

gttgggacat caacactaaa ccagagattg gtaccaaaac tagctactag atccaaggta 720

aacgggcaaa gtggaaggat ggagttcttt tggacaattt taaaaccgaa tgatgcaata 780

aactttgaga gtaatggaaa tttcattgct ccagaaaatg catacaaaat tgtcaagaaa 840

ggggactcaa caattatgaa aagtgaattg gaatatggta actgcaacac caagtgtcaa 900

actccaatag gggcgataaa ctctagtatg ccattccaca acatccaccc tctcaccatc 960

ggggaatgcc ccaaatatgt gaaatcaaac agattagtcc ttgcgactgg gctcagaaat 1020

agccctcaag gagagagaag aaggaaaaag agaggactat ttggagctat agcaggtttt 1080

atagagggag gatggcaggg aatggtagat ggttggtatg ggtaccacca tagcaacgag 1140

cgggggagtg ggtacgctgc agacaaagaa tccactcaaa aggcaataga tggagtcacc 1200

aataaggtca actcgatcat tgacaaaatg aacactcagt ttgaggctgt tggaagggaa 1260

tttaataact tagaaaggag aatagaaaat ttaaacaaga agatggaaga cggattccta 1320

gatgtctgga cttataatgc tgaacttctg gttctcatgg aaaatgagag aactctagac 1380

tttcatgact caaatgtcaa gaacctttac gacaaggtcc gactacagct tagggataat 1440

gcaaaggagc ttggtaacgg ttgtttcgag ttctatcaca gatgtgataa tgaatgtatg 1500

gaaagtgtaa gaaacggaac gtatgactac ccgcagtatt cagaagaagc aagattaaaa 1560

agagaggaaa taagtggagt aaaattggaa tcaataggaa cttaccaaat actgtcaatt 1620

tattcaacag tggcgagctc cctagcactg gcaatcatgg tggctggtct atctttatgg 1680

atgtgctcca atggatcgtt acaatgcaga atttgcattt aaatttgtga gttcagattg 1740

tagttaaaaa caccct 1756

<210>7

<211>5

<212>PRT

<213>Avian influenza virus

<400>7

Ile Asn Pro Ala Asn

1 5

<210>8

<211>5

<212>PRT

<213>Avian influenza virus

<400>8

Ala Asn Pro Ala Asn

1 5

<210>9

<211>5

<212>PRT

<213>Avian influenza virus

<400>9

Ile Asn Pro Val Asn

1 5

<210>10

<211>6

<212>PRT

<213>Avian influenza virus

<400>10

Ser Ser Trp Ser Asp His

1 5

<210>11

<211>6

<212>PRT

<213>Avian influenza virus

<400>11

Ser Ser Trp Ser Ser His

1 5

<210>12

<211>5

<212>PRT

<213>Avian influenza virus

<400>12

Asn Ser Thr Tyr Pro

1 5

<210>13

<211>5

<212>PRT

<213>Avian influenza virus

<400>13

Asn Asn Ala Tyr Pro

1 5

<210>14

<211>5

<212>PRT

<213>Avian influenza virus

<400>14

Asn Asn Thr Tyr Pro

1 5

<210>15

<211>6

<212>PRT

<213>Avian influenza virus

<400>15

Val Pro Arg Ile Ala Thr

1 5

<210>16

<211>6

<212>PRT

<213>Avian influenza virus

<400>16

Val Pro Lys Ile Ala Thr

1 5

<210>17

<211>6

<212>PRT

<213>Avian influenza virus

<400>17

Val Pro Lys Leu Ala Thr

1 5

<210>18

<211>20

<212>PRT

<213>Avian influenza virus

<400>18

Lys Ser Ser Phe Phe Arg Asn Val Val Trp Leu Ile Lys Lys Asn Asn

1 5 10 15

Ala Tyr Pro Thr

20

<210>19

<211>20

<212>PRT

<213>Avian influenza virus

<400>19

Arg Ser Ser Phe Phe Arg Asn Val Val Trp Leu Ile Lys Lys Asn Asn

1 5 10 15

Thr Tyr Pro Thr

20

Claims (10)

1. a peptide species is characterized in that, said amino acid sequence of polypeptide is shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.

2. nucleotide sequence of polypeptide shown in the SEQ ID NO:5 of encoding.

3. nucleotide sequence according to claim 2 is characterized in that, said nucleotide sequence is shown in SEQ ID NO:6.

4. expression vector that contains the said nucleotide sequence of claim 3.

5. expression vector according to claim 4, wherein said carrier are the insect viruses expression vector.

One kind anti-shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4 the monoclonal antibody of polypeptide.

7. the application of polypeptide according to claim 1 in preparation birds flu-preventing vaccine.

8. a compsn that is used for birds flu-preventing is characterized in that, said compsn contains:

(1) polypeptide shown in polypeptide shown in the SEQ ID NO:1 and the SEQ ID NO:3, perhaps

(2) polypeptide shown in polypeptide shown in the SEQ ID NO:2 and the SEQ ID NO:4.

9. the application of compsn according to claim 8 in preparation birds flu-preventing vaccine.

10. the application of antibody according to claim 6 in preparation diagnosis bird flu detection reagent.

Images