CN101875915B - Method for inducing and acclimatizing epidermal stem cells into adipocytes - Google Patents
Method for inducing and acclimatizing epidermal stem cells into adipocytes Download PDFInfo
- Publication number
- CN101875915B CN101875915B CN2009102104004A CN200910210400A CN101875915B CN 101875915 B CN101875915 B CN 101875915B CN 2009102104004 A CN2009102104004 A CN 2009102104004A CN 200910210400 A CN200910210400 A CN 200910210400A CN 101875915 B CN101875915 B CN 101875915B
- Authority
- CN
- China
- Prior art keywords
- stem cells
- epidermal stem
- substratum
- cell
- dryness
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for inducing and acclimatizing epidermal stem cells into adipocytes. In the method, since an eplife culture medium and an inducing culture medium are mixed in different proportions, the epidermal stem cells have enough time for adapting the condition that the eplife culture medium is continuously reduced and the inducing culture medium is continuously increased, the probability of differentiation towards the epidermis can be reduced and the probability of converting to target cells is increased. The method of the invention simply and very effectively induces and acclimatizes the epidermal stem cells into the adipocytes, overcomes the preconception of the technical personnel in the field, overturns the judgment that the epidermal stem cells are unipotent stem cells for the first time, and proves that the epidermal stem cells have multipotentiality.
Description
Technical field
The present invention relates to a kind of method of inducing cell, specifically utilize the method for epidermis liver cell inducing and acclimating for adipocyte.
Background technology
Human research to epidermal stem cells has history decades, but because it is difficult to induce differentiation to be considered to unipotent stem cell always, promptly only can break up the relevant composition that becomes epidermis.Regenerative medicine is very powerful and exceedingly arrogant in medical field, the research of stem cell has occupied important low level in the regenerative medicine field, stem cell is because it has many differentiation potentials, and the ability that can be divided into various histoorgans under given conditions obtains the concern of scientists.Embryonic stem cell is a kind of myeloid-lymphoid stem cell, and it can be divided into and remove extraplacental institute in a organized way and organ.But,, those skilled in the art substitute embryonic stem cell so being devoted to seek another myeloid-lymphoid stem cell always because the research of embryonic stem cell relates to ethical problems.
People are locked in target on the adult stem cell gradually.At present, those skilled in the art the success with MSC (mescenchymal stem cell), ADSC adult stem cells such as (fat stem cells) is induced to differentiate into the cell of other types, as chondrocyte, osteocyte, myocardial cell etc.MSC finds in marrow at first, because of it has multidirectional differentiation potential, hematopoiesis support and promotes characteristics such as stem cell implantation, immunoregulation and self-replacation to be subjected to people's attention day by day.As mescenchymal stem cell in vivo or under the external specific inductive condition, can be divided into multiple histocytes such as fat, bone, cartilage, muscle, tendon, ligament, nerve, liver, cardiac muscle, endothelium, still has multidirectional differentiation potential after continuous passage cultivation and the freezing preservation, can be used as the ideal seed cell and be used for injuries of tissues and organs reparation old and feeble and that pathology causes, therefore, at present MSC can be repaired injured tissues in clinical widespread usage as a kind of seed cell and timbering material of bone tissue engineer.Mescenchymal stem cell (MSCs) is to belong to a mesoblastic class multipotential stem cell, mainly is present between reticular tissue and organ in the matter, and is the abundantest with content in the myeloid tissue, because marrow is its main source, therefore is referred to as mesenchymal stem cells MSCs.But utilize MSC to induce the drawback of differentiation function cell to be: the source of MSC is limited, draws materials and pretty troublesome, is relatively limited on drawing materials; The MSC inducing culture cycle is long, and the culturing process complexity be difficult for cultivating and amplification, so the application of MSC runs into a lot of obstructions.
Epidermal stem cells claims specificity stem cell or unipotent cell again, is meant to produce a kind of cell type, but has the cell of self refresh attribute.Those skilled in the art are classified as unipotent cell with epidermal stem cells always.Also be subjected to the influence of unipotent cell and limited for the range of application of epidermal stem cells.
Summary of the invention
The objective of the invention is to remedy the deficiencies in the prior art, provide a kind of adult stem cell that will have pluripotency to be induced to differentiate into the method for adipocyte by the orientation domestication.For the application of clinical tissue engineering later on provides a kind of potential seed cell. can be widely used in aspects such as trauma repair, gene therapy, beauty treatment, for the mankind provide convenience.
In order to achieve the above object, thinking of the present invention is: in the further investigation to epidermal stem cells, we recognize the annex hair follicle of epidermis, the stem cell that all there is multidirectional differentiation potential in sweat gland, and also there is such stem cell with the corium that epidermis adjoins, as the abundantest stem cell of body content, the unipotent stem cell that can only break up epidermic cell exactly? be with this query, we begin the epidermal stem cells versatility has been carried out very long research.
In research process, we have fully realized the correlation properties of epidermal stem cells, recognize that also epidermal stem cells was a kind of stem cell that is very difficult to cultivate before the eplife culture systems is come out, it must be cultivated at low calcium ion concn or not have and just can keep its dryness in the culture systems of calcium ion and reduce to epidermal differentiation.The Eplife culture systems has not only also added the keeping of dryness that many somatomedins help epidermal stem cells more for it provides such environment, and also finds the dryness of epidermal stem cells is risen former being commissioned to train after supporting in our experimentation.But this growth characteristic is given again and is induced differentiation to bring a difficult problem, induces the purpose cell of differentiation to need certain density calcium ion to exist, and this is that its growth is necessary.
Therefore how to keep epidermal stem cells the relatively stable and positive guiding of dryness its become the matter of utmost importance that the present invention need solve to the purpose cytodifferentiation.Because the eplife culture systems has clear and definite meaning (by experiment confirm) to keeping of epidermal stem cells dryness, therefore we have selected as the method for preparing cocktail the eplife substratum to be carried out mixing of different ratios with inducing culture, making epidermal stem cells have competent temporal adaptation eplife substratum constantly to reduce inducing culture increases gradually, and helps reducing the probability that changes to the purpose cell to the epidermal differentiation increase.We are referred to as domestication with this culturing process.
Concrete technical scheme of the present invention is:
A kind of inducing and acclimating epidermal stem cells is the method for adipocyte, and the concrete steps of this method are:
(1) with epidermal stem cells after cultivating, the density of getting stable growth is 80%～95% epidermal stem cells, PBS washes cell twice, change fresh Eplife substratum, be replaced by fatty inducing culture and dryness behind 20～30h and keep and cultivated in the mixed culture medium of substratum 3～5 days, the concentration ratio that fatty inducing culture and dryness are kept substratum is 1: 3～5;
(2) concentration ratio of fatty inducing culture and dryness being kept substratum be replaced by 2: 3～5 continue to cultivate 4～8 big;
(3) being replaced by fatty inducing culture does not fully have dryness and keeps substratum, and induces its differentiation more than at least 10～20 days with fatty inducing culture.
Above-mentioned inducing and acclimating epidermal stem cells is the method for adipocyte, and described fatty inducing culture based component and consumption are:
90%～95% basic medium IMDM; 1uM dexamethasone (Dexamethasone); 0.2mM indomethacin (indomethacin); 0.5mM Regular Insulin (insulin); 0.5mM isobutyl--methyl xanthine (isobutyl-methylxanthine); 10% foetal calf serum FBS.
Above-mentioned inducing and acclimating epidermal stem cells is the method for adipocyte, and composition and consumption that described dryness is kept substratum are: the two anti-and 1～5%HKGS additives of 94～98%Epilife, 1%PS.
Above-mentioned inducing and acclimating epidermal stem cells is the method for adipocyte, and the preparation process of employed epidermal stem cells is as follows in the described step (1):
(1) get isolated time 1～4h, the people face tissue of 4 ℃ of preservations is soaked in 1min in rare iodophor solution, and PBS/ normal saline flushing 3 times is removed fatty tissue, is trimmed to 1cm
2Tissue block;
(2) tissue block is placed contain 4 ℃ of neutral protein enzyme solution and handle 14～16h or directly place 37 ℃ of incubators to handle more than the 3h;
(3) 4 ℃ PBS flushing sample 3 times; Separate epidermis;
(4) shred the back and add equal-volume 0.25%Typsin-EDTA 3～8ml, in 37 ℃ of processing 30～90min, stop digestion, again by the thermal agitation layering with 3～8ml MEFs substratum;
(5) cell suspension of drawing the middle level is transferred in another centrifuge tube centrifugal 600～1000rpm3～8min;
(6) abandon supernatant, resuspended with the human epidermal stem cell substratum;
(7) move in the culturing bottle, leave standstill 30～90min after, abandon culture supernatant and, change fresh epidermal stem cells substratum with PBS flushing 2～3 times; Place 37 ℃, 5%CO
2Incubator continues to cultivate.
Above-mentioned inducing and acclimating epidermal stem cells is the method for adipocyte, it is characterized in that, described human epidermal stem cell substratum is formed two anti-, the 1%HKGS additives of 94～98%Epilife, 1%PS.
Advantage of the present invention and benefit are: the inventor is through experiment confirm repeatedly, and the inventive method is domesticated for adipocyte with the epidermal stem cells directional induction simply and very effectively.And overcome those skilled in the art's prejudice, overturning epidermal stem cells first is the judgement of unipotent stem cell, proves that it has multidirectional differentiation potential.
Description of drawings
Fig. 1 detects epidermal stem cells signature CD90 for immunofluorescence, CD24, and CD29, wherein the CD29 positive rate is greater than 15%, and the CD24 positive rate is greater than 80%, and the CD29 positive rate is greater than 90%;
Fig. 2 detects the not differentiation keratinocyte in people's foreskin stratum basale source for flow cytometer.CD90, CD24, β 1 integrin is the surface markers of differentiation keratinocyte.Wherein every picture group left side figure is a control group, and right figure is the epidermal stem cells group that detects.The result shows that the keratinocyte dryness of acquisition is strong;
Fig. 3 is dryness gene OCT4 in the epidermal stem cells of each time point of RT-PCR evaluation cultivation, SOX2, Klf4, Nanog, c-myc, CRIPTO, REX1, KRT14, differentiation marker KRT1, KRT5, KRT10, KRT19, other cell markings MTTF, TYR, the expression of c-kit;
Fig. 4 is for the initial state of epidermic cell and induce two days later variation;
Fig. 5 induces keratinocyte for domestication and produces adipocyte, fatty inducing culture a lot of loose island like cells gatherings after a day among the A, and on a week (left side), two weeks (in), carried out oil red o dyeing after three weeks, induced on (right side) respectively; Among the B expression of inducing three all backs RT-PCR analyzing genes, M, marker; K, the keratinocyte of differentiation; S, sample;
The fatty oil red O specific stain positive after Fig. 6 directional induction.
Embodiment
The preparation of embodiment 1 inducing and acclimating procuticle stem cell
One, the preparation of epidermal stem cells:
Direct sources and primary source: agree to take from the healthy posthetomy patient of 301 Hospital's surgery through the patient.
(1) gets fresh adult's foreskin (the about 1～4h of isolated time, 4 ℃ of preservations);
(2) foreskin is soaked in 1min in rare iodophor solution (containing Iodophor 20%);
(3) 3 flush away clots of PBS/ normal saline flushing (preventing to influence the digestion of enzyme);
(4) prune foreskin, remove fatty tissue, use the PBS/ normal saline flushing for several times again, be cut into 1cm at last
2About organize square;
(5) tissue block is placed contain neutral protease (3mg/ml; D-hanks makees solvent) in the 6cm ware of solution 4 ℃ handle 14-16h, also can place 37 ℃ of incubators (also can directly place 37 ℃ of incubators to handle more than the 3h---observe treatment effect at any time) inadequately if handle;
(6) 4 ℃ PBS flushing sample 3 times;
(7) separate epidermis (tear get with the sterilization tweezer);
(concentration of pancreatin is 0.25% among the adding equal-volume 0.25%Typsin-EDTA after shredding in bottle, the concentration of EDTA is 0.05%, the pancreatin and the EDTA of above-mentioned concentration were mixed by 1: 1) common 4ml, (more little digestion time of sample age is also long more to handle 30～90min in 37 ℃, generally＜30 years old 37 ℃ of digestion 60min to 90min, generally＞30 years old 37 ℃ of digestion 45min), the substratum (MEFs substratum) that contains serum with 4ml stops digestion, again by the thermal agitation layering: stratum corneum (upper strata), cellular layer (middle level), tissue (lower floor);
(8) cell suspension of carefully drawing the middle level is transferred in another centrifuge tube, centrifugal 1000rpm 5min;
(9) abandon supernatant, resuspended with the human epidermal stem cell substratum;
(10) move in the culturing bottle (pretreated) with 100 μ g/ml IV Collagen Type VIs, leave standstill 60min (stem cell inertia, earlier adherent) after, abandon culture supernatant and, change fresh epidermal stem cells substratum with PBS flushing 2 times; Place 37 ℃, 5%CO
2Incubator continues to cultivate.
Annotate: human epidermal stem cell substratum group: 98%Epilife (Cascade Biologics, cat.no.M-EPI-500-CA); 1%PS (two anti-Invitrogen, cat.no.15070); 1%, additive (HKGS, Cascade Biologics, cat.no.S-001-5)
Two, the growth conditions before the inducing and acclimating epidermal stem cells:
1, fresh epidermal stem was cultivated after 1 day, changed substratum (purpose is to remove dead cell).
2, generally cultivate 3 days after, this changes human epidermal stem cell substratum again.At this moment the most adherent growth of cell is the pebble path sample, and cell is fusiformis and oval (the cell walls boundary is clear), and sees a fairly large number of roundlet light cell, is grown in the upper strata of attached cell and is the growth of clone's property.
Three, the evaluation of epidermal stem cells:
Whether the epidermal stem cells that above method is obtained is our needed epidermal stem cells, in conjunction with the molecule marker of cells and characteristic of stem, and the feature of epidermal stem cells we adopt RT-PCR (Fig. 3), immunofluorescence (Fig. 1), flow cytometry (Fig. 3) to detect the mark of epidermal stem cells.
1, authentication method:
For adherent cell above determining is our desired epidermal stem cells, we adopt RT-PCR, and the method for immunofluorescence detects its dryness molecule and specific molecule marker.
1.1RT-PCR
1.1.1RNA extraction
(1) suction of the substratum in ready IPS cell, epidermal stem cells, the MEF cell is abandoned, wash cell twice with PBS.
(2) each six orifice plate adds the Tribule lysate 1ml of 4 ℃ of precoolings, sees that cell is all cleaved to open, approximately 5min.
(3) with rnase-free rifle point cell pyrolysis liquid is drawn onto in the 1.5ml centrifuge tube.
(4) add the 200ul chloroform, concuss is four to five times up and down, makes its abundant mixing.
(5) 12000rpm, 4 ℃ of 5min. liquid divides three layers, draws the upper transparent liquid layer in new 1.5ml centrifuge tube.
(6) add isopyknic Virahol, the mixing four or five times of turning upside down, the static 10min of room temperature.
(7) 12000rpm, 5min, 4 ℃ of this moments, visible RNA precipitated, and abandoned supernatant, noticed that careful operation will not precipitate the piece sucking-off.
(8) add 70% ethanol 700ul of precooling, 12000,2min, 4 ℃, abandon supernatant, repetitive operation is once.
(9) liquid residual among the RNA is dried, look the precipitation volume amount and add nuclease free water dissolving RNA (noting the too dried difficult dissolving of RNA)
1.1.2 reverse transcription RNA is CDNA
(10) by reverse transcription test kit configuration reverse transcription system, see Table 1
Table 1
How much what * RNA added should decide on precipitation capacity, and the amount of last nuclease free water should be supplied 10ul
After adding well by last table, 37 ℃, 15min, 85 ℃, 5s.-20 preservations are stand-by.
1.1.3PCR amplification
(11) the PCR reaction system is as follows
PCR?mixture 12.5ul
Primer?1 1ul
Primer?2 1ul
CDNA 1ul
dd?H2O 9.5ul
(11) the PCR reaction conditions sees Table 2
Table 2
| Gene title and another name | Upstream primer | Downstream primer | Annealing temperature (℃) | Cycle number | |
| Oct4(POU5F1)-new | CGTGAAGCTGGAGAAGGAGAAGCTG | GAACATGTGTAAGCTGCGGCCCTTG | 62 | 40 | |
| Sox2 | GCTGCACATGAAGGAGCACCC | CGGACTTGACCACCGAACCCA | 58 | 33 | |
| Klf4 | CAAGTCCCGCCGCTCCATTAC | TGGCTGGGCTCCTTCCCTCAT | 58 | 33 | |
| c-Myc | ACTCTGAGGAGGAACAAGAA | TGGAGACGTGGCACCTCTT | 58 | 33 | |
| Nanog | CCCAAAGGCAAACAACCCACT | ATTGCTATTCTTCGGCCAGTT | 58 | 33 | |
| CRIPTO(TDGF1) | | GCAGCAGCCTTTACTGGTCAT | 60 | 33 | |
| REX1 | CGCTGACACCATCCTCATCGG | GGCGTCATCGCTTGGTCTTGG | 55 | 33 | |
| KRT1 | AGGATGTGGATGGTGCTTAT | GCTTTGCTCTTCTGGGCTAT | 58 | 33 | |
| KRT5 | CTGGACACCAAGTGGACCCT | GCTCCGCATCAAAGAACATC | 58 | 33 | |
| KRT10 | TGATAATGCCAACATCCTGC | CCTCCTCGTGGTTCTTCTTC | 68 | 33 | |
| KRT14 | GGAGATGATTGGCAGCGTGGA | GGACCTGCTCGTGGGTGGACA | 62 | 33 | |
| KRT15 | AGCCTACCTGAAGAAGAACCACG | TGGCATAGCGGCACTCTGTCT | 58 | 33 | |
| KRT19 | GCGACTACAGCCACTACTACACGAC | CGACCTCCCGGTTCAATTCTT | 58 | 33 | |
| MITF | GACAGAAGAAACTGGAGCACG | ATCAGTGACACCGACGGGAGA | 62 | 33 | |
| TYR | TAGTCCACTTACTGGGATAGCG | AGTCTGGGTCTGAATCTTGTAG | 62 | 33 | |
| β-actin | AAAGACCTGTACGCCAACAC | GTCATACTCCTGCTTGCTGAT | 62 | 32 |
* the condition (cycle number) of PCR reaction, different gene fragments is widely different, so we need find out best condition in the process of the test.
1.1.4 agarose gel electrophoresis detects amplified fragments
(13) take by weighing 1g electrophoresis level agarose, add 100ml 1xTBE, heating is dissolved agarose fully in the microwave oven;
(14) treat that glue is cooled to 50-60 ℃, the adding final concentration is that the EB dye liquor of 0.5ug/ml shakes up;
(15) seal offset plate with adhesive tape, pour into and be cooled to 30-40 ℃ of gel that configures;
(16) treat that gel solidifies, add a certain amount of electrophoresis liquid in the electrophoresis chamber, adhesive tape is unloaded, the glue groove is put in the electrophoresis chamber, makes electrophoresis liquid not have the glue groove.Pull up comb gently;
(17) get Marker5ul and go up sample, the PCR product that amplification is good is got 8ul and is gone up the sample electrophoresis, and when just beginning, 100V voltage treats that sample runs the plastic hole, and 60V when treating sample to glue 2/3, stops electrophoresis, and ultraviolet lamp is observed down, takes pictures.
1.2 immunofluorescence
(1) get state IPS clone cell preferably, PBS washes cell twice, adds fixedly 30min of 1ml4% Paraformaldehyde 96
(2) abandon stationary liquid, PBS washes cell 3 times, each 5min
(3) add 1ml 0.05% penetrating liquid 30min
(4) abandon penetrating liquid, wash cell 3 times, each 5min with PBS
(5) add 500ul sheep blood serum confining liquid, 1h.One anti-diluent resists by required dilution proportion one
(6) add good one anti-of dilution, put in the wet box 4 ℃ of refrigerator overnight
(7) take out an anti-cell of hatching next day, rinse with PBS and wash once, washing each 10min with PBS 3 times
(8) PBS configuration two is anti-, abandons PBS, and the two anti-500ul that dilution is good are added in the cell and (take out two anti-later operations and answer lucifuge! ) hatch 1h45min.
(9) with PBS dilution DAPI dye liquor, contain in two dye liquors that resist, continue to hatch 30min in 1: 2500 ratio adding
(10) abandon liquid in the culture dish, PBS rinses and washes once, is washing with PBS 3 times, each 10min
(11) add a small amount of PBS, put under the fluorescent microscope and observe
1.3 the detection of flow cytometer
(1) will use the TE peptic cell by when substratum (after adherent 1 hour change) epidermal stem cells of the adherent selection of four Collagen Type VIs, DTI stops digesting, and the cell that digests is washed cell three times, 12000rpm, 5min with the PBS that contains 10%FBS of precooling.
(2) with above-mentioned PBS re-suspended cell, counting diluting cells number is 5 * 105.
(3) every duplicate samples has been hanged cell with the PBS that 100ul contains 3%BSA, adds corresponding antibodies: 10ulCD29,10ul CD90, and 10ul CD24,4 degree refrigerators are hatched 30min.
(4) wash cell three times with cold PBS, 12000rpm, 5min.
(5) anti-with 3% the PBS dilution two that contains BSA, rabbit resists (1: 400), mouse-anti (1: 200)
(6) 4 degree refrigerators are hatched 20-30min, repeating step four, and left back with the cold PBS re-suspended cell that contains BSA of 500ul, flow cytometer detects.
2, qualification result:
As shown in Figure 1, immunofluorescence detects epidermal stem cells signature CD90, CD24, CD29, wherein the CD29 positive rate greater than 15%, the CD24 positive rate greater than 80%, the CD29 positive rate is greater than 90%.As shown in Figure 2, flow cytometer detects the not differentiation keratinocyte in people's foreskin stratum basale source, CD90, CD24, the surface markers of β 1integrin for not breaking up keratinocyte, wherein every picture group left side figure is a control group, right figure is the epidermal stem cells group that detects, and the result shows that the keratinocyte dryness of acquisition is strong.As shown in Figure 3, dryness gene in the epidermal stem cells of each time point that the RT-PCR evaluation is cultivated, OCT4, SOX2, Klf4, Nanog, c-myc, CRIPTO, REX1, KRT14, differentiation marker KRT1, KRT5, KRT10, KRT19, the expression of other cell markings MTTF, TYR, c-kit.
It is 100% that the technology of present separate stem cells does not also reach the cell purity that separation is obtained, and it is very high to show that by the detected result of flow cytometer we separate the cell purity that obtains, and wherein the CD29 verification and measurement ratio reaches 99%.Simultaneously we have detected the molecule marker of other cells with immunofluorescence, and detected result shows that the quantity that other cells exist is few.
Embodiment 2 inducing and acclimating epidermal stem cells are adipocyte
1, substratum is formed
(1) fatty inducing culture based component and consumption are: 90% IMDM (Beaune spy); 1uM Dexamethasone (sigma D1756); 0.2mM indomethacin (sigma.cat No.17378); (0.5mMinsulin sigma cat No.19278); 0.5mM isobutyl-methylxanthine (sigma catNo.E9644); 10%FBS (Gibco, cat.no.10437010)
(2) dryness is kept the composition and the consumption of substratum and is: 98%Epilife (Cascade Biologics, cat.no.M-EPI-500-CA), two anti-(the two anti-Invitrogen of 1%PS, cat.no.15070) and 1%HKGS additive (HKGS, Cascade Biologics, cat.no.S-001-5).
2, method for inducing and domesticating:
(1) with epidermal stem cells after cultivating, the density of getting stable growth is 80%～95% epidermal stem cells, PBS washes cell twice, changes fresh Eplife substratum, is replaced by 20% fatty inducing culture and 80% dryness behind the 24h and keeps in the mixed culture medium of substratum and to cultivate 3 days;
Being replaced by 100% fatty inducing culture in (4) the 8th days does not fully have dryness and keeps substratum, and induces its differentiation more than at least 10～20 days with fatty inducing culture.
The evaluation and the interpretation of result of embodiment 3 purpose cells
One, identified by immunofluorescence is induced differentiated result
1, method:
(1) get induce the back one, two, three pericytes, PBS washes cell twice, adds fixedly 30min of 1ml4% Paraformaldehyde 96;
(2) abandon stationary liquid, PBS washes cell 3 times, each 5min;
(3) add 1ml 0.05% penetrating liquid 30min;
(4) abandon penetrating liquid, wash cell 3 times, each 5min with PBS;
(5) add 500ul sheep blood serum confining liquid, 1h.One anti-diluent resists by required dilution proportion one;
(6) add the good SMA of dilution one and resist, put in the wet box 4 ℃ of refrigerator overnight;
(7) take out an anti-cell of hatching next day, rinse with PBS and wash once, washing each 10min with PBS 3 times
(8) PBS configuration two is anti-, abandons PBS, and the two anti-500ul that dilution is good are added to (to take out two anti-later operations and answer lucifuge) in the cell hatches 1h45min;
(9) with PBS dilution DAPI dye liquor, contain in two dye liquors that resist, continue to hatch 30min in 1: 2500 ratio adding;
(10) abandon liquid in the culture dish, PBS rinses and washes once, is washing with PBS 3 times, each 10min;
(11) add a small amount of PBS, put under the fluorescent microscope and observe.
2, qualification result:
Induce back 10 days, 2 weeks, 3 all immunofluorescences to detect epidermic cell specific marker (the involucrin positive), adipocyte-specific mark (oil red O) in domestication respectively.As shown in Figure 5, induce keratinocyte for domestication and produce adipocyte, A fat inducing culture is a lot of loose island like cells gatherings after one day, on a week (left side), two weeks (in), carried out oil red O stain respectively after three weeks, induced on (right side); B is the expression of inducing three all backs RT-PCR analyzing genes, M, marker; K, the keratinocyte of differentiation; S, sample;
Fig. 4 is for the epidermic cell initial state and induce two days later state.Left side figure is initial inductive epidermal stem cells growth conditions; Right figure is the growth conditions (can be used as reference index) of domestication inducing culture epidermal stem cells two days later
Fig. 6 is directional induction domestication back adipocyte (oil red O) the specific stain positive.
Two, RT-PCR identifies and induces differentiated result
1, RNA extracts
(1) gets and induce back three pericytes and epidermal stem cells to do contrast, wash cell twice with PBS;
(2) each six orifice plate adds the Tribule lysate 1ml of 4 ℃ of precoolings, sees that cell is all cleaved to open, approximately 5min;
(3) with rnase-free rifle point cell pyrolysis liquid is drawn onto in the 1.5ml centrifuge tube;
(4) add the 200ul chloroform, concuss is four to five times up and down, makes its abundant mixing;
(5) 12000rpm, 4 ℃ of 5min. liquid divides three layers, draws the upper transparent liquid layer in new 1.5ml centrifuge tube;
(6) add isopyknic Virahol, the mixing four or five times of turning upside down, the static 10min of room temperature;
(7) 12000rpm, 5min, 4 ℃ of this moments, visible RNA precipitated, and abandoned supernatant, noticed that careful operation will not precipitate the piece sucking-off;
(8) add 70% ethanol 700ul of precooling, 12000,2min, 4 ℃, abandon supernatant, repetitive operation is once;
(9) liquid residual among the RNA is dried, look the precipitation volume amount and add nuclease free water dissolving RNA (noting the too dried difficult dissolving of RNA).
2, reverse transcription RNA is CDNA
(1) by reverse transcription test kit configuration reverse transcription system, sees Table 3
Table 3
How much what * RNA added should decide on precipitation capacity, and the amount of last nuclease free water should be supplied 10ul
After adding well by last table, 37 ℃, 15min, 85 ℃, 5s.-20 preservations are stand-by.
3, pcr amplification
(1) the PCR reaction system is as follows
PCR?mixture 12.5ul
Primer?1 1ul
Primer?2 1ul
CDNA 1ul
dd?H2O 9.5ul
(2) the PCR reaction conditions sees Table 4
Table 4
* the condition (cycle number) of PCR reaction, different gene fragments is widely different, so we need find out best condition in the process of the test
4, agarose gel electrophoresis detects amplified fragments
(1) take by weighing 1g electrophoresis level agarose, add 100ml 1xTBE, heating is dissolved agarose fully in the microwave oven
(2) treat that glue is cooled to 50-60 ℃, the adding final concentration is that the EB dye liquor of 0.5ug/ml shakes up
(3) seal offset plate with adhesive tape, pour into and be cooled to 30-40 ℃ of gel that configures
(4) treat that gel solidifies, add a certain amount of electrophoresis liquid in the electrophoresis chamber, adhesive tape is unloaded, the glue groove is put in the electrophoresis chamber, makes electrophoresis liquid not have the glue groove.Pull up comb gently
(5) get Marker5ul and go up sample, the PCR product that amplification is good is got 8ul and is gone up the sample electrophoresis, and when just beginning, 100V voltage treats that sample runs the plastic hole, and 60V when treating sample to glue 2/3, stops electrophoresis, and ultraviolet lamp is observed down, takes pictures.
As shown in Figure 5, B is the expression of inducing three all backs RT-PCR analyzing genes, M, marker; K, the keratinocyte of differentiation; S, sample;
Three, induce the result:
We prepare number of samples 135 examples of epidermal stem cells, and non-directional is induced 15 examples, 100% success.We have proved that epidermal stem cells can successfully be divided into adipocyte through above-mentioned directional induction.
Four, purposes of the present invention:
Epidermal stem cells can directed differentiation become adipocyte in directional induction domestication culture systems, confirmed the non-unipotent stem cell of epidermal stem cells, and it has clear and definite multidirectional differentiation potential.Epidermal stem cells is widely distributed at human body, draws materials easily, and the stem cell activity is not subjected to age limit to have good amplification in vitro ability again, and these all will increase advantage for it in the adult stem cell Application Areas.
Claims (2)
1. the method that inducing and acclimating epidermal stem cells is an adipocyte is characterized in that, the concrete steps of this method are:
(1) with epidermal stem cells after cultivating, the density of getting stable growth is 80%～95% epidermal stem cells, PBS washes cell twice, change fresh Epilife substratum, be replaced by fatty inducing culture and dryness behind 20～30h and keep and cultivated in the mixed culture medium of substratum 3～5 days, the concentration ratio that fatty inducing culture and dryness are kept substratum is 1: 3～1: 5;
(2) concentration ratio of fatty inducing culture and dryness being kept substratum is replaced by and was continued in 2: 3～2: 5 to cultivate 2～3 days;
(3) concentration ratio of fatty inducing culture and dryness being kept substratum is replaced by and is continued at 3: 2 to cultivate 2～3 days;
(4) being replaced by fatty inducing culture does not fully have dryness and keeps substratum, and induces its differentiation more than at least 10 days with fatty inducing culture;
Described fatty inducing culture based component and consumption are:
90% basic medium IMDM; The 1uM dexamethasone; 0.2mM indomethacin; 0.5mM Regular Insulin; 0.5mM isobutyl--methyl xanthine; 10% foetal calf serum FBS;
Composition and consumption that described dryness is kept substratum are:
The two anti-and 1～5%HKGS additives of 94～98%Epilife, 1%PS.
2. inducing and acclimating epidermal stem cells according to claim 1 is the method for adipocyte, it is characterized in that, the preparation process of employed epidermal stem cells is as follows in the described step (1):
(1) get isolated time 1～4h, the people face tissue of 4 ℃ of preservations is soaked in 1min in the rare iodophor solution that contains 20% Iodophor, and PBS/ normal saline flushing 3 times is removed fatty tissue, is trimmed to 1cm
2Tissue block;
(2) tissue block is placed contain 4 ℃ of neutral protein enzyme solution and handle 14～16h or directly place 37 ℃ of incubators to handle more than the 3h;
(3) 4 ℃ PBS flushing sample 3 times; Separate epidermis;
(4) shred the back and add equal-volume 0.25%Trypsin-EDTA 3～8ml, in 37 ℃ of processing 30～90min, stop digestion, again by the thermal agitation layering with 3～8ml MEFs substratum;
(5) cell suspension of drawing the middle level is transferred in another centrifuge tube centrifugal 600～1000rpm, 3～8min;
(6) abandon supernatant, resuspended with the human epidermal stem cell substratum;
(7) move in the culturing bottle, leave standstill 30～90min after, abandon culture supernatant and, change Freshman epidermal stem cells substratum with PBS flushing 2～3 times; Place 37 ℃, 5%CO
2Incubator continues to cultivate;
Described human epidermal stem cell substratum consists of: two anti-, the 1%HKGS additives of 94～98%Epilife, 1%PS.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102104004A CN101875915B (en) | 2009-10-30 | 2009-10-30 | Method for inducing and acclimatizing epidermal stem cells into adipocytes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102104004A CN101875915B (en) | 2009-10-30 | 2009-10-30 | Method for inducing and acclimatizing epidermal stem cells into adipocytes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101875915A CN101875915A (en) | 2010-11-03 |
| CN101875915B true CN101875915B (en) | 2011-12-21 |
Family
ID=43018600
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102104004A Expired - Fee Related CN101875915B (en) | 2009-10-30 | 2009-10-30 | Method for inducing and acclimatizing epidermal stem cells into adipocytes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101875915B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102382800B (en) * | 2011-12-08 | 2013-01-23 | 吉林大学 | Method for inducing formation of porcine fat cells by cell signal channel inhibitor |
| CN107384855A (en) * | 2017-07-24 | 2017-11-24 | 陈强 | A kind of induced fibroblast is the method for adipocyte like cell |
| CN113462636B (en) * | 2021-08-05 | 2023-11-14 | 合肥滴碧云生物科技有限公司 | Improved method for differentiating epidermal stem cells into liver cells |
| CN116474172A (en) * | 2023-04-17 | 2023-07-25 | 广州市麦施缔医疗科技有限公司 | Epidermal stem cell and fat mixed injection method and breast augmentation and hip augmentation regeneration method |
-
2009
- 2009-10-30 CN CN2009102104004A patent/CN101875915B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101875915A (en) | 2010-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101760447B (en) | Method for inducing and acclimating epidermal stem cells into nerve cells | |
| CN103251649A (en) | Lyophilized powder of human mesenchymal stem cell culture supernatant and preparation method thereof | |
| CN105950542A (en) | Human skin epidermal cell culture medium and application thereof | |
| CN105079783B (en) | Pharmaceutical composition and its preparation method and application | |
| CN101875915B (en) | Method for inducing and acclimatizing epidermal stem cells into adipocytes | |
| ATE517177T1 (en) | METHOD FOR CULTIVATION OF HUMAN MESENCHYMAL STEM CELLS, IN PARTICULAR FOR THE TREATMENT OF NON-HEALING BREAKS, AND BIOREACTOR FOR CARRYING OUT THIS CULTIVATION METHOD | |
| CN109136180A (en) | Human umbilical cord's blood mescenchymal stem cell extract and its preparation method and application | |
| CN103436444A (en) | Culture apparatus used for temperature sensitive cells, preparation method thereof and cell culturing method | |
| CN108057116A (en) | Application of the stem cell composition in skin injury medicine | |
| CN102719394B (en) | Method for constructing goat dermal fibroblast (DFB) line | |
| CN101760449B (en) | Method for inducing and acclimating epidermal stem cells into muscle cells | |
| CN104212762A (en) | Method for culture of urine-derived pluripotent stem cells by virtue of in vitro small molecule induction | |
| Schwarz et al. | Characterization of adipose-derived equine and canine mesenchymal stem cells after incubation in agarose-hydrogel | |
| CN109112101A (en) | A kind of fibroblast culture medium and its application | |
| CN106701670A (en) | Methods for enhancing bioactive factor secretion capacity of mesenchymal stem cells and extracting active factors in culture solution | |
| CN106244548A (en) | Luteolin purposes in inducing mesenchymal stem cell neurad cell directional breaks up | |
| CN104877953A (en) | Skin preparation for promoting pigment generation of melanocytes | |
| US20030202965A1 (en) | Methods and compositions for the preparation of cell transplants | |
| CN108066750A (en) | Stem cell and its secretion are used to treat the new application of skin burn | |
| Yuan et al. | Cartilage tissue engineering using combination of chitosan hydrogel and mesenchymal stem cells | |
| CN108588017A (en) | A kind of amplification method of umbilical cord mesenchymal stem cells and its application in arthritis | |
| CN112716976A (en) | Nano composite hydrogel containing umbilical cord mesenchymal stem cells and preparation method and application thereof | |
| CN101760448B (en) | Method for inducing and acclimating epidermal stem cells into functional cells | |
| CN102552323B (en) | Medicine for accelerating skin repair and regeneration, preparation method thereof and application thereof | |
| CN115418341B (en) | Method for transdifferentiation of fibroblast to hair papilla cell and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111221 Termination date: 20161030 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |