CN101760448B - Method for inducing and acclimating epidermal stem cells into functional cells - Google Patents

Abstract

The invention discloses a method for inducing and acclimating epidermal stem cells into functional cells, comprising the following steps of: mixing an eplife culture medium and an induction culture medium according to different proportions, and ensuring that the epidermal stem cells have enough time fit for the continuous reduction of the eplife culture medium and the gradual increase of the induction culture medium, which is beneficial to reducing the differentiation to the epidermis and increasing the transformational probability to targeted cells. The method is simple and very effective tosimultaneously induce and acclimate the epidermal stem cells into nerve cells, fat cells and muscle cells in a nondirective way, overcomes the prejudice from technical personnel in the filed, subverts a judgment that the epidermal stem cells are unipotent stem cells for the first time, and proves that the epidermal stem cells have the multi-directional differentiation potential.

Description

Inducing and acclimating epidermal stem cells is the method for functioning cell

Technical field

The present invention relates to a kind of method of inducing cell, specifically utilize inducing and acclimating epidermal stem cells to be the method for functioning cell, described functioning cell is mainly neurocyte, adipocyte and muscle cell.

Background technology

Human research to epidermal stem cells, existing decades are historical, but because it is difficult to induce differentiation to be considered to unipotent stem cell always, namely only can break up the Related Component that becomes epidermis.Regenerative medicine is very powerful and exceedingly arrogant in medical field, the research of stem cell has occupied important low level in the regenerative medicine field, stem cell is because it has many differentiation potentials, and the ability that can be divided under given conditions various histoorgans obtains the concern of scientists.Embryonic stem cell is a kind of myeloid-lymphoid stem cell, and it can be divided into and remove extraplacental institute in a organized way and organ.But because the research of embryonic stem cell relates to ethical problems, so being devoted to seek another myeloid-lymphoid stem cell always, those skilled in the art substitute embryonic stem cell.

People are locked in target on the adult stem cell gradually.At present, those skilled in the art the success with MSC (mescenchymal stem cell), the adult stem cells such as ADSC (fat stem cell) are induced to differentiate into the cell of other types, such as chondrocyte, osteocyte, myocardial cell etc.MSC finds in marrow at first, because it has the concern that multi-lineage potential, hematopoiesis support and the characteristics such as the implantation of promotion stem cell, immunoregulation and self-replacation are subject to people day by day.Such as mescenchymal stem cell in vivo or under the external specific inductive condition, can be divided into the Various Tissues cells such as fat, bone, cartilage, muscle, tendon, ligament, nerve, liver, cardiac muscle, endothelium, still has multi-lineage potential after continuous passage cultivation and the freezing preservation, can be used as desirable seed cell and be used for injuries of tissues and organs reparation old and feeble and that pathology causes, therefore, at present MSC can be repaired the clinical generally application of being organized in of damage as a kind of seed cell and timbering material of bone tissue engineer.Mescenchymal stem cell (MSCs) is to belong to a mesoblastic class multipotential stem cell, mainly is present between reticular tissue and organ in the matter, and is the abundantest with content in the myeloid tissue, because marrow is its main source, therefore is referred to as mesenchymal stem cells MSCs.

But utilize MSC to induce the drawback of differentiation function cell to be: the source of MSC is limited, draws materials and pretty troublesome, upward relatively limited to from drawing materials because the content of MSC is 1/100000 only in marrow, in peripheral blood MSC content lower be 1/1000000; The MSC inducing culture cycle is long, and culturing process is complicated, be difficult for cultivating and amplification, so the application of MSC runs into a lot of obstructions.

Epidermal stem cells claims again specificity stem cell or unipotent cell, refers to produce a kind of cell type, but has the cell of self attribute.Those skilled in the art are classified as unipotent cell with epidermal stem cells always.Also be subjected to the impact of unipotent cell and limited for the range of application of epidermal stem cells.

Summary of the invention

The object of the invention is to remedy the deficiencies in the prior art, provide a kind of adult stem cell that will have pluripotency to be divided into the method for the functioning cells such as adipocyte, muscle cell, neurocyte by Tamed and led.For the later on application of clinical tissue engineering provides a kind of potential seed cell, can be widely used in the aspects such as trauma repair, gene therapy, beauty treatment, for the mankind provide convenience.

In order to achieve the above object, thinking of the present invention is: in the further investigation to epidermal stem cells, we recognize the annex hair follicle of epidermis, the stem cell that all there is multi-lineage potential in sweat gland, and also there is such stem cell with the corium that epidermis adjoins, as the abundantest stem cell of body content, the unipotent stem cell that can only break up exactly epidermic cell? with this query, we begin the epidermal stem cells versatility has been carried out very long research.

In research process, we have fully realized the correlation properties of epidermal stem cells, recognize that also epidermal stem cells was a kind of stem cell that is very difficult to cultivate before the Eplife culture systems is come out, it must be cultivated at low calcium ion concn or just can keep its dryness in without the culture systems of calcium ion and reduce to epidermal differentiation.The Eplife culture systems has not only also added the keeping of dryness that many somatomedins are conducive to epidermal stem cells more for it provides such environment, and also finds can make behind former culture the dryness of epidermal stem cells to rise in our experimentation.But this growth characteristic is given again and is induced differentiation to bring a difficult problem, induces the purpose cell of differentiation to need certain density calcium ion to exist, and this is that its growth is necessary.

So the dryness that how to keep epidermal stem cells is relatively stable, and it becomes the matter of utmost importance that the present invention need solve to the purpose cytodifferentiation with A clear guidance.Because the Eeplife culture systems has clear and definite meaning (by experiment confirm) to keeping of epidermal stem cells dryness, therefore we have selected the method as preparing cocktail that the Eeplife substratum is carried out mixing of different ratios with inducing culture, making epidermal stem cells have sufficient temporal adaptation Eeplife substratum constantly to reduce inducing culture increases gradually, and is conducive to reduce the probability that changes to the purpose cell to the epidermal differentiation increase.We are referred to as domestication with this culturing process.

Concrete technical scheme of the present invention is:

A kind of inducing and acclimating epidermal stem cells is the method for functioning cell, and the concrete steps of the method are

(1) with epidermal stem cells after cultivating, the density of getting stable growth is greater than 60% epidermal stem cells, at first cultivated 3～5 days in the mixed culture medium of non-direct guide substratum and dryness maintain base, the concentration ratio of non-direct guide substratum and dryness maintain base is 1: 3～5;

(2) after the concentration ratio of non-direct guide substratum and dryness maintain base being replaced by continuation in 2: 3 cultivated 4-8 days;

Be replaced by the non-direct guide substratum fully after (3) 6 days, and induce its differentiation more than at least 10～20 days with the non-direct guide substratum.

Above-mentioned inducing and acclimating epidermal stem cells is the method for functioning cell, wherein, washes cell 2～3 times front 1～2 day of step (1) beginning with the PBS damping fluid.

Described non-direct guide medium component and consumption are: 70～90%DMEM/F12,10～20%FBS and 1%PS.

Composition and the consumption of described dryness maintain base are: 94%～98%Epilife, 1%PS two anti-and～the 5%HKGS additive.

Advantage of the present invention and benefit are: the inventor confirms that through test of many times the inventive method is neurocyte, adipocyte and muscle cell with inducing and acclimating epidermal stem cells simply and very effectively.And overcome those skilled in the art's prejudice, overturning first epidermal stem cells is the judgement of unipotent stem cell, proves that it has multi-lineage potential.

Description of drawings

Fig. 1 is that immunofluorescence detects epidermal stem cells signature CD90, CD24, CD29, wherein the CD29 positive rate greater than 15%, CD24 positive rate greater than 80%, CD29 positive rate greater than 90%;

Fig. 2 is the not differentiation keratinocyte that flow cytometer detects people's foreskin stratum basale source.CD90, CD24, β 1 integrin is the surface markers of differentiation keratinocyte.Wherein the left figure of every picture group is control group, and right figure is the epidermal stem cells group that detects.The result shows that the keratinocyte dryness of acquisition is strong;

Fig. 3 is dryness gene OCT4 in the epidermal stem cells of each time point of identify cultivating of RT-PCR, SOX2, Klf4, Nanog, c-myc, CRIPTO, REX1, KRT14, differentiation marker KRT1, KRT5, KRT10, KRT19, other cell markings MTTF, TYR, the expression of c-kit;

Fig. 4 is the initial state of epidermic cell and induces two days later variation;

Fig. 5 immunofluorescence detects the undifferentiated keratinocyte fibronectin in people's foreskin source, and nestin, the expression of c-kit, A are the cell that keratinocyte was cultivated in the Eplife substratum three days, and B is the index that immunofluorescence detects

Fig. 6 produces mesoderm and neurocyte for the mode of the undifferentiated keratinocyte of adult by the serum Tamed and led; B is left to be that the adult's keratinocyte before inducing, right figure are Tamed and led after a day, and the undifferentiated keratinocyte of circle begins floatingly mostly, and the cell of the rapid differentiation that some paste back again forms the gathering of island sample; C is the epidermic cell that immunofluorescence involucrin detects differentiation after 10 days; The D immunofluorescence detects SMA; The cell of the E arrow indication oil red O stain positive; The cell of the F arrow indication nestin positive;

Neural (nestin), fat (oil red O), muscle (SMA) the specific stain positive behind Fig. 7 non-direct guide.

Embodiment

The preparation of embodiment 1 inducing and acclimating procuticle stem cell

One, the preparation of epidermal stem cells:

Direct sources and primary source: agree to take from the healthy posthetomy patient of 301 Hospital's surgery through the patient.

(1) gets fresh adult's foreskin (the about 1～4h of isolated time, 4 ℃ of preservations);

(2) foreskin is soaked in 1min in rare iodophor solution (containing Iodophor 20%);

(3) 3 flush away clots of PBS/ normal saline flushing (preventing from affecting the digestion of enzyme);

(4) prune foreskin, remove fatty tissue, use again the PBS/ normal saline flushing for several times, be cut at last 1cm ²About organize square;

(5) tissue block is placed contain neutral protease (3mg/ml; D-hanks makees solvent) in the 6cm ware of solution 4 ℃ process 14-16h, not also can place 37 ℃ of incubators (also can directly place 37 ℃ of incubators to process more than the 3h---observe at any time treatment effect) if process;

(6) 4 ℃ PBS flushing sample 3 times;

(7) separate epidermis (tear get with disinfecting forceps);

(concentration of pancreatin is 0.25% among the adding equal-volume 0.25%Typsin-EDTA after shredding in bottle, the concentration of EDTA is 0.05%, pancreatin and the EDTA of above-mentioned concentration were mixed by 1: 1) common 4ml, (the sample age, less digestion time was also longer to process 30～90min in 37 ℃, generally＜30 years old 37 ℃ of digestion 60min to 90min, generally＞30 years old 37 ℃ of digestion 45min), the substratum (MEFs substratum) that contains serum with 4ml stops digestion, again by the thermal agitation layering: stratum corneum (upper strata), cellular layer (middle level), tissue (lower floor);

(8) cell suspension of carefully drawing the middle level is transferred in another centrifuge tube, centrifugal 1000rpm 5min;

(9) abandon supernatant, resuspended with the human epidermal stem cell substratum;

(10) move in the culturing bottle (pretreated with 100 μ g/ml IV Collagen Type VIs), leave standstill 60min (stem cell inertia, first adherent) after, abandon culture supernatant and with PBS flushing 2 times, change fresh epidermal stem cells substratum; Place 37 ℃, 5%CO ²Incubator continues to cultivate.

Annotate: the human epidermal stem cell substratum forms

94～98％Epilife(Cascade?Biologics，cat.no.M-EPI-500-CA)

1%PS (two anti-Invitrogen, cat.no.15070)

1%, additive (HKGS, Cascade Biologics, cat.no.S-001-5)

Two, the growth conditions before the inducing and acclimating epidermal stem cells:

1, fresh epidermal stem was cultivated after 1 day, replaced medium (purpose is to remove dead cell).

2, generally cultivate 3 days after, this changes human epidermal stem cell substratum again.At this moment the most adherent growth of cell is the pebble path sample, and cell is fusiformis and oval (the cell walls boundary is clear), and sees a fairly large number of roundlet light cell, is grown in the upper strata of attached cell and is the growth of clone's property.

Three, the evaluation of epidermal stem cells:

The epidermal stem cells that above method is obtained is our needed epidermal stem cells whether, in conjunction with the molecule marker of cells and characteristic of stem, and the feature of epidermal stem cells we adopt RT-PCR (Fig. 3), immunofluorescence (Fig. 1), flow cytometry (Fig. 3) to detect the mark of epidermal stem cells.

1, authentication method:

For adherent cell above determining is our desired epidermal stem cells, we adopt RT-PCR, and the method for immunofluorescence detects its dryness molecule and specific molecule marker.

1.1RT-PCR

1.1.1RNA extraction

(1) suction of the substratum in ready IPS cell, epidermal stem cells, the MEF cell is abandoned, wash cell twice with PBS.

(2) each six orifice plate adds the Tribule lysate 1ml of 4 ℃ of precoolings, sees all cleaved opening of cell, approximately 5min.

(3) with rnase-free rifle point cell pyrolysis liquid is drawn onto in the 1.5ml centrifuge tube.

(4) add the 200ul chloroform, concuss is four to five times up and down, makes its abundant mixing.

(5) 12000rpm, 4 ℃ of 5min. liquid divides three layers, draws the upper transparent liquid layer in new 1.5ml centrifuge tube.

(6) add isopyknic Virahol, the mixing four or five times of turning upside down, the static 10min of room temperature.

(7) 12000rpm, 5min, 4 ℃ of this moments, visible RNA precipitated, and abandoned supernatant, noticed that careful operation will not precipitate the piece sucking-off.

(8) add 70% ethanol 700ul of precooling, 12000,2min, 4 ℃, abandon supernatant, repetitive operation is once.

(9) liquid residual among the RNA is dried, add nuclease free water dissolving RNA (noticing that RNA is too dried not soluble) depending on the precipitation volume amount

1.1.2 reverse transcription RNA is CDNA

(10) by reverse transcription test kit configuration reverse transcription system, see Table 1

Table 1

How much what * RNA added should decide on precipitation capacity, and the amount of last nuclease free water should be supplied 10ul

After adding well by upper table, 37 ℃, 15min, 85 ℃, 5s.-20 preservations are stand-by.

1.1.3PCR amplification

(11) the PCR reaction system is as follows

PCR?mixture 12.5ul

Primer?1 1ul

Primer?2 1ul

CDNA 1ul

dd?H2O 9.5ul

(11) the PCR reaction conditions sees Table 2

Table 2

Gene title and another name	Upstream primer	Downstream primer	Annealing temperature (℃)	Cycle number
					Oct4(POU5F1)-new	CGTGAAGCTGGAGAAGGAGAAGCTG	GAACATGTGTAAGCTGCGGCCCTTG	62	40
Sox2	GCTGCACATGAAGGAGCACCC	CGGACTTGACCACCGAACCCA	58	33
					Klf4	CAAGTCCCGCCGCTCCATTAC	TGGCTGGGCTCCTTCCCTCAT	58	33
c-Myc	ACTCTGAGGAGGAACAAGAA	TGGAGACGTGGCACCTCTT	58	33
					Nanog	CCCAAAGGCAAACAACCCACT	ATTGCTATTCTTCGGCCAGTT	58	33
CRIPTO(TDGF1)	TGCCCAAGAAGTGTTCCCTGT	GCAGCAGCCTTTACTGGTCAT	60	33
					REX1	CGCTGACACCATCCTCATCGG	GGCGTCATCGCTTGGTCTTGG	55	33

KRT1	AGGATGTGGATGGTGCTTAT	GCTTTGCTCTTCTGGGCTAT	58	33
					KRT5	CTGGACACCAAGTGGACCCT	GCTCCGCATCAAAGAACATC	58	33
KRT10	TGATAATGCCAACATCCTGC	CCTCCTCGTGGTTCTTCTTC	68	33
					KRT14	GGAGATGATTGGCAGCGTGGA	GGACCTGCTCGTGGGTGGACA	62	33
KRT15	AGCCTACCTGAAGAAGAACCACG	TGGCATAGCGGCACTCTGTCT	58	33
					KRT19	GCGACTACAGCCACTACTACACGAC	CGACCTCCCGGTTCAATTCTT	58	33
MITF	GACAGAAGAAACTGGAGCACG	ATCAGTGACACCGACGGGAGA	62	33
					TYR	TAGTCCACTTACTGGGATAGCG	AGTCTGGGTCTGAATCTTGTAG	62	33
β-actin	AAAGACCTGTACGCCAACAC	GTCATACTCCTGCTTGCTGAT	62	32

* the condition (cycle number) of PCR reaction, different gene fragments is widely different, so we need to find out best condition in the process of the test.

1.1.4 agarose gel electrophoresis detects amplified fragments

(13) take by weighing 1g electrophoresis level agarose, add 100ml 1xTBE, heating is dissolved agarose fully in the microwave oven;

(14) treat that glue is cooled to 50-60 ℃, the adding final concentration is that the EB dye liquor of 0.5ug/ml shakes up;

(15) seal offset plate with adhesive tape, pour into and be cooled to 30-40 ℃ of gel that configures;

(16) treat that gel solidifies, add a certain amount of electrophoresis liquid in the electrophoresis chamber, adhesive tape is unloaded, the glue groove is put in the electrophoresis chamber, makes electrophoresis liquid not have the glue groove.Pull up gently comb;

(17) get the Marker5ul loading, the PCR product that amplification is good is got 8ul loading electrophoresis, and when just beginning, 100V voltage treats that sample runs the plastic hole, and 60V when treating sample to glue 2/3, observes under the stop electrophoresis, ultraviolet lamp, takes pictures.

1.2 immunofluorescence

(1) get preferably IPS clone cell of state, PBS washes cell twice, adds fixedly 30min of 1ml4% Paraformaldehyde 96

(2) abandon stationary liquid, PBS washes cell 3 times, each 5min

(3) add 1ml 0.05% penetrating liquid 30min

(4) abandon penetrating liquid, wash cell 3 times with PBS, each 5min

(5) add 500ul sheep blood serum confining liquid, 1h.The primary antibodie diluent is by required dilution proportion primary antibodie

(6) add the good primary antibodie of dilution, put in the wet box 4 ℃ of refrigerator overnight

(7) take out the cell that primary antibodie is hatched next day, rinse with PBS and wash once, washing with PBS 3 times, each 10min

(8) PBS configuration two is anti-, abandons PBS, and the two anti-500ul that dilution is good are added in the cell and (take out two anti-later operations and answer lucifuge! ) hatch 1h45min.

(9) with PBS dilution DAPI dye liquor, contain in two dye liquors that resist in 1: 2500 ratio adding, continue to hatch 30min

(10) abandon liquid in the culture dish, PBS rinses and washes once, is washing with PBS 3 times, each 10min

(11) add a small amount of PBS, put the fluorescence microscopy Microscopic observation

1.3 the detection of flow cytometer

(1) will be by when replaced medium (after adherent 1 hour) epidermal stem cells of the adherent selection of four Collagen Type VIs, use the TE peptic cell, DTI stops digestion, and the cell that digests is washed cell three times with the PBS that contains 10%FBS of precooling, 12000rpm, 5min.

(2) with above-mentioned PBS re-suspended cell, counting diluting cells number is 5 * 105.

(3) every duplicate samples has been hanged cell with the PBS that 100ul contains 3%BSA, adds corresponding antibodies: 10ulCD29,10ul CD90, and 10ul CD24,4 degree refrigerators are hatched 30min.

(4) wash cell three times with cold PBS, 12000rpm, 5min.

(5) anti-with 3% the PBS dilution two that contains BSA, rabbit resists (1: 400), mouse-anti (1: 200)

(6) 4 degree refrigerators are hatched 20-30min, repeating step four, and left back with the cold PBS re-suspended cell that contains BSA of 500ul, flow cytometer detects.

2, qualification result:

As shown in Figure 1, immunofluorescence detects epidermal stem cells signature CD90, CD24, CD29, wherein the CD29 positive rate greater than 15%, the CD24 positive rate greater than 80%, the CD29 positive rate is greater than 90%.As shown in Figure 2, flow cytometer detects the not differentiation keratinocyte in people's foreskin stratum basale source, CD90, CD24, the surface markers of β 1integrin for not breaking up keratinocyte, wherein the left figure of every picture group is control group, right figure is the epidermal stem cells group that detects, and the result shows that the keratinocyte dryness of acquisition is strong.As shown in Figure 3, dryness gene in the epidermal stem cells of each time point that the RT-PCR evaluation is cultivated, OCT4, SOX2, Klf4, Nanog, c-myc, CRIPTO, REX1, KRT14, differentiation marker KRT1, KRT5, KRT10, KRT19, the expression of other cell markings MTTF, TYR, c-kit.

At present the technology of separate stem cells does not also reach and makes that to separate the cell purity that obtains be 100%, and it is very high that the result who detects by flow cytometer shows that we separate the cell purity that obtains, and wherein the CD29 verification and measurement ratio reaches 99%.Simultaneously we have detected the molecule marker of other cells with immunofluorescence, and detected result shows that the quantity that other cells exist is few.

Embodiment 2 inducing and acclimating epidermal stem cells are functioning cell (neurocyte, adipocyte and muscle cell)

1, substratum forms

(1) non-direct guide medium component and consumption are: 89%DMEM/F12 (Gibico), 10%FBS and 1%PS (two anti-Invitrogen, cat.no.15070).

(2) composition of dryness maintain base and consumption are: 98%Epilife (Cascade Biologics, cat.no.M-EPI-500-CA), 1%PS is (two anti-, Invitrogen, cat.no.15070) and 1%HKGS additive (HKGS, Cascade Biologics, cat.no.S-001-5).

2, method for inducing and domesticating:

(1) Tamed and led pre-treatment:

Needed to wash cell with PBS in 1～2 day before cell induction begins, purpose is to determine the small circle cell number and change fresh Epilife substratum.

(2) with epidermal stem cells after cultivating, the density of getting stable growth is greater than 60% epidermal stem cells (cultural method is seen above-mentioned), at first cultivated in the mixed culture medium of non-direct guide substratum and dryness maintain base 3 days, the concentration ratio of non-direct guide substratum and dryness maintain base is 1: 4 (i.e. 20% non-direct guide substratum and 80% dryness maintain base);

(3) after the concentration ratio of non-direct guide substratum and dryness maintain base is replaced by and continues to cultivate 6 days (i.e. 40% non-direct guide substratum and 60% dryness maintain base) at 2: 3;

Be replaced by the non-direct guide substratum of non-direct guide substratum 100% after (4) 6 days fully, and induce its differentiation with the non-direct guide substratum, differentiation is more than 10～20 days.

Evaluation and the interpretation of result of embodiment 3 purpose cells

(1) authentication method:

In the experimental verification of inducing as muscle cell, neurocyte and adipocyte, immunofluorescence detects muscle cell mark (a-SMA), neurocyte mark (Nestin) and positive by the oil red O stain of oil red Coloration experiment proof adipocyte.

Muscle cell: detect a-SMA with immunofluorescence in 1-3 week after Tamed and led finishes;

Neurocyte detects Nestin with immunofluorescence in 1-3 week after Tamed and led finishes;

Adipocyte: use oil red O stain in 1-3 week after Tamed and led finishes: get and induce rear cell (the microscopically observation has the form of adipocyte, occur a lot of fat in the cell and drip cavity), wash cell 1-3 time with PBS, add the oil red O dye liquor (oil red: distilled water=3: 2) dyeing 15min-1h that configures, in the dyeing course, Microscopic observation dyeing situation.The concrete time can oneself hold, to reach satisfied Color.

(2) qualification result:

10 days, 2 weeks, 3 all immunofluorescences detect epidermic cell specific marker (involucrin is positive), muscle cell specific marker (SMA is positive), Neuron-specific mark (Nestin is positive) behind Tamed and led respectively, during three weeks, oil red O stain detects adipocyte.Be illustrated in figure 6 as the mode of the undifferentiated keratinocyte of adult by the serum Tamed and led and produce mesoderm and neurocyte; B is left to be that the adult's keratinocyte before inducing, right figure are Tamed and led after a day, and the undifferentiated keratinocyte of circle begins floatingly mostly, and the cell of the rapid differentiation that some paste back again forms the gathering of island sample; C is the epidermic cell that immunofluorescence involucrin detects differentiation after 10 days; The D immunofluorescence detects SMA; The cell of the E arrow indication oil red O stain positive; The cell of the F arrow indication nestin positive.

Fig. 4 is the epidermic cell initial state and induces two days later state.Left figure is initial epidermal stem cells growth conditions of inducing; Right figure is the growth conditions (can be used as reference index) that Tamed and led is cultivated epidermal stem cells two days later.

Fig. 5 immunofluorescence detects the undifferentiated keratinocyte fibronectin in people's foreskin source, and nestin, the expression of c-kit, A are the cell that keratinocyte was cultivated in the Eplife substratum three days, and B is the index that immunofluorescence detects.

Neural (nestin), fat (oil red O), muscle (SMA) the specific stain positive behind Fig. 7 non-direct guide.A figure detects Nestin, and detected result is positive; B figure cell is through oil red O stain, and detected result is positive, and C figure immunofluorescence detects SMA, and detected result is positive.

(3) induce the result:

We prepare number of samples 131 examples of epidermal stem cells, non-direct guide 10 examples, 100% success.We have proved that epidermal stem cells can successfully be divided into adipocyte, muscle cell, neurocyte through above-mentioned non-direct guide.

(4) purposes of the present invention:

Epidermal stem cells is in the non-directional culture systems, and can break up simultaneously becomes fat, muscle, neurocyte, has confirmed the non-unipotent stem cell of epidermal stem cells, and it has clear and definite multi-lineage potential.Epidermal stem cells is widely distributed at human body, draws materials easily, and Stem Cell Activity is not subjected to age limit to have again good amplification in vitro ability, and these all will increase advantage for it in the adult stem cell Application Areas.

Claims (3)

1. inducing and acclimating epidermal stem cells is the method for functioning cell, it is characterized in that, the concrete steps of the method are:

(1) with epidermal stem cells after cultivating, the density of getting stable growth is greater than 60% epidermal stem cells, at first cultivated 3～5 days in the mixed culture medium of non-direct guide substratum and dryness maintain base, the concentration ratio of non-direct guide substratum and dryness maintain base is 1: 3～5;

(2) after the concentration ratio of non-direct guide substratum and dryness maintain base being replaced by continuation in 2: 3 cultivated 4～8 days;

Be replaced by the non-direct guide substratum fully after (3) 6 days, and induce its differentiation 10～20 days with the non-direct guide substratum;

Described non-direct guide medium component and consumption are: 89%DMEM/F12,10%FBS and 1% penicillin-Streptomycin sulphate is two anti-;

Composition and the consumption of described dryness maintain base are: 94～98%Epilife, the two anti-and 1～5%HKGS additives of 1% penicillin-Streptomycin sulphate;

Described functioning cell is neurocyte, adipocyte or muscle cell.

2. inducing and acclimating epidermal stem cells according to claim 1 is the method for functioning cell, it is characterized in that, washes cell 2～3 times front 1～2 day of step (1) beginning with the PBS damping fluid.

3. inducing and acclimating epidermal stem cells according to claim 1 and 2 is the method for functioning cell, it is characterized in that, the preparation process of employed epidermal stem cells is as follows in the described step (1):

(1) get isolated time 1～4h, the people face tissue of 4 ℃ of preservations is soaked in 1min in the rare iodophor solution that contains Iodophor 20%, and PBS/ normal saline flushing 3 times is removed fatty tissue, is trimmed to 1cm ²Tissue block;

(2) tissue block is placed contain 4 ℃ of neutral protein enzyme solution and process 14～16h or directly place 37 ℃ of incubators to process more than the 3h;

(3) 4 ℃ PBS flushing sample 3 times; Separate epidermis;

(4) shred rear adding equal-volume 0.25%Typsin-EDTA3～8ml, in 37 ℃ of processing 30～90min, stop digestion with 3～8ml MEFs substratum, again by the thermal agitation layering;

(5) cell suspension of drawing the middle level is transferred in another centrifuge tube centrifugal 600～1000rpm3～8min;

(6) abandon supernatant, resuspended with the human epidermal stem cell substratum;

(7) move in the culturing bottle, leave standstill 30～90min after, abandon culture supernatant and with PBS flushing 2～3 times, change Freshman epidermal stem cells substratum; Place 37 ℃, 5%CO ₂Incubator continues to cultivate;

Described human epidermal stem cell substratum consists of two anti-, the 1%HKGS additives of 98%Epilife, 1%PS.

Images