CN101831495B - Method for detecting bovine neosporosis and application - Google Patents
Method for detecting bovine neosporosis and application Download PDFInfo
- Publication number
- CN101831495B CN101831495B CN 201010160434 CN201010160434A CN101831495B CN 101831495 B CN101831495 B CN 101831495B CN 201010160434 CN201010160434 CN 201010160434 CN 201010160434 A CN201010160434 A CN 201010160434A CN 101831495 B CN101831495 B CN 101831495B
- Authority
- CN
- China
- Prior art keywords
- primer
- template
- amplification
- probe
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting bovine neosporaosis. The method comprises the following steps of: adding an internal amplification control for indicating false negative into a PCR reaction system, constructing an interior label template by basic group rearrangement, primer design and bridging PCR amplification, constructing a fluorescent quantitative PCR reaction system containing internal label, and determining reaction conditions of a co-amplification system, wherein Mg2+ is 2.5mmol/L, the dNTP is 0.3mmol/L, the primer is 0.5mmol/L, and the probe is 0.2mmol/L; and the amplification conditions comprise 50 DEG C, 2min and one cycle, or 95 DEG C, 5min and one cycle, or 95 DEG C and 15s or 57 DEGC and 45s and 45 cycles. The method has the advantages of high detection sensitivity, good specificity and convenient operation, can indicate and correct the generation of false negative results, and is widely applied in the field of timely, accurately and effectively detecting the bovine neosporaosis.
Description
Invention field
The invention belongs to the animal epidemic detection field, be specifically related to the detection method of protozoan parasite disease, particularly relate to a kind of detection method and Application Areas of ox neosporosis.
Background technology
Ox neosporosis (Neosporosis) is to colonize in by dog neospora (Neospora caninum) a kind of protozoal disease that causes in host.But this disease vertical transmission is one of Etiological that causes the milk cow miscarriage, has caused very large financial loss to livestock industry.Widely distributed in this disease world wide.Since calendar year 2001, successively detected the existence of dog neospora antibody in milk cow (yak) serum in the areas such as Beijing, Shanxi, Qinghai, Hebei, Xinjiang.Up to now, also do not prevent and treat this sick active drug and vaccine, therefore, good detection technique is effectively to control this sick good method.
Detection method comparatively commonly used has indirect fluorescent antibody test (IFAT), immunohistochemistry detection method (IHC), Avidin-Biotin-Goodpasture's staining (ABC), enzyme linked immunosorbent assay (ELISA), latex agglutination test (NAT) and immunoblotting (IB) etc. at present, traditional method has been brought into play vital role in the control of ox neosporosis, but it is complicated to exist some experimental implementation, sense cycle is long, can not detect the drawbacks such as infected animal of latent infection and early infection.Along with developing rapidly of Protocols in Molecular Biology, the application of fluorescent PCR detection technique has improved detection efficiency and detection sensitivity greatly.But due to the not principal component that has large amount of complex in sample, and in the sample preparation process, the residual of some materials can affect pcr amplification, and the sensitivity that reaction is recorded even causes false negative result, detect for fluorescent PCR, can't correctly determine the copy number of goal gene.By the method for adding interior mark coamplification template, detected result being carried out quality control is approved widely.
Through retrieval, also have no both at home and abroad and adopt the bypass method pcr amplification to build interior mark coamplification template and fluorescent probe, built detection sensitivity high, specificity is good, easy to operate and can indicate and calibrate false negative result, improve the report of fluorescence quantifying PCR method of the detection ox neosporosis of accuracy rate.Therefore; exploration and research detection sensitivity are high; specificity is good; easy to operate and can indicate and proofread and correct the method for false negative result; for promptly and accurately effectively detecting the ox neosporosis, protection livestock industry develops in a healthy way, promotes the agricultural products in China outlet and protects the aspects such as favorable image of China in international trade all significant.
Summary of the invention
Relevant detection sensitivity is high for having no at present, and specificity is good, and is easy to operate and can indicate and proofread and correct false negative result, improves the method for the detection ox neosporosis of accuracy rate.The invention provides a kind of, method quick, that accurately detect sensitive, efficient to the ox neosporosis.
The object of the present invention is to provide that a kind of detection sensitivity is high, specificity good, the test period is short, and can indicate and proofread and correct false negative result, guaranteed the ox neosporosis detection method of PCR detection accuracy.
The present invention is by primer and probe design, use the bypass method pcr amplification, obtained mark template in the N.caninum fluorescent quantitative PCR, and addition and the reaction conditions of internally marking template are optimized, set up the fluorescence quantitative PCR detection system that contains internal standard substance, thereby realized the sensitivity to the ox neosporosis, efficient, quick, accurately detection.
The present invention specifically provides the method for quick of a kind of ox neosporosis conclusive evidence and accurate quantitative analysis.
Technical scheme of the present invention: add the false-negative amplification interior label of indication (internal amplification control by adopting in the PCR reaction system, IAC), by base rearrangement, design of primers and bypass method pcr amplification, built an IAC fragment, through condition optimizing, successful structure contain interior target quantitative fluorescent PCR reaction system, can show the existence that suppresses composition or indicate false-negative generation, realization is implemented monitoring to process of the test, guarantee to detect quality, thereby set up a kind of detection method of ox neosporosis.
The present invention further provides a kind of ox neosporosis detection method, concrete steps are as follows:
1. the design of primer and probe is with synthetic:
Amplify two of the Auele Specific Primer Np2 of 138bp and Nr2 according to N.caninum Nc-5 gene order design, one of NTpro fluorescent probe, two of template structure primer Np1 and Nr1, wherein Np1, Nr1 are positioned at outside Np2, Nr2, amplify the fragment that length is 338bp.Probe NTpro sequence is reset, utilize the base mutation principle, design primer Nc1 and Nc2 by the bypass method pcr amplification, have built interior mark probe NCpro.
2. the preparation of target dna template:
Ox anticoagulated whole blood or ox aborted fetus organize pathological material of disease to extract according to the Whole Blood Genomic DNA of routine report that in test kit or tissue sample, genome DNA extracting reagent kit operates, take dog neospora complete genome DNA as template, Np1, Nr1 are amplimer, and reaction conditions is: 94 ℃ of sex change 5min; 94 ℃ of 30s, 62 ℃ of 20s, 72 ℃ of 30s, 35 circulations; Extend 10min at 72 ℃ at last.Amplified production reclaims through gel-purified, is connected on the pMD18-T carrier, transforms DH5 α competent cell, extracts plasmid, cuts, after PCR and order-checking identify, obtains To Template pMD18-NT through enzyme, and the present invention is called for short NT.
3. the design of bypass method pcr amplification and interior mark probe:
Take plasmid NT as template, adopt respectively primer Np1, Nc1 and Nc2, Nr1 to carry out pcr amplification for the pairing primer, amplification condition is: 94 ℃ of 5min; 94 ℃ of 30s, 62 ℃ of 20s, 72 ℃ of 30s, 35 circulations; 72 ℃ of 10min.Amplified production is called after Np1c1, Nc2r1 respectively; After Np1c1, Nc2r1 purifying are reclaimed, equal amount of mixture as template, carries out pcr amplification with primer Np1 and Nr1, and reaction conditions is: 94 ℃ of sex change 5min; 94 ℃ of 30s, 62 ℃ of 20s, 72 ℃ of 30s, 35 circulations; Extend 10min at 72 ℃ at last.Product purification after amplification is reclaimed and is connected on the pMD18-T carrier, transform DH5 α competent cell, extract plasmid, through enzyme cut, PCR and order-checking identify correct after, mark template pMD18-NC in obtaining, the present invention is called for short NC.
4. the foundation of substance fluorescent PCR amplification system:
Take NT and NC as template, respectively take Np2, Nr2, NTpro and Np2, Nr2, NCpro as primer and probe increase, then be respectively 10 with concentration
9～10
0The NT of copy/μ L and NC mixture are template, take Np1, Nr1, NTpro and NCpro as primer and probe carry out the fluorescent PCR coamplification, through relatively, in final coamplification system in the mark template add concentration and react 10 for each
2Copy, Mg
2+2.5mmol/L, each 0.3mmol/L of dNTP, each 0.5mmol/L of primer, each 0.2mmol/L of probe, amplification condition are 50 ℃, 2min, 1 circulation; 95 ℃, 5min, 1 circulation; 95 ℃ of 15s, 57 ℃ of 45s, 45 circulations.
In the present invention, be numbered N.caninum Nc-5 gene order design primer and the fluorescent probe of X84238.1 in the reference gene storehouse, the long 1205bp of this N.caninum Nc-5 gene order, those of ordinary skills can be known by the public's channel.
In the present invention, take N.caninum Nc-5 gene as template, amplify with primer Np1 and Nr1 the fragment that length is 338bp, this fragment is cloned into the pMD-18T carrier, obtains To Template pMD18-NT, is called for short NT.
In the present invention, take NT as template, amplify with primer Np2 and Nr2 the fluorescent PCR amplified fragments that length is 138bp.
In the present invention, take NT as template, amplifying respectively length with primer Np1, Nc1 and Nc2, Nr1 is 194bp and 168bp fragment, called after Np1c1 and Nc2r1.
In the present invention, take Np1c1, Nc2r1 equal amount of mixture as template, carry out pcr amplification with primer Np1 and Nr1 and go out the fragment that length is 338bp, this fragment is cloned into the pMD-18T carrier, obtains interior mark template pMD18-NC, is called for short NC.
Simultaneously, the present invention fully takes into account, and when NC and NT two templates increase simultaneously, can compete enzyme, primer and probe, amplification is exerted an influence, to the reaction conditions of coamplification system with detect lower bound and be optimized research.Get concentration and be respectively 10
9～10
0The NT of copy/μ L and NC mixture, take Np2, Nr2, NTpro and NCpro as primer and probe carry out the fluorescent PCR coamplification, through optimizing, in the coamplification system in the mark template add concentration and react 10 for each
2Copy, Mg
2+2.5mmol/L, each 0.3mmol/L of dNTP, each 0.5mmol/L of primer, each 0.2mmol/L of probe, TaqDNA polysaccharase are 1.5u, amplification condition is 50 ℃, 2min, 1 circulation; 95 ℃, 5min, 1 circulation; 95 ℃ of 15s, 57 ℃ of 45s, 45 circulations.
Further, the specificity of ox neosporosis detection method of the present invention, the repeatable detection are proved conclusively, and have been set up typical curve.
With amplification system provided by the invention increased respectively bovine herpes virus-1, bovine leukemia virus, foot and mouth disease virus, toxoplasma gondii, ox annular Taylor worm and Niu Shuanya Babesia DNA or cDNA; sample does not all have positive amplification curve, shows that the method has specificity preferably.
Use amplification system provided by the invention, with 10
2The NC template of copy/reaction is respectively with 10
7, 10
5With 10
3The NT of copy/reaction carries out repeatedly repeated augmentation detection, and Ct value standard deviation and the variation coefficient that different tests obtains are analyzed, and the Ct value variation coefficient that different tests obtains is 0.5%～1.3%, shows that the method has repeatability preferably.
Further, the present invention passes through 10
9～10
0Adding concentration in the NT of copy/reaction density and system is 10
2The NC coamplification of copy has been set up ox neosporosis fluorescent PCR coamplification examination criteria curve.
By implementing the concrete summary of the invention of the present invention, can reach following beneficial effect.
1. detection sensitivity is high: the method can detect the recombinant plasmid of 10 copies, and conventional PCR is high 1000 times for remolding sensitivity.
2. detection time is short: traditional polypide partition method at least will be more than 7d to the detection time of N.caninum, and this invention comprises that sample pre-treatments arrives detection time and obtain detected result within 2.5h, shortens at least 30min than the PCR detection method of routine.
3. specificity is good: by to bovine herpes virus-1, bovine leukemia virus, foot and mouth disease virus, toxoplasma gondii, ox annular Taylor worm and Niu Shuanya Babesia DNA or cDNA sample detection, only have the N.caninum test positive.
4. good reproducibility: by to 10
7, 10
5With 10
3The NC-5 standard plasmid of 3 gradient dilutions of copy/reaction carries out three repeatability and detects, and the Ct value variation coefficient that different tests obtains is 0.5～1.3%, all within 5%.
5. stability is high: detect by the repeatability to sample, all obtain the consistence result.
6. pollute few: detect with regular-PCR and compare, whole reaction is carried out in the pipe of same sealing, has reduced the pollution that electrophoresis step causes.
7. can carry out Real-Time Monitoring and detection by quantitative: by the reception of instrument to producing fluorescent signal in each amplification, realize the Real-Time Monitoring of whole reaction process and the detection by quantitative of result.
8. can indicate the generation of false negative result: along with increasing of reacting, if sample and interior mark template all do not have amplification curve, illustrate that this detected result is false negative result because of the interior mark template in this reaction system.
9. flow process is simple: strong operability, be easy to grasp, and as long as possess molecular biology mechanism knowledge, can finely complete just need not good special training.
10. cost is low: the reagent that uses is the molecular biology common agents, and low price is easy to buying, and consumption is few.
11. interior mark stencil design is reasonable: reset and the bypass method pcr amplification by base, interior mark template two terminal sequences and the goal gene sequence that build are in full accord, at the probe joint bit sequence, change has occured only, make it and to be combined with interior mark probe, the base sequence of interior tap section and the character of goal gene are also substantially identical, with be combined with a pair of primer, therefore in tap section and goal gene same amplification efficiency is arranged, guaranteed the carrying out of coamplification.
12. the addition of interior mark template is reasonable: in adding, the mark template is the recombinant plasmid of 100 copies, and this concentration can reach the monitoring to reaction process, does not affect again fluorescent quantitation to the augmentation detection of To Template fluorescent PCR.
13. practical value is high: realize process of the test is implemented monitoring, effectively solved the false negative result that exists in the traditional detection method, can carry out quality monitoring to the laboratory, guarantee the accuracy of detected result.
14. effect is good: detect with this system with this inventive method 50 parts of anticoagulated whole bloods and 8 parts of aborted fetus tissues to clinical collection, all obtain expected results.
15. reference is large: the foundation of the method for the research of relevant parasite inspection and quarantine technology provides reference preferably, and has to the development of standardization the reference of guidance for the standard detection reagent.
16. have a extensive future: the method can be widely used in inspection and quarantine, animal and veterinary and cultivation unit, for effective prevention and control of epidemic disease significant.
Description of drawings
Figure 1 shows that N.caninum pcr amplification result, wherein, 1 is that primer Np1/Nr1 is total to 338bp to the N.caninumPCR amplified production, and M is DL 2000Marker.
Figure 2 shows that recombinant plasmid pcr amplification result, wherein, 1,2 is that primer Np1/Nr1 is total to 338bp to restructuring plasmid PCR amplified production, and M is DL2000Marker.
Figure 3 shows that the recombinant plasmid enzyme cuts qualification result, wherein, 1 fragment that produces for the restructuring plasmid enzyme restriction, M is DL2000Marker.
Figure 4 shows that Np1c1 and Nc2r1PCR amplification, wherein, 1 is primer Np1/Nc1 to the amplification of NT 194bp altogether, 2 be primer Nc2/Nr1 to the common 168bp of the amplification of NT, M is DL 2000Marker.
Figure 5 shows that primer, the relative template position of probe.
Figure 6 shows that NT, NC template fluorescent PCR amplification partial sequence schematic diagram, wherein underscore is probe sequence.
Figure 7 shows that NTpro (Fig.A) and NCpro (Fig.B) real-time pcr amplification curve, wherein, 1 is the fluorescent PCR amplification curve take NT as template; 2 are the fluorescent PCR amplification curve take NC as template; Result shows, probe has specificity preferably for each self-template.
Figure 8 shows that 10
2The NC of copy/reaction and the NT coamplification curve of serial gradient dilution, wherein, 1-10 is 10
9-10
0The NT (Fig.A) of copy/reaction and corresponding NC (Fig.B) amplification curve.
Figure 9 shows that the coamplification typical curve.
Figure 10 shows that the replica test of coamplification system, wherein, 1-3 is respectively 10
7, 10
5, 10
3The NT (Fig.A) of copy/reaction and corresponding NC (Fig.B) amplification curve.
Embodiment
Below, for embodiment, the present invention is described, still, the present invention is not limited to following embodiment.
Dog neospora genomic dna, clinical sample and the relevant control sample selected in the present invention, wherein dog neospora complete genome DNA is provided by China Agricultural University; The ox anticoagulated whole blood organizes the samples such as pathological material of disease to pick up from different cattle farms, Xinjiang with aborted fetus; The nucleic acid samples those of ordinary skills such as bovine herpes virus-1, bovine leukemia virus, foot and mouth disease virus, toxoplasma gondii, ox annular Taylor worm and Niu Shuanya Babesia can obtain by public's approach.
The main agents of selecting in the present invention:
It is hundred Imtech's products that Whole Blood Genomic DNA extraction test kit (DP1102), DNAzol genomic dna rapid extraction reagent (DP3002), plasmid prepare test kit (DP1001); PMD18-T carrier (D101A), DH5 α competent cell, gel-purified reclaim test kit (DV805A), Taq archaeal dna polymerase (5U/ μ L), DL 2000DNA molecular weight standard etc. and are precious biotechnology (Dalian) company limited product, and primer, probe are synthetic by precious biotechnology (Dalian) company limited.
The key instrument of selecting in the present invention:
Micro sample adding appliance (Eppendorf), high speed frozen centrifugation (HITACHI CF16RX), fluorescent PCR instrument (ABI7300), PCR instrument (Biometra), electrophoresis apparatus (Bio-RAD MODEL200), digital image analyzer (Alpha innotech corporation IS-2200), Lambda35 ultraviolet spectrophotometer (PerkinElmer) etc.
All reagent of selecting in the present invention and instrument are all well known selecting, but do not limit enforcement of the present invention, and other reagent more well known in the art and equipment are all applicable to the enforcement of the following embodiment of the present invention.
Be numbered N.canmum Nc-5 gene order design primer and the fluorescent probe of X84238.1 in the present invention in the reference gene storehouse, those of ordinary skills can be known by the public's channel.
Embodiment one: the detection of ox neosporosis
1. the design of primer and probe is with synthetic:
Amplify two of the Auele Specific Primer Np2 of 138bp and Nr2 according to N.caninumNc-5 gene order design, one of NTpro fluorescent probe, two of template structure primer Np1 and Nr1, wherein Np1, Nr1 are positioned at outside Np2, Nr2, amplify the fragment that length is 338bp.Probe NTpro sequence is reset, utilize the base mutation principle, design primer Nc1 and Nc2 by the bypass method pcr amplification, have built interior mark probe NCpro.
2. the preparation of target dna template:
Ox anticoagulated whole blood and ox aborted fetus are organized respectively and are extracted test kit and DNAzol extraction according to the Whole Blood Genomic DNA of hundred Imtech, by the operation of practical illustration book.
Take dog neospora complete genome DNA as template, be amplimer with Np1, Nr1, reaction conditions is: 94 ℃ of sex change 5min; 94 ℃ of 30S, 62 ℃ of 20S, 72 ℃ of 30S, 35 circulations; Extend 10min at 72 ℃ at last.Amplified production reclaims through gel-purified, is connected on the pMD18-T carrier, transforms DH5 α competent cell, extracts plasmid, through enzyme cut, after PCR and order-checking identify, called after pMD18-NT is called for short NT.
3. the design of bypass method pcr amplification and interior mark probe:
Take plasmid NT as template, adopt respectively primer Np1, Nc1 and Nc2, Nr1 to carry out pcr amplification for the pairing primer, amplification condition is: 94 ℃ of 5min; 94 ℃ of 30S, 62 ℃ of 20s, 72 ℃ of 30s, 35 circulations; 72 ℃ of 10min.Amplified production is called after Np1c1, Nc2r1 respectively.
With after Np1c1, Nc2r1 balanced mix as template, carry out pcr amplification with primer Np1 and Nr1, reaction conditions is: 94 ℃ of sex change 5min; 94 ℃ of 30S, 62 ℃ of 20S, 72 ℃ of 30S, 35 circulations; Extend 10min at 72 ℃ at last.。Product purification after amplification is reclaimed and is connected on the pMD18-T carrier, transform DH5 α competent cell, extract plasmid, through enzyme cut, PCR and order-checking identify correct after, called after pMD18-NC, abbreviation NC.
4. the foundation of substance fluorescent PCR amplification system:
Take NT and NC as template, respectively take Np2, Nr2, NTpro and Np2, Nr2, NCpro as primer and probe increase, dNTP (2.5mM) consumption is respectively 1 μ L, 1.5 μ L, 2 μ L, 2.5 μ L, 3 μ L, it is 0.25 μ L, 0.5 μ L, 1 μ L, 1.5 μ L, 2 μ L that primer (10 μ M) consumption is respectively, probe (10 μ M) consumption is respectively 0.25 μ L, 0.5 μ L, 1 μ L, 1.5 μ L, 2 μ L, Mg
2+(25mM) consumption is respectively 0.5 μ L, 1 μ L, 1.5 μ L, 2 μ L, 2.5 μ L, TaqDNA polysaccharase (5U/ μ L) consumption is respectively 0.125 μ L, 0.25 μ L, 0.5 μ L, 1 μ L, DNA profiling 1 μ L, Tm is 56～61 ℃, loop parameter is 40,45 and 50, other parameter constants when optimizing.
Further, the present invention gets 10
9～10
0The NT of copy/μ L concentration and NC mixture, take Np1, Nr1, NTpro and NCpro as primer and probe carry out the fluorescent PCR coamplification, through optimizing, in the coamplification system in mark template NC add concentration and react 10 for each
2Copy, Mg
2+2.5mmol/L, each 0.3mmol/L of dNTP, each 0.5mmol/L of primer, each 0.2mmol/L of probe, amplification condition are 50 ℃, 2min, 1 circulation; 95 ℃, 5min, 1 circulation; 95 ℃ of 15s, 57 ℃ of 45s, 45 circulations.
Primer code name in the present invention, sequence, position see Table 1.Wherein, be numbered N.caninum Nc-5 gene order design primer and the fluorescent probe of X84238.1 in the reference gene storehouse, the long 1205bp of this N.caninum Nc-5 gene order, those of ordinary skills can be known by the public's channel.
Table 1: primer code name, sequence, position and few nucleotide
Embodiment two: the acquisition of To Template
Ox anticoagulated whole blood and ox aborted fetus are organized respectively and are extracted test kit and DNAzol extraction according to the Whole Blood Genomic DNA of hundred Imtech, by the operation of practical illustration book.
Choose 25 μ L PCR reaction systems: 2.5 μ L10 * Buffer, 1.5 μ L MgCl
2(25mM), 2 μ LdNTP (2.5mM), each 1 μ L of upstream and downstream primer (10 μ M), 1 μ L dog neospora genomic dna, 0.25 μ LTaq archaeal dna polymerase (5U/ μ L) adds ddH
2O mends to 25 μ L.The PCR response procedures is: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 62 ℃ of annealing 20s, 72 ℃ are extended 30s, totally 35 circulations; 72 ℃ are extended 10min.
Amplified production 10g/L agarose electrophoresis, and gel-purified recovery are connected on the pMD18-T carrier, transform DH5 α competent cell, and the extraction plasmid carries out PCR, enzyme is cut and check order evaluation.
1. the pcr amplification of recombinant plasmid is identified: during the screening electrophoresis, after the slow 10 times of dilutions of recombinant plasmid of more negative movement, getting 1 μ L is template, adds 2.5 μ L 10 * PCR damping fluids, 1.5 μ L MgCl
2(25mM), 2 μ LdNTP (2.5mM) mixtures, 0.25 μ L Taq archaeal dna polymerase (5u/ μ L), each 1 μ L of upstream and downstream primer (10 μ M), moisturizing to 25 μ L volume carries out pcr amplification, and amplification condition is the same, and the 10g/L agarose gel electrophoresis detects.
2. the enzyme of recombinant plasmid is cut evaluation: add 10 * K Buffer, 1 μ L in the 0.2mL pipe, each 0.3 μ L of BamH I and HindIII enzyme (15u/ μ L), plasmid DNA 4 μ L, aqua sterilisa is mended to 10 μ L, centrifugal mixing put 37 ℃ of water-bath digestion 2h, 65 ℃ of water-bath 10min deactivation restriction endonucleases, add 2 μ L6 * loading buffer, the 10g/L agarose gel electrophoresis detects.
3. the order-checking of recombinant plasmid: pcr amplification, enzyme are cut all positive plasmid clones of evaluation, and incubated overnight is proposed the positive plasmid order-checking.
Agarose gel electrophoresis shows, take the full gene DNA of N.caninum as template, and Np1, Nr1 is primer, amplifies the 338bp fragment that size conforms to, and recombinant plasmid is cut evaluation through primer Np1, Nr1PCR amplification and enzyme and is all obtained the 338bp fragment, and order-checking is identified all correct.Through identifying that correct recombinant plasmid is To Template, called after pMD18-NT is called for short NT.Result is referring to accompanying drawing 1,2,3.
Embodiment three: the structure of interior mark template
Take plasmid NT as template, adopt respectively primer Np1, Nc1 and Nc2, Nr1 to carry out pcr amplification for the pairing primer, amplification condition is: 94 ℃ of 5min; 94 ℃ of 30S, 62 ℃ of 20s, 72 ℃ of 30s, 35 circulations; 72 ℃ of 10min.Amplified production is called after Np1c1, Nc2r1 respectively.
Take plasmid NT as template, adopt respectively primer Np1, Nc1 and Nc2, Nr1 to carry out pcr amplification for the pairing primer, 25 μ L reaction systems, 2.5 μ L 10 * PCR damping fluids wherein, 1.5 μ L MgCl
2(25mM), 2 μ LdNTP (2.5mM) mixtures, 0.25 μ L Taq archaeal dna polymerase (5u/ μ L), each 1 μ L of upstream and downstream primer (10 μ M), template 1 μ L.Amplification condition is: 94 ℃ of 5min; 94 ℃ of 30S, 62 ℃ of 20s, 72 ℃ of 30s, 35 circulations; 72 ℃ of 10min.Amplify respectively size and be the fragment of 194bp and 168bp, and called after Np1c1 and Nc2r1, referring to accompanying drawing 4.
With after Np1c1, Nc2r1 balanced mix as template, carry out pcr amplification with primer Np1 and Nr1, reaction system and amplification condition are with embodiment one, two.Product purification after amplification is reclaimed and is cloned into the pMD18-T carrier, transform DH5 α competent cells with embodiment one, two, extract plasmid, through enzyme cut, PCR and order-checking identify correct after, called after pMD18-NC, abbreviation NC.Nc1 and Nc2 splicing part are interior mark probe sequence.
Each primer, the relative template position of probe and interior mark template design of graphics are referring to accompanying drawing 5.NT, NC fluorescent PCR amplification partial sequence is as follows, can be referring to accompanying drawing 6.
Embodiment four: the foundation of substance fluorescent PCR amplification system
Take NT and NC as template, respectively take Np1, Nr1, NTpro and Np1, Nr1, NCpro as primer and probe increase, 25 μ L reaction system, wherein Mg
2+1.5mmol/L, each 0.2mmol/L of dNTP, each 0.4 μ mol/L of primer, probe 0.2 μ mol/L, Taq enzyme 1.25u, template 1 μ l, amplification condition is 50 ℃, 2min, 1 circulation; 95 ℃, 5min, 1 circulation; 95 ℃ of 15s, 57 ℃ of 45s, 45 circulations.Result shows, probe has specificity preferably for each self-template, and amplification curve is referring to accompanying drawing 7.
Embodiment five: coamplification detects the mensuration of lower bound
When NC and NT two templates increase simultaneously, can compete enzyme, primer and probe, amplification is exerted an influence, should restudy the reaction conditions of coamplification system and detect lower bound.
Get 10
9～10
0The NT of copy/μ L concentration and NC mixture, take Np1, Nr1, NTpro and NCpro as primer and probe carry out fluorescent PCR amplification.Because NC and NT increase in same reaction, detect primer also identical, both can be at war with to substrate, primer, enzyme etc., therefore, select the NC fragment of suitable concentration to add the fluorescence quantitative PCR detection system to and want to closing.Through optimizing, in selecting in coamplification system of the present invention, mark template interpolation concentration is each reaction 10
2Copy, Mg
2+2.5mmol/L, each 0.3mmol/L of dNTP, each 0.5mmol/L of primer, each 0.2mmol/L of probe, all the other conditions are with embodiment three, and amplification curve is referring to accompanying drawing 8.
Embodiment six: the foundation of typical curve
Get 10
9～10
0The NT of copy/μ L concentration and NC mixture, take Np1, Nr1, NTpro and NCpro as primer and probe carry out the quantitative fluorescent PCR coamplification, through optimizing, the coamplification system is final select in the mark template add concentration and react 10 for each
2Copy, wherein Mg
2+2.5mmol/L, each 0.3mmol/L of dNTP, each 0.5mmol/L of primer, each 0.2mmol/L of probe, amplification condition are 50 ℃, 2min, 1 circulation; 95 ℃, 5min, 1 circulation; 95 ℃ of 15s, 57 ℃ of 45s, 45 circulations.Amplification curve with NT is formulated typical curve, referring to accompanying drawing 9.Can find out from the typical curve that obtains, in the concentration range of surveying, the concentration of standard substance presents obvious linear dependence relation with corresponding Ct value, and the slope of its regression curve is-3.08, and intercept is 42.05, coefficient R
2Be 0.997, this coefficient is greater than 0.95, and the equal reasonable layout of each dilution amplification point shows that the typical curve of this research acquisition is good by typical curve.
Embodiment seven: the specific detection of method
DNA or the cDNA samples such as bovine herpes virus-1, bovine leukemia virus, foot and mouth disease virus, toxoplasma gondii, ox annular Taylor worm and Niu Shuanya Babesia have increased respectively with the reaction system in embodiment six and amplification condition; sample is all negative, illustrates that method provided by the invention has specificity preferably.
Embodiment eight: repeatability detects
With the reaction system in embodiment six and amplification condition respectively to 10
7, 10
5With 10
3The NT of copy/reaction carries out repeatedly repeated augmentation detection, and the Ct value variation coefficient that different tests obtains is 0.5%～1.3%, all in 10%, shows that the inventive method has good repeatability and stability, and amplification curve is referring to accompanying drawing 10.
Embodiment nine: the remolding sensitivity of method
Nc-5 standard plasmid (10 with 10 times of gradient dilutions
0～10
9Copy/μ L) be that primer carries out the regular-PCR amplification as template with Np1 and Nr1, reaction system and amplification condition are with implementing one, two, the reaction product detected through gel electrophoresis amplifies the specific fragment that length is 338bp, with the high dilution that is positive as detection sensitivity.The interior target fluorescent PCR method that do not contain of setting up with embodiment four simultaneously detects.Result shows that this contains interior target fluorescence PCR method detection sensitivity than regular-PCR highly sensitive 1000 times, and the sensitivity of interior target fluorescent PCR is suitable with not containing.
Embodiment ten: to the detection of clinical sample
Use the method for setting up to detect to the 50 parts of whole bloods (wherein 3 parts have been accredited as the positive) and the 8 parts of aborted fetus samples (wherein 1 part has been accredited as the positive) that pick up from ox neosporosis Endemic Area.There are sample and the interior mark template of 2 parts of whole bloods (comprising 1 part of positive) all there is no amplification curve, show that the nucleic acid of carrying has problem.Again extract nucleic acid and increase, interior mark template and positive all amplify curve.
Sequence table
Organization Applicant
--------------------------------------------
Street: No. 116, North Road, South Lake
City: Urumchi
State: Xinjiang
Country: China
PostalCode：830063
PhoneNumber：0991-4644690
FaxNumber：0991-4637201
EmailAddress：xjniuguohui@sina.com
＜110〉OrganizationName: Inspection and Quarantine Center of Xinjiang Entry-Exit Inspection and Quarantin
Application Project
＜120〉Title: a kind of detection method of neosporosis and application
＜130〉AppFileReference: a kind of detection method of neosporosis and application
<140>CurrentAppNumber：
<141>CurrentFilingDate：__-__-__
Sequence
<213>OrganismName：
<400>PreSequenceString：
gggtgtgcgt ccaatcctgt aacgtgttgc tctgctgacg tgtcgttgtt gggcgcagcc 60
tgcggcagca aggctccttt tttgtttgtg actatagtgt gtgaacgggt gaaccgaggg 120
agttggtagc ggtgagaggt gggatacgtg gtttgtggtt agtcattcgt cacgttgaaa 180
tcagcctgcg tcagggtgag gacagtgtgt caatgatact tatcgagagt tcagtgttct 240
gtgttgaggc aacaccggcg gcactgatga cgggggagat tattcatagg gagcaagcgg 300
acgagggaag gggcagaaga cgtaggttga ctggcgag 338
<212>Type：DNA
<211>Length：338
SequenceName：NT-338bp
SequenceDescription：
Sequence
<213>OrganismName：
<400>PreSequenceString：
gggtgtgcgt ccaatcctgt aacgtgttgc tctgctgacg tgtcgttgtt gggcgcagcc 60
tgcggcagca aggctccttt tttgtttgtg actatagtgt gtgaacgggt gaaccgaggg 120
agttggtagc ggtgagaggt gggatacgtg gtttgtggtt agtcattcgt tccaccgtcg 180
tatccagctc acatggtgag gacagtgtgt caatgatact tatcgagagt tcagtgttct 240
gtgttgaggc aacaccggcg gcactgatga cgggggagat tattcatagg gagcaagcgg 300
acgagggaag gggcagaaga cgtaggttga ctggcgag 338
<212>Type：DNA
<211>Length：338
SequenceName：NC-338bp
SequenceDescription：
Sequence
<213>OrganismName：
<400>PreSequenceString：
gggtgtgcgt ccaatcctgt aacgtgttgc tctgctgacg tgtcgttgtt gggcgcagcc 60
tgcggcagca aggctccttt tttgtttgtg actatagtgt gtgaacgggt gaaccgaggg 120
agttggtagc ggtgagaggt gggatacgtg gtttgtggtt agtcattcgt tccaccgtcg 180
tatccagctc acat 194
<212>Type：DNA
<211>Length：194
SequenceName：Np1c1-194bp
SequenceDescription：
Sequence
<213>OrganismName：
<400>PreSequenceString：
tccaccgtcg tatccagctc acatggtgag gacagtgtgt caatgatact tatcgagagt 60
tcagtgttct gtgttgaggc aacaccggcg gcactgatga cgggggagat tattcatagg 120
gagcaagcgg acgagggaag gggcagaaga cgtaggttga ctggcgag 168
<212>Type：DNA
<211>Length：168
SequenceName：Nr1c2-168bp
SequenceDescription：
Claims (1)
1. the interior mark fluorescent PCR coamplification detection reagent of an ox neosporosis, is characterized in that, described detection reagent has following characteristics:
(1) the dog neospora detects primer and probe:
Upstream primer Np2:GTGGTTTGTGGTTAGTCATTCG
Downstream primer Nr2:GCATAATCTCCCCCGTCATCAG
To Template detection probes Ntpro:FAM-CACGTTGAAATCAGCCTG CGTCAG-ECLIPSE
Interior mark template detection probe Ncpro:HEX-TCCACCGTCGTATCCAGC TCACAT-ECLIPSE
(2) mark template in coamplification:
Be numbered X84238.1 in mark template and gene pool in described coamplification, length is that the dog neospora Nc-5 gene order of 338bp has the identical sex change of alkali cardinal sum, annealing temperature, and can jointly carry out the fluorescent PCR amplification in same reaction system, in described coamplification, the sequence of mark template is as shown in SequenceName:NC-338bp:
gggtgtgcgt ccaatcctgt aacgtgttgc tctgctgacg tgtcgttgtt gggcgcagcc
tgcggcagca aggctccttt tttgtttgtg actatagtgt gtgaacgggt gaaccgaggg agttggtagc ggtgagaggt gggatacgtg gtttgtggtt agtcattcgt tccaccgtcg tatccagctc acatggtgag gacagtgtgt caatgatact tatcgagagt tcagtgttct gtgttgaggc aacaccggcg gcactgatga cgggggagat tattcatagg gagcaagcgg acgagggaag gggcagaaga cgtaggttga ctggcgag。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010160434 CN101831495B (en) | 2010-04-30 | 2010-04-30 | Method for detecting bovine neosporosis and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010160434 CN101831495B (en) | 2010-04-30 | 2010-04-30 | Method for detecting bovine neosporosis and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101831495A CN101831495A (en) | 2010-09-15 |
| CN101831495B true CN101831495B (en) | 2013-06-19 |
Family
ID=42715714
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010160434 Expired - Fee Related CN101831495B (en) | 2010-04-30 | 2010-04-30 | Method for detecting bovine neosporosis and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101831495B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181541B (en) * | 2011-04-08 | 2013-09-04 | 孟维娜 | Kit for specific PCR (polymerase chain reaction) detection of pneumocystis and detection method thereof |
| CN102888412B (en) * | 2012-09-21 | 2018-02-09 | 吉林大学 | A kind of neospora specific PCR detecting reagent kit and preparation method |
| CN105219878A (en) * | 2015-11-13 | 2016-01-06 | 新疆农业大学 | A kind of neosporosis detection kit |
| CN108034741A (en) * | 2018-01-18 | 2018-05-15 | 王素华 | A kind of two-pressure humidity generator nest-type PRC specific primer and detection kit and nested PCR detection method |
| CN111197100B (en) * | 2020-01-14 | 2021-09-14 | 中国农业大学 | Neosporozoan caninum specific PCR detection kit, preparation method and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995025541A1 (en) * | 1994-03-21 | 1995-09-28 | The Regents Of The University Of California | Bovine neospora isolates and their uses |
| CN1211449A (en) * | 1997-08-26 | 1999-03-24 | 辉瑞产品公司 | Neospora veccine |
| CN1232087A (en) * | 1998-03-26 | 1999-10-20 | 辉瑞产品公司 | Polynucleotide molecules encoding neospora proteins |
| CN1902314A (en) * | 2003-12-04 | 2007-01-24 | 马德里孔普卢屯大学 | Use of gene ncsag4 for the diagnosis and prevention of neosporosis and as a marker for analysis of the pathogenesis |
| TW201028691A (en) * | 2009-01-23 | 2010-08-01 | Nat Univ Chung Hsing | Loop-mediated isothermal amplification (LAMP) method for the rapid identification of Neospora caninum |
-
2010
- 2010-04-30 CN CN 201010160434 patent/CN101831495B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1995025541A1 (en) * | 1994-03-21 | 1995-09-28 | The Regents Of The University Of California | Bovine neospora isolates and their uses |
| CN1211449A (en) * | 1997-08-26 | 1999-03-24 | 辉瑞产品公司 | Neospora veccine |
| CN1232087A (en) * | 1998-03-26 | 1999-10-20 | 辉瑞产品公司 | Polynucleotide molecules encoding neospora proteins |
| CN1902314A (en) * | 2003-12-04 | 2007-01-24 | 马德里孔普卢屯大学 | Use of gene ncsag4 for the diagnosis and prevention of neosporosis and as a marker for analysis of the pathogenesis |
| TW201028691A (en) * | 2009-01-23 | 2010-08-01 | Nat Univ Chung Hsing | Loop-mediated isothermal amplification (LAMP) method for the rapid identification of Neospora caninum |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101831495A (en) | 2010-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fooks et al. | Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century | |
| CN101701265B (en) | Method for detecting infectious bovine rhinotracheitis virus and application thereof | |
| CN101831495B (en) | Method for detecting bovine neosporosis and application | |
| CN109781981A (en) | Detect molecular probe, kit and its application of African swine fever virus | |
| CN106868166A (en) | Primer, probe and kit for field quick detection johne's bacillus | |
| CN102115794A (en) | Internal-reference-containing HCMV fluorescence quantitative PCR detection kit | |
| CN103725796A (en) | BVDV (bovine viral diarrhea virus) internal control typing fluorescent PCR (polymerase chain reaction) detection kit and preparation thereof | |
| CN109609695A (en) | Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus | |
| CN108624720A (en) | The primed probe group and kit of RAA Fluorometric assay Rift Valley fever virus | |
| CN105648059A (en) | Schistosoma japonicum nucleic acid detection kit based on RPA and detection method | |
| CN103667514A (en) | Kit for detecting polymorphism of interleukin 28B gene by utilizing fluorescence PCR (Polymerase Chain Reaction) technology | |
| CN112359137A (en) | RT-LAMP amplification system for visual virus nucleic acid RNA detection and application | |
| Zhang et al. | An isothermal molecular point of care testing for African swine fever virus using recombinase-aided amplification and lateral flow assay without the need to extract nucleic acids in blood | |
| CN113234814A (en) | Multiple RPA primer and probe composition for simultaneously detecting acute hepatopancreas necroses and liver enterosporidium of shrimps and detection method | |
| CN103397105A (en) | Kit for detecting GII type norovirus and applications thereof | |
| Wang et al. | Development of a recombinase polymerase amplification assay with lateral flow dipstick for rapid detection of feline parvovirus | |
| CN110527730A (en) | It is a kind of based on the Shiqu echinococcus detection kit of RPA technology and its application | |
| Paterson et al. | Development of molecular methods for the identification of aspergillus and emerging moulds in paraffin wax embedded tissue sections | |
| CN105483290A (en) | Porcine delta coronavirus SYBR Green I fluorescence quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primers and detection method | |
| CN105886663A (en) | Locked nucleic acid sensitivity-enhanced fluorescent quantitative PCR (polymerase chain reaction) detection reagent kit for wild strains of porcine pseudorabies viruses | |
| CN104745729A (en) | Double fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection reagent for African swine fever viruses and porcine reproductive and respiratory syndrome viruses and preparation method and application thereof | |
| CN104388594A (en) | Taqman Real-time PCR kit for detecting porcine pseudorabies virus | |
| Vemulapalli et al. | A real-time TaqMan® RT-PCR assay with an internal amplification control for rapid detection of transmissible gastroenteritis virus in swine fecal samples | |
| CN105063228B (en) | The detection kit and detection method of a kind of flavobacterium columnare | |
| CN108486223A (en) | A kind of Ji Shi Babesias RPA molecular detecting methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130619 Termination date: 20190430 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |