CN101811959A - Compound separated and extracted from marine penicillium and application thereof - Google Patents
Compound separated and extracted from marine penicillium and application thereof Download PDFInfo
- Publication number
- CN101811959A CN101811959A CN200910255783A CN200910255783A CN101811959A CN 101811959 A CN101811959 A CN 101811959A CN 200910255783 A CN200910255783 A CN 200910255783A CN 200910255783 A CN200910255783 A CN 200910255783A CN 101811959 A CN101811959 A CN 101811959A
- Authority
- CN
- China
- Prior art keywords
- compound
- chloroform
- pseudomonas aeruginosa
- methyl alcohol
- quorum sensing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of preparing compounds, and relates to a compound separated and extracted from marine penicillium and application thereof. The compound is used for preventing and treating in-vitra and in-vivo pseudomonas aeruginosa infection of people or animals, and the chemical formula of the compound which is obtained by fermenting the marine penicillium and has the effect of inhibiting quorum sensing of pseudomonas aeruginosa is 4,6-dimethyl-7-[(1R,2E,4aS,7R,8R,8aR)-1,2.4a,5,6,7,8,8a-octahydro-7-hydroxyl-2-(3-hydroxyl-2-oxygen-propylene)-3,6,8-trimethyl-1-naphthyl]-,(2E,4E,6E)-heptantriene acid, and the molecular formula of the compound is C25H34O5; the compound does not inhibit the growth of the wild type pseudomonas aeruginosa; the quorum-sensing inhibition effect of the compound is concentration-dependent, and is gradually strengthened with the increase of the concentration; virulence factors controlled by the quorum sensing of the pseudomonas aeruginosa can be inhibited; and the compound also has the advantages of readily available raw materials, simple and easily controlled preparation process, obvious sensing inhibition effect and prominent social benefits.
Description
Technical field:
The invention belongs to the marine microorganism technical field, relate to a kind of compound and application in suppressing the Pseudomonas aeruginosa quorum sensing thereof of producing, have preventive and therapeutic effect human or animal inside and outside charrin disease by marine penicillium QJ012 (Penicillium sp.QJ012) separation.
Background technology:
Along with the widespread use of antibacterials, it is more and more serious that drug-resistance of bacteria becomes, and become the great difficult problem of the harm humans health of paying close attention in the whole world, and the new way of seeking the treatment infectation of bacteria has become the forward position and the focus of current life science.Quorum sensing (Quorum Sensing, QS) be a kind of bacterial population behavior regulator control system that is subjected to extensive concern recently, discover, the pathogenesis of many human bodies or phytopathogen is subjected to the regulation and control of QS system, a lot of opsonigenous substancess also are subjected to the control of this system, thereby can reach by the QS system that disturbs pathogenic bacteria and weaken the pathogenic purpose of animals and plants pathogenic bacteria, they are different fully with traditional antibiotic mechanism of action, growth to bacterium does not exert an influence, and therefore can not cause bacterial drug resistance in theory.Pseudomonas aeruginosa (Peudomonas aeruginosa) is a kind of opportunistic pathogen, be that one of The main pathogenic fungi that infects takes place during hospital patient, than the patient of easy infection in immunologic hypofunction, as tumour and AIDS patient, or the patient of life-time service Broad spectrum antibiotics etc.In to Pseudomonas aeruginosa QS systematic research process, find, the QS system of this bacterium has participated in many biological behaviors, comprising the generation of formation, bacterial drug resistance and the virulence factor of bacterial biofilm etc., these factors form to infect and produce resistance in body to Pseudomonas aeruginosa and play a part very important.Therefore, increasing people is just attempting by disturbing Pseudomonas aeruginosa QS system to reach the purpose of its infection of control bacterium.Unique ocean environment is an important biomolecule resource treasure-house of developing, the marine microorganism kind is about more than 20 times of Lu Sheng microorganism, the marine microorganism pathways metabolism is special, can produce the biologically active substance of the novel structure that is different from the Lu Sheng microorganism fully.By the thalassiomycetes extract is screened, find that therefrom having the Pseudomonas aeruginosa quorum sensing suppresses active thalassiomycetes, and separation obtains having the inhibiting compound of Pseudomonas aeruginosa quorum sensing from its extract, be the problem that the scientific research personnel in present technique field is inquiring into, do not see effective achievement report so far as yet.
Summary of the invention:
The objective of the invention is to overcome the shortcoming that exists in the prior art, a kind of marine penicillium strain is provided, and by separating a kind of have inhibiting compound of Pseudomonas aeruginosa quorum sensing and the application of the control in the charrin disease of human or animal inside and outside thereof in its extract.
To achieve these goals, the name of ocean provided by the present invention mould (Penicillium sp.) bacterial strain is called QJ012, is preserved in Chinese typical culture collection center on September 30th, 2009, and preserving number is CCTCC No.M 209218; The inhibiting compound of Pseudomonas aeruginosa quorum sensing that has that fermentation marine penicillium QJ012 (Penicillium sp.QJ012) obtains is 4,6-dimethyl-7-[(1R, 2E, 4aS, 6S, 7R, 8R, 8aR)-1,2,4a, 5,6,7,8,8a-octahydro-7-hydroxyl-2-(3-hydroxyl-2-oxygen-propylidene)-3,6,8-trimethylammonium-1-naphthyl]-(2E, 4E, 6E)-heptantriene acid, its molecular formula is C
25H
34O
5, structural formula is:
Wherein, 1～25 is the numbering of carbon atom.
Of the present inventionly produce compound by marine penicillium fermentation and comprise fermentation culture and tunning extraction and two steps of compound separation, get the marine penicillium kind after the activation earlier, be inoculated into and carry out fermentation culture in the fermention medium, extract at least 1 time with extraction liquid after the fermentation ends, extraction liquid is filtered, vacuum concentration obtains brown medicinal extract to doing; Compound separation is after medicinal extract is mixed sample with proper silica gel H, separate with vacuum liquid chromatography column chromatography, elutriant with different proportionings carries out gradient elution again, collect the component of 100% chloroform wash-out, concentrate the back and separate with Sephadex LH-20 gel filtration chromatography, with 50% chloroform+50% methyl alcohol as moving phase, repeat wash-out 3 times, the component of collecting is concentrated the back separate the component of collecting 100% chloroform wash-out, the compound of the Pseudomonas aeruginosa quorum sensing that is inhibited with normal phase silicagel column; Wherein the elutriant of different proportionings comprises 50% sherwood oil+50% chloroform, 20% sherwood oil+80% chloroform, 100% chloroform, 99% chloroform+1% methyl alcohol, 98% chloroform+2% methyl alcohol, 97% chloroform+3% methyl alcohol, 96% chloroform+4% methyl alcohol, 95% chloroform+5% methyl alcohol, 90% chloroform+10% methyl alcohol, 80% chloroform+20% methyl alcohol and 100% methyl alcohol.
Marine penicillium QJ012 involved in the present invention (Penicillium sp.QJ012) and formula (I) compound all have the preventive and therapeutic effect that suppresses charrin disease; Compound does not suppress the growth of wild-type Pseudomonas aeruginosa PAO1 in the 0-50mg/L concentration range; The quorum sensing restraining effect of this compound is concentration dependent, and along with concentration increases gradually, its effect that suppresses quorum sensing strengthens gradually; This compound can significantly suppress the virulence factor that Pseudomonas aeruginosa is subjected to the quorum sensing regulation and control; Marine penicillium QJ012 (Penicillium sp.QJ012) has the preventive and therapeutic effect that suppresses Pseudomonas aeruginosa quorum sensing and charrin disease.
The present invention compared with prior art has the marine penicillium strain and is easy to get, and its technological process of producing compound is simple and easy to control, and it is obvious that the compound of producing suppresses the quorum sensing effect, the advantage that social benefit is outstanding.
Description of drawings:
Fig. 1 is thalassiomycetes extract screening active ingredients figure of the present invention.
Fig. 2 is the wild-type Pseudomonas aeruginosa PAO1 growth curve chart under the compound effects of the present invention.
Fig. 3 suppresses determination of activity figure for the quorum sensing of the compound of different concns of the present invention.
Fig. 4～9 are that compound of the present invention is respectively to the regulating and controlling effect figure of wild-type Pseudomonas aeruginosa PAO1 relevant virulence gene lasB, lasI, lasR, rhlI, rhlR, toxA
Embodiment:
Also the present invention is described further in conjunction with the accompanying drawings below by embodiment.
Embodiment 1: marine penicillium QJ012 CCTCC No.M 209218 obtains
One. bacterial strain obtains
1. pick up from Qingdao Qian Hai and marine site, Jiaozhou Bay for seawater, the ooze sample cultivated.
2. the separation and Culture of thalassiomycetes: the fungi purifying adopts following substratum: with peeling potatoes, clean, section, claim 200g to put into the old seawater of the 1000mL 10～20min that boils that simmers in water, four layers of filtered through gauze, filtrate adds water and mends to 1000mL, add glucose 20g, agar 20g, 121 ℃, 1.05kg/cm
2Sterilization 20min faces with preceding adding penicillin, each 30 μ g/mL of Streptomycin sulphate; Take by weighing the about 1g of ooze under the sterile state, add aseptic seawater 10mL, the concussion mixing dilutes 10 times, the 100 times samples of making 3 concentration gradients altogether more respectively, respectively gets 0.2mL and coats solid medium, and each gradient is coated with a plurality of flat boards; Seawater sample is got 1mL carry out the same operation, observe every day, when isolated strains enters the growth animated period on substratum, and the spore of picking different shape fungal strain, be inverted under the purifying of on fungi purifying substratum, ruling, 28 ℃, relative humidity 90%, fixed temperature and humidity condition and cultivate; When according to said method line was the single bacterium colony of form on single flat board continuously, the single bacterium colony on the picking flat board carried out pure culture, treated that bacterium colony grows up to the back and preserves purebred.
3. the preparation of fermentation culture of thalassiomycetes and extract: following substratum is adopted in fermentation: sorbyl alcohol 20g, maltose 20g, glutamine 10g, KH
2PO
40.5g, MgSO
47H
2O 0.3g, tryptophane 0.5g, yeast extract 3g is 1000mL with the Chen Haishui constant volume, transferring pH is 6.5,121 ℃, 1.05kg/cm
2Sterilization 20min; After the dull and stereotyped activation of purifying gained bacterial classification, the an amount of inoculated by hypha block of picking is in the conical centrifuge tube of interior dress 10mL aforesaid liquid substratum, 28 ℃ of temperature, rotating speed 140rpm, concussion was cultivated 10 days, after the fermentation ends, with fermented product thalline and the ultrasonication of supernatant mixed solution, add the equal-volume ethyl acetate, stirred overnight at room temperature, 6000rpm is centrifugal, and 10min gets supernatant liquor, adds equal-volume ethyl acetate re-extract more once, be concentrated into total extraction liquid vacuum and low temperature dried, dry thing dissolve with methanol, final concentration is 100mg/mL, and is active for surveying.
4. utilize Pseudomonas aeruginosa quorum sensing supressor (QSI) screening model detection of active: Pseudomonas aeruginosa quorum sensing supressor (QSI) screening model QSIS2 is by (Journal of bacteriology such as Thomas Bovbjerg Rasmussen; Mar.2005; p.1799-1814) make up; this screening model is to utilize Pseudomonas aeruginosa to be subjected to the promotor of the startup subdomain of the pathogenic related gene lasB that the QS system regulates as reporter gene; with Polylevulosan transferase gene sacB (sucrose lethal gene) is that reporter gene makes up; Pseudomonas aeruginosa quorum sensing supressor (QSI) screening model QlasI makes up on the QSIS2 basis and finishes; this screening model is to utilize Pseudomonas aeruginosa to be subjected to the promotor of the startup subdomain of the 3-oxygen dodecanoyl homoserine lactone signaling molecule synthase gene lasI that the QS system regulates as reporter gene; with Polylevulosan transferase gene sacB (sucrose lethal gene) is that reporter gene makes up; when adding sucrose in the substratum; because sacB expression of gene; the growth of thalline can be suppressed; and when QSI exists; the sacB expression of gene is suppressed; protect the growth of thalline, thereby can filter out the inhibition of quorum sensing system effectively with the variation of thalli growth.
Screening model QSIS2 plate screening method: with LB nutrient agar (1.5%[wt/vol]) fusing, to be cooled to 50 ℃, adding sucrose (final concentration 6%[wt/vol]), gentamicin (final concentration 80 μ g/mL), 3-oxygen dodecanoyl homoserine lactone (3-oxo-C12-HSL) (final concentration 200nM), butyryl homoserine lactone (C4-HSL) (final concentration 200nM), the screening model overnight culture (final concentration 2%[vol/vol]) and viable bacteria staining agent TCC (final concentration 0.02%[wt/vol]), pour the substratum of mixing into glass dish, make and detect flat board, on flat board, punch, add the fungus extract sample for preparing respectively, 37 ℃ of incubator incubated overnight, bacterium is enclosed growing state around observing well, if having quorum sensing, fungus extract suppresses active, there then should have bacterial growth to iris out around the well to be existing, the big more activity that is of bacterium loop diameter is strong more, detected result as shown in Figure 1, bacterial growth loop diameter maximum around the bacterial strain QJ012 well, promptly its activity that suppresses the Pseudomonas aeruginosa quorum sensing is the strongest.
Screening model QlasI plate screening method: add 3-oxygen dodecanoyl homoserine lactone (3-oxo-C12-HSL) (final concentration 100nM), do not add butyryl homoserine lactone (C4-HSL), all the other components are dull and stereotyped identical with the QSIS2 screening, detected result is identical with screening model QSIS2 detected result, bacterial growth loop diameter maximum around the bacterial strain QJ012 well, be that its activity that suppresses the Pseudomonas aeruginosa quorum sensing is the strongest, picture is unlisted.
Two, identification of strains
RDNA intergenic region (ITS regions) sequencing and analysis, concrete steps are as follows:
1. extract the genomic dna of bacterial strain QJ012 according to the gene clone standard operation.
2. adopt the general upstream primer ITS1:5 ' of fungi ITS sequence-TCCGTAGGTGAACCTGCGG-3 ' and downstream primer ITS4:5 '-TCCTCCGCTTATTGATATGC-3 ' to take the genomic dna as template PCR reaction amplification ITS1-5.8S rDNA-ITS2 entire segment, the pcr amplification product of gained is entrusted the order-checking of order-checking company.
3. submit to NCBI website Genbank database to carry out the comparison of Blast Nucleotide the ITS sequence that records, determine that behind homology analysis QJ012 is Penicillium (Penicillium sp.); The Genbank accession number of marine penicillium QJ012 CCTCCNo.M 209218 ITS sequences is GU188272.
Embodiment 2: the fermentation marine penicillium prepares compound
One. fermentation culture adopts following substratum: sorbyl alcohol 20g, maltose 20g, glutamine 10g, KH
2PO
40.5g, MgSO
47H
2O 0.3g, tryptophane 0.5g, yeast extract 3g is 1000mL with the Chen Haishui constant volume, transferring pH is 6.5,121 ℃, 1.05kg/cm
2Sterilization 20min.
Two. zymotechnique: after the dull and stereotyped activation of marine penicillium QJ012, an amount of inoculated by hypha block of picking is in the triangular flask of interior dress 200mL aforesaid liquid substratum, and 28 ℃ of temperature, rotating speed 140rpm shake and cultivated 10 days.
Three. tunning extracts: after the fermentation ends, with fermented product thalline and the ultrasonication of supernatant mixed solution, add the equal-volume ethyl acetate, stirred overnight at room temperature, 6000rpm is centrifugal, and 10min gets supernatant liquor, add equal-volume ethyl acetate re-extract more once, total extraction liquid vacuum and low temperature is concentrated into dried, obtain brown medicinal extract.
Four. the preparation method of formula (I) compound: above-mentioned medicinal extract separates with vacuum liquid chromatography column chromatography after mixing sample with proper silica gel H, carries out gradient elution with the elutriant of different proportionings, collect the component of 100% chloroform wash-out, concentrate the back and separate with Sephadex LH-20 gel filtration chromatography, with 50% chloroform+50% methyl alcohol as moving phase, repeat wash-out 3 times, the component of collecting is concentrated the back separate the component of collecting 100% chloroform wash-out with normal phase silicagel column, the be inhibited compound of Pseudomonas aeruginosa quorum sensing, promptly compound 4,6-dimethyl-7-[(1R, 2E, 4aS, 6S, 7R, 8R, 8aR)-1,2,4a, 5,6,7,8,8a-octahydro-7-hydroxyl-2-(3-hydroxyl-2-oxygen-propylidene)-3,6,8-trimethylammonium-1-naphthyl]-(2E, 4E, 6E)-heptantriene acid; Wherein the elutriant of different proportionings comprises 50% sherwood oil+50% chloroform, 20% sherwood oil+80% chloroform, 100% chloroform, 99% chloroform+1% methyl alcohol, 98% chloroform+2% methyl alcohol, 97% chloroform+3% methyl alcohol, 96% chloroform+4% methyl alcohol, 95% chloroform+5% methyl alcohol, 90% chloroform+10% methyl alcohol, 80% chloroform+20% methyl alcohol and 100% methyl alcohol.
Five. formula (I) compound structure is identified:
Utilize mass spectrum (MS), nuclear-magnetism (
1H NMR,
13C NMR DEPT) carries out structure to compound and identifies that ESI-MS provides pseudo-molecular ion peak [M+Na] respectively in m/z 437 and 851
+[2M+Na]
+, combined carbon spectrum and hydrogen spectrum analysis, its molecular formula is C
25H
34O
5 1H NMR and
13There is 1 ketone carbonyl in this molecule of C NMR (DEPT) spectrum prompting, 1 ester carbonyl group, 6 two key methynes, 4 two key quaternary carbons, 1 company's oxygen methyne, 1 company's oxygen methylene radical and 5 methyl are 9 according to this molecule degree of unsaturation, point out in this molecule also to have 2 rings, with gained spectral data and document (Journal of Natural Products, 1999, Vol.62,1147-1150) relatively, determine that it is known compound 4,6-dimethyl-7-[(1R, 2E, 4aS, 6S, 7R, 8R, 8aR)-1,2,4a, 5,6,7,8,8a-octahydro-7-hydroxyl-2-(3-hydroxyl-2-oxygen-propylidene)-3,6,8-trimethylammonium-1-naphthyl]-(2E, 4E, 6E)-heptantriene acid.
Compound spectral data: colorless oil; [α]
20 D=+5.4 ° (0.0014, MeOH); ESI-MS (m/z): 437[M+Na]
+, 851[2M+Na]
+
1H?NMR(600MHz，CDCl
3)δ：7.38(d，1H，J＝15.0，H-3)，6.28(s，1H，H-5)，6.03(s，1H，H-18)，5.95(s，1H，H-15)，5.82(d，1H，J＝15.0，H-2)，5.40(d，J＝9.1，H-7)，5.27(dd，1H，J＝9.1，2.8，H-8)，4.31(d，1H，J＝18.3，H-20)，4.26(d，1H，J＝18.3，H-20)，2.72(t，1H，J＝9.2，H-11)，2.70(s，1H，H-14)，2.06(s，3H，H-22)，1.90(s，3H，H-25)，1.87(s，3H，H-21)，1.76(br?d，1H，J＝12.8，H-13)，1.54(br?d，1H，J＝11.9，H-9)，1.37(m，1H，H-12)，1.31(m，1H，H-13)，1.24(m，1H，H-10)，1.09(d，3H，J＝6.4，H-23)，0.99(d，3H，J＝6.4，H-24)。
13C?NMR(150MHz，CDCl3)δ：198.2(s，C-19)，172.1(s，C-1)，155.9(s，C-17)，152.7(d，C-3)，144.5(d，C-5)，142.5(d，C-15)，134.9(s，C-6)，134.3(d，C-7)，131.8(s，C-4)，131.6(s，C-16)，116.2(d，C-18)，115.5(d，C-2)，80.8(d，C-11)，69.3(t，C-20)，47.2(d，C-9)，38.1(t，C-13)，37.7(d，C-8)，37.7(d，C-10)，35.1(d，C-12)，33.4(d，C-14)，19.7(q，C-25)，18.7(q，C-24)，16.7(q，C-22)，15.3(q，C-23)，13.8(q，C-21)。
1H?NMR(600MHz，CD
3OD)δ：7.29(d，1H，J＝15.5，H-3)，6.29(br?s，1H，H-18)，6.26(br?s，1H，H-5)，5.97(br?s，1H，H-15)，5.80(d，1H，J＝15.5，H-2)，5.38(br?d，J＝9.0，H-7)，5.31(dd，1H，J＝9.0，2.3，H-8)，4.26(d，1H，J＝18.3，H-20)，4.21(d，1H，J＝18.3，H-20)，2.68(br?s，1H，H-14)，2.59(t，1H，J＝9.7，H-11)，2.02(s，3H，H-22)，1.89(br?s，3H，H-25)，1.88(br?s，3H，H-21)，1.78(br?d，1H，J＝12.8，H-13)，1.52(brd，1H，J＝12.8，H-9)，1.32(m，1H，H-12)，1.28(m，1H，H-13)，1.23(m，1H，H-10)，1.07(d，3H，J＝6.4，H-23)，0.96(d，3H，J＝6.0，H-24)。
Embodiment 3: the test of formula (I) compound activity
One. the formula of different concns (I) compound is to the influence of wild-type Pseudomonas aeruginosa PAO1 growth
1, picking wild-type Pseudomonas aeruginosa PAO1 is in fresh LB substratum, and 37 ℃, 140rpm are cultured to logarithmic phase;
2, the bacterium liquid that will be cultured to logarithmic phase with fresh LB is diluted to OD
600Be 0.05, divide to be filled to 5 test tubes, every pipe 5mL, adding formula (I) compound makes its final concentration be respectively 0mg/L, 6.25mg/L, 12.5mg/L, 25mg/L, 50mg/L, 37 ℃, the cultivation of 140rpm shaking table;
3, surveyed respectively every 1-2 hour and respectively manage OD
600Until the logarithm later stage; With incubation time (h) is X-coordinate, with the optical absorbance OD at 600nm place
600Be ordinate zou, draw the growth curve of wild-type Pseudomonas aeruginosa PAO1 under formula (I) compound effects, from growth curve (Fig. 2) as can be seen, this compound does not suppress the growth of wild-type Pseudomonas aeruginosa PAO1 in the 0-50mg/L concentration range.
Two. the QSI of the formula of different concns (I) compound suppresses active
Utilize Pseudomonas aeruginosa quorum sensing supressor (QSI) screening model QSIS2 to detect the QSI activity of different concns ocean mould QJ012 extract: the method when detection method is active with the detection fungus extract is identical; In detecting dull and stereotyped well, add 0mg/mL respectively, 12.5mg/mL, 25mg/mL, each 5 μ L of the formula of 50mg/mL (I) compound and positive control furanone C-30 (1.25mg/mL), 37 ℃ of incubator incubated overnight, bacterium is enclosed growing state around observing well, and the bacterium loop diameter is big more to be that activity is strong more; The result as shown in Figure 3, numeral 1～5 is represented 0mg/mL respectively, 12.5mg/mL, 25mg/mL, the formula of 50mg/mL (I) compound and positive control furanone C-30 (1.25mg/mL); Along with formula in the well (I) compound concentration increases gradually, the bacterium loop diameter around the well is also corresponding to be increased gradually; The quorum sensing restraining effect that this compound is described is concentration dependent, and along with concentration increases gradually, its activity that suppresses the Pseudomonas aeruginosa quorum sensing strengthens gradually; Screening model QlasI detected result is identical with screening model QSIS2 detected result, and picture is unlisted.
Three: quantitative PCR detection formula (I) compound is subjected to the effect of the relevant virulence gene of QS regulation and control to wild-type Pseudomonas aeruginosa PAO1
1. picking wild-type Pseudomonas aeruginosa PAO1 is in fresh LB substratum, and 37 ℃, 140rpm are cultured to logarithmic phase; The bacterium liquid that will be cultured to logarithmic phase with fresh LB is diluted to OD
600Be 0.05, divide to be filled to 6 test tubes, every pipe 5mL; Be divided into 2 groups, adding formula (I) compound makes its final concentration be respectively 0mg/L and 50mg/L, and 3 every group parallel; Be cultured to OD more under the same conditions
600Be about 0.6, extract total RNA and reverse transcription is cDNA according to the gene clone standard operation;
2. be subjected to the dna sequence dna of the relevant virulence gene of QS regulation and control according to wild-type Pseudomonas aeruginosa PAO1, design quantification PCR primer as shown in Table 1:
| The primer title | Sequence (5 ' to 3 ') | The primer title | Sequence (5 ' to 3 ') |
| ??rss(fwd) | ?GCGCAACCCTTGTCCTTAGTT | ??rss(rev) | ??TGTCACCGGCAGTCTCCTTAG |
| ??lasB(fwd) | ?AAGGCCTTGCGGGTATCC | ??lasB(rev) | ??CGTGTACAACCGTGCGTTCT |
| ??lasI(fwd) | ?CAGCCGTTTCGCCATCAA | ??lasI(rev) | ??TCATCATCTTCTCCACGCCTAC |
| ??lasR(fwd) | ?GACCAGTTGGGAGATATCGGTTA | ??lasR(rev) | ??TCCGCCGAATATTTCCCATA |
| ??rhlI(fwd) | ?TCTGGTCCAGCCTGCAATG | ??rhlI(rev) | ??TGGAGGATCACGCCGTTG |
| ??rhlR(fwd) | ?TCAGCTTCTGGGTCAGCAACT | ??rhlR(rev) | ??CGAGCGCGAGGAAATCC |
| ??toxA(fwd) | ?CCCGGCGAAGCATGAC | ??toxA(rev) | ??GGGAAATGCAGGCGATGA |
Table one
16S rDNA, lasB, lasI, lasR, rhlI, rhlR, the toxA gene of the corresponding wild-type Pseudomonas aeruginosa PAO1 of difference, wherein 16S rDNA gene is as confidential reference items;
3. the cDNA template after the reverse transcription is diluted in right amount,, adopt acquiescence PCR program, carry out quantitative PCR detection according to the explanation of SYBR-Green Master Realtime PCRMix Kit test kit;
4. carry out relative quantitative assay with ABI 7500RT-PCR relative quantitative assay software; The result is shown in Fig. 4～9, and the formula of final concentration 50mg/L (I) compound can obviously reduce lasB, lasI, lasR, rhlI, rhlR, toxA expression of gene, is reduced to original 67%, 74%, 82%, 85%, 87%, 78% respectively.
Claims (3)
1. compound by the marine penicillium separation and Extraction, marine penicillium strain name is called QJ012, is preserved in Chinese typical culture collection center on October 9th, 2009, and preserving number is CCTCC No.M 209218; It is characterized in that the compound with inhibition Pseudomonas aeruginosa quorum sensing that obtains through fermentation marine penicillium QJ012 is 4,6-dimethyl-7-[(1R, 2E, 4aS, 6S, 7R, 8R, 8aR)-1,2,4a, 5,6,7,8,8a-octahydro-7-hydroxyl-2-(3-hydroxyl-2-oxygen-propylidene)-3,6,8-trimethylammonium-1-naphthyl]-, (2E, 4E, 6E)-heptantriene acid, its molecular formula is C
25H
34O
5, structural formula is:
Wherein, 1～25 is the numbering of carbon atom.
2. the compound by the marine penicillium separation and Extraction according to claim 1, it is characterized in that producing compound by the marine penicillium fermentation comprises that fermentation culture and tunning extract and two steps of compound separation, get the marine penicillium kind after the activation earlier, be inoculated into and carry out fermentation culture in the fermention medium, extract at least 1 time with extraction liquid after the fermentation ends, extraction liquid is filtered, and vacuum concentration obtains brown medicinal extract to doing; Compound separation is after medicinal extract is mixed sample with proper silica gel H, separate with vacuum liquid chromatography column chromatography, elutriant with different proportionings carries out gradient elution again, collect the component of 100% chloroform wash-out, concentrate the back and separate with the SephadexLH-20 gel filtration chromatography, with 50% chloroform+50% methyl alcohol as moving phase, repeat wash-out 3 times, the component of collecting is concentrated the back separate the component of collecting 100% chloroform wash-out, the compound of the Pseudomonas aeruginosa quorum sensing that is inhibited with normal phase silicagel column; Wherein the elutriant of different proportionings comprises 50% sherwood oil+50% chloroform, 20% sherwood oil+80% chloroform, 100% chloroform, 99% chloroform+1% methyl alcohol, 98% chloroform+2% methyl alcohol, 97% chloroform+3% methyl alcohol, 96% chloroform+4% methyl alcohol, 95% chloroform+5% methyl alcohol, 90% chloroform+10% methyl alcohol, 80% chloroform+20% methyl alcohol and 100% methyl alcohol.
3. the application of compound by the marine penicillium separation and Extraction is characterized in that marine penicillium QJ012 and formula (I) compound all has the preventive and therapeutic effect that suppresses charrin disease; Compound does not suppress the growth of wild-type Pseudomonas aeruginosa PAO1 in the 0-50mg/L concentration range; The quorum sensing restraining effect of compound is concentration dependent, and along with concentration increases gradually, its effect that suppresses quorum sensing strengthens gradually; Compound is applied to suppress the virulence factor that Pseudomonas aeruginosa is subjected to the quorum sensing regulation and control; Marine penicillium QJ012 is applied to suppress the control of the infection of Pseudomonas aeruginosa quorum sensing and Pseudomonas aeruginosa.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910255783 CN101811959B (en) | 2009-12-25 | 2009-12-25 | Compound separated and extracted from marine penicillium and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910255783 CN101811959B (en) | 2009-12-25 | 2009-12-25 | Compound separated and extracted from marine penicillium and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101811959A true CN101811959A (en) | 2010-08-25 |
| CN101811959B CN101811959B (en) | 2013-01-30 |
Family
ID=42619348
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910255783 Expired - Fee Related CN101811959B (en) | 2009-12-25 | 2009-12-25 | Compound separated and extracted from marine penicillium and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101811959B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268395A (en) * | 2011-07-22 | 2011-12-07 | 浙江大学 | Marine Penicillium strain and application thereof |
| CN103695358A (en) * | 2013-12-24 | 2014-04-02 | 扬州大学 | Oceanic streptomyces parvulus and application thereof on aspect of quorum sensing inhibition |
| CN104730175A (en) * | 2015-04-10 | 2015-06-24 | 大连工业大学 | Automatic vacuum liquid-chromatography separator and control method thereof |
-
2009
- 2009-12-25 CN CN 200910255783 patent/CN101811959B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| DONALD B.STIERLE，ET AL.: "Isolation of Two Highly Methylated Polyketide Derivatives from aYew-Associated Penicillium Species", 《JOURNAL OF NATURAL PRODUCTS》 * |
| 王为善等: "具有群体感应抑制活性海洋放线菌的分离和鉴定", 《微生物学通报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102268395A (en) * | 2011-07-22 | 2011-12-07 | 浙江大学 | Marine Penicillium strain and application thereof |
| CN102268395B (en) * | 2011-07-22 | 2012-11-21 | 浙江大学 | Marine Penicillium strain and application thereof |
| CN103695358A (en) * | 2013-12-24 | 2014-04-02 | 扬州大学 | Oceanic streptomyces parvulus and application thereof on aspect of quorum sensing inhibition |
| CN103695358B (en) * | 2013-12-24 | 2015-08-26 | 扬州大学 | The one small streptomycete in strain ocean and the application in quorum sensing suppression thereof |
| CN104730175A (en) * | 2015-04-10 | 2015-06-24 | 大连工业大学 | Automatic vacuum liquid-chromatography separator and control method thereof |
| CN104730175B (en) * | 2015-04-10 | 2016-08-24 | 大连工业大学 | A kind of automatic vacuum Split liquid chromatographic apparatus and control method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101811959B (en) | 2013-01-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101974464B (en) | Streptomyces and process for preparing antimycin antibiotics by fermentation using same | |
| Duan et al. | Isolation and identification of endophytic bacteria from root tissues of Salvia miltiorrhiza Bge. and determination of their bioactivities | |
| CN106434372B (en) | Application of coral-derived fungus aspergillus terreus strain C21-10 | |
| CN108300677B (en) | One plant of streptomyces albus and its preparing the application in microbialpreservatives | |
| CN106010980A (en) | Endophytic fungus paraconiothyrium brasiliense strain and application thereof | |
| CN101811959B (en) | Compound separated and extracted from marine penicillium and application thereof | |
| CN110776518A (en) | Azaphilone spiro compounds and preparation method and application thereof | |
| CN112760233B (en) | Deep-sea-derived aspergillus aculeatus, metabolite thereof and application | |
| CN108660093B (en) | Marine streptomycete and tunicamycin compound and preparation method thereof | |
| Zhu et al. | Selective isolation and ansamycin-targeted screenings of commensal actinomycetes from the “maytansinoids-producing” arboreal Trewia nudiflora | |
| CN107488594B (en) | New penicillium and metabolite antacid A thereof | |
| Zain et al. | Secondary metabolites of Aureobasidium pullulans isolated from Egyptian soil and their biological activity | |
| CN112143681B (en) | Bacillus belgii capable of producing feruloyl esterase and application thereof | |
| CN109053601A (en) | A kind of noval chemical compound LW-1 of the separation and Extraction from Aspergillus terreus secondary metabolite | |
| CN101293886A (en) | Preparing method and application of white banksia rose endogenetic epiphyte product of snail optical black shell bacterium ketone A | |
| CN107686817A (en) | One plant of fetid marsh fleabane endogenetic fungus CYSK 4 and its Ascomylactam class compounds of production application | |
| CN113308407A (en) | Streptomyces abyssocyanensis and Tianyamycin series compounds and application thereof | |
| CN102757443A (en) | Sulfur-substituted podophyllum derivative and bioconversion, separation and purification method thereof | |
| CN102234669B (en) | Biotransformation and purification method of 4-(2,3,5,6-tetramethylpyrazine-1-group)-4'-demethylepipodophyllotoxin | |
| CN108948036A (en) | A kind of cochliobolus quinone B derivative and its production bacterial strain and application | |
| CN109971655B (en) | Astragalus membranaceus endophytic Chaetomium sp HQ-1 and application thereof | |
| CN110241029A (en) | One plant of coptis soil ferulic acid degradation bacteria and application thereof | |
| CN108660169A (en) | A method of fermentation prepares spine spore bacteriums antibiotic | |
| CN116426394B (en) | Jade Long Biaolan symbiotic fungus and application thereof | |
| CN115247131B (en) | Trichoderma atroviride and metabolite and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130130 Termination date: 20131225 |