CN101805792B

CN101805792B - Real-time fluorescence PCR (Polymerase Chain Reaction) detecting method of Bactrocera philippinensis as well as primer and probe for detection

Info

Publication number: CN101805792B
Application number: CN2010101424258A
Authority: CN
Inventors: 叶军; 房蕊; 易建平
Original assignee: Shanghai Entry Exit Inspection and Quarantine Bureau of PRC
Current assignee: Shanghai Entry Exit Inspection and Quarantine Bureau of PRC
Priority date: 2010-04-08
Filing date: 2010-04-08
Publication date: 2012-07-04
Anticipated expiration: 2030-04-08
Also published as: CN101805792A

Abstract

The invention discloses a real-time fluorescence PCR (Polymerase Chain Reaction) detecting method of Bactrocera philippinensis as well as a primer and a probe for detection. The invention establishes the real-time fluorescence PCR detecting method of Bactrocera philippinensis according to sequence design specific primers G-FP/RP (a sequence shown in an upstream primer SEQ ID NO.1 and a sequence shown as a downstream primer SEQ ID NO.2) and a probe G-MGB (a sequence shown as an SEQ ID NO.3) of part of cob-nadh1 genes in mtDNA of some similar species of Bactrocera dorsalis hendel, Bactrocera papayae, Bactrocera carambolae and Bactrocera philippinensis (GenBank numbers are respectively DG917577, DQ917578, EF014414 and DQ995281) so as to achieve the aim of rapidly and accurately detecting andauthenticating the Bactrocera philippinensis.

Description

Real-time fluorescence PCR detection method of Philippines trypetid and detection are with primer and probe

Technical field

The present invention relates to forestry and Plant Quarantine technical field, be specifically related to the detection method of a kind of Philippines trypetid; Relate in particular to the real-time fluorescence PCR detection method of a kind of Philippines trypetid; In addition, the invention still further relates to primer and the probe that detects the Philippines trypetid.

Background technology

Philippines trypetid Bactrocera philippinensis belongs to Diptera (Diptera), Tephritidae (Tephritidae), belongs to (Bactrocera) from the abdomen bactrocera oligochaeta.Mainly be distributed in countries in Southeast Asia such as Philippines, the host mainly contains jackfruit, pawpaw, Portugal, mango, fruits cash crop such as peach olive.Production causes heavy losses to fruit in its range of distribution, is put into " the inward Plant Quarantine property harmful organism list of China ".Because the increase day by day of China and Southeast Asian countries fresh fruit volume of trade, the Philippines trypetid with trade fruit import China into, the risk that works the mischief increases gradually, becomes one of emphasis harmful organism of China Plant Quarantine department concern.Mostly the worm attitude of in the quarantine of port immigration fresh fruit, intercepting and capturing the Philippines trypetid is ovum, larva or pupa; Philippines trypetid and its generic citrus fruit fly B.dorsalis, carambola trypetid B.carambolae are very close with pawpaw trypetid B.papayae morphological specificity, and ovum, larva and pupa can't use the typoiogical classification method to distinguish especially.In reality quarantine, be the larva of intercepting and capturing etc. to be raised adult just can carry out kind and identify that feeding time generally needs 10-20 days, bring for the trade of immigration fresh fruit and have a strong impact on.Therefore, seeking authentication method fast and accurately is the direction of technological problem demanding prompt solution and development of quarantining present stage.

Yu Daojian etc. (2004) have reported with the quarantine of PCR method and have identified piscidia trypetid B.correcta, also do not see at present to have and utilize molecular biology method that the Philippines trypetid is carried out the report that kind is identified.

Summary of the invention

The technical problem that the present invention will solve provides the real-time fluorescence PCR detection method of a kind of Philippines trypetid; For this reason, the present invention also is provided for the detection primer and the probe of aforesaid method.Utilize Philippines's trypetid detection primer and probe to detect evaluation to the Philippines trypetid quickly and accurately.

(the GenBank numbering is respectively: DQ917577 according to citrus fruit fly, pawpaw trypetid, carambola trypetid and Philippines trypetid in the present invention; DQ917578; EF014414; DQ995281) the sequences Design Auele Specific Primer and the probe of part cob-nadh1 gene among the mtDNA of these several allied specieses have been set up the real-time fluorescence PCR detection method of Philippines trypetid, quick and precisely detect the purpose of identifying the Philippines trypetid to reach.

In one aspect of the invention, the real-time fluorescence PCR detection method of a kind of Philippines trypetid is provided, it is characterized in that, comprise the steps:

(1) design primer and probe;

The sequence of this primer is:

Upstream primer G-FP:5 '-CGGGCTGTGGCACAAACTAT-3 ' (SEQ ID NO.1);

Downstream primer G-RP:5 '-AACTCCGATTCACCTTCTGCAA-3 ' (SEQ ID NO.2);

The sequence of this probe is:

Philippines trypetid probe G-MGB:FCATTAGTTTTATTATCCTTTGTATTTP (SEQ ID NO.3) or its complementary strand;

(2) extract Philippines trypetid DNA;

(3) adopting step (1) designed primer and probe to carry out real-time fluorescence PCR detects.

Step (2) is specially: get Philippines's trypetid single head worm appearance and put into mortar, add the liquid nitrogen shape of claying into power, extract sample DNA with test kit.

In the step (3), the reaction system that said real-time fluorescence PCR detects is 25 μ L, comprises 5 * real time PCR Buffer 5uL; Mg2+solution0.5uL, dNTP mixture0.75uL, TaKaRa Ex-Taq HS0.25uL; Each 0.5uL of upstream and downstream primer G-FP/RP of step (1) design; TaqMan-MGB probe 0.6uL, dna profiling 0.5uL, ultrapure water is mended to 25uL.

In the step (3), the response procedures that said real-time fluorescence PCR detects is: 50 ℃ of 2min, 95 ℃ of 10min of sex change in advance; 95 ℃ of 15sec then, 60 ℃ of 1min circulations 40 times.

In another aspect of this invention, a kind of primer that is used to detect the Philippines trypetid is provided, its sequence is:

Upstream primer G-FP:5 '-CGGGCTGTGGCACAAACTAT-3 ' (SEQ ID NO.1);

Downstream primer G-RP:5 '-AACTCCGATTCACCTTCTGCAA-3 ' (SEQ ID NO.2).

In another aspect of this invention, a kind of probe that is used to detect the Philippines trypetid is provided, its sequence is: G-MGB:FCATTAGTTTTATTATCCTTTGTATTTP (SEQ ID NO.3) or its complementary strand.

Above-mentioned real-time fluorescence PCR detection method adopts MGB (full name is Minor Groove Binder) probe.MGB probe one be probe 3 ' end mark self non-luminous cancellation fluorescence molecule, to replace the TAMRA fluorescent mark that routine can be luminous; The 2nd, 3 ' end of probe has combined Minor groove binder binding substances in addition, and the Tm value of probe is improved, and has increased the hybrid stability property of probe greatly.This method has following advantage: 1, design more easily; 2, probe is shorter: the Tm value difference that 3, improves between pairing and the E of department pairing template is different; 4, experimental result is more accurate, resolution is higher; 5, the stability of hybridization improves; 6, low background; 7, repeatability is stronger.Detection, SNP and two mutants that this method is fit to pathogenic agent detect, and both can carry out the gene quantification analysis, can carry out gene mutation analysis again.

Compared with prior art, beneficial effect of the present invention is:

1, shorten greatly detection time, can in eight hours, accomplish detection, the traditional conventional method needs 10-20 days;

2, the evaluation accuracy rate of Philippines trypetid is increased, the traditional conventional method also needs information support such as other detailed places of production to identify.

Description of drawings

Fig. 1 is primer G-FP/G-RP of the present invention and the position view of probe G-MGB on Philippines trypetid (DQ995281);

Fig. 2 is the comparison synoptic diagram of four kinds of trypetids (Philippines trypetid DQ995281, citrus fruit fly DQ917577, carambola trypetid EF014414, pawpaw trypetid DQ917578) sequence at probe location;

Fig. 3 is the synoptic diagram as a result of 6 Philippines's trypetid sample real-time fluorescence PCR amplifications of different sources.

Embodiment

Below in conjunction with accompanying drawing and embodiment the present invention is done further detailed explanation.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually by normal condition; People such as Sambrook for example, molecular cloning: condition described in the laboratory manual (New York:Cold Spring Harbor Laboratory Press.1989), or the condition of advising by manufacturer.

Embodiment 1

1. design primer and probe

(the GenBank numbering is respectively: DQ917577 according to citrus fruit fly, pawpaw trypetid, carambola trypetid and Philippines trypetid; DQ917578; EF014414, DQ995281) the following Auele Specific Primer G-FP/RP of sequences Design of part cob-nadh1 gene and probe G-MGB among the mtDNA of these several allied specieses (Mitochondrial DNA) (primer and probe are synthetic by last sea base Kanggong department):

Upstream primer G-FP:5 '-CGGGCTGTGGCACAAACTAT-3 ';

Downstream primer G-RP:5 '-AACTCCGATTCACCTTCTGCAA-3 ';

Philippines trypetid probe G-MGB:FCATTAGTTTTATTATCCTTTGTATTTP

The detection principle of above-mentioned primer and probe is as shown in Figure 1, and four kinds of trypetids (Philippines trypetid DQ995281, citrus fruit fly DQ917577, carambola trypetid EF014414, pawpaw trypetid DQ917578) sequence is seen Fig. 2 in the comparison of probe location.

2, extract Philippines trypetid DNA

Get Philippines's trypetid single head worm appearance (sample source is seen table 1) and put into mortar; Add the liquid nitrogen shape of claying into power, extract sample DNA with Tissue Kit (Qiagen company).

Table 1 Philippines trypetid sample message

Sample number into spectrum	The host	The source place	Collect the date	Remarks
					SH65	Mango	Philippines	1998.6	Give
SH102	Mango	Philippines	2005.12	Intercept and capture at the port
					SH103	Mango	Philippines	2006.11	Intercept and capture at the port
SH104	Mango	Philippines	2006.11	Intercept and capture at the port
					SH114	Pawpaw	Philippines	2007.3	Intercept and capture at the port
SH126	Mango	Philippines	2007.10	Intercept and capture at the port

SH65: give by the Liang Fan researcher of Guangdong Entry-Exit Inspection and Quarantine Bureau.

3, real-time fluorescence PCR detects

Real-time fluorescence PCR amplification system 25uL (the precious TaKaRa real-time PCR core kit of biotech firm in Dalian): 5 * real time PCR Buffer (Mg2 ⁺Free) 5uL, Mg2+ solution (250mmol/L) 0.5uL, dNTP mixture (each 10mmol/L) 0.75uL; TaKaRa Ex-TaqHS (5U/uL) 0.25uL; Each 0.5uL of upstream and downstream primer G-FP/RP (10umol/L), TaqMan-MGB probe (5umol/L) 0.6uL, DNA (10～20ng/uL) template 0.5uL; Ultrapure water is mended to 25uL, and the real-time fluorescence PCR amplification is carried out on ABI PRISM 7700 quantitative pcr amplification appearance.Open Sequence Detection 1.71, the PCR reaction conditions is set, two-step approach amplified reaction program: 50 ℃ of 2min, 95 ℃ of 10min of sex change in advance; 95 ℃ of 15sec then, 60 ℃ of 1min circulations 40 times.Click operation, carry out the PCR reaction, 1h 56min reacts end, preserves file, opens analysis software, and instrument is analyzed experimental result automatically, provides Δ Rn (the fluorescence increased value of n circulation time) and cycle number image.

Detected result is as shown in Figure 3, in Fig. 3, the curve (digital 1-6 curve) of 6 risings is arranged, and the sample details of digital 1-6 curve representation are as shown in table 1.In Fig. 3; 1 expression sample number into spectrum is Philippines's trypetid sample of SH102, and 2 expression sample number into spectrum are Philippines's trypetid sample of SH104, and 3 expression sample number into spectrum are Philippines's trypetid sample of SH126; 4 expression sample number into spectrum are Philippines's trypetid sample of SH103; 5 expression sample number into spectrum are Philippines's trypetid sample of SH114, and 6 expression sample number into spectrum are Philippines's trypetid sample of SH65, and 7 expressions do not have the negative control of template DNA.By Fig. 3 show this real-time fluorescence PCR detected be the Philippines trypetid, show that primer G-FP/RP and probe G-MGB can specific detection Philippines trypetids.

Sequence table

< 110>Shanghai Bureau of Emigration &. Engression Examination &. Quarantine People's R

< 120>real-time fluorescence PCR detection method of Philippines trypetid and detection are with primer and probe

<130>NP-10-14091

<160>3

<170>PatentIn?version?3.3

<210>1

<211>20

<212>DNA

< 213>artificial sequence

<220>

<221>misc_feature

< 223>primer

<400>1

cgggctgtgg?cacaaactat 20

<210>2

<211>22

<212>DNA

< 213>artificial sequence

<220>

<221>misc_feature

< 223>primer

<400>2

aactccgatt?caccttctgc?aa 22

<210>3

<211>26

<212>DNA

< 213>artificial sequence

<400>3

cattagtttt?attatccttt?gtattt 26

Claims

1. the real-time fluorescence PCR detection method of a Philippines trypetid is characterized in that, comprises the steps:

(1) design primer and probe;

The sequence of this primer is:

Upstream primer G-FP:5 '-CGGGCTGTGGCACAAACTAT-3 ' (SEQ ID NO.1);

Downstream primer G-RP:5 '-AACTCCGATTCACCTTCTGCAA-3 ' (SEQ ID NO.2);

The sequence of this probe is:

(2) extract Philippines trypetid DNA;

2. the real-time fluorescence PCR detection method of Philippines as claimed in claim 1 trypetid is characterized in that, step (2) is specially: get Philippines's trypetid single head worm appearance and put into mortar, add the liquid nitrogen shape of claying into power, extract sample DNA with test kit.

3. the real-time fluorescence PCR detection method of Philippines as claimed in claim 1 trypetid is characterized in that, in the step (3), the reaction system that said real-time fluorescence PCR detects is 25 μ L, comprises 5 * real time PCR Buffer 5uL, Mg ²⁺Solution0.5uL, dNTP mixture0.75uL, TaKaRa Ex-Taq HS0.25uL, each 0.5uL of upstream and downstream primer G-FP/RP of step (1) design, TaqMan-MGB probe 0.6uL, dna profiling 0.5uL, ultrapure water is mended to 25uL.

4. like the real-time fluorescence PCR detection method of claim 1 or 3 described Philippines trypetids, it is characterized in that in the step (3), the response procedures that said real-time fluorescence PCR detects is: 50 ℃ of 2min, 95 ℃ of 10min of sex change in advance; 95 ℃ of 15sec then, 60 ℃ of 1min circulations 40 times.

5. a primer that is used to detect the Philippines trypetid is characterized in that, its sequence is:

Upstream primer G-FP:5 '-CGGGCTGTGGCACAAACTAT-3 ' (SEQ ID NO.1);

Downstream primer G-RP:5 '-AACTCCGATTCACCTTCTGCAA-3 ' (SEQ ID NO.2).

6. a probe that is used to detect the Philippines trypetid is characterized in that, its sequence is:

G-MGB:FCATTAGTTTTATTATCCTTTGTATTTP (SEQ ID NO.3) or its complementary strand.