CN101792797B - Method for breeding common wheat-thinopyrum bessarabicum small-fragment translocation line and molecular marker thereof - Google Patents
Method for breeding common wheat-thinopyrum bessarabicum small-fragment translocation line and molecular marker thereof Download PDFInfo
- Publication number
- CN101792797B CN101792797B CN2009102343857A CN200910234385A CN101792797B CN 101792797 B CN101792797 B CN 101792797B CN 2009102343857 A CN2009102343857 A CN 2009102343857A CN 200910234385 A CN200910234385 A CN 200910234385A CN 101792797 B CN101792797 B CN 101792797B
- Authority
- CN
- China
- Prior art keywords
- hundred
- couchgrass
- translocation
- chromosome
- line
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method for breeding a common wheat-thinopyrum bessarabicum small-fragment translocation line T2JS-2BS.2BL and a molecular marker thereof, and belongs to the technical field of plant breading. The method comprises the following steps: selecting and breading a Chinese spring thinopyrum bessarabicum small-fragment translocation line with the aid of the molecular marker, and screening and identifying small-fragment translocation chromosomes by using cytology to obtain the homozygous translocation line T2JS-2BS.2BL with good genetic compensation and obtain 3 specific tracking co-dominant markers. The translocation line has the effects of increasing the plant height, effective spike number, grain number and single plant yield and prolonging the growth period; and the disclosed co-dominant markers can distinguish homozygous and heterozygous translocation type, are favorable for marking auxiliary selection, and provide new germplasm for breading a high-yield wheat variety and widening a hereditary basis of breading the wheat.
Description
One, technical field
This patent discloses the selection and the radioactive labelling thereof of a kind of common wheat-hundred Sa couchgrass small segment translocation line (T2JS-2BS2BL), belongs to field of plant variety breeding technology.
Two, background technology
One hundred Sa Elytriga (Thinopyrum? Bessarabicum
2n = 2x = 14, JJ) originating in the Black Sea and the Mediterranean, with a strong salt, phosphorus efficiency, disease resistance, strong tillering, horny rate and other traits, Wheat Improvement is an important genetic resources (see References: Peizi You, Wenhui Qin, CHEN Hua-feng, Zhuang Lifang, QI Zeng-jun. one hundred Sa Elytriga wheat genetic improvement in the application of research. Shaanxi Journal of Agricultural Sciences, 2008,54 (1) :70-74 ).International corn wheat improvement center (CIMMYT) has obtained 7 wheat-hundred Sa couchgrass disome alien addition lines, and (document sees reference: William M D H M; Mujeeb-Kazi A.Biochemical and molecular diagnostics ofThinopyrum bessarabicum chromosomes in Triticum aestivum germplasm.Theor Appl Genet; 1995,90:952-956), but show through identifying; This cover addition line and imperfect; (document sees reference: Zhang J-Y, LiX-M, WangRichard R-C to lack 3J and 6J; Cortes A, Rosas V and A Mujeebi-Kazi.Molecular cytogenetic characterization of E
b-genomechromosomes in Thinopyrum bessarabicum disomic addition lines of bread wheat.Plant Sci, 2002,163 (1): 167-174).Zhuang Lifang, etc. bred seven disomic addition lines and seven with spontaneous translocation chromosome multiple additional lines (see References: Zhuang Lifang, QI Zeng-jun, Inga, Chen PD, Liu Dajun. Ordinary wheat - one hundred Sa Elytriga (Thinopyrum? bessarabicum) disomic additional Breeding and identification. Genetics ,2003,30:919-925; Zhuang Lifang, QI Zeng-jun, Chen PD, Feng Yi Gao, Liu Dajun. ordinary wheat - one hundred Sa Elytriga Breeding and chromosomal translocations Identification of Chinese Academy of Agricultural Sciences, 2003,36 (12) :1432-1436), Chen Huafeng, etc. of these materials by molecular marker analysis (see References: Chen Huafeng, Qian Li, Zhuang Lifang, CHEN Quan war, Feng Yi high Peizi You, QI Zeng-jun , Chen PD, Liu Dajun. Triticum aestivum Chinese Spring - one hundred Sa Elytriga heterochromatin molecular marker analysis system. Crops ,2007,33:1232-1239), found that these additional lines not covered by 4J and 5J, incomplete.King et al (1993) has also reported the translocation line T5AS5JL that relates to 5J, and (document sees reference: King I P, Purdie K A, Rezanoor H N; Kobner R M D, Miller T E, Reader S M; And Micholsm P Characterization of Thinopyrum bessarabicum chromosome segments in wheat usingrandom amplified polymorphic DNAs (RAPDs) and genomic in situ hybridization.Theor Appl Genet, 1993,86:895-900) (document sees reference: King I P with some karyomit(e) recombinant chous that utilize the Ph gene mutation body to lead to; Forster B P, LawC C, Cant K A; Orford S E; Gorham J, Reader S M, Miller T E.Introgression of salt-tolerance genes fromThinopyrum bessarabicum into wheat.New Phytol; 1997,137:75-81).
In order to transfer and utilize one hundred Sa Elytriga favorable genes, Nanjing Agricultural University cells genetically distant hybridization obtained through a number of Chinese Spring - one hundred Sa Elytriga two bodies or multiple additional lines, wherein the additional lines TJ04 (2n = 44) in the Added one pair one hundred Sa Elytriga end of chromosomes also contains one pair of common wheat and one hundred Sa Elytriga small fragments translocation chromosome, the additional lines with strong tillering large panicle, plant height growth period delay and other Features (see References: Zhuang Lifang, QI Zeng-jun, Chen PD, Feng Yi Gao, Liu Dajun. ordinary wheat - one hundred Sa Elytriga Breeding and Identification of chromosomal translocations Chinese Academy of Agricultural Sciences, 2003,36 (12) :1432-1436).Qian Baoli (2007) finds through molecular markers for identification; The pair of end body that adds among the addition line TJ04 is hundred Sa couchgrass karyomit(e) 6JL; The a pair of small segment translocation chromosome that comprises occurs between common wheat karyomit(e) 2BS and the hundred Sa couchgrass karyomit(e) 2JS; Tentatively be inferred as T2JS-2BS2BL, but do not utilize cytologic technology to confirm as yet, also do not have simultaneously small segment translocation chromosome is wherein separated with the end Autosome; Breed the translocation line that isozygotys (document sees reference: Qian Baoli. the molecular marker analysis .2007 of hundred Sa couchgrass chromosome structures in the general wheat background, Agricultural University Of Nanjing's master thesis).Except that relating to 2 pairs of hundred different Sa couchgrass chromosome segments simultaneously; Other karyomit(e) of addition line TJ04 is all from China spring; Thereby the big fringe of its performance, the characteristic such as strong of tillering cause by the hundred Sa couchgrass genes that import; But, therefore be difficult to analysis and brought into play effect by any bar exogenous chromosome on earth because TJ04 comprises 2 pairs of hundred different Sa couchgrass chromosome segments simultaneously.
This patent is promptly done maternal with common wheat China spring-hundred Sa couchgrass addition line TJ04, common wheat China spring (public) is made male parent, and the preparing hybrid combination obtains hybrid F
1And F
2Extract the genomic dna of hybrid plant respectively; Hundred Sa couchgrass karyomit(e) 6JL that utilization filters out and 2JS specially change mark (document sees reference: Qian Baoli. the molecular marker analysis .2007 of hundred Sa couchgrass chromosome structures in the general wheat background; Agricultural University Of Nanjing's master thesis) selects and cytological Identification through mark, F
2Colony forms according to karyomit(e), be distinguished into 6 kinds dissimilar, therefrom select chromosome number and be the translocation line and do not relate to the chromatinic China spring type of any hundred Sa couchgrass of isozygotying that only relates to the small segment translocation chromosome of 2n=42.Divide the double-colored in situ hybridization of band-genomic in situ hybridization, Tumor-necrosis factor glycoproteins pSc119.2 and hundred Sa couchgrass genomes to combine utilization to be positioned SSR mark on the 2B karyomit(e) through karyomit(e) order C-and analyze that (document sees reference: Sourdille P, Singh S, Cadalen T; Brown-Guedira G L, Gay G, Qi L L; Gill B S; Dufour P, Murigneux A, and M Bernard.Microsatellite-based deletion bin system for the establishment ofgenetic-physical map relationships in wheat (Triticum aestivum L.) .Funct Integr Genomics; 2004; 4:12-25), this patent concludes that accurately transposition occurs in the 2BS kinetochore between the FL0.53, and definite designation is T2JS-2BS.2BL.
Through the comparison test in 2 years, disclosed the T2JS-2BS2BL transposition plant height, spike length, spikelet number and single plant yield have been had positive-effect.(document sees reference: Conley E J, Nduati V, Gonzalez-Hernandez J L, Mesfin A according to the ESTs that is positioned wheat part 2 homology crowd; Trudeau-Spanjers M, Chao S, Lazo G R, Hummel D D; Anderson O D, Qi L L, Gill B S, Echalier B; Linkiewicz A M, Dubcovsky J, Akhunov E D,
J; Peng J H, Lapitan N L V, Pathan M S, Nguyen H T; Ma X-F, Miftahudin, Gustafson J P, Greene R A; Sorrells M E, Hossain K G, Kalavacharla V, Kianian S F; Sidhu D, Dilbirligi M, Gill K S, Choi D W; Fenton R D, Close T J, McGuire P E, Qualset C Oand J A Anderson.A 2600-locus chromosome bin map of wheat homoeologous group 2 reveals interstitialgene-rich islands and colinearity with rice.Genetics; 2004,168:625-637) design PCR primer filters out the codominance molecule marker of following the trail of this transposition, for shifting and utilizing the excellent genes of this translocation line to facilitate.
Three, summary of the invention
Technical problem:
Common wheat China spring-hundred Sa couchgrass addition line TJ04 (2n=44) has strong, the big fringe of ability for tillering, many, plant height increases and characteristics such as prolongation at heading stage; Because this addition line genetic background is China spring; Therefore the effect that is different from China spring that it showed is mainly caused by the chromatinic introducing of hundred Sa couchgrass; But in TJ04, relate to 2 kinds of hundred different Sa couchgrass chromatin simultaneously, effect has been brought into play in therefore very difficult analysis which kind of chromatin on earth.This patent promptly through TJ04 and China spring hybridization, obtains hybrid F
1, F
2And F
2:3Combine cytological Identification through molecular marker assisted selection; Select the small segment translocation line that isozygotys of chromosome number 2n=42, comprehensive utilization molecule marker and cytologic technology are accurately identified the transposition breakpoint, and clearly this translocation line to the effect of Other Main Agronomic Characters; Screening can be distinguished the codominant marker of isozygotying with the heterozygosis transposition simultaneously, facilitates by shifting and utilizing this transposition to be taken excellent genes.
Technical scheme:
The selection of common wheat-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL comprises:
(1) molecular marker assisted selection seed selection China spring-hundred Sa couchgrass small segment translocation line
1) China spring-hundred Sa couchgrass addition line TJ04 makes female parent, and the common wheat China spring is done the combination of male parent preparing hybrid, and obtains hybrid F
1, F
2And F
2:3, extract parents, hybrid F respectively
1And F
2Genomic dna;
2) at first utilize hundred Sa couchgrass karyomit(e) 6JL specially to change mark Xbtd8 (primer sequence F:GTTTGGCCGAATTCACAAGT; R:CATGCATGCAGTTCCTCAAG) to F
2The karyomit(e) of individual plant is formed and is analyzed, and selects to contain the individual plant of the hundred Sa couchgrass specific bands of about 300bp that Xbtd8 amplifies, explains that these individual plants contain hundred Sa couchgrass karyomit(e) 6JL;
3) utilize hundred Sa couchgrass karyomit(e) 2JS specially to change mark Xgdm35 (primer sequence F:CCTGCTCTGCCCTAGATACG again; R:ATGTGAATGTGATGCATGCA is to F
2Individual plant is analyzed, and identifies the individual plant of the specific band with the about 150bp of hundred Sa couchgrass karyomit(e) 2JS, explains that these individual plants contain hundred Sa couchgrass karyomit(e) 2JS;
4) result of comprehensive mark Xbtd8 and Xgdm35 is from F
2Filter out the individual plant that contains hundred Sa couchgrass karyomit(e) 2JS and do not contain 6JL in the individual plant, be classified as the transposition type;
5) utilize chromosome of wheat 2BS specially to change mark Xgwm257 (F:AGAGTGCATGGTGGGACG; R:CCAAGACGATGCTGAAGTCA) further detect the integrity of 2BS in the transposition type individual plant, wherein lack the individual plant of the 2BS amplified band of about 240bp that Xgwm257 produces, be the potential translocation line that isozygotys;
(2) cytology Screening and Identification small segment translocation chromosome
The 24 strain potential that utilize the cytology method that mark the is selected translocation line that isozygotys carries out Screening and Identification; C-divides band and hundred Sa couchgrass genomic in situ hybridization, Tumor-necrosis factor glycoproteins pSc119.2 and hundred Sa couchgrass genome Two Colour Fluorescence in situ hybridizations through root-tip cells karyomit(e) order; This translocation chromosome is long-armed to have and long-armed similar C-band line of China spring karyomit(e) 2B and the hybrid belt line of Tumor-necrosis factor glycoproteins pSC119.2; Divide band band line and this translocation chromosome galianconism only has a chromosome of wheat 2B galianconism near centric C-; And in situ hybridization shows the chromatin of this translocation chromosome galianconism 60% from hundred Sa couchgrass, the transposition breakpoint be positioned at the nearly centromere band line of 2BS near; Pollen mother cell chromosomes pairing and setting percentage investigation detect; These translocation line chromosome pairings and setting percentage are all normal; Be the good translocation line that isozygotys of hereditary compensatory; The transposition breakpoint arrives between the disappearance breakpoint FL0.53, between 4 marks (Xbarc18, Xbarc230, Xgwm374 and Xgwm429) and other 3 marks (Xgwm630, Xgwm319 and Xbarc114) in the 2BS kinetochore; Is common wheat China spring-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL according to The above results with this translocation line definite designation, is numbered NAU2009-1.
T2JS-2BS2BL translocation line economical character is average plant height 131.88cm, and 11.54 of number of productive ears, spike length 11.15cm, 27.51 of spikelet numbers, 77.53 of grain number per spikes, fringe grain weigh 2.07 grams, 189.05 days breeding times, single-strain grain weight 15.57 grams, thousand seed weight 26.48 grams.
The special tracking codominant marker of said common wheat-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL comprises:
Codominant marker Xcinau696, its primer CINAU696,
F：TTCTTCACGCCGCTTGTT；R：TCATTGCTGGAGGATTGC
In translocation line, can amplify the specific band of the about 260bp of hundred Sa couchgrass karyomit(e) 2JS, and lack the specific band of the about 350bp of chromosome of wheat 2BS simultaneously;
Codominant marker Xcinau737 and its primer CINAU737,
F：CGTATGGACCGTCTTCACAG；R：ATGCCGCAGATGGAGTTG
In translocation line, can amplify the specific band of hundred Sa couchgrass 2J the short arm of a chromosome 440bp, lack the specific band of wheat 2B the short arm of a chromosome 470bp;
With codominant marker Xcinau807, its primer CINAU807,
F：GACACGGTCTTCCCTGAT；R：AAGGGCTGAAAGTGTTGC
In translocation line, can amplify the specific band of hundred Sa couchgrass 2J the short arm of a chromosome 510bp, and lack the specific band of wheat 2B the short arm of a chromosome 470bp.
Beneficial effect:
1, the invention discloses the selection of a kind of common wheat China spring-hundred Sa couchgrass small segment translocation line (T2JS-2BS2BL), the translocation line of this method seed selection (T2JS-2BS2BL) has the effect that increases plant height, number of productive ear, grain number per spike, single plant yield and prolongation breeding time;
2,3 codominance molecule markers disclosed by the invention can be followed the trail of this translocation chromosome effectively, and can distinguish and isozygoty or the heterozygosis transposition, are used for molecular marker assisted selection, for cultivating the High-yield Wheat kind, widening the cultivated wheat hereditary basis new germplasm is provided.
Four, description of drawings
Fig. 1 hundred Sa couchgrass and common wheat karyomit(e) are specially changed mark Xbtd8-6JL, and (Fig. 1 a), Xgdm35-2JS (Fig. 1 b), Xgwm257-2BS (Fig. 1 c) and Xcinau696-2JS (Fig. 1 d) be at TJ04/ China spring F
2Amplification in the colony. swimming lane: M:DL2000; 1: China spring; 2: China spring-hundred Sa couchgrass double diploid; 3: hundred Sa couchgrass; 4-12:TJ04/ China spring F
2, wherein swimming lane 5 and 9 only has mark Xbtd8-6JL (Fig. 1 a) detects the special band (shown in the arrow) of hundred Sa couchgrass karyomit(e) 6JL, shows that this individual plant only contains hundred Sa couchgrass karyomit(e) 6JL; Swimming lane 6 had not only contained the special band of the hundred Sa couchgrass karyomit(e) 2JS that underlined Xgdm35-2JS (Fig. 1 b) detects but also had contained the special band of chromosome of wheat 2BS (shown in the arrow) that Xgwm257-2BS (Fig. 1 c) detects, and showed that this individual plant is a heterozygosis transposition type; Swimming lane 11 contains the special band of the hundred Sa couchgrass karyomit(e) 2JS that underlined Xgdm35-2JS (Fig. 1 b) detects but lacks the special band of chromosome of wheat 2BS (shown in the arrow) that Xgwm257-2BS (Fig. 1 c) detects simultaneously, shows that this individual plant is the transposition type of isozygotying; Swimming lane 8 has mark Xbtd8-6JL, and (Fig. 1 a) detects the special band of the special band of hundred Sa couchgrass karyomit(e) 6JL and the hundred Sa couchgrass karyomit(e) 2JS that Xgdm35-2JS (Fig. 1 b) detects but lacks the special band of chromosome of wheat 2BS (shown in the arrow) that Xgwm257-2BS (Fig. 1 c) detects, and shows that this individual plant is the transposition type of isozygotying that comprises 6JL; Swimming lane 12 has mark Xbtd8-6JL simultaneously, and (Fig. 1 a) detects the special band of hundred Sa couchgrass karyomit(e) 6JL; The special band of chromosome of wheat 2BS (shown in the arrow) that the special band of the hundred Sa couchgrass karyomit(e) 2JS that Xgdm35-2JS (Fig. 1 b) detects and Xgwm257-2BS (Fig. 1 c) detect shows that this individual plant is the heterozygosis transposition type that comprises 6JL; Swimming lane 4; 7 and 10 only have the special band of chromosome of wheat 2BS (shown in the arrow) that mark Xgwm257-2BS (Fig. 1 c) detects; Showing that these individual plants are not for relating to the China spring type of hundred Sa couchgrass karyomit(e) 6JL and 2JS. mark Xcinau696-2JS (Fig. 1 d) can detect hundred Sa couchgrass karyomit(e) 2JS and chromosome of wheat 2BS simultaneously; Thereby through once amplification; Just can the state area of translocation chromosome be separated; Bonding mark Xbtd8-6JL (Fig. 1 result a); Can judge that swimming lane 11 has the special band of hundred Sa couchgrass karyomit(e) 2JS of mark Xcinau696-2JS (Fig. 1 d) detection, but lack the special band of the chromosome of wheat 2BS of Xcinau696-2JS detection simultaneously, show that this individual plant is the transposition type of isozygotying; The detected result of other individual plant has shown the utility value of codominant marker Xcinau696-2JS in this translocation chromosome of tracking with to utilize hundred Sa couchgrass karyomit(e) 2JS specially to change mark Xgdm35-2JS (Fig. 1 b) simultaneously in full accord with the detected result that chromosome of wheat 2BS specially changes mark Xgwm257-2BS (Fig. 1 c).
Fig. 2 China spring 2B karyomit(e) C-divides the C-of band (a) and translocation chromosome T2JS-2BS2BL to divide band (b), the full genomic in situ hybridization of hundred Sa couchgrass (c), order C-to divide the band full genomic in situ hybridization composite diagrams of-hundred Sa couchgrass (d), Tumor-necrosis factor glycoproteins pSc119.2 and the full genome of hundred Sa couchgrass to make the Two Colour Fluorescence in situ hybridization band line (e) of probe. and (arrow shows the transposition breakpoint; B, c, d and e arrow top show hundred Sa couchgrass karyomit(e) 2JS chromatin, and the below is a chromosome of wheat 2B chromatin)
Fig. 3 China spring and common wheat-hundred Sa couchgrass small segment translocation line NAU2009-1 fringe types relatively.
Five, biological preservation
Common wheat China spring-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL; Be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center; Preservation date 2009.10.14; Classification called after common wheat (Triticum aestivum), deposit number is CGMCC No.3295.
Six, embodiment
(1) molecular marker assisted selection seed selection China spring-hundred Sa couchgrass small segment translocation line
China Spring - one hundred Sa Elytriga additional lines TJ04 (2n = 44) (see References: Zhuang Lifang, QI Zeng-jun, Chen PD, Feng Yi Gao, Liu Dajun. Ordinary wheat - one hundred Sa Elytriga chromosomal translocation Breeding and Identification of Chinese Academy of Agricultural Science, 2003,36 (12) :1432-1436) with the addition of one pair of one hundred Sa body 6JL Thinopyrum chromosome ends at the same time also includes one pair of wheat and one hundred Sa small fragments of Agropyron translocation chromosome, the chromosome translocation under Qian Bao Li (2007) Molecular marker analysis concluded occur in wheat chromosomes 2BS with one hundred Sa Trititrigia between chromosomes 2JS, tentatively titled T2JS-2BS · 2BL (Qian Bao Li, common wheat background one hundred Sa Thinopyrum chromosome structure Molecular marker analysis, 2007, Nanjing Agricultural University Master thesis (
http://libwww.njau.edu.cn ).
For from TJ04, isolating the translocation line that isozygotys, and disclose the effect of translocation chromosome, this patent is done maternal through addition line TJ04 (2n=44), and the common wheat China spring is done the combination of male parent preparing hybrid, and obtains hybrid F
1, F
2And F
2:3Extract parents, hybrid F respectively
1And F
2Genomic dna, utilize karyomit(e) specially to change mark then and its karyomit(e) is formed identified.At first utilize hundred Sa couchgrass karyomit(e) 6JL specially to change mark Xbtd8 (primer sequence: F:GTTTGGCCGAATTCACAAGT; R:CATGCATGCAGTTCCTCAAG) to 106 F
2The karyomit(e) of individual plant is formed and is analyzed, and finds that 21 individual plants contain the hundred Sa couchgrass specific bands (Fig.1a) of about 300bp that Xbtd8 amplifies, explain that these individual plants contain hundred Sa couchgrass karyomit(e) 6JL.Utilize hundred Sa couchgrass karyomit(e) 2JS specially to change mark Xgdm35 (primer sequence: F:CCTGCTCTGCCCTAGATACG again; R:ATGTGAATGTGATGCATGCA) to F
2Individual plant is analyzed, and identifies the specific band that 73 individual plants have the about 150bp of hundred Sa couchgrass karyomit(e) 2JS, explains that these individual plants contain hundred Sa couchgrass karyomit(e) 2JS.The result of comprehensive mark Xbtd8 and Xgdm35 is from 106 F
2Filter out 60 individual plants in the individual plant and contain hundred Sa couchgrass karyomit(e) 2JS and do not contain 6JL, be classified as the transposition type; And identify 26 individual plants and do not relate to any hundred Sa couchgrass chromatin, similar with parent's China spring, be classified as the China spring type.
For the seed selection transposition type individual plant that isozygotys, utilize chromosome of wheat 2BS specially to change mark Xgwm257 (F:AGAGTGCATGGTGGG ACG; R:CCAAGACGATGCTGAAGTCA) be used for further detecting the integrity of 2BS in 60 transposition type individual plants; The result shows that wherein 24 individual plants lack the amplified band of about 240bp that Xgwm257-2BS produces; These individual plants are the potential translocation line that isozygotys; 36 individual plants have the amplified band of about 240bp of Xgwm257-2BS generation simultaneously, are heterozygosis transposition type.
(2) the accurate Screening and Identification small segment of cytology and molecular marking technique translocation chromosome identity and breakpoint
Be result that verification mark is selected and accurately Screening and Identification translocation chromosome identity and transposition breakpoint thereof, this patent utilizes the cytology method that the 24 strain potential translocation line that isozygotys has been carried out Screening and Identification.Root-tip cells karyomit(e) order C-divides band (Fig. 2 b) and hundred Sa couchgrass genomic in situ hybridization (Fig. 2 c), Tumor-necrosis factor glycoproteins pSc119.2 and hundred Sa couchgrass genome Two Colour Fluorescence in situ hybridizations (Fig. 2 e) to prove; This translocation chromosome is long-armed to have and long-armed similar C-band line of China spring karyomit(e) 2B and the hybrid belt line of Tumor-necrosis factor glycoproteins pSC119.2; Divide band band line and this translocation chromosome galianconism only has a chromosome of wheat 2B galianconism near centric C-; And in situ hybridization shows the chromatin of this translocation chromosome galianconism about 60% from hundred Sa couchgrass, the transposition breakpoint be positioned at the nearly centromere band line of 2BS near.Pollen mother cell chromosomes pairing and setting percentage investigation show that these translocation line chromosome pairings and setting percentage are all normal, are the good translocation line that isozygotys of hereditary compensatory.(wherein 13 are positioned the 2B the short arm of a chromosome further to utilize 15 gSSR marks that are positioned on the 2B karyomit(e); 2 to be positioned 2B karyomit(e) long-armed) (document sees reference: Sourdille P; Singh S, Cadalen T, Brown-Guedira G L; Gay G; Qi L L, Gill B S, Dufour P; Murigneux A; And M Bernard.Microsatellite-based deletion bin system forthe establishment of genetic-physical map relationships in wheat (Triticum aestivum L.) .Funct IntegrGenomics, 2004,4:12-25) this translocation line is analyzed discovery; 4 marks (Xbarc13, Xgwm410, Xbarc55 and Xgwm148) that are positioned 2 marks (Xgwm257 and Xbarc200) of 2BS-3 (FL0.84-1.00) and are positioned at 2BS-1 (FL0.53-0.84) all lack corresponding amplification site; And be positioned in 7 marks of C-2BS-1 (FL0-0.53), 4 (Xbarc18, Xbarc230, Xgwm374 and Xgwm429) lack corresponding amplification site, and other 3 marks (Xgwm630, Xgwm319 and Xbarc114) and 2 marks (Xgwm47.2 and Xbarc167) that are positioned 2BL have the amplification site identical with China spring; Show that the transposition breakpoint arrives between the disappearance breakpoint FL0.53, between 4 marks (Xbarc18, Xbarc230, Xgwm374 and Xgwm429) and other 3 marks (Xgwm630, Xgwm319 and Xbarc114) (Fig. 4) in the 2BS kinetochore.(above molecule marker is seen Qian Baoli, the molecular marker analysis of hundred Sa couchgrass chromosome structures in the general wheat background, and 2007, the Master degree candidate of Agricultural University Of Nanjing paper (
Http:// libwww.njau.edu.cn).
Is common wheat China spring-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL according to The above results with this translocation line definite designation, is numbered NAU2009-1.
(3) effect analysis of common wheat China spring-hundred Sa couchgrass small segment translocation line (T2JS-2BS2BL)
For understanding the effect of this translocation chromosome to Other Main Agronomic Characters; Disclose the utility value of this translocation line; This patent in 2007-2008 year on farm, Agricultural University Of Nanjing Jiangpu, to common wheat China spring (public), China spring-hundred Sa couchgrass addition line TJ04 and hybrid F thereof
1And F
2Economical character carried out investigation and relatively found, 24 strains are isozygotied and plant height, spike length and heading stage of T2JS-2BS2BL translocation line individual plant are significantly higher than 25 China spring type individual plants and China spring, and similar with TJ04.For further analyzing the effect of this translocation chromosome, utilize 19 isozygoty T2JS-2BS2BL translocation line and 19 China spring type F
2The F that individual plant selfing obtains
2:3Family compares the t inspection show to Other Main Agronomic Characters on farm, Agricultural University Of Nanjing Jiangpu by randomized block design in 2008-2009 year; Compare with China spring type family, the T2JS-2BS2BL translocation line significantly increases plant height 11.14cm, increases spike length 3.04cm; Postpone 10d at heading stage, grain number per spike increases by 8, and the effective tillering number increases by 3; Single plant yield increases 2.73g; But thousand seed weight reduces 2.78g, the fringe grain heavily do not have notable difference (table 2, Fig. 8); Show that the T2JS-2BS2BL translocation chromosome imports the approach raising individual plant grain yield that can pass through to increase number of grain per ear and number of productive ear in the Wheat Background, for the improving yield of wheat breeding provides new genetic resources.
(5) common wheat China spring-hundred Sa couchgrass small segment translocation line (T2JS-2BS2BL) codominant marker's screening and application
The codominant marker that China spring-hundred Sa couchgrass small segment translocation line (T2JS-2BS2BL) is followed the trail of in screening can distinguish and isozygoty and heterozygosis transposition type through once amplification simultaneously, is beneficial to through marker assisted selection and accelerates the utilization of T2JS-2BS2BL in breeding.Therefore this patent utilizes the ESTs that is positioned wheat part 2 homology crowd, and (document sees reference: Conley E J, Nduati V, Gonzalez-Hernandez JL, Mesfin A; Trudeau-Spanjers M, Chao S, Lazo G R, Hummel D D; Anderson O D, Qi L L, Gill B S, Echalier B; Linkiewicz A M, Dubcovsky J, Akhunov E D,
J; Peng J H, Lapitan N L V, Pathan M S, Nguyen H T; Ma X-F, Miftahudin, Gustafson J P, Greene R A; Sorrells M E, Hossain K G, Kalavacharla V, Kianian S F; Sidhu D, Dilbirligi M, Gill K S, Choi D W; Fenton R D, Close T J, McGuire P E, Qualset C Oand J A Anderson.A 2600-locus chromosome bin map of wheat homoeologous group 2 reveals interstitialgene-rich islands and colinearity with rice.Genetics; 2004,168:625-637) designed 140 pairs of PCR primers, utilize these primers to the translocation line analysis of increasing, therefrom filter out 3 codominant markers (Xcinau696, Xcinau737 and Xcinau807) (table 1).Primer CINAU696 (F:TTCTTCACGCCGCTTGTT; R:TCATTGCTGGAGGATTGC) in translocation line, can amplify the specific band of the about 260bp of hundred Sa couchgrass karyomit(e) 2JS, and lack the specific band of the about 350bp of chromosome of wheat 2BS simultaneously, this mark is to 106 F
2The analysis revealed of individual plant; This mark can be distinguished simultaneously and isozygoty and heterozygosis transposition (Fig.1d), specially changes the qualification result and the cytological Identification result (Fig. 1 b and 1c) in full accord thereof of mark (Xgdm35 and Xgwm257) with utilizing hundred Sa couchgrass karyomit(e) 2JS and chromosome of wheat 2BS simultaneously.
Primer CINAU737 (F:CGTATGGACCGTCTTCACAG; R:ATGCCGCAGATGGAGTTG) in translocation line, can amplify the specific band of hundred Sa couchgrass 2J the short arm of a chromosome 440bp, lack the specific band (plate does not attach) of wheat 2B the short arm of a chromosome 470bp.Primer CINAU807 (F:GACACGGTCTTCCCTGAT; R:AAGGGCTGAAAGTGTTGC) in translocation line, can amplify the specific band of hundred Sa couchgrass 2J the short arm of a chromosome 510bp, and lack the specific band (plate does not attach) of wheat 2B the short arm of a chromosome 470bp.These 2 are marked at 106 F
2Amplification in the individual plant and mark Xcinau696 are identical, disclose these and are marked at transfer and utilize higher utility value among the small segment transposition T2JS-2BS2BL.
Table 1 is followed the trail of the codominant marker of T2JS-2BS2BL translocation line
Table 2 common wheat China spring-hundred Sa couchgrass small segment translocation line NAU2009-1 and China spring type proterties are relatively
Sequence table
SEQUENCE?LISTING
< 110>Agricultural University Of Nanjing
< 120>selection and the molecule marker thereof of common wheat-hundred Sa couchgrass small segment translocation line
< 130>specification sheets
<160>12
<170>PatentIn?version?3.1
<210>1
<211>20
<212>DNA
< 213>manual work
<220>
< 221>mark Xbtd8F
<222>(1)..(20)
<223>
<400>1
gtttggccga?attcacaagt 20
<210>2
<211>20
<212>DNA
< 213>synthetic
<220>
< 221>mark Xbtd8R
<222>(1)..(20)
<223>
<400>2
catgcatgca?gttcctcaag 20
<210>3
<211>20
<212>DNA
< 213>synthetic
<220>
< 221>mark Xgdm35F
<222>(1)..(20)
<223>
<400>3
cctgctctgc?cctagatacg 20
<210>4
<211>20
<212>DNA
< 213>synthetic
<220>
< 221>mark Xgdm35R
<222>(1)..(20)
<223>
<400>4
atgtgaatgt?gatgcatgca 20
<210>5
<211>18
<212>DNA
< 213>synthetic
<220>
< 221>mark Xgwm257F
<222>(1)..(18)
<223>
<400>5
agagtgcatg?gtgggacg 18
<210>6
<211>20
<212>DNA
< 213>synthetic
<220>
< 221>mark Xgwm257R
<222>(1)..(20)
<223>
<400>6
ccaagacgat?gctgaagtca 20
<210>7
<211>18
<212>DNA
< 213>synthetic
<220>
< 221>mark Xcinau696F
<222>(1)..(18)
<223>
<400>7
ttcttcacgc?cgcttgtt 18
<210>8
<211>18
<212>DNA
< 213>synthetic
<220>
<221>CINAU696R
<222>(1)..(18)
<223>
<400>8
tcattgctgg?aggattgc 18
<210>9
<211>20
<212>DNA
< 213>synthetic
<220>
<221>CINAU737F
<222>(1)..(20)
<223>
<400>9
cgtatggacc?gtcttcacag 20
<210>10
<211>17
<212>DNA
< 213>synthetic
<220>
<221>CINAU737R
<222>(1)..(17)
<223>
<400>10
atgccgcagat?ggagttg 17
<210>11
<211>16
<212>DNA
< 213>synthetic
<220>
<221>CINAU807F
<222>(1)..(16)
<223>
<400>11
gacacggtcttc?cctgat 16
<210>12
<211>15
<212>DNA
< 213>synthetic
<220>
<221>CINAU807R
<222>(1)..(15)
<223>
<400>12
aagggctgaaagt?gttgc 15
Claims (4)
1. the selection of common wheat-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL comprises:
(1) molecular marker assisted selection seed selection China spring-hundred Sa couchgrass small segment translocation line
1) China spring-hundred Sa couchgrass addition line TJ04 makes female parent, and the common wheat China spring is done the combination of male parent preparing hybrid, and obtains hybrid F
1, F
2And F
2: 3, extract parents, hybrid F respectively
1And F
2Genomic dna;
2) at first utilize hundred Sa couchgrass karyomit(e) 6JL specially to change mark Xbtd8,
F：GTTTGGCCGAATTCACAAGT；R：CATGCATGCAGTTCCTCAAG
To F
2The karyomit(e) of individual plant is formed and is analyzed, and finds out the individual plant of the hundred Sa couchgrass specific bands that contain the 300bp that Xbtd8 amplifies, and these individual plants contain hundred Sa couchgrass karyomit(e) 6JL;
3) utilize hundred Sa couchgrass karyomit(e) 2JS specially to change mark Xgdm35 again,
F：CCTGCTCTGCCCTAGATACG；R：ATGTGAATGTGATGCATGCA
To F
2Individual plant is analyzed, and finds out the individual plant of the specific band with the about 150bp of hundred Sa couchgrass karyomit(e) 2JS, and these individual plants contain hundred Sa couchgrass karyomit(e) 2JS;
4) result of comprehensive mark Xbtd8 and Xgdm35 is from F
2Filter out the individual plant that contains hundred Sa couchgrass karyomit(e) 2JS and do not contain 6JL in the individual plant, these individual plants are classified as the transposition type;
5) utilize chromosome of wheat 2BS specially to change mark Xgwm257,
F：AGAGTGCATGGTGGG?ACG；R：CCAAGACGATGCTGAAGTCA
Detect the integrity of 2BS in the transposition type individual plant, screening lacks the individual plant of the 240bp amplified band that Xgwm257 produces, and these individual plants are the potential translocation line that isozygotys;
(2) molecular cytology and molecular markers for identification small segment translocation chromosome
The potential that utilizes the cytology method that mark the is selected translocation line that isozygotys carries out evaluation and screening; C-divides band and hundred Sa couchgrass genomic in situ hybridization, Tumor-necrosis factor glycoproteins pSc119.2 and hundred Sa couchgrass genome Two Colour Fluorescence in situ hybridizations through root-tip cells karyomit(e) order; The selection translocation chromosome is long-armed to have and long-armed similar C-band line of China spring karyomit(e) 2B and the hybrid belt line of Tumor-necrosis factor glycoproteins pSC119.2; Divide band band line and this translocation chromosome galianconism only has a chromosome of wheat 2B galianconism near centric C-; In situ hybridization shows the chromatin of this translocation chromosome galianconism 60% from hundred Sa couchgrass, the transposition breakpoint be positioned at the nearly centromere band line of 2BS near; Pollen mother cell chromosomes pairing and setting percentage investigation detect; These translocation line chromosome pairings and setting percentage are all normal; The transposition breakpoint arrives between the disappearance breakpoint FL0.53, between 4 mark Xbarc18, Xbarc230, Xgwm374 and Xgwm429 and other 3 mark Xgwm630, Xgwm319 and Xbarc114 in the 2BS kinetochore;
Is common wheat China spring-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL according to The above results with the translocation line definite designation that obtains, and is numbered NAU2009-1, and its economical character is average plant height 131.88cm; 11.54 of number of productive ears, spike length 11.15cm, 27.51 of spikelet numbers; 77.53 of grain number per spikes, fringe grain weigh 2.07 grams, 189.05 days breeding times; Single-strain grain weight 15.57 grams, thousand seed weight 26.48 grams.
2. be used to the to increase primer CINAU696 of special tracking codominant marker Xcinau696 of claim 1 said common wheat-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL, its sequence is:
F：TTCTTCACGCCGCTTGTT；R：TCATTGCTGGAGGATTGC
This primer can amplify the specific band of the about 260bp of hundred Sa couchgrass karyomit(e) 2JS in translocation line, lack the specific band of the about 350bp of chromosome of wheat 2BS simultaneously.
3. be used to the to increase primer CINAU737 of special tracking codominant marker Xcinau737 of claim 1 said common wheat-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL, its sequence is:
F：CGTATGGACCGTCTTCACAG；R：ATGCCGCAGATGGAGTTG
This primer can amplify the specific band of hundred Sa couchgrass 2J the short arm of a chromosome 440bp in translocation line, lack the specific band of wheat 2B the short arm of a chromosome 470bp;
4. be used to the to increase primer CINAU807 of special tracking codominant marker Xcinau807 of claim 1 said common wheat-hundred Sa couchgrass small segment translocation line T2JS-2BS2BL, its sequence is:
F：GACACGGTCTTCCCTGAT；R：AAGGGCTGAAAGTGTTGC
This primer can amplify the specific band of hundred Sa couchgrass 2J the short arm of a chromosome 510bp in translocation line, and lacks the specific band of wheat 2B the short arm of a chromosome 470bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102343857A CN101792797B (en) | 2009-11-24 | 2009-11-24 | Method for breeding common wheat-thinopyrum bessarabicum small-fragment translocation line and molecular marker thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009102343857A CN101792797B (en) | 2009-11-24 | 2009-11-24 | Method for breeding common wheat-thinopyrum bessarabicum small-fragment translocation line and molecular marker thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101792797A CN101792797A (en) | 2010-08-04 |
| CN101792797B true CN101792797B (en) | 2012-07-04 |
Family
ID=42585711
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009102343857A Expired - Fee Related CN101792797B (en) | 2009-11-24 | 2009-11-24 | Method for breeding common wheat-thinopyrum bessarabicum small-fragment translocation line and molecular marker thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101792797B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104365471B (en) * | 2014-11-06 | 2016-06-15 | 南京农业大学 | One soft, the selection-breeding of mildew-resistance Triticum aestivum-Haynaldia villosa translocation line, authentication method |
| CN105331689B (en) * | 2015-10-27 | 2020-02-04 | 河南科技学院 | Wheat-elytrigia elongata powdery mildew resistant translocation line breeding method and molecular marker thereof |
| CN110055317B (en) * | 2019-04-29 | 2022-04-26 | 中国农业科学院作物科学研究所 | Method for discovering exogenous functional candidate genes in wheat distant hybridization progeny small-fragment translocation line |
| CN113584209A (en) * | 2021-08-06 | 2021-11-02 | 南京农业大学 | Method for identifying wheat dominant variation chromosome and genetic effect thereof |
-
2009
- 2009-11-24 CN CN2009102343857A patent/CN101792797B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| 庄丽芳.普通小麦-百萨偃麦草(Thinopyrum bessarabicum)二体异附加系的选育与鉴定.《遗传学报》.2003,(第10期), * |
| 庄丽芳.普通小麦-百萨偃麦草染色体易位的选育与鉴定.《中国农业科学》.2003,(第12期), * |
| 陈华锋.普通小麦中国春-百萨偃麦草异染色体系的分子标记分析.《作物学报》.2007,(第8期), * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101792797A (en) | 2010-08-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nelson et al. | The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula | |
| Gulsen et al. | A new citrus linkage map based on SRAP, SSR, ISSR, POGP, RGA and RAPD markers | |
| CN102098909B (en) | A method to identify asian soybean rust resistance quantitative trait loci in soybean and compositions thereof | |
| Yang et al. | Rapid development of molecular markers by next-generation sequencing linked to a gene conferring phomopsis stem blight disease resistance for marker-assisted selection in lupin (Lupinus angustifolius L.) breeding | |
| US8367899B2 (en) | Gray leaf spot tolerant maize and methods of production | |
| Chen et al. | Molecular characterization of Haynaldia villosa chromatin in wheat lines carrying resistance to wheat curl mite colonization | |
| Barakat et al. | Assessment of genetic diversity among wheat doubled haploid plants using TRAP markers and morpho-agronomic traits | |
| CN101792797B (en) | Method for breeding common wheat-thinopyrum bessarabicum small-fragment translocation line and molecular marker thereof | |
| CN101440366B (en) | Specific fragment tightly linked to musk melon powdery mildew resistance gene Pm-2F and obtaining method thereof | |
| CN102766697B (en) | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape | |
| Kujane et al. | Genetic diversity analysis of soybean ('Glycine max (L.)'Merr.) genotypes making use of SSR markers | |
| CN105123507A (en) | Scab-resistant gene Fhb7 short-segment translocation line derived from elytrigia elongata and application thereof | |
| Skrzypek et al. | Complex characterization of oat (Avena sativa L.) lines obtained by wide crossing with maize (Zea mays L.) | |
| BRPI1006508B1 (en) | Method of Selecting a Corn Plant | |
| BR112017002448B1 (en) | Method of identification of maize plant with resistance to maize helminthosporiosis and method of introgression of qtl alleles in maize plants | |
| Nkongolo | RAPD variations among pure and hybrid populations of Picea mariana, P. rubens, and P. glauca (Pinaceae), and cytogenetic stability of Picea hybrids: identification of species-specific RAPD markers | |
| Kaur et al. | Molecular characterization of oats (Avena sativa L.) germplasm with microsatellite markers | |
| EP2299803B1 (en) | Genetic loci associated with mechanical stalk strength in maize | |
| CN101368181A (en) | Numerator mark concatenated with rice purple pericladium gene PSH1 (t), acquiring method and application thereof | |
| Framarzpour et al. | Evaluation of genetic diversity of Rapeseed (Brassica napus L.) cultivars using SRAP markers | |
| KR100264743B1 (en) | Map QTL related to cold tolerance at seedling stage of rice using RAPD marker and selection method of cold tolerant rice variety | |
| CN111485032A (en) | Method for identifying cucumber female line and SNP primer combination used by same | |
| Tan et al. | Heterozygosities and genetic relationship of tea cultivars revealed by simple sequence repeat markers and implications for breeding and genetic mapping programs | |
| JP4575613B2 (en) | DNA marker linked to aluminum resistance factor and use thereof | |
| Sharma et al. | Introgression of disease resistance in urdbean (Vigna mungo) by involving its related species |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120704 Termination date: 20131124 |