CN101768591A - Translation adjusting element and application thereof - Google Patents
Translation adjusting element and application thereof Download PDFInfo
- Publication number
- CN101768591A CN101768591A CN200810187701A CN200810187701A CN101768591A CN 101768591 A CN101768591 A CN 101768591A CN 200810187701 A CN200810187701 A CN 200810187701A CN 200810187701 A CN200810187701 A CN 200810187701A CN 101768591 A CN101768591 A CN 101768591A
- Authority
- CN
- China
- Prior art keywords
- seq
- polynucleotide
- polypeptide
- gene
- u2hr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a translation adjusting element for adjusting and controlling gene expression in an mRNA translation level, in particular to a translation adjusting element in hairless gene 5'-UTR and application thereof. The invention also provides a method, oligonucleotide and a kit for diagnosing Marie Unna hereditary hypotrichosis.
Description
Technical field
The present invention relates to be used for translation adjusting element at mRNA translation skill regulate gene expression.Particularly, the present invention relates to translation adjusting element and uses thereof among hairless gene 5 '-UTR.The invention still further relates to the method, oligonucleotide and the test kit that are used to diagnose Marie Unna hereditary hypotrichosis.
Background technology
(hair follicles HF) is growth of hair generating period and the organ that comes off to hair follicle.After the birth, although hair follicle and hair form can change under androgenic effect, hair follicle quantity will no longer increase.The growth of hair is an one-period round-robin process, can be divided into vegetative period or active period (anagen) (following proliferation of cells, migration and differentiation), migratory stage or catagen (catagen) (having significant phenomena of apoptosis) and resting stage (telogen) three phases
[1,2]Can activate hair follicle external root sheath (outer root sheath, the ORS) migration of Nei epithelium multipotential stem cell, and the ball top (hair bulb) that makes new advances of differentiation regeneration from the signal of dermal papilla mesenchymal cell; Ball top will produce new hair
[3]Like this, just reenter next vegetative period hair cycle from resting stage.Overwhelming majority's finding hair clinically loses (as alopecia (alopecia), hairlessness (atrichia) and hypotrichosis disease (hypotrichosis)) and excessive hair growth (hirsutism) all is due to the HF loop cycle gets muddled
[1]Collaborative multiple other factors of Wnt signal path start the newborn of hair follicle and upgrade
[4-8]
Nineteen twenty-six Brooke reported first mouse hairless (Hr) gene mutation body, phenotypic characteristic for when birth hair normal, and the hair not regrowth that begins to come off in birth back causes not having hair
[9]The Hr gene that people such as Thompson in 1996 have cloned mouse shows this gene great expression in skin and cerebral tissue through Northern in situ hybridization
[10]Human Hairless (HR) assignment of genes gene mapping is in karyomit(e) 8p21 zone, 1189 amino acid of encoding, higher with the homology of the Hr gene of mouse and rat, have 81.0% and 81.1% sequence identity respectively, show that this gene is conservative people, mouse, rat camber
[11]A kind of nuclear receptor of HR genes encoding is aporepressor altogether, can directly suppress the expression of Wnt path antagonist Wise and Soggy, thereby regulates HF loop cycle and the required Wnt signal path of HF regeneration activation
[12-14]The HR gene lose the generation that functional sudden change can cause autosomal recessive atrichia congenita (OMIM 203655, and OMIM 209500)
[11,15,16]Marie Unna hereditary hypotrichosis (MUHH; OMIM 146550) be a kind of hair disappearance disease of autosomal dominant inheritance, at first report by German dermatologist Maire Unna, patient characteristic during for birth oligotrichosis or lack as; The Childhood hair thicker, matter is hard and matt; Progressive trichomadesis then takes place pubescence
[17]Domestic and international five research groups utilize the family in different families source that the MUHH locus is positioned karyomit(e) 8p21, but can not determine always whether MUHH is relevant with the HR gene
[18-22]
The change of Disease-causing gene sudden change all can the causing mRNA translation of many heredopathias
[23]In case the translation of ripe mRNA is activated, the many cis-acting elements on the mRNA sequence just begin to regulate albumen synthetic efficient.Many albumen can not merely be the variable shearings by mRNA from a mRNA molecule synthesis, also can realize by the selected text translation initiator codon simultaneously
[24,25]The selection of translation initiation codon and the efficient of translation are subjected to mRNA specificity element, for example 5 '-non-translational region (5 '-untranslated region, regulation and control of 5 '-UTR) GC content, the size of 5 '-UTR and activated upstream initiator codon (uAUG) position in 5 '-UTR.Human all mRNA nearly 50% contain one or more uAUG or upstream open reading frame (upstream open reading frame, uORF)
[26,27]Rule of thumb, uAUG/uORF usually by influence that rrna arrives and initial main opening code-reading frame (main open reading frame, mORF) and the translation efficiency of reduction mORF.Because the change of controlling element (as uAUG/uORF) causes being found in unusually in human inheritance's disease of downstream gene expression on the mRNA molecule.Most human inherited diseases are the sudden changes by the protein-coding region of genes involved, as nonsense mutation, missense mutation, phase shift mutation or because the sudden change of intron causes premessenger RNA (pre-mRNA) processing causes unusually, but constantly there is report to point out to influence the mRNA translation efficiency and the heredopathia that causes by sudden change
[28-30]
The hair follicle of mouse the anagen have transcribing of Hr mRNA, but lack the translation of corresponding protein
[13,31], illustrate that there is the expression regulation of translation skill in this gene.Previous in the MUHH family, all fail to find any disease cause mutation of existing at the HR gene coding region
[18-22]Therefore, can infer the cis-acting elements outside the HR gene coding region, may be the reason that MUHH takes place such as uORF.
Summary of the invention
The present invention is based on following discovery, be some the upstream opening code-reading frames (uORF) among ripe the mRNA 5 '-UTR of people Hairless (HR) gene, be specially the uORF of called after U1HR and U2HR, can regulate the translation of the main opening code-reading frame of its downstream HR gene (mORF).
On the one hand, the invention provides the polynucleotide corresponding to U2HR, it comprises the nucleotide sequence of coding aminoacid sequence shown in SEQ IDNO:1.In a concrete embodiment, described polynucleotide comprise the nucleotide sequence shown in SEQ ID NO:2.
Ground beyond expectation, the inventor finds that this U2HR can suppress the translation of mORF among the target gene mRNA as general translation adjusting element.
Therefore, on the other hand, the invention provides a kind of method that suppresses expression of target gene, it comprises the step that the polynucleotide corresponding to U2HR of the present invention is inserted into 5 ' of target gene-UTR district, and wherein said polynucleotide suppress the translation of the target gene mORF in its downstream as the 5 '-UTR element among the target gene mRNA.For this reason, the present invention also provides a kind of carrier, and it comprises the polynucleotide corresponding to U2HR of the present invention.
On the other hand, the invention provides a peptide species, it comprises the aminoacid sequence shown in SEQ ID NO:1.In addition, the present invention also provides a kind of antibody, its specificity is in conjunction with a peptide species, described polypeptide comprise shown in SEQ ID NO:1 aminoacid sequence or by as described in aminoacid sequence form, perhaps described antibodies specific is in conjunction with by carrying out the polypeptide that one or several amino acid whose replacement, disappearance or interpolation produce in the aminoacid sequence shown in the SEQ ID NO:1.Described antibody is polyclonal antibody or monoclonal antibody.
The inventor also further confirms, the sudden change of U2HR among ripe the mRNA 5 '-UTR of people HR gene can make this U2HR lose function, and then cause that the mORF translation skill improves among the ripe mRNA of HR gene, be the acquisition functional expression of HR gene, and cause Marie Unna hereditary hypotrichosis (MUHH) thus.
Therefore, on the other hand, the invention provides the method that is used to diagnose MUHH, it comprise among the U2HR of ripe the mRNA 5 '-UTR that detects people HR gene or people HR gene corresponding to the step that whether has sudden change in the zone of this U2HR.Described method comprises the step of PCR for example or nucleic acid hybridization.For this reason, the invention provides oligonucleotide, described oligonucleotide can be used as primer and/or probe, is used for the method for diagnosis MUHH of the present invention.
Therefore, the invention provides a kind of oligonucleotide that is used to diagnose MUHH, described oligonucleotide can be used as primer, be used for by PCR method from whole 5 '-UTR of the ripe mRNA of people HR gene or from people HR gene corresponding to the one section nucleotide sequence of specific amplification the zone of this whole 5 '-UTR corresponding to the nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:1.In a concrete embodiment, oligonucleotide of the present invention be positioned at the 1-370 position of SEQ ID NO:5 or one section nucleotide sequence complementation of 476-691 position Nucleotide.By using described oligonucleotide to carry out the nucleotide sequence that amplified production that specific amplification obtains has the aminoacid sequence of coding shown in SEQ ID NO:1, for example has the nucleotide sequence shown in the SEQ ID NO:2; Perhaps described amplified production has the nucleotide sequence of the mutant of the aminoacid sequence shown in the coding SEQ ID NO:1, and described mutant has by carry out the aminoacid sequence that one or several amino acid whose replacement, disappearance or interpolation produce in the aminoacid sequence shown in the SEQ ID NO:1.In a concrete embodiment, described oligonucleotide has the nucleotide sequence that is selected from SEQ ID NO:6 and SEQ ID NO:7.
In addition, the present invention also provides a kind of oligonucleotide, and described oligonucleotide specificity is in conjunction with nucleotide sequence or its mutant shown in SEQ IDNO:2.Described oligonucleotide can be used as probe, is used to diagnose MUHH.
The present invention also provides above-mentioned oligonucleotide to be used for diagnosing the purposes of the diagnostic kit of MUHH and the diagnostic kit that is used to diagnose MUHH that comprises above-mentioned oligonucleotide in preparation.
On the other hand, the invention provides the polynucleotide corresponding to U1HR, it comprises the nucleotide sequence of the aminoacid sequence of coding shown in SEQID NO:3.In a concrete embodiment, described polynucleotide comprise the nucleotide sequence shown in SEQ ID NO:4.
The present invention also provides a kind of method that raises expression of target gene, described method comprises the step that the polynucleotide corresponding to U1HR of the present invention is inserted into 5 ' of target gene-UTR district, and wherein said polynucleotide raise the translation of the target gene mORF in its downstream as the 5 '-UTR element among the target gene mRNA.For this reason, the present invention also provides a kind of carrier, and it comprises the polynucleotide corresponding to U1HR of the present invention.
On the other hand, the present invention also provides a peptide species, and it comprises the aminoacid sequence shown in SEQ ID NO:3.In addition, the present invention also provides a kind of antibody, its specificity is in conjunction with a peptide species, described polypeptide comprises the aminoacid sequence shown in SEQ ID NO:3, and perhaps described antibodies specific combination is by carrying out the polypeptide that one or several amino acid whose replacement, disappearance or interpolation produce in the aminoacid sequence shown in the SEQ ID NO:3.Described antibody is polyclonal antibody or monoclonal antibody.
In addition, the present invention also provides the method for the compound of the translation efficiency that screening can regulate target gene, described method is included in the suitable system, the polynucleotide that make candidate compound and the polypeptide with the aminoacid sequence shown in SEQ ID NO:1 or have a nucleotide sequence shown in SEQ ID NO:2 contact, and screening can strengthen or suppress the compound of ability that described polypeptide or polynucleotide are regulated the translation efficiency of target gene thus.
Description of drawings
Fig. 1: the nucleotide sequence in HR gene 5 '-UTR district.Four uORF difference called after U1HR (dotted line), U2HR (solid line), U3HR (double solid line) and U4HR (double solid line).The aminoacid sequence of inferring of U1HR and U2HR represents that with single-letter the mORF of HR gene illustrates last six Nucleotide of initial sum with box indicating.
Fig. 2: the comparison of 15 kinds of Mammals U2HR nucleotide sequences.Identical Nucleotide represented in asterisk.
Fig. 3: U2HR is to the restraining effect of downstream HR gene mORF translation.(a) diagram has the HR-luciferase reporting carrier of HR gene 5 '-UTR, and the plain enzymic activity of the relative fluorescence of wild-type (WT) and mutant.Four kinds of mutant are the sudden change of the T of ATG initiator codon to C, are expressed as U1HRm, U2HRm, U3HRm and U4HRm respectively.(b) diagram has the HR-EGFP expression vector of HR gene 5 '-UTR and the expression analysis of U1HRm and U2HRm mutant.Bottom left: the HR-EGFP mRNA expression level that records behind real-time quantitative RT-PCR (qRT-PCR) prompting HeLa cell transfecting WT, U1HRm or the U2HRm carrier is similar.Down: behind immunoblotting prompting cell transfecting U1HRm and the U2HRm mutant, the pattern that the HR-EGFP protein level changes.Bottom right: behind cell transfecting U1HRm and the U2HRm mutant, the relative wild-type of HR-EGFP protein expression level is respectively 0.56 and 2.91.These changes are consistent with the uciferase activity of HR-luciferase.(c) detection of U1HR and U2HR convertibility.A left side: expression vector U2HRno-stop and U2HRno-stop that diagram makes up.In: immunoblotting explanation fusion rotein has comparison according to the higher molecular weight level of EGFP.Right: anti--U2HR polyclonal antibody has confirmed the translation of U2HR-EGFP fusion rotein.
The restraining effect to HR gene downstream mORF translation has been eliminated in the sudden change of Fig. 4: U2HR.(a) the transfection cell that has a HR-luciferase reporting carrier of various U2HR sudden change all presents the enhanced uciferase activity.(b) the transfection cell fluorescence strength of signal that has a HR-EGFP carrier of various U2HR sudden change all strengthens.(c) the transfection cell that has a HR-EGFP carrier of various U2HR sudden change have the relative HR-EGFP mRNA expression level similar with wild-type (WT) construct (on), but have enhanced HR-EGFP protein expression level (neutralization time).Among the figure: WT: wild-type; M1:c.2T＞C (p.0); M2:c.104A＞G (p.X35Wext1163X); M3:c.7C＞T (p.Q3X); M4:c.71T＞A (p.I24N); M5:c.73C＞G (p.P25A); M6:c.82G＞C (p.D28H); M7:c.76G＞A (p.E26K).
Fig. 5: wild-type U2HR is to the restraining effect of downstream luciferase gene translation.The plain enzymic activity of the relative fluorescence of transfection pcDNA3.1-Luc plasmid reaches 497.5, and the plain enzymic activity of the relative fluorescence of transfection pcDNA3.1-U2HR-Luc plasmid only has 61.8, and prompting U2HR is to downstream luciferase gene translation had strong inhibitory effects.
Fig. 6: wild-type U2HR is to the restraining effect of downstream EGFP gene translation.Compare with empty carrier pEGFP-N1 (Clontech), the EGFP expression amount of pEGFP-N1-U2HR significantly reduces, and has illustrated that U2HR significantly suppresses the translation of downstream EGFP gene.
Embodiment
In the present invention, term " 5 '-UTR ", i.e. " 5 ' non-translational region ", be called " leader sequence (leadersequence) " again, be meant ripe mRNA and the coding described ripe mRNA dna sequence dna in Special Areas, it starts from transcription initiation site, and terminates in initiator codon (normally AUG) front end of coding region, downstream.
Generally, 5 '-UTR negativity regulation and control downstream gene expression, rrna be incorporated into the cap sequence of 5 '-UTR and along 5 ' to 3 ' direction slip scan AUG initiator codon.Therefore, mORF upstream uAUG can be discerned by rrna and/or initial translation, thereby regulates the translation skill of mORF, and this regulatory mechanism is confirmed in the pathogeny of the human inherited disease of minority
[28-30]
In the present invention, term " uORF ", i.e. " upstream opening code-reading frame (upstream open readingframe) ", be meant the reading frame that exists in 5 ' of ripe mRNA-UTR district, it has initiator codon AUG and terminator codon UAG or UAA or UGA feature, can translate into corresponding peptide molecule according to the coding triplet sub-rule.
In the present invention, term " mORF ", i.e. " main opening code-reading frame (main open readingframe) ", be meant for uORF, gene is translated by this reading frame (mORF) under physiological condition, so mORF can be described as real opening code-reading frame (genuine open reading frame) or physiological opening code-reading frame (physiological open reading frame) again.
On the basis of bioinformatic analysis, the inventor adopts the linkage analysis method that the Disease-causing gene of MUHH is positioned in the zone of karyomit(e) 8p21, and candidate gene FGF17, HR in the described zone and FAM160B2 carried out Mutation Screening, the result has only found disease cause mutation in HR gene 5 '-UTR district.
The inventor carries out sequential analysis by bioinformatics method, and employing RT-polymerase chain reaction (reverse transcription-polymerase chain reaction, RT-PCR), 5 '-UTR of HR gene is upstream extended to 691nt, and at four uORF of this area discover.As shown in Figure 1, according to 5 ' to 3 ' direction these four uORF are distinguished called after U1HR, U2HR, U3HR and U4HR.Wherein U2HR has the nucleotide sequence shown in SEQ ID NO:2, infers its a kind of 34 amino acid whose polypeptide that have of encoding, and described amino acid sequence of polypeptide is shown in SEQ ID NO:1; U1HR has the nucleotide sequence shown in SEQ ID NO:4, infers its a kind of 16 amino acid whose polypeptide that have of encoding, and described amino acid sequence of polypeptide is shown in SEQ ID NO:3; U3HR has the nucleotide sequence shown in SEQ IDNO:8; U4HR has the nucleotide sequence shown in SEQ ID NO:9.
Find that by the sequence conservation analysis in numerous Mammalss, U1HR, U2HR and U4HR are very conservative on sequence itself and sequence size.Wherein U2HR is particularly conservative, in 15 kinds of known peptide sequences coded by mammiferous U2HR, 31 amino acid (Fig. 2) in full accord is arranged.
Discover that further some uORF among ripe the mRNA 5 '-UTR of people HR gene are specially U1HR and U2HR, can regulate the translation of its downstream HR gene mORF.Wherein the sudden change of U2HR can make this U2HR lose function, and then causes that the mORF translation skill improves among the ripe mRNA of HR gene, i.e. the acquisition functional expression of HR gene, and cause MUHH thus.
Based on above-mentioned discovery, can diagnose MUHH from the nucleotide sequence of the U2HR in patient's the biological sample or by the sudden change on its amino acid sequence coded by measuring.
Therefore, on the one hand, the invention provides a kind of polynucleotide, it comprises the nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:1, perhaps is made up of the nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:1.In a concrete embodiment, described polynucleotide comprise the nucleotide sequence shown in SEQ ID NO:2.In another concrete embodiment, described polynucleotide are made up of the nucleotide sequence shown in the SEQ ID NO:2.
As mentioned above, the sudden change of the U2HR among ripe the mRNA 5 '-UTR of people HR gene can cause the downstream mORF translation skill among the mRNA to improve, and causes the acquisition functional expression of HR gene, and causes MUHH.Therefore, the invention provides the method that is used to diagnose MUHH, it comprise among the U2HR of ripe the mRNA 5 '-UTR that detects people HR gene or people HR gene corresponding to the step that whether has sudden change in the zone of this U2HR.Described sudden change comprises the sudden change that example is as shown in table 2.Described method comprises the step of PCR for example or nucleic acid hybridization.For this reason, the invention provides oligonucleotide, described oligonucleotide can be used as primer and/or probe, is used for the method for diagnosis MUHH of the present invention.For this reason, the invention provides a kind of oligonucleotide that is used to diagnose MUHH, described oligonucleotide can be used as, for example, primer, be used for by PCR method from whole 5 '-UTR of the ripe mRNA of people HR gene or from people HR gene corresponding to the one section nucleotide sequence of specific amplification the zone of this whole 5 '-UTR corresponding to the nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:1.In a concrete embodiment, oligonucleotide of the present invention be positioned at the 1-370 position of SEQ ID NO:5 or one section nucleotide sequence complementation of 476-691 position Nucleotide, the length of this section nucleotide sequence for example is 10 to 50 Nucleotide, is preferably 18 to 25 Nucleotide.By using described oligonucleotide to carry out the nucleotide sequence that amplified production that specific amplification obtains has the aminoacid sequence of coding shown in SEQ ID NO:1, for example has the nucleotide sequence shown in the SEQ ID NO:2; Perhaps described amplified production has the nucleotide sequence of the mutant of the aminoacid sequence shown in the coding SEQ ID NO:1, and described mutant has by carry out the aminoacid sequence that one or several amino acid whose replacement, disappearance or interpolation produce in the aminoacid sequence shown in the SEQ ID NO:1.The length of described oligonucleotide is about 10 to 50 Nucleotide, is preferably 18 to 25 Nucleotide.In a concrete embodiment, described oligonucleotide has the nucleotide sequence that is selected from SEQ ID NO:6 and SEQ ID NO:7.
In addition, the present invention also provides a kind of oligonucleotide, and described oligonucleotide specificity is in conjunction with nucleotide sequence or its mutant shown in SEQ IDNO:2.Described oligonucleotide can be used as probe, is used to diagnose MUHH.
The present invention also provides aforesaid oligonucleotide to be used for diagnosing the purposes of the diagnostic kit of MUHH and the diagnostic kit that is used to diagnose MUHH that comprises aforesaid oligonucleotide in preparation.
The inventor regulates and control the translation of HR gene in the peptide negativity of this presentation of results U2HR that provides coding, and proposes to exist in the human genetic disease the unusual of sequence dependent uORF regulatory function first.The inventor has confirmed further that also all among the U2HR lose the raising that functional sudden change can cause HR gene mORF translation skill, has illustrated that the molecular mechanism that causes MUHH is the acquired functional expression of HR gene.
Moreover, the inventor finds also beyond expectationly, a uORF among ripe the mRNA5 '-UTR of people HR gene, and promptly U2HR can suppress the translation of the downstream mORF among the target gene mRNA as general translation adjusting element.
The destruction of uORF is human genetic disease's a kind of new sudden change mechanism
[23,28]UORF is very common in human mRNA's 5 '-UTR district
[32,33], length on average contains 4 uORF greater than the mankind 5 '-UTR of 400nt
[32]Most inhibition uORF may be merely by hindering the initiator codon that rrna arrives downstream mORF
[34]And some human genetic disease, for example in heredity thrombocytosis and familial cutaneous melanoma case
[29,30], lose or a newborn inhibition uORF can cause obtaining functional respectively and loses functional effect.
Therefore, on the other hand, the invention provides a kind of method that suppresses expression of target gene, it comprises the translation of using inhibition 5 '-UTR element to suppress the downstream mORF among the target gene mRNA.In one embodiment, the invention provides a kind of method that suppresses expression of target gene, it comprises the step that the polynucleotide corresponding to U2HR of the present invention is inserted into 5 ' of target gene-UTR district, wherein said polynucleotide suppress the translation of the target gene mORF in its downstream as the 5 '-UTR element among the target gene mRNA, and described polynucleotide comprise the nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:1.For this reason, the present invention also provides a kind of carrier, and it comprises the polynucleotide corresponding to U2HR of the present invention.In one embodiment, described carrier is a gene therapy vector.
In another embodiment, the invention provides a kind of method that suppresses expression of target gene, it comprises that use is suppressed the translation of the downstream mORF among the target gene mRNA by the polynucleotide encoded polypeptide corresponding to U2HR of the present invention.For this reason, the present invention also provides a peptide species, its comprise shown in SEQ ID NO:1 aminoacid sequence or by as described in aminoacid sequence form.
In addition, the present invention also provides a kind of antibody, its specificity is in conjunction with a peptide species, described polypeptide comprise shown in SEQ ID NO:1 aminoacid sequence or by as described in aminoacid sequence form, perhaps described antibodies specific is in conjunction with by carrying out the polypeptide that one or several amino acid whose replacement, disappearance or interpolation produce in the aminoacid sequence shown in the SEQ ID NO:1.Antibody of the present invention can be used for regulating the translation efficiency of target gene.Antibody of the present invention can be polyclonal antibody or monoclonal antibody.In a concrete embodiment, described target gene is the HR gene.
On the other hand, the present invention also provides a kind of pharmaceutical composition, and it comprises a peptide species, described polypeptide comprise shown in SEQ ID NO:1 aminoacid sequence or by as described in aminoacid sequence form.On the other hand, the present invention also provides a kind of pharmaceutical composition, and it comprises antibody of the present invention.On the other hand, the present invention also provides a kind of pharmaceutical composition, and it comprises polynucleotide of the present invention.
The present invention also provides the method for the compound of the translation efficiency that screening can regulate target gene, described method is included in the suitable system, the polynucleotide that make candidate compound and the polypeptide with the aminoacid sequence shown in SEQ ID NO:1 or have a nucleotide sequence shown in SEQ ID NO:2 contact, and screening can strengthen or suppress the compound of ability that described polypeptide or polynucleotide are regulated the translation efficiency of target gene thus.Suitable system for example comprises employed system among this specification sheets embodiment.
The inventor's result has confirmed that the sudden change that causes MUHH occurs over just among the inhibition U2HR, but this can not get rid of with the individuality of other hair phenotypic correlations in the effect brought into play of the active U1HR of positivity.
On the other hand, the invention provides the polynucleotide corresponding to U1HR, it comprises the nucleotide sequence of the aminoacid sequence of coding shown in SEQID NO:3.In a concrete embodiment, described polynucleotide comprise the nucleotide sequence shown in SEQ ID NO:4.
The present invention also provides a kind of method that raises expression of target gene, described method comprises the step that the polynucleotide corresponding to U1HR of the present invention is inserted into 5 ' of target gene-UTR district, and wherein said polynucleotide raise the translation of the target gene mORF in its downstream as the 5 '-UTR element among the target gene mRNA.For this reason, the present invention also provides a kind of carrier, and it comprises the polynucleotide corresponding to U1HR of the present invention.
On the other hand, the present invention also provides a peptide species, and it comprises the aminoacid sequence shown in SEQ ID NO:3.In addition, the present invention also provides a kind of antibody, its specificity is in conjunction with a peptide species, described polypeptide comprises the aminoacid sequence shown in SEQ ID NO:3, and perhaps described antibodies specific combination is by carrying out the polypeptide that one or several amino acid whose replacement, disappearance or interpolation produce in the aminoacid sequence shown in the SEQ ID NO:3.Described antibody is polyclonal antibody or monoclonal antibody.
Embodiment
The linkage analysis and the Mutation Screening of embodiment 1:MUHH Disease-causing gene
1, linkage analysis
The inventor adopt 18 members' (comprising 11 individualities of getting involved, 3 do not get involved individuality and 4 spouses) blood sample in 1 the 5 generation MUHH of Han nationality family, all patient's sample collecting are all signed Informed Consent Form.Genomic dna extracts according to standard method.In 2 linkage analysises, the inventor has chosen four polymorphic microsatellite markers (ATAAC, D8S405, D8S1786, D8S1733) of HR locus flank and has adopted the MLINK program in the LINKAGE software package to calculate the LOD value from UCSC genome browser (Human Mar.2006 Assembly version).The used parameter of linkage analysis is: autosomal dominant inheritance (autosomal dominant inheritance), complete penetrance (penetrance), zero mutation rate (mutation rate), equivalent sex recombination fraction (male-female recombination rate), equivalent microsatellite allele frequency (microsatellite-allele frequency), the disease gene frequency is 1/10000.Table 1 is the primer sequence of four polypeptide microsatellite markers and the position in genome.
Table 1: the primer sequence of used polypeptide microsatellite marker and the position in genome in the linkage analysis
| Mark | Sequence number | Forward (5 '-3 ') | Oppositely (5 '-3 ') | Initial | Finish |
| ??ATAAC | SEQ ID NO:10 and 11 | ??TCTAGAAACCCGCTGAGAGG | ??CTAGGGTGCATGTGGGTTTC | ??21829927 | ??21830078 |
| ??D8S405 | SEQ ID NO:12 and 13 | ??GGCTGTGGGATATCACTAGAAGG | ??GGTGGGAAAACTGAGGGATTCAC | ??22024661 | ??22024894 |
| ??D8S1786 | SEQ ID NO:14 and 15 | ??CGAAAGATTGAGACCCCAT | ??GTTTCCACACCGAAGCC | ??22489214 | ??22489578 |
| ??D8S1733 | SEQ ID NO:16 and 17 | ??CACAGTCTCAAACTCCTGGG | ??ACGAAAAACCATGAACAAGA | ??22576582 | ??22576836 |
2, Mutation Screening
Above-mentioned desmic region examination 3 known: FGF17, HR in 1 individuality of getting involved of the inventor in above-mentioned Chinese's family and the disease cause mutation of FAM160B2.The exon of FGF17 and FAM160B2 gene and include the subarea all use the polymerase chain reaction (polymerase chain reaction, PCR) amplification; And for the HR gene, the inventor whole genome zone of having increased comprises 16 overlapping fragmentses, directly checks order in the purified back of amplified production.The inventor uses UCSC genome browser (Human Mar.2006 Assembly version) and has detected the genome area (chr8:22,041,880-22,046,879) of 5kb, and concentrates on the 1st exon in No. 8 karyomit(e) HR of the people gene reference sequences.The inventor has selected RefSeq, Human EST and Conservation parameter, and 5 '-UTR of HR gene upstream extended to 691nt, and the ORF Finder instrument of using the NCBI website carries out the uORF prediction in HR gene 5 '-UTR district, at this area discover four uORF, according to 5 ' to 3 ' direction respectively called after U1HR, U2HR, U3HR and U4HR (Fig. 1).
The existence prompting MUHH of 5 '-UTR district uORF of HR gene may be because due to certain suddenlys change among the described uORF.For proving this hypothesis, the inventor at first in described MUHH gets involved individuality examination to U2HR c.2T＞C sudden change, a unique ATG codon among the U2HR has been eliminated in this sudden change, that is may make the protein translation completely dissolve of self.Get involved individual and 617 irrelevant the Hans contrast with primer HRUP3F1:AATCACGGGCTCCTGTTTCC (SEQ ID NO:6) and HRUP3R1:CGTTCTCCCGCTCTGTCTGC (SEQ ID NO:7) and carry out the genome pcr amplification to all, with the checking that suddenlys change of NcoI digestion with restriction enzyme amplified production, the result show described U2HR c.2T＞the C sudden change exists only in the individuality of getting involved.For other MUHH familys individual Mutation Screening of getting involved, adopt above-mentioned same primer to carrying out pcr amplification, product carries out sequence verification with the HRUP3F1 primer.
The inventor also from from 18 familys that are diagnosed as MUHH clinically both domestic and external, comprises that 8 had before been reported the family that interlocks in 8p21
[18-22]In further examination arrived sudden change in the U2HR zone.The detected altogether 13 kinds of different U2HR sudden changes of the MUHH family of all 19 different sourcess are summarized in the table 2.Wherein 7 sudden changes are positioned at initiator codon or the terminator codon of U2HR, cause the translation can not be initial or postpone to stop respectively.Except two nonsense mutations, other all sudden changes are missense mutation.
Such mutation spectrum, particularly missense mutation and postpone the terminator codon sudden change and all point out U2HR a kind of functional polypeptide molecule of may encoding strongly, and the sudden change that causes MUHH be essentially lose functional.In addition, the codon of 24～28 amino acids that are positioned at coding U2HR is all concentrated in all missense mutation, and the importance of corresponding amino-acid residue on function has been described.
The U2HR that shows to find in 2:19 the MUHH family suddenlys change
*1:c.1A on behalf of this sudden change,＞G cause the primary A of U2HR cDNA (being SEQ ID NO:2) to sport G;
*2:c.2T on behalf of this sudden change,＞A cause the deputy T of U2HR cDNA (being SEQ ID NO:2) to sport A, below roughly the same;
On behalf of this sudden change, #1:p.0 cause the U2HR polypeptide not express;
On behalf of this sudden change, #2:p.Q3X influence U2HR polypeptide the 3rd amino acids, and making it by Q-spoiling is X, below roughly the same;
#3:p.X35Qext1263X representative sudden change makes the newborn glutamine amino acid of terminator codon, and down translates by the coding triplet sub-rule subsequently
Embodiment 2:U2HR is to the influence of HR genetic expression
1, clone and mutagenesis
The inventor is at first with oligonucleotide EcoRI-SacII-up:5 '-AGCTGGCATTCCGGTACTGTTGGTAAAGCCAGAATTCGTCTGCAGGACCGCGGCA-3 ', (SEQ ID NO:18) and oligonucleotide EcoRI-SacII-down:5 '-CATGTGCCGCGGTCCTGCAGACGAATTCTGGCTTTACCAACAGTACCGGAATGCC-3 ', the annealing hybridized fragment of (SEQ ID NO:19) is at pGL3-Promoter, (Promega) the HindIII/NcoI site of plasmid is introduced EcoRI and SacII cloning site.The cDNA (TaKaRa) that total RNA (Invitrogen) reverse transcription that-642～+ 81 fragments of HR gene use U2HR-WT-F and U2HR-WT-R primer that (seeing Table 3) extracted from A375 clone (ATCC) subsequently becomes got and be cloned into the pGL3-Promoter plasmid of this transformation for template amplification EcoRI and SacII cloning site produce pGL3-UTR-HR-Luc structure plasmid.The inventor is with 4 uORF in HR gene 5 ' UTR district initiator codon sudden change (ATG sports ACG) separately subsequently, 4 kinds of mutant are expressed as U1HRm, U2HRm, U3HRm and U4HRm respectively, and, comprise 5 kinds of missense mutation: M3 (7C＞T), M4 (71T＞A), M5 (73C＞G), M6 (82G＞C) and M7 (76G＞A) according to 7 kinds among the U2HR shown in the table 2 coding mutation types that cause amino acid change; Initiator codon sudden change M1, i.e. a U2HRm; With a terminator codon sudden change M2 (104A＞G), be inserted in the pGL3-UTR-HR-Luc plasmid by PCR mediated mutagenesis method (all mutagenic primers are listed in the table 3) respectively.These the 7 kinds of mutant of above-mentioned M1-M7 and the U1HRm that are included in respectively in each pGL3-UTR-HR-Luc plasmid are gone into (Neo among the plasmid pEGFP-N1 (Clontech) by EcoR I-Sac II cloning site subclone
rThe ORF upstream is inserted the Flag label and is formed Flag-Neo
rFusion rotein), obtain corresponding 8 kinds of HR-EGFP expression plasmids.The plasmid of all structures all passes through sequence verification.
Table 3:PCR mutagenic primer sequence
2, HR gene 5 '-UTR district uORF is to the influence of downstream mORF expression
UORF is to the influence of HR gene mORF translation
HeLa cell (ATCC) is incubated in the DMEM substratum that contains 10% foetal calf serum, and uses Lipofectamine
TM2000 (Invitrogen) transfection reagent carries out transfection.With the above-mentioned pGL3-UTR-HR-Luc construct difference transfection HeLa cell that has U1HRm, U2HRm, U3HRm and U4HRm, cotransfection pRL-TK renilla luciferase carrier (Promega) is as the internal reference plasmid of markization transfection efficiency simultaneously.After the transfection 24 hours, lysing cell was also measured uciferase activity with reference to Dual Luciferase specification sheets (Promega) on TURNER DESIGN TD20/20 instrument.The experiment triplicate.
Found that only U1HRm and two kinds of sudden changes of U2HRm can significantly change the luciferase relative reactivity.The U1HRm mutant still has about 50% uciferase activity, and (Fig. 3 a), prompting U1HR and U2HR are respectively as a kind of pungency and inhibition translational control element and functionating and the U2HRm mutant makes the activity of luciferase improve about 3 times.
To continue to cultivate 24 hours behind the above-mentioned HR-EGFP construct transfection HeLa cell that has U1HRm and a U2HRm subsequently.Cell washs twice through 4 ℃ of precooling PBS, and usefulness RIPA damping fluid (50mMTris-HCl, pH 7.4,150mM NaCl, 1%NP-40 0.1%SDS) carries out cracking.Protein sample from transfectional cell separates with 12%Novex NuPAGE Tris-Bis glue (Invitrogen), through half-dried electroporation (BioRad) isolating albumen is transferred on the pvdf membrane (Millipore).Blotting membrane is through containing TBST damping fluid (the 10mM Tris of 5% skim-milk, pH 7.5,150mM NaCl, 0.5%Tween-20) after the sealing, (Sigma-Aldrich) hybridize with mouse source anti-FLAG M2 monoclonal antibody (1: 3000), use immunity pure (ImmunoPure) peroxidase coupling goat anti-mouse IgG (1: 3000) probe (Pierce) to hybridize subsequently, use SuperSignal West Femto Maximum SensitivitySubstrate (Pierce) to develop at last.Same trace (MBL) carries out with the anti-GFP monoclonal antibody in mouse source (1: 3000) after with the same blotting membrane of 1%SDS-25mM glycine (pH2.0) buffer solution elution.The results suggest U1HRm mutant of immunoblotting still has about 50% fluorescence activity, and the U2HRm mutant makes fluorescence activity improve about 3 times (Fig. 3 b, in, the right side), this is consistent with described U1HRm and two kinds of mutant results in the luciferase reporting system of U2HRm.
The influence that uORF transcribes HR gene mORF
To continue to cultivate 24 hours behind the above-mentioned HR-EGFP construct transfection HeLa cell that has U1HRm and a U2HRm.Extracting cell total rna (Invitrogen) and reverse transcription is cDNA (TaKaRa).HR-EGFP and FLAG-Neo
rReal-time quantitative RT-PCR (qRT-PCR) detect primer and use Primer Express v2.0 software (Applied Biosystems) and design.It is as follows that the qRT-PCR of HR-EGFP detects primer: GFP-F:5 '-TAAACGGCCACAAGTTCAGC-3 ' (SEQID NO:38), GFP-R:5 '-GGTGGTGCAGATGAACTTCAGG-3 ' (SEQ IDNO:39); FLAG-Neo
rIt is as follows that qRT-PCR detects primer: Neo-F:5 '-CTTGCCGAATATCATGGTGG-3 ' (SEQ ID NO:40), Neo-R:5 '-AAGCTCTTCAGCAATATCACGG-3 ' (SEQ ID NO:41).Each 20 μ l of the every pipe of the reaction system of qPCR comprise 10 μ l SYBR Premix Ex Taq
TM(TaKaRa), the above-mentioned reverse transcription cDNA product (50ng) of 5 μ l and the described primer of 5 μ l (each 500nM), each sample is established four parallel pipes.Be reflected in the Rotor-Gene 6000 real-time rotatable analysers (Corbett Life Science) and carry out, condition is: 95 ℃ of 10min, 95 ℃ 10 seconds/60 ℃ 15 seconds/72 ℃ of 40 round-robin 20 seconds.The expression level of HR-EGFP mRNA Neo on pEGFP-N1 (Clontech) plasmid
rThe marking of mRNA level of genetic expression, relative expression's level determines that according to the comparison Δ Δ CT method in Rotor-Gene 6000 real-time rotatable analyser (Corbett LifeScience) service platforms its reverse transcription product of using transfection wild-type (WT) HR-EGFP plasmid cell source is as standard substance.QRT-PCR experiment repetitive operation three times.Found that two kinds of mutant of described U1HRm and U2HRm do not influence transcribe (Fig. 3 b, the left side) of downstream HR gene mORF.The protein translation of therefore pointing out U1HR and U2HR to encode bioactive peptide and positivity and negativity regulation and control downstream HR physiological mORF respectively.
The detection of U1HR and U2HR convertibility
The structure of U2HRno-stop plasmid also forms to read over the upstream that U2HR is placed EGFP ORF by-642～-220 fragments of inserting HR gene 5 '-UTR district on pEGFP-N1 (Clontech) plasmid and finishes.The U1HRno-stop plasmid then is to be-642～-221 fragment clonings in HR gene 5 '-UTR district to be gone into pEGFP-N1 (Clontech) plasmid behind the CAG to obtain (Fig. 3 c, a left side) by the PCR mediated mutagenesis with the terminator codon TAG mutagenesis of U1HR.This is made up gained plasmid transfection HeLa cell respectively, translation product separately with the anti-GFP monoclonal antibody in mouse source (1: 3000) (MBL) or the anti-U2HR polyclonal antibody in rabbit source (1: 3000) of customization (AbMART) carry out the immunoblotting detection.Immunoblotting explanation fusion rotein has comparison according to the higher molecular weight level of EGFP (Fig. 3 c, in), and the inventor has confirmed the translation (Fig. 3 c, the right side) of U2HR-EGFP fusion rotein with described resisting-U2HR polyclonal antibody simultaneously.
3, U2HR is to the influence of HR genetic transcription
In the HR-EGFP expression analysis, the inventor adopts qRT-PCR to detect the mRNA relative expression level of amalgamation HR-EGFP.Continue to cultivate 24 hours behind the transfection HeLa cell respectively with the above-mentioned HR-EGFP expression plasmid that has the M1-M7 mutant.Extracting cell total rna (Invitrogen) and reverse transcription is cDNA (TaKaRa).HR-EGFP and FLAG-Neo
rQRT-PCR detect primer and use PrimerExpress v2.0 software (Applied Biosystems) and design.It is as follows that the qRT-PCR of HR-EGFP detects primer: GFP-F:5 '-TAAACGGCCACAAGTTCAGC-3 ' (SEQ ID NO:38), GFP-R:5 '-GGTGGTGCAGATGAACTTCAGG-3 ' (SEQ ID NO:39); FLAG-Neo
rIt is as follows that qRT-PCR detects primer: Neo-F:5 '-CTTGCCGAATATCATGGTGG-3 ' (SEQ ID NO:40), Neo-R:5 '-AAGCTCTTCAGCAATATCACGG-3 ' (SEQ ID NO:41).Each 20 μ l of the every pipe of the reaction system of qPCR comprise 10 μ l SYBR Premix Ex Taq
TM(TaKaRa), the above-mentioned reverse transcription cDNA product (50ng) of 5 μ l and the described primer of 5 μ l (each 500nM), each sample is established four parallel pipes.Be reflected in the Rotor-Gene 6000 real-time rotatable analysers (Corbett Life Science) and carry out, condition is: 95 ℃ of 10min, 95 ℃ 10 seconds/60 ℃ 15 seconds/72 ℃ of 40 round-robin 20 seconds.Use Neo on pEGFP-N1 (Clontech) plasmid simultaneously
rThe marking of mRNA level of genetic expression, relative expression's level determines that according to the comparison Δ Δ CT method in Rotor-Gene 6000 real-time rotatable analysers (the Corbett Life Science) service platform its reverse transcription product of using transfection wild-type (WT) HR-EGFP plasmid cell source is as standard substance.QRT-PCR experiment repetitive operation three times.The cell that the visible transfection of result has a HR-EGFP carrier of above-mentioned M1-M7 mutant has the relative HR-EGFP mRNA expression level similar with wild-type (WT) construct (Fig. 4 c, on).These 7 kinds of mutant of described M1-M7 that U2HR is described do not influence downstream HR gene transcription activity.
4, U2HR is to the influence of its downstream HR gene mORF translation
The HR-uciferase activity detects
The HeLa cell cultures and is used Lipofectamine in the DMEM substratum that contains 10% foetal calf serum
TM2000 (Invitrogen) transfection reagent carries out transfection.The various pGL3-UTR-HR-Luc constructs that will have wild-type (WT) and above-mentioned M1-M7 mutant are transfected in the HeLa cell of 24 well culture plates, and cotransfection pRL-TK renilla luciferase carrier (Promega) is as the internal reference plasmid of markization transfection efficiency simultaneously.After the transfection 24 hours, lysing cell was also measured uciferase activity with reference to Dual Luciferase specification sheets (Promega) on TURNER DESIGN TD20/20 instrument.The experiment triplicate.
The result as seen, with respect to the wild-type construct, the plain enzymic activity of the relative fluorescence of the various constructs of described M1-M7 all has in various degree enhancing, and (Fig. 4 is a).
Immunoblotting
The HR-EGFP construct that will have wild-type (WT) and the various mutant of described M1-M7 was transfected into the HeLa cell of 24 well culture plates after 24 hours, cell is through twice of 4 ℃ of precooling PBS washing, with RIPA damping fluid (50mM Tris-HCl, pH 7.4,150mM NaCl, 1%NP-40 0.1%SDS) carries out cracking.Protein sample from transfectional cell separates with 12%Novex NuPAGE Tris-Bis glue (Invitrogen), and through half-dried electroporation (BioRad) isolating albumen is transferred on the pvdf membrane (Millipore).Blotting membrane is through containing TBST damping fluid (the 10mM Tris of 5% skim-milk, pH 7.5,150mMNaCl, 0.5%Tween-20) after the sealing, (Sigma-Aldrich) hybridize with mouse source anti-FLAG M2 monoclonal antibody (1: 3000), use immunity pure (ImmunoPure) peroxidase coupling goat anti-mouse IgG (1: 3000) probe (Pierce) to hybridize subsequently, use SuperSignal West FemtoMaximum Sensitivity Substrate (Pierce) to develop at last.Same trace (MBL) carries out with the anti-GFP monoclonal antibody in mouse source (1: 3000) after with the same blotting membrane of 1%SDS-25mM glycine (pH2.0) buffer solution elution.
As seen the result compares with the wild-type construct, and the green fluorescent protein fluorescence intensity of the various mutant of described M1-M7 obtains enhancing (Fig. 4 b and Fig. 4 c, in, down) in various degree.
Luciferase (Fig. 4 a) and the result of immunoblotting (Fig. 4 b and Fig. 4 c, in, down) illustrated that all U2HR carries out expression regulation in translation skill to the mORF of its downstream HR gene.
Therefore, the inventor has verified the influence to downstream gene mORF expression of HR gene 5 '-UTR district wild-type (WT) and mutant U2HR from gene transcription level and translation skill, the presentation of results of RT-PCR the U2HR of mutant to the not influence of transcribing of downstream gene, and the result of uciferase activity and immunoblotting has all confirmed that from translation skill the U2HR of mutant can eliminate the restraining effect to downstream gene to some extent.
Embodiment 3:U2HR encoded polypeptides molecule has general translation inhibit feature
1, the U2HR encoded peptide is to the restraining effect of downstream luciferase gene translation
Plasmid construction
The inventor at first will have a complete luciferase gene encoding sequence by the HindIII/BamHI double enzyme site from pGL3-promoter plasmid (Promega) fragment cloning is gone into pcDNA3.1 (+) and is formed the pcDNA3.1-Luc construct (Invitrogen).Pass through U2HR-F:5 '-AACGAATTCAAGCTTGCCACCATGGCGCAACCTACG-3 ' (SEQ IDNO:42) and U2HR-R:5 '-AATGAATTCAAGCTTCTAGGGCCGCAGGTT-3 ' (SEQ ID NO:43) primer subsequently to amplifying the U2HR fragment wild-type (WT) the HR-EGFP construct that makes up from the foregoing description 2, and the HindIII point of contact formation pcDNA3.1-U2HR-Luc plasmid of insertion pcDNA3.1-Luc plasmid, the plasmid of all structures all passes through sequence verification.
Uciferase activity detects
The HeLa cell cultures and is used Lipofectamine in the DMEM substratum that contains 10% foetal calf serum
TM2000 (Invitrogen) transfection reagent carries out transfection.PcDNA3.1-Luc and pcDNA3.1-U2HR-Luc construct are each separately transfected in the HeLa cell of 24 well culture plates, described two kinds of plasmids all establish three parallel, simultaneously respectively cotransfection pRL-TK renilla luciferase carrier as the internal reference plasmid of markization transfection efficiency.After the transfection 24 hours, lysing cell was also measured the plain enzymic activity of relative fluorescence with reference to Dual Luciferase specification sheets (Promega) on TURNER DESIGN TD20/20 instrument.The experiment triplicate.
Result (Fig. 5) as seen thus, the plain enzymic activity of the relative fluorescence of transfection pcDNA3.1-Luc plasmid reaches 497.5, and the plain enzymic activity of the relative fluorescence of transfection pcDNA3.1-U2HR-Luc plasmid only has 61.8, and prompting U2HR is to downstream luciferase gene translation had strong inhibitory effects.
2, the U2HR encoded peptide is to the restraining effect of downstream EGFP gene translation
Plasmid construction
The inventor by above-mentioned U2HR-F and U2HR-R primer to from above-mentioned wild-type (WT) HR-EGFP construct, amplifying the U2HR fragment, and the EcoRI point of contact that is inserted into pEGFP-N1 (Clontech) plasmid forms the pEGFP-N1-U2HR plasmid, and constructed plasmid advanced sequence verification.
Immunoblotting
PEGFP-N1 (Clontech) plasmid and pEGFP-N1-U2HR construct transfection HeLa cell are after 24 hours, cell is used RIPA damping fluid (50mM Tris-HCl, pH7.4,150mM NaCl after 4 ℃ of precooling PBS wash twice, 1%NP-40 0.1%SDS) carries out cracking.Protein sample from transfectional cell separates with 12%Novex NuPAGE Tris-Bis glue (Invitrogen), and through half-dried electroporation (BioRad) isolating albumen is transferred on the pvdf membrane (Millipore).Blotting membrane is through containing TBST damping fluid (the 10mM Tris of 5% skim-milk, pH 7.5,150mM NaCl, 0.5%Tween-20) after the sealing, (Sigma-Aldrich) hybridize with mouse source anti-FLAG M2 monoclonal antibody (1: 3000), use immunity pure (ImmunoPure) peroxidase coupling goat anti-mouse IgG (1: 3000) probe (Pierce) to hybridize subsequently, use SuperSignal West Femto Maximum SensitivitySubstrate (Pierce) to develop at last.Same trace (MBL) carries out with the anti-GFP monoclonal antibody in mouse source (1: 3000) after with the same blotting membrane of 1%SDS-25mM glycine (pH2.0) buffer solution elution.
Results suggest is compared with empty carrier pEGFP-N1 (Clontech), and the EGFP expression amount of pEGFP-N1-U2HR significantly reduces (Fig. 6), has illustrated that U2HR significantly suppresses the translation of downstream EGFP gene.
Reference
1.Paus?R，Cotsarelis?G.The?biology?of?hair?follicles.N.Engl.J.Med.341，491-497(1999).
2.Stenn?KS，Paus?R.Controls?of?hair?follicle?cycling.Physiol.Rev.81，449-494(2001).
3.Beaudoin?GM?3rd，Sisk?JM，Coublombe?PA，Thompson?CC.Hair?triggers?reactivation?ofhair?growth?by?pormoting?Wnt?signaling.PNAS?102，14653-14658(2005).
4.Alonso?L，Fuchs?E.Stem?cells?in?the?skin：waste?not，Wnt?not.Genes?Dev.17，1189-1200(2003).
5.Huelsken?J，Vogel?R，Erdmann?B，Cotsarelis?G，Birchmeier?W.beta-Catenin?controls?hairfollicle?morphogenesis?and?stem?cell?differentiation?in?the?skin.Cell?105，533-545(2001).
6.Andl?T，Reddy?ST，Gaddapara?T，Millar?S?E.WNT?signals?are?required?for?the?initiation?ofhair?follicle?development.Dev.Cell?2，643-653(2002).
7.Van?Mater?D，Kolligs?FT，Dlugosz?AA，Fearon?ER.Transient?activation?of?beta-cateninsignaling?in?cutaneous?keratinocytes?is?sufficient?to?trigger?the?active?growth?phase?of?thehair?cycle?in?mice.Genes?Dev.17，1219-1224(2003).
8.Ito?M，Yang?Z，Andl?T，Cui?C，Kim?N，Millar?SE，Cotsarelis?G.Wnt-dependent?de?novohair?follicle?regeneration?in?adμlt?mouse?skin?after?wounding.Nature?447，316-320(2007).
9.Brooke，H.C.Hairless?mice.J.Hered.17：173-174(1926).
10.Thompson，C.C.Thyroid?hormone-responsive?genes?in?developing?cerebellum?include?anovel?synaptotagmin?and?a?hairless?homolog.J.Neurosci.16：7832-7840(1996).
11.Cichon?S，Anker?M，Vogt?IR，Rohleder?H，Pützstück?M，Hillmer?A，Farooq?SA，Al-DhafriKS，Ahmad?M，Haque?S，Rietschel?M，Propping?P，Kruse?R，
MM.Cloning，genomic?organization，alternative?transcripts?and?mutational?analysis?of?the?generesponsible?for?autosomal?recessive?universal?congenital?alopecia.Hum.Mol.Genet.7，1671-1679(1998).
12.Potter?GB，Beaudoin?GM?3rd，DeRenzo?CL，Zarach?JM，Chen?SH，Thompson?CC.Thehairless?gene?mutated?in?congenital?hair?loss?disorders?encodes?a?novel?nuclear?receptorcorepressor.Genes?Dev.15，2687-2701(2001).
13.Beaudoin?GM?3rd，Sisk?JM，Coμlombe?PA，Thompson?CC.Hairless?triggers?reactivationof?hair?growth?by?promoting?Wnt?signaling.Proc.Natl.Acad.Sci?USA.102，14653-14658(2005).
14.Thompson?CC，Sisk?JM，Beaudoin?GM?3rd.Hairless?and?Wnt?signaling：allies?inepithelial?stem?cell?differentiation.Cell?Cycle?5，1913-1917(2006).
15.Ahmad?W，Faiyaz?μl?Haque?M，Brancolini?V，Tsou?HC，μl?Haque?S，Lam?H，Aita?VM，Owen?J，deBlaquiere?M，Frank?J，Cserhalmi-Friedman?PB，Leask?A，McGrath?JA，Peacocke?M，Ahmad?M，Ott?J，Christiano?AM.Alopecia?universalis?associated?with?amutation?in?the?human?hairless?gene.Science?279，720-724(1998).
16.Sprecher?E，Bergman?R，Szargel?R，Friedman-Birnbaum?R，Cohen?N.Identification?of?agenetic?defect?in?the?hairless?gene?in?atrichia?with?papμlar?lesions：evidence?forphenotypic?heterogeneity?among?inherited?atrichias.Am.J.Hum.Genet.64，1323-1329(1999).
17.Unna?M.
hypotrichosis?congenita?hereditaria.Dermatol?Wochenschr.81，1167-1178(1925).
18.van?Steensel?M，Smith?FJ，Steijlen?PM，Kluijt?I，Stevens?HP，Messenger?A，Kremer?H，Dunnill?MG，Kennedy?C，Munro?CS，Doherty?VR，McGrath?JA，Covello?SP，ColemanCM，Uitto?J，McLean?WH.The?gene?for?hypotrichosis?of?Marie?Unna?maps?betweenD8S258?and?D8S298：exclusion?of?the?hr?gene?by?cDNA?and?genomic?sequencing.Am.J.Hum.Genet.65，413-419(1999).
19.Sreekumar?GP，Roberts?JL，Wong?CQ，Stenn?KS，Parimoo?S.Marie?Unna?hereditaryhypotrichosis?gene?maps?to?human?chromosome?8p21?near?hairless.J.Invest.Dermatol.114，595-597(2000).
20.Lefevre?P，Rochat?A，Bodemer?C，Vabres?P，Barrandon?Y，de?Prost?Y，Garner?C，Hovnanian?A.Linkage?of?Marie-Unna?hypotrichosis?locus?to?chromosome?8p21?andexclusion?of?10?genes?including?the?hairless?gene?by?mutation?analysis.Eur.J.Hum.Genet.8，273-279(2000).
21.Cichon?S，Kruse?R，Hillmer?AM，Kukuk?G，Anker?M，Altland?K，Knapp?M，Propping?P，
MM.A?distinct?gene?close?to?the?hairless?locus?on?chromosome?8p?underlieshereditary?Marie?Unna?type?hypotrichosis?in?a?German?family.Br.J.Dermatol.143，811-814(2000).
22.He?PP，Zhang?XJ，Yang?Q，Li?M，Liang?YH，Yang?S，Yan?KL，Cui?Y，Shen?YY，WangHY，Sun?LD，Du?WH，Shen?YJ，Xu?SJ，Huang?W.Refinement?of?a?locus?for?Marie?Unnahereditary?hypotrichosis?to?a?1.1-cM?interval?at?8p21.3.Br.J.Dermatol.150，837-842(2004).
23.Scheper?GC，van?der?Knaap?MS，Proud?CG.Trahslation?matters：protein?synthesis?defectsin?inherited?disease.Nat.Rev.Genet.8，711-723(2007).
24.Ho?O，Green?WR.Alternative?translational?products?and?cryptic?T?cell?epitopes：expectingthe?unexpected.J?Immunol?177：8283-8289.65(2006).
25.Wang?X-Q，Rothnagel?JA.Post-transcriptional?regμlation?of?the?glil?oncogene?by?theexpression?of?alternative?5′untrans-lated?regions.J?Biol?Chem，276：1311-1316(2001).
26.Davμluri?R.V.，Suzuki，Y.，Sugano，S.and?Zhang，M.Q.CART?classification?of?human?5′UTR?sequences.Genome?Res.，10：，1807-1816(2000).
27.Pesole?G，Gissi，C，Grillo，G，Licciμlli，F，Liuni，S?and?Saccone，C.Analysis?ofoligonucleotide?AUG?start?codon?context?in?eukaryotic?mRNAs.Gene，261：，85-91(2000).
28.Cazzola?M，Skoda?RC.Translational?pathophysiology：a?novel?molecμlar?mechanism?ofhuman?disease.Blood?95，3280-3288(2000).
29.Wiestner?A，Schlemper?RJ，van?der?Maas?AP，Skoda?RC.An?activating?splice?donormutation?in?the?thrombopoietin?gene?causes?hereditary?thrombocythaemia.Nat.Genet.18，49-52(1998).
30.Liu?L，Dilworth?D，Gao?L，Monzon?J，Summers?A，Lassam?N，Hogg?D.Mutation?of?theCDKN2A?5′UTR?creates?an?aberrant?initiation?codon?and?predisposes?to?melanoma.Nat.Genet.21，128-132(1999).
31.Panteleyev?AA，Paus?R，Christiano?AM.Patterns?of?hairless(hr)gene?expression?inmouse?hair?follicle?morphogenesis?and?cycling.Am.J.Pathol.157，1071-1079(2000).
32.Iacono?M，Mignone?F，Pesole?G.uAUG?and?uORFs?in?human?and?rodent?5′untranslatedmRNAs.Gene?349，97-105(2005).
33.Churbanov?A，Rogozin?IB，Babenko?VN，Ali?H，Koonin?EV.Evolutionary?conservationsuggests?a?regμlatory?function?of?AUG?triplets?in?5′-UTRs?of?eukaryotic?genes.NucleicAcids?Res.33，5512-5520(2005).
34.Sachs?MS，Geballe?AP.Downstream?control?of?upstream?open?reading?frames.Genes?Dev.20，915-921(2006).
Sequence table
＜110〉Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences
＜120〉translation adjusting element and uses thereof
<130>I200801851CB
<160>45
<170>PatentIn?version?3.3
<210>1
<211>34
<212>PRT
<213>Homo?sapiens
<400>1
Met?Ala?Gln?Pro?Thr?Ala?Ser?Ala?Gln?Lys?Leu?Val?Arg?Pro?Ile?Arg
1???????????????5???????????????????10??????????????????15
Ala?Val?Cys?Arg?Ile?Leu?Gln?Ile?Pro?Glu?Ser?Asp?Pro?Ser?Asn?Leu
20??????????????????25??????????????????30
Arg?Pro
<210>2
<211>105
<212>DNA
<213>Homo?sapiens
<400>2
atggcgcaac?ctacggcctc?ggcccagaag?ctggtgcggc?cgatccgcgc?cgtgtgccgc?????60
atcctgcaga?tcccggagtc?cgacccctcc?aacctgcggc?cctag????????????????????105
<210>3
<211>16
<212>PRT
<213>Homo?sapiens
<400>3
Met?Ala?Ile?Arg?Gly?Pro?Ala?Ala?Leu?Ser?Ala?Ala?Leu?Tyr?Leu?His
1???????????????5???????????????????10??????????????????15
<210>4
<211>51
<212>DNA
<213>Homo?sapiens
<400>4
atggcgatca?gaggtcctgc?tgcgctctcc?gccgcgctct?acctccatta?g??????????????51
<210>5
<211>691
<212>DNA
<213>Homo?sapiens
<400>5
gaatcacggg?ctcctgtttc?ccgcagggtg?ctggaggagg?aaaccggcgg?agcagcttcc?????60
ccactctcag?ttgcgcttct?ggcgatggcg?atcagaggtc?ctgctgcgct?ctccgccgcg????120
ctctacctcc?attagccgcg?ctgcgcggtg?ctgcgccctc?gccggtgcct?ctctcctggg????180
tcccaggatc?ggcccccacc?atccaggcac?gacccccttc?cccggcccct?cggcctttcc????240
cccaactcgg?ccatctccga?cccggggcgc?gtgttccccc?cggcccggcg?ccttctctcc????300
ctccgggggc?acccgctccc?tagccccggc?ccggccctcc?ccgcggcgca?gcacggagtc????360
tcggcgtccc?atggcgcaac?ctacggcctc?ggcccagaag?ctggtgcggc?cgatccgcgc????420
cgtgtgccgc?atcctgcaga?tcccggagtc?cgacccctcc?aacctgcggc?cctagagcgc????480
ccccgccgcc?ccgggggaag?gagagcgcga?gcgcgctgag?cagacagagc?gggagaacgc????540
gtcctcgccc?gccggccggg?aggccccgga?gctggcccat?ggggagcagg?cgcccggtgc????600
cggccacgac?gaccgccacc?gcccgcgccg?cgaccggccg?gtgaagccca?gggacccccc????660
tctgggagag?ccccatgagg?gcaggagagt?g???????????????????????????????????691
<210>6
<211>20
<212>DNA
<213>Artificial
<220>
<223>HRUP3F1
<400>6
aatcacgggc?tcctgtttcc?????????????????????????????????????????????????20
<210>7
<211>20
<212>DNA
<213>Artificial
<220>
<223>HRUP3R1
<400>7
cgttctcccg?ctctgtctgc?????????????????????????????????????????????????20
<210>8
<211>66
<212>DNA
<213>Homo?sapiens
<400>8
atggggagca?ggcgcccggt?gccggccacg?acgaccgcca?ccgcccgcgc?cgcgaccggc?????60
cggtga????????????????????????????????????????????????????????????????66
<210>9
<211>17
<212>DNA
<213>Homo?sapiens
<400>9
atgagggcag?gagagtg????????????????????????????????????????????????????17
<210>10
<211>20
<212>DNA
<213>Artificial
<220>
<223>ATAAC?F
<400>10
tctagaaacc?cgctgagagg?????????????????????????????????????????????????20
<210>11
<211>20
<212>DNA
<213>Artificial
<220>
<223>ATAAC?R
<400>11
ctagggtgca?tgtgggtttc?????????????????????????????????????????????????20
<210>12
<211>23
<212>DNA
<213>Artificial
<220>
<223>D8S405F
<400>12
ggctgtggga?tatcactaga?agg?????????????????????????????????????????????23
<210>13
<211>23
<212>DNA
<213>Artificial
<220>
<223>D8S405R
<400>13
ggtgggaaaa?ctgagggatt?cac?????????????????????????????????????????????23
<210>14
<211>19
<212>DNA
<213>Artificial
<220>
<223>D8S1786F
<400>14
cgaaagattg?agaccccat??????????????????????????????????????????????????19
<210>15
<211>17
<212>DNA
<213>Artificial
<220>
<223>D8S1786R
<400>15
gtttccacac?cgaagcc????????????????????????????????????????????????????17
<210>16
<211>20
<212>DNA
<213>Artificial
<220>
<223>D8S1733F
<400>16
cacagtctca?aactcctggg?????????????????????????????????????????????????20
<210>17
<211>20
<212>DNA
<213>Artificial
<220>
<223>D8S1733R
<400>17
acgaaaaacc?atgaacaaga?????????????????????????????????????????????????20
<210>18
<211>55
<212>DNA
<213>Artificial
<220>
<223>EcoRI-SacII-up
<400>18
agctggcatt?ccggtactgt?tggtaaagcc?agaattcgtc?tgcaggaccg?cggca??????????55
<210>19
<211>55
<212>DNA
<213>Artificial
<220>
<223>EcoRI-SacII-down
<400>19
catgtgccgc?ggtcctgcag?acgaattctg?gctttaccaa?cagtaccgga?atgcc??????????55
<210>20
<211>28
<212>DNA
<213>Artificial
<220>
<223>U1HRm-F
<400>20
gttgcgcttc?tggcgacggc?gatcagag????????????????????????????????????????28
<210>21
<211>28
<212>DNA
<213>Artificial
<220>
<223>U1HRm-R
<400>21
ctctgatcgc?cgtcgccaga?agcgcaac????????????????????????????????????????28
<210>22
<211>24
<212>DNA
<213>Artificial
<220>
<223>U3HRm-F
<400>22
cccggagctg?gcccacgggg?agca????????????????????????????????????????????24
<210>23
<211>24
<212>DNA
<213>Artificial
<220>
<223>U3HRm-R
<400>23
tgctccccgt?gggccagctc?cggg????????????????????????????????????????????24
<210>24
<211>25
<212>DNA
<213>Artificial
<220>
<223>U4HRm-F
<400>24
gggagagccc?cacgagggca?ggaga???????????????????????????????????????????25
<210>25
<211>25
<212>DNA
<213>Artificial
<220>
<223>U4HRm-R
<400>25
tctcctgccc?tcgtggggct?ctccc???????????????????????????????????????????25
<210>26
<211>27
<212>DNA
<213>Artificial
<220>
<223>U2HR-7C＞T-F
<400>26
gcgtcccatg?gcgtaaccta?cggcctc?????????????????????????????????????????27
<210>27
<211>27
<212>DNA
<213>Artificial
<220>
<223>U2HR-7C＞T-R
<400>27
gaggccgtag?gttacgccat?gggacgc?????????????????????????????????????????27
<210>28
<211>27
<212>DNA
<213>Artificial
<220>
<223>U2HR-71T＞A-F
<400>28
gtgccgcatc?ctgcagaacc?cggagtc?????????????????????????????????????????27
<210>29
<211>27
<212>DNA
<213>Artificial
<220>
<223>U2HR-71T＞A-R
<400>29
gactccgggt?tctgcaggat?gcggcac?????????????????????????????????????????27
<210>30
<211>27
<212>DNA
<213>Artificial
<220>
<223>U2HR-73C＞G-F
<400>30
catcctgcag?atcgcggagt?ccgaccc?????????????????????????????????????????27
<210>31
<211>27
<212>DNA
<213>Artificial
<220>
<223>U2HR-73C＞G-R
<400>31
gggtcggact?ccgcgatctg?caggatg?????????????????????????????????????????27
<210>32
<211>25
<212>DNA
<213>Artificial
<220>
<223>U2HR-82G＞C-F
<400>32
atcccggagt?cccacccctc?caacc???????????????????????????????????????????25
<210>33
<211>25
<212>DNA
<213>Artificial
<220>
<223>U2HR-82G＞C-R
<400>33
ggttggaggg?gtgggactcc?gggat???????????????????????????????????????????25
<210>34
<211>27
<212>DNA
<213>Artificial
<220>
<223>U2HR-76G＞A-F
<400>34
cctgcagatc?ccgaagtccg?acccctc?????????????????????????????????????????27
<210>35
<211>27
<212>DNA
<213>Artificial
<220>
<223>U2HR-76G＞A-R
<400>35
gaggggtcgg?acttcgggat?ctgcagg?????????????????????????????????????????27
<210>36
<211>20
<212>DNA
<213>Artificial
<220>
<223>GFP-F
<400>36
taaacggcca?caagttcagc?????????????????????????????????????????????????20
<210>37
<211>22
<212>DNA
<213>Artificial
<220>
<223>GFP-R
<400>37
ggtggtgcag?atgaacttca?gg??????????????????????????????????????????????22
<210>38
<211>20
<212>DNA
<213>Artificial
<220>
<223>Neo-F
<400>38
cttgccgaat?atcatggtgg?????????????????????????????????????????????????20
<210>39
<211>22
<212>DNA
<213>Artificial
<220>
<223>Neo-R
<400>39
aagctcttca?gcaatatcac?gg??????????????????????????????????????????????22
<210>40
<211>36
<212>DNA
<213>Artificial
<220>
<223>U2HR-F
<400>40
aacgaattca?agcttgccac?catggcgcaa?cctacg???????????????????????????????36
<210>41
<211>30
<212>DNA
<213>Artificial
<220>
<223>U2HR-R
<400>41
aatgaattca?agcttctagg?gccgcaggtt??????????????????????????????????????30
<210>42
<211>33
<212>DNA
<213>Artificial
<220>
<223>U2HR-WT-F
<400>42
gcgaattcga?gcagcttccc?cactctcagt?tgc??????????????????????????????????33
<210>43
<211>23
<212>DNA
<213>Artificial
<220>
<223>U2HR-WT-R
<400>43
ctttcaggtg?tcagaatgtg?tgg?????????????????????????????????????????????23
<210>44
<211>21
<212>DNA
<213>Artificial
<220>
<223>U2HRm/M1-F
<400>44
gcgtcccacg?gcgcaaccta?c???????????????????????????????????????????????21
<210>45
<211>21
<212>DNA
<213>Artificial
<220>
<223>U2HRm/M1-R
<400>45
gtaggttgcg?ccgtgggacg?c???????????????????????????????????????????????21
Claims (22)
1. polynucleotide, it comprises the nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:1.
2. the polynucleotide of claim 1, it comprises the nucleotide sequence shown in SEQ ID NO:2.
3. claim 1 or 2 polynucleotide, it is a translation adjusting element.
4. method that suppresses expression of target gene, described method comprises the step that each polynucleotide in the claim 1 to 3 is inserted into 5 ' of target gene-UTR district, and wherein said polynucleotide suppress the translation of the target gene mORF in its downstream as the 5 '-UTR element among the target gene mRNA.
5. carrier, it comprises in the claim 1 to 3 each polynucleotide.
6. a peptide species, it comprises the aminoacid sequence shown in SEQ ID NO:1.
7. antibody, its specificity are in conjunction with the polypeptide that is selected from as next group:
A) comprise the polypeptide of the aminoacid sequence shown in the SEQ ID NO:1;
B) polypeptide of forming by the aminoacid sequence shown in the SEQ ID NO:1; With
C) by in the aminoacid sequence shown in the SEQ ID NO:1, carrying out the polypeptide that one or several amino acid whose replacement, disappearance or interpolation produce.
8. oligonucleotide that is used to diagnose Marie Unna hereditary hypotrichosis, described oligonucleotide be positioned at the 1-370 position of SEQ ID NO:5 or one section nucleotide sequence complementation of 476-691 position Nucleotide.
9. the oligonucleotide of claim 8, it has the nucleotide sequence that is selected from SEQ ID NO:6 and SEQ ID NO:7.
10. oligonucleotide that is used to diagnose Marie Unna hereditary hypotrichosis, described oligonucleotide specificity is in conjunction with nucleotide sequence or its mutant shown in SEQ ID NO:2.
11. each oligonucleotide is used for diagnosing the purposes of the diagnostic kit of Marie Unna hereditary hypotrichosis in the claim 8 to 10 in preparation.
12. a diagnostic kit that is used to diagnose Marie Unna hereditary hypotrichosis, it comprises in one or more claim 8 to 10 each oligonucleotide.
13. polynucleotide, it comprises the nucleotide sequence of the aminoacid sequence of coding shown in SEQ ID NO:3.
14. the polynucleotide of claim 13, it comprises the nucleotide sequence shown in SEQ ID NO:4.
15. the polynucleotide of claim 13 or 14, it is a translation adjusting element.
16. method that raises expression of target gene, described method comprises the step that each polynucleotide in the claim 13 to 15 is inserted into 5 ' of target gene-UTR district, and wherein said polynucleotide raise the translation of the target gene mORF in its downstream as the 5 '-UTR element among the target gene mRNA.
17. a carrier, it comprises in the claim 13 to 15 each polynucleotide.
18. a peptide species, it comprises the aminoacid sequence shown in SEQ ID NO:3.
19. an antibody, its specificity combination is selected from the polypeptide as next group:
A) comprise the polypeptide of the aminoacid sequence shown in the SEQ ID NO:3;
B) polypeptide of forming by the aminoacid sequence shown in the SEQ ID NO:3; With
C) by in the aminoacid sequence shown in the SEQ ID NO:3, carrying out the polypeptide that one or several amino acid whose replacement, disappearance or interpolation produce.
20. screen the method for the compound of the translation efficiency that can regulate target gene, described method is included in the suitable system, the polynucleotide that make candidate compound and the polypeptide with the aminoacid sequence shown in SEQ ID NO:1 or have a nucleotide sequence shown in SEQ ID NO:2 contact, and screening can strengthen or suppress the compound of ability that described polypeptide or polynucleotide are regulated the translation efficiency of target gene thus.
21. a pharmaceutical composition, it comprises in the claim 1 to 3 each polynucleotide, the carrier of claim 5, the polypeptide of claim 6 or the antibody of claim 7.
22. a pharmaceutical composition, it comprises in the claim 13 to 15 each polynucleotide, the carrier of claim 17, the polypeptide of claim 18 or the antibody of claim 19.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810187701A CN101768591A (en) | 2008-12-31 | 2008-12-31 | Translation adjusting element and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810187701A CN101768591A (en) | 2008-12-31 | 2008-12-31 | Translation adjusting element and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101768591A true CN101768591A (en) | 2010-07-07 |
Family
ID=42501692
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810187701A Pending CN101768591A (en) | 2008-12-31 | 2008-12-31 | Translation adjusting element and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101768591A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107849574A (en) * | 2015-06-30 | 2018-03-27 | 埃泽瑞斯公司 | Increase the UTR of the translation efficiency of RNA molecule |
| WO2019076355A1 (en) * | 2017-10-19 | 2019-04-25 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Method for regulating gene expression |
| WO2024067747A1 (en) * | 2022-09-30 | 2024-04-04 | 艾斯拓康医药科技(北京)有限公司 | 5'-utr sequence and use thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070136890A1 (en) * | 2003-07-03 | 2007-06-14 | Board Of Trustees Operating Michigan State University | Expression of a recombinant transgene |
| EP2042514A1 (en) * | 2007-09-25 | 2009-04-01 | Life & Brain GmbH | Maintenance of hair growth and treatment of hair-loss |
-
2008
- 2008-12-31 CN CN200810187701A patent/CN101768591A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070136890A1 (en) * | 2003-07-03 | 2007-06-14 | Board Of Trustees Operating Michigan State University | Expression of a recombinant transgene |
| EP2042514A1 (en) * | 2007-09-25 | 2009-04-01 | Life & Brain GmbH | Maintenance of hair growth and treatment of hair-loss |
Non-Patent Citations (1)
| Title |
|---|
| 李俊燕 等: "一遗传性单纯少毛症家系的基因定位", 《中国麻风皮肤病杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107849574A (en) * | 2015-06-30 | 2018-03-27 | 埃泽瑞斯公司 | Increase the UTR of the translation efficiency of RNA molecule |
| US11136585B2 (en) | 2015-06-30 | 2021-10-05 | Ethris Gmbh | UTRs increasing the translation efficiency of RNA molecules |
| WO2019076355A1 (en) * | 2017-10-19 | 2019-04-25 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Method for regulating gene expression |
| US11739313B2 (en) | 2017-10-19 | 2023-08-29 | Institute Of Genetics And Developmental Biology, Chinese Academy Of Sciences | Method for regulating gene expression |
| WO2024067747A1 (en) * | 2022-09-30 | 2024-04-04 | 艾斯拓康医药科技(北京)有限公司 | 5'-utr sequence and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DK2121979T3 (en) | Genetic markers for risk management of cardiac arrhythmia | |
| US9109259B2 (en) | Detection method for novel ROS1 fusions | |
| CN106471134B (en) | Methods and products for quantifying RNA transcript variants | |
| JP2015109806A (en) | Method for detecting new ret fused body | |
| CN105296659B (en) | A kind of gene marker relevant to cerebral arterial thrombosis | |
| JP2003529315A (en) | Components and methods for disease diagnosis and treatment | |
| CA2404448C (en) | Genes involved in intestinal inflammatory diseases and use thereof | |
| WO2001066719A1 (en) | Novel gene cloned in human neuroblastoma and novel gene fragments | |
| US8865880B2 (en) | Identification of a novel BHD gene | |
| Katoh et al. | Identification and characterization of human GUKH2 gene in silico | |
| CN101768591A (en) | Translation adjusting element and application thereof | |
| JP2002345489A (en) | Chemical substance | |
| JP2004187620A (en) | Disorder marker for kidney disease and utilization thereof | |
| CN105296658A (en) | Application of ALKBH2 gene to diagnosis of cerebral ischemic stroke | |
| Huang et al. | Molecular cloning and functional characterization of the mouse mafB gene | |
| CN105543400B (en) | The molecular marker of type-1 diabetes mellitus | |
| DK2220256T3 (en) | An in vitro method for the diagnosis of skin cancer | |
| AU2002224781B2 (en) | Mutations in the ferroportin 1 gene associated with hereditary haemochromatosis | |
| US7112419B2 (en) | Human hepatoma associated protein and the polynucleotide encoding said polypeptide | |
| CN106702003B (en) | Application of HSDL1 in diagnosis and treatment of osteosarcoma | |
| CN101245345A (en) | Goat S6K1 gene cDNA encoding zone nucleotide sequence | |
| Nobile et al. | Identification and characterization of a novel human brain-specific gene, homologous to S. scrofa tmp83. 5, in the chromosome 10q24 critical region for temporal lobe epilepsy and spastic paraplegia | |
| JP2011523352A (en) | Anti-HMGA1 monoclonal antibodies, methods for their production and their use for quantification of HMGA1 | |
| EP1641937B1 (en) | Mutations in the slc40a1 gene associated to impaired iron homeostasis | |
| CN114480624A (en) | Stargardt disease mutation detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20100707 |