CN101748144A

CN101748144A - Torch pear haloduric gene PpGST and application thereof

Info

Publication number: CN101748144A
Application number: CN201010100346A
Authority: CN
Inventors: 刘迪秋; 王继磊; 葛锋; 方松刚; 李文娴; 田荣欢; 王光勇
Original assignee: Kunming University of Science and Technology
Current assignee: Kunming University of Science and Technology
Priority date: 2010-01-22
Filing date: 2010-01-22
Publication date: 2010-06-23
Anticipated expiration: 2030-01-22
Also published as: CN101748144B

Abstract

The invention relates to a torch pear haloduric gene PpGST and an application thereof. The PpGST gene is provided with base sequence as SEQ ID indicates and encoded glutathione S-transferring enzyme. In the invention, the PpGST gene is proven to have the function of improving plant resisting salt stress by the technology related to functional genomics; and when the haloduric gene PpGST is structured on a plant expression vector and shifted to over expression in tobacco, the obtained transgenic tobacco enjoys very strong haloduric activity.

Description

A kind of torch pear haloduric gene PpGST and application thereof

Technical field

The present invention relates to molecular biology and genetically engineered field, specifically is a kind of new resistant gene of salt PpGST and the application thereof that obtains from Yunnan torch pears (Pyrus pyrifolia Nakai).

Background technology

Along with the develop rapidly of industrial and agricultural production and the continuous increase of population, society increases day by day to the demand of grain, yet the scarcity of cultivated land resource but is on the rise.The erosion of soil, salinification, Desertification, degeneration and pollution are five human big soil issues of puzzlement always.The data of Food and Argriculture OrganizationFAO shows that the global saliferous soil total area reaches 9.5 * 10 approximately ⁸Hectare takes up an area of 7.26% of ball land area.China's salinification land area is also very big, is about 1.0 * 10 ⁸Hectare, wherein modern salinification soil accounts for 37%, remains the salinification soil and accounts for 45%, and potential salinification soil accounts for 18%.The salinification of soil has a strong impact on the yield and quality of crop, makes agriculture production be subjected to heavy losses.At present, the scheme in comprehensive regulation salinification soil has had many successful cases, and difficulty is big, the cycle long, it is many to expend but implement.Along with development of biology, people can cultivate the new variety of plant with good character at short notice by transgenic technology.Cultivate crop by transgenic technology, not only can solve the salinification problem in soil, can also make full use of saliferous soil, improve crop yield with salt tolerance.

Under high-salt stress, and levels of reactive oxygen species in the plant materials (reactive oxygen species, growing amount ROS) obviously increases, and these active oxygens can injury protein matter, film fat and other cellular component, thereby plant is caused oxidative damage.For preventing the damage of active oxygen, plant can pass through superoxide-dismutase (superoxide dismutase, SOD), catalase (catalase, CAT), ascorbate peroxidase enzyme (ascorbate peroxidase, APX), Triptide sulphur-transferring enzyme (Glutathione S-transferase, GST), (Glutathione peroxidase GPx) waits antioxidase to remove the intravital free radical of plant, thereby slows down stress effect Selenoperoxidase.Wherein the effect of GSTs is most important.

GSTs is the multifunctional protein enzyme of a class by the multigene family coding, is prevalent in the plant materials.Its expression is subjected to inducing of various environmental factors, plays an important role in growth and development of plant, secondary metabolism and stress-tolerance.The GSTs kind of expressing in the different plants has very big-difference, and also there is specificity in being expressed in of GSTs in the same plant materials in different tissues and the organ.Though the gene order of plant GSTs has than big-difference, but its three-dimensional structure is high conservative but, the N end has gsh (glutathione, GSH) binding site, the C end has the electric hydrophobic mixture binding site of parent, the GSTs avtive spot also contains a conservative Serine or cysteine residues (Dixon DP, Davis BG, Edwards R.Functional divergence inthe glutathione transferase superfamily in plants.J Biol Chem, 2002,277:30859-30869.).GSTs generally forms homology or heterodimer functionating by 2 subunits, major function is to remove the murder by poisoning of extraneous toxin and endogenous toxic metabolite, combining of the sulfydryl of energy catalytic reduction type gsh and multiple electrophilic, lipophilic substrate, be transported to positions such as vacuole again, thereby reduce the toxicity of substrate.

Solubility plant GSTs can be divided into 7 classes, and wherein 6 classes are verified on function, is respectively phi, tau, zeta, theta, lambda and DHAR.Phi and tau class GSTs are that plant is peculiar, and kind is also maximum, the multiple allogenic material that comprises sterilant are had significant in conjunction with active.On the contrary, zeta and theta class GSTs guard in animal and plant, and allogenic material is had only limited activity.The function of theta class GSTs is similar to Selenoperoxidase, mainly is to reduce the generation of hydroperoxide in the organ under oxidative stress.Zeta class GSTs has the isomerase activity that depends on gsh.The catalysis maleoyl acetoacetate is isomerizated into the single acyl etheric acid of FUMARIC ACID TECH GRADE in the metabolic penultimate stride of tyrosine.Plant DHARs is different with other classes with lambda class GSTs, be monomer rather than dimer, have a halfcystine rather than Serine in catalytic site, all has the sulfydryl transferase active, DHARs also has specific function (the Edwards R that L-dehydroascorbic acid is resolved into xitix, Dixon DP.Plant glutathionetransferases.Methods Enzymol.2005,401:169-186.).

At present, will express in a plurality of GSTs importing various plants by transgenic technology, and select the transfer-gen plant of obvious anti-adversity ability.The gst gene (EC 2.5.1.18) of cotton is imported overexpression in the tobacco, can obviously improve tobacco to methyl viologen (methylviologen, MV) induce resistibility (the Yu T of oxidative stress, Li YS, Chen XF, et al.Transgenic tobacco plants overexpressing cotton glutathione S-transferase (GST) show enhancedresistance to methyl viologen.J Plant Physiol.2003,160:1305-1311.).The expression of Suaeda salsa GST can effectively improve the resistance (Zhao Fengyun of transgenic paddy rice to low temperature stress, Wang Xiaoyun, Zhao Yanxiu, Deng. change Suaeda salsa qlutathione s transferring enzyme and catalase gene over to and strengthen the resistance of rice seedling low temperature stress. Mol.Biol., 2006,32:231-238.), also can quicken the growth (Qi Yuancheng of transgenic arabidopsis under condition of salt stress, Zhang Shimin, Liping Wang, Deng. the Thiadiazolidine isomerase gene overexpression can quicken the growth of transgenic arabidopsis under the salt stress. Mol.Biol., and 2004,30:517-522.).The overexpression of GST in transgenosis fringed pink (Dianthus superbus), can increase the adaptive faculty of fringed pink to soil, can also strengthen fringed pink at multiple photosynthesis (the Lim JD that coerces in the environment, Hahn SJ, Yu CY, et al.Expression of the glutathione S-transferase gene (NT 107) in transgenicDianthus superbus.Plant Cell Tiss Org Cult, 2005,80:277-286.).

Resistant gene of salt GST of the present invention is from the sand pear kind torch pears in Yunnan, and it has the red peel phenotype of genetic stability, and is strong to soil suitability, scab resistant and canker, and anti-late frost, low temperature resistant also has stronger resistance to pear sucker.

Summary of the invention

The purpose of this invention is to provide a kind of torch pear haloduric gene PpGST and application thereof, it is building up on the plant expression vector and imports in the tobacco express, the PpGST transgene tobacco that obtains is carried out salt stress to be handled, confirm that PpGST has the salt tolerant activity, for this improvement of genes tobacco of later-stage utilization and other plant anti-adversity ability lay the foundation.

The global cDNA fragment of an anti contravariance related gene that carries in the torch pears of separating clone of the present invention Yunnan, utilize the agriculture bacillus mediated goal gene that makes to change in the recipient plant and overexpression, and then verify this gene role in the plant stress-resistance process by experiment, for this improvement of genes tobacco of later-stage utilization and other plant anti-adversity ability lay the foundation, strengthen tobacco and other plant resistance to salt damage.The contriver is PpGST with this unnamed gene.

Plant with this gene fragment has the phenotype of opposing salt damage to a certain extent.Wherein said dna fragmentation perhaps is equivalent to the dna sequence dna shown in the SEQ ID substantially shown in sequence table SEQ ID, perhaps its function is equivalent to the part fragment of sequence shown in the SEQ ID.This gene is carried out sequential analysis, show that the PpGST full-length cDNA is 864bp, have the open reading frame (ORF) of 693bp, the 5 ' non-translational region of 62bp and the 3 ' non-translational region of 109bp, coding contains 231 amino acid whose protein.The PpGST proteins encoded has the conserved domain of gsh sulphur-transferase gene family, to similar with the GSTs albumen height of capsicum (Capsicum annuum L.) and other species, show that it belongs to the GST in the torch pears from dawrf mallow (Malva pusilla), castor-oil plant (Ricinus communis L.).Sequence shown in the overexpression sequence table SEQ ID can strengthen tobacco and the other plant resistance to salt damage.

Said gene can be applied to improve the anti-adversity ability of plant, and concrete operations are as follows:

(1) acquisition of gene: with torch pears red peel is material, extracts total RNA of plant, utilizes the increase gene order of PpGST of RT-PCR, is connected to then on the pMD-18T carrier, obtains to have the clone of goal gene through order-checking.

(2) plant expression vector construction and genetic transformation: cut the pMD-18T-PpGST carrier with restriction enzyme BamH I and EcoR I enzyme, reclaim by glue and obtain target gene fragment.With same restriction endonuclease digestion plant expression vector pCAMBIA2300s, glue reclaims and obtains the big fragment of carrier.Target gene fragment is connected with the pCAMBIA2300s carrier segments, makes up overexpression vector pCAMBIA2300s-PpGST.By the frozen-thawed method pCAMBIA2300s-PpGST plant expression vector is imported among the agrobacterium strains LBA4404.Utilize agriculture bacillus mediated genetic transformation method, will express in the plants such as PpGST encoding sequence importing tobacco.Screen positive transfer-gen plant by antibiotic-screening, genomic dna PCR (polymerase chainreaction) and RT-PCR (reverse transcription-polymerase chain reaction).

(3) the transfer-gen plant resistance is analyzed: with the transfer-gen plant and the wild-type plant tissue cultured seedling of robust growth, subculture is on the MS substratum that contains 200mM, 240mM, 280mM NaCl respectively.In the incubator of identical intensity of illumination and temperature, cultivate after 10-12 days, the phenotype of transfer-gen plant and wild-type plant under the observation salt stress, thus filter out the transfer-gen plant that salt damage is had obvious resistibility.

The present invention provides a kind of new method for strengthening plant to the resistance of salt damage, cultivates the deficiency that salt-tolerant plant can overcome traditional breeding method by genetic engineering means, and not only breeding cycle is short, and simple to operate, obtains high anti-material easily.To express in the PpGST gene transfered plant from the torch pears, and can strengthen the resistance of plant, this gene be imported in the plants such as tobacco, carnation, Lisianthus, can produce novel germplasm of salt tolerant and kind salt damage.Utilize genetic engineering technique to increase the importance that stress resistance of plant has remarkable advantages and do not replace.It can be provided convenience for scale operation such as crop, flowers, a large amount of reduces the underproduction that badly causes because of natural condition, and for agriculture production saving cost and raise the management level, so the present invention has wide market application prospect.

Description of drawings

Fig. 1 is the PCR detected result of part transgene tobacco genomic dna.Marker:DL2000DNA Marker (Dalian is precious biological), by 2,000bp, 1,000bp, 750bp, 500bp, 250bp and six dna fragmentations of 100bp are formed.Over against photograph: with plasmid pMD-18T-PpGST is the PCR product of template; WT: total DNA is the PCR product of template with non-transgenic tobacco (being wild-type tobacco); Blank: the reaction product that does not comprise template DNA in the PCR system.

Fig. 2 is the expression analysis result of PpGST transcriptional level in the positive transgene tobacco of part.Marker:DL2000DNA Marker (Dalian is precious biological); 1-20 is respectively different positive transgene tobacco individual plants; WT: it is the PCR product of template that the total RNA of non-transgenic tobacco reverses cDNA; Blank: the reaction product that does not comprise template DNA in the PCR system; Over against photograph: plasmid pMD-18T-PpGST is the PCR product of template.

Fig. 3 is a PpGST transgene tobacco salt tolerance analytical results.WT: wild-type tobacco; Negative control plant: the tobacco plant that changes other genes over to.

Embodiment

Embodiment:

1) PpGST Cloning of Entire Gene and sequential analysis

After the red peel grind into powder of liquid nitrogen with the torch pears, change in the centrifuge tube, adopt guanidine isothiocyanate method to extract total RNA.Adopting reversed transcriptive enzyme M-MLV (day root) is synthetic cDNA first chain of template with total RNA, and reaction system and operating process are: get 5 μ g Total RNA, add 50ng oligo (dT) 15,2 μ L dNTP (2.5mM each), ddH successively ₂O (RNase-free) to reaction volume be 13.5 μ L; Behind the mixing, behind 70 ℃ of heat denatured 5min rapidly at cooled on ice 5min, add 4 μ L, 5 * First-stand buffer, 0.5 μ L RNasin (200U), 1 μ L M-MLV (200U), 1 μ L DTT (0.1M) then successively, mixing is also centrifugal in short-term, 42 ℃ of temperature are bathed 1.5h, take out back 95 ℃ of heating 5min, termination reaction.CDNA first chain is synthetic, and to be placed on-20 ℃ of preservations standby.

The first chain cDNA is a template with synthetic, amplifying target genes PpGST, and the primer sequence is respectively 5 ' AAAAGTCGAAAACTCAGGGTGGGCTG3 ' and 5 ' TGTTGCACTTTGGGATGGACGAGC3 '.Adopt the precious biological high-fidelity DNA polymerase ex taq in Dalian to amplify goal gene.PCR reaction conditions: 94 ℃ of 3min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 1min, 32 circulations; 72 ℃ of 10min.Reaction system (20 μ L) is 1 μ L cDNA, 2 μ L, 10 * Long taq Buffer, 0.4 μ L dNTP (10mM each), 0.1 μ L forward primer (20 μ M), 0.1 μ L reverse primer (20 μ M), 0.2 μ L ex Taq DNApolymerase (5U/ μ L), 16.2 μ L ddH ₂O.PCR gets 5 μ L and is used for agarose gel electrophoresis after finishing, and detects the specificity and the size of amplified production.

Because the PCR product has only a DNA band, so directly the PCR product is carried out the TA clone, the test kit that uses is pMD18-T vector kit (Dalian is precious biological), reaction system and operating process are: get 1.5 μ L PCR products, add 1 μ L pMD18-T vector (50ng/ μ L) and 2.5 μ L, 2 * Ligation solution I successively, mixing places 16 ℃ of reaction overnight.Adopting the heat shock conversion method will connect product changes in the bacillus coli DH 5 alpha.With containing X-Gal, IPTG, penbritin (ampicillin, LB solid medium screening positive clone Amp).Select several white colonies, shake that the special primer with amplification PpGST identifies the clone that multiple clone site is inserted PpGST behind the bacterium.The clone who identifies is checked order, the final PpGST full-length cDNA that obtains is 864bp, analyzes by NCBI ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) and finds that it comprises the opening code-reading frame (seeing sequence table) of a 693bp.One of PpGST coding contains 231 amino acid whose protein, and the molecular weight of PpGST is 26.3KDa, iso-electric point 5.61.With regard to whole proteinic amino acid was formed, the leucic content of hydrophobic amino acid was the highest, is about 12.9%.All neutral amino acids content are 72%, and acidic amino acid content is 14%, and basic aminoacids content is 14%.Only contain 1 halfcystine, be positioned at the 32nd.Analyzed PpGST encoded protein sequence by information biology software SignalP 3.0, detected it and whether have N end signal peptide.The result shows that this albumen is a kind of non-secretory protein.

2) plant expression vector construction

Adopt alkaline lysis method of extracting to insert the escherichia coli plasmid pMD-18T-PpGST of PpGST and the plasmid of plant expression vector pCAMBIA2300S, get 1 μ L and be used for integrity and the concentration height of agarose gel electrophoresis to detect the plasmid that extracted.Respectively plasmid pMD-18T-PpGST and pCAMBIA2300S are carried out double digestion (100 μ L system) with EcoRI (Fermentas) and BamHI (Fermentas), reaction system and operating process are: get 10 μ LpMD-18T-PpGST or pCAMBIA2300S plasmid, add 10 μ L, 10 * Tango buffer, 2 μ L EcoRI, 2 μ L BamHI, 76 μ L ddH successively ₂O, centrifugal in short-term behind the mixing, place 37 ℃ of reaction overnight.All enzymes are cut the product point carry out electrophoresis in sepharose, then PpGST fragment and the big fragment of pCAMBIA2300S are carried out the glue recovery respectively, whole process uses UNIQ-10 pillar DNA glue to reclaim test kit (worker is given birth in Shanghai).The concrete operations flow process is: downcut the sepharose piece that contains the target DNA band and place the 1.5mL centrifuge tube, the ratio adding Binding Buffer II in 400 μ L/100mg sepharoses places 60 ℃ of water-bath 10min, and glue is thoroughly melted; The gelating soln that melts is transferred in the UNIQ-10 post in the 2mL collection tube, room temperature place centrifugal 1min behind the 2min (6,000g/min); Take off the UNIQ-10 post, outwell the waste liquid in the collection tube, again the UNIQ-10 post is put into collection tube, add 500 μ L Wash Solution, and the centrifugal 1min of room temperature (8,000g/min), repeat this step more once; Take off the UNIQ-10 post, outwell the waste liquid in the collection tube, again the UNIQ-10 post is put into collection tube, and the centrifugal 2min of room temperature (12,000g/min); Take off the UNIQ-10 post and put into new 1.5mL centrifuge tube, at 20 μ L Elution Buffer of film central authorities adding preheating, room temperature is placed 2min, and the centrifugal 1min of room temperature (12,000g/min), collect the dna fragmentation that liquid is recovery in the centrifuge tube.Get 1 μ L and reclaim product, place-20 ℃ of preservations standby by agarose gel electrophoresis detection segmental size of recovery and concentration.

Utilize T4DNA Ligase (Dalian is precious biological), the PpGSTDNA fragment and the pCAMBIA2300S carrier segments that reclaim are coupled together, and reaction system (20 μ L) and operating process are: get 10 μ L PpGSTDNA fragments and add 2 μ LpCAMBIA2300S carrier DNAs, 2 μ L, 10 * T4 DNA Ligase Buffer, 1 μ L T4 DNA Ligase, 5 μ LddH successively ₂O, centrifugal in short-term behind the mixing, place 16 ℃ of metal bath reaction overnight.Then adopt the heat shock conversion method will connect product and change in the bacillus coli DH 5 alpha, with containing 50mg/L kantlex (kanamycin, solid medium screening positive clone Km).Select single bacterium colony and shake bacterium, being template with bacterium liquid carries out PCR with the special primer of amplification PpGST, picks out the clone that PpGST and pCAMBIA2300S successfully are connected, if the bacterial strain that is detected is positive, adding glycerine also places-80 ℃ of preservations standby.

With the pCAMBIA2300S-PpGST plasmid in alkaline lysis method of extracting and the above-mentioned intestinal bacteria of purifying.And the competent cell of preparation Agrobacterium LBA4404 bacterial strain, operating process is: the LBA4404 bacterial strain that preserve in the laboratory is gone up line at LB solid medium (containing Rifampin 20mg/L), 28 ℃ be cultured to grow single bacterium colony after, mono-clonal of picking is in the 2mL LB liquid nutrient medium that contains the 20mg/L Rifampin, and 28 ℃ of shaking culture are to muddy; Get 5mL bacterium liquid and transfer in the 100mL LB liquid nutrient medium that contains the 20mg/L Rifampin, 28 ℃ of shaking culture are to OD ₆₀₀Be 0.5; (5,000g/min) the collection thalline is abandoned supernatant to 4 ℃ of centrifugal 5min, adds the 0.1M CaCl of 10mL precooling ₂, the thalline that fully suspends gently, ice bath 20min; Then (5,000g/min) the collection thalline is abandoned supernatant to 4 ℃ of centrifugal 5min, adds the 0.1M CaCl that contains 15% glycerine of 4mL precooling ₂Solution is sub-packed in the 1.5mL centrifuge tube after fully suspending, every pipe 200 μ L, and it is standby that liquid nitrogen flash freezer is placed on-80 ℃ of preservations.

Adopt the frozen-thawed method that the plant expression vector pCAMBIA2300S-PpGST of above-mentioned structure is changed in the prepared Agrobacterium LBA4404 competent cell.Operation steps is: get the adding of 2 μ g pCAMBIA2300S-PpGST plasmids and contain in the centrifuge tube of 200 μ L competent cells, ice bath 5min behind the mixing gently, then change freezing 1min in the liquid nitrogen over to, place 37 ℃ of water-bath 5min then rapidly, ice bath 2min immediately afterwards, add 800 μ L LB liquid nutrient mediums, 28 ℃ of shaking culture 4h.Agrobacterium after the activation is applied on the LB solid medium that contains 50mg/L Km 28 ℃ of static cultivations.Select single bacterium colony and shake bacterium, carry out PCR, detect pCAMBIA2300S-PpGST and whether change in the Agrobacterium with the special primer of amplification PpGST.For positive colony, it is standby that adding glycerine is placed on-80 ℃ of preservations.

3) agriculture bacillus mediated plant genetic transforms and the transgenic plant screening

The transgene receptor of this experiment is tobacco (Nicotiana tabacum L.).With tobacco seed with 75% alcohol-pickled 30s, with sterilized water washing back with 0.1% HgCl ₂Soak 8min, and then wash several times with sterilized water, be seeded on the 1/2MS substratum, 28 ℃ of dark 5-8d that cultivate go to illumination box (25 ℃, 16h/d illumination) after the germination, and later every month with MS substratum subculture once.

Take out the Agrobacterium LBA4404 bacterial classification of preserving that contains the pCAMBIA2300S-PpGST plasmid from-80 ℃ of refrigerators, be inoculated in 5mL and contain in the LB liquid nutrient medium of 50mg/L Km and 20mg/L Rifampin, 28 ℃ are cultured to muddiness.The bacterium liquid of drawing the 1mL muddiness is cultivated 48h for 28 ℃ to the LB solid medium that contains 50mg/L Km.Agrobacterium on the LB solid medium scraped be inoculated in right amount in the MGL liquid nutrient medium, additional a certain amount of Syringylethanone, 28 ℃ of shaking culture 2-3h are with the activation Agrobacterium.

Get tobacco aseptic seedling leaf and be cut into 1cm ²About the leaf dish, be soaked in above-mentioned containing in the MGL liquid nutrient medium that activates Agrobacterium fully, contaminate 15min.Blot the bacterium liquid of blade surface with aseptic filter paper, the leaf dish is placed carry out incubated at room temperature on the common substratum.Substratum is a MS+0.02mg/L 6-BA+2mg/L NAA+30g/L sucrose altogether, and incubation time is 2d.

Leaf dish after cultivating altogether forwarded to be added with seedling differentiation in the antibiotic MS screening culture medium, screen transfer-gen plant simultaneously.Screening culture medium be MS+0.5mg/L 6-BA+0.1mg/L NAA+30g/L sucrose+50mg/LKm+200mg/L cephamycin (cefotaxime sodium salt, Cef); During screening and culturing culturing bottle is transferred to illumination box and cultivates (25 ℃, 16h/d illumination, 8h/d dark).The back MS cultivation succeeding transfer culture that contains 50mg/L Km and 200mg/L Cef sprouts.Because of tobacco callus differentiation rate higher, so need further screen to regeneration plant.The tobacco regrowth moved on the MS substratum that contains 50mg/L Km and 200mg/L Cef it is taken root, select for use the regrowth of taking root preferably to do further molecular level at last and detect.

Adopt the CTAB method to extract the genomic dna of transgenic tobacco plant blade, get 1 μ L genomic dna and detect its integrity and concentration by agarose gel electrophoresis.Being template with the genomic dna of transfer-gen plant carries out PCR with the special primer of amplification PpGST.PCR gets 8 μ L products and is used for agarose gel electrophoresis to detect positive transfer-gen plant after finishing.The amplification of part transgenic tobacco plant as shown in Figure 1.The PpGST transformation of tobacco screens the positive transfer-gen plant of 34 strains altogether, is numbered 1～34 respectively.

4) PpGST expression analysis and transfer-gen plant salt tolerance are analyzed

The tender leaf of getting positive transgenosis individual plant and non-transgenic tobacco (wild-type) extracts total RNA, reverse transcription generates cDNA first chain, and as one section sequence of template amplification PpGST gene inside, the primer sequence is respectively 5 ' TGAGGCTGATGCTGCTCTGCT 3 ' and 5 ' AATGGATGTTGCGGGTACTTT 3 '.PCR reaction conditions: 94 ℃ of 3min; 94 ℃ of 30s, 59 ℃ of 30s, 72 ℃ of 30s, 32 circulations; 72 ℃ of 10min.Expression according to PpGST transcriptional level in each transgenosis individual plant of PCR interpretation of result.The method of total RNA extraction and RT-PCR is identical with step and step 1).PCR gets 5 μ L and is used for agarose gel electrophoresis after finishing, and the detected result of part individual plant as shown in Figure 2.Detect altogether that PpGST has expression at transcriptional level in 27 transgenosis individual plants, these individual plants be numbered 2,3,5,6,9,11,12,13,14,15,16,18,19,20,21,22,23,24,25,26,28,29,30,31,32,33,34.

The positive transgene tobacco of detected 27 strains is carried out tissue culture fast-propagation, and select PpGST transgene tobacco, wild-type tobacco and negative control tobacco plant (changing the tobacco plant of other genes over to) tissue cultured seedling of robust growth, subculture is on the MS substratum that contains 200mM, 240mM, 280mM NaCl respectively.In the incubator of identical intensity of illumination and temperature, cultivate after 10-12 days, observe the growing state of each plant under the salt stress.The result as shown in Figure 3, on the MS of 200mM NaCl substratum, all types of plant can both normally take root.On the MS of 240mM NaCl substratum, wild-type tobacco can not be taken root, and growth is subjected to obvious inhibition, the negative control transgene tobacco amount of taking root seldom, and PpGST changes tobacco and can normally take root robust growth.On the MS of 280mMNaCl substratum, the growth of PpGST transgene tobacco, wild-type tobacco and negative control tobacco all is subjected to inhibition to a certain degree, but the PpGST transgene tobacco still can be taken root, and wild-type tobacco and negative control tobacco can't take root because of salt stress.Above-mentioned experimental result shows that the overexpression of PpGST in transgene tobacco can alleviate the degree that plant is subjected to salt damage, strengthens the salt tolerance of plant.

Sequence table (SEQ ID)

＜110〉Kunming University of Science and Technology

＜120〉a kind of torch pear haloduric gene PpGST and application thereof

<130>

<160>2

<170>PatentIn?version?3.5

<210>1

<211>864

<212>DNA

<213>Pyrus?pyrifolia?Nakai

<220>

<221>mRNA

<222>(1)..(864)

<220>

<221>5’UTR

<222>(1)..(62)

<220>

<221>CDS

<222>(63)..(755)

<220>

<221>3’UTR

<222>(756)..(864)

<400>1

aaaagtcgaa?aactcagggt?gggctgaggc?tgatgctgct?ctgctgcgtt?taatttatca 60

aa?atg?atg?gaa?gca?cag?gag?gtg?gag?gtg?gag?gcg?cag?gcg?gcg?act 107

Met?Met?Glu?Ala?Gln?Glu?Val?Glu?Val?Glu?Ala?Gln?Ala?Ala?Thr

1 5 10 15

gaa?agt?ggc?gat?caa?caa?ctc?aag?ctt?tat?tcc?tac?tgg?agg?agc?tct 155

Glu?Ser?Gly?Asp?Gln?Gln?Leu?Lys?Leu?Tyr?Ser?Tyr?Trp?Arg?Ser?Ser

20 25 30

tgc?gcc?tac?cgt?gtt?cga?att?gct?ctc?aac?ttg?aaa?ggg?ttg?aaa?tac 203

Cys?Ala?Tyr?Arg?Val?Arg?Ile?Ala?Leu?Asn?Leu?Lys?Gly?Leu?Lys?Tyr

35 40 45

gag?tac?aaa?gct?gta?aac?cta?ctg?aag?gga?gag?caa?ttc?agt?ccg?gag 251

Glu?Tyr?Lys?Ala?Val?Asn?Leu?Leu?Lys?Gly?Glu?Gln?Phe?Ser?Pro?Glu

50 55 60

ttc?aga?aag?ctg?aat?ccg?ctc?ggg?tat?gtg?cct?gtg?ctt?gtg?gat?ggg 299

Phe?Arg?Lys?Leu?Asn?Pro?Leu?Gly?Tyr?Val?Pro?Val?Leu?Val?Asp?Gly

65 70 75

gac?acc?ctt?gtt?gct?gac?tca?ttt?gcc?atc?cta?atg?tat?tta?gaa?gaa 347

Asp?Thr?Leu?Val?Ala?Asp?Ser?Phe?Ala?Ile?Leu?Met?Tyr?Leu?Glu?Glu

80 85 90 95

aag?tac?ccg?caa?cat?cca?ttg?tta?ccg?ccc?gat?ctt?cag?aaa?aaa?gct 395

Lys?Tyr?Pro?Gln?His?Pro?Leu?Leu?Pro?Pro?Asp?Leu?Gln?Lys?Lys?Ala

100 105 110

atc?aat?tac?cag?gct?gca?aat?att?gtt?tcc?tca?agc?ata?caa?cct?cta 443

Ile?Asn?Tyr?Gln?Ala?Ala?Asn?Ile?Val?Ser?Ser?Ser?Ile?Gln?Pro?Leu

115 120 125

caa?aat?ctg?gct?gta?ctg?aag?tac?att?gaa?gaa?aaa?gtt?agt?ccc?gat 491

Gln?Asn?Leu?Ala?Val?Leu?Lys?Tyr?Ile?Glu?Glu?Lys?Val?Ser?Pro?Asp

130 135 140

gag?aaa?ctt?gaa?tgg?gtt?aaa?gtt?cat?att?gga?aaa?ggc?ttt?tca?gca 539

Glu?Lys?Leu?Glu?Trp?Val?Lys?Val?His?Ile?Gly?Lys?Gly?Phe?Ser?Ala

145 150 155

ctt?gaa?gaa?ctg?ctg?aac?aac?cat?gca?gga?aaa?tat?gca?act?gga?gag 587

Leu?Glu?Glu?Leu?Leu?Asn?Asn?His?Ala?Gly?Lys?Tyr?Ala?Thr?Gly?Glu

160 165 170 175

gaa?gtt?tac?atg?gca?gat?ttg?ttt?ctg?gca?ccc?cag?gtt?tat?gca?gcc 635

Glu?Val?Tyr?Met?Ala?Asp?Leu?Phe?Leu?Ala?Pro?Gln?Val?Tyr?Ala?Ala

180 185 190

att?agg?ttc?cag?cta?gac?atg?act?cag?ttc?ccc?ctt?ttg?aac?agg?atg 683

Ile?Arg?Phe?Gln?Leu?Asp?Met?Thr?Gln?Phe?Pro?Leu?Leu?Asn?Arg?Met

195 200 205

cat?gag?gca?tac?aaa?aag?ata?ccg?gca?ttc?cta?gat?gtt?atc?cca?gaa 731

His?Glu?Ala?Tyr?Lys?Lys?Ile?Pro?Ala?Phe?Leu?Asp?Val?Ile?Pro?Glu

210 215 220

aag?cag?ccg?gat?gct?ctt?ttt?cca?tagttaaaaa?attgtgttga?agagggtccc 785

Lys?Gln?Pro?Asp?Ala?Leu?Phe?Pro

225 230

ggttagaaat?cgtcggttcc?actcttctta?aacttccttt?ttaaaatcag?atgaagctcg 845

tccatcccaa?agtgcaaca 864

<210>2

<211>231

<212>PRT

<213>Pyrus?pyrifolia?Nakai

<400>2

Met?Met?Glu?Ala?Gln?Glu?Val?Glu?Val?Glu?Ala?Gln?Ala?Ala?Thr?Glu

1 5 10 15

Ser?Gly?Asp?Gln?Gln?Leu?Lys?Leu?Tyr?Ser?Tyr?Trp?Arg?Ser?Ser?Cys

20 25 30

Ala?Tyr?Arg?Val?Arg?Ile?Ala?Leu?Asn?Leu?Lys?Gly?Leu?Lys?Tyr?Glu

35 40 45

Tyr?Lys?Ala?Val?Asn?Leu?Leu?Lys?Gly?Glu?Gln?Phe?Ser?Pro?Glu?Phe

50 55 60

Arg?Lys?Leu?Asn?Pro?Leu?Gly?Tyr?Val?Pro?Val?Leu?Val?Asp?Gly?Asp

65 70 75 80

Thr?Leu?Val?Ala?Asp?Ser?Phe?Ala?Ile?Leu?Met?Tyr?Leu?Glu?Glu?Lys

85 90 95

Tyr?Pro?Gln?His?Pro?Leu?Leu?Pro?Pro?Asp?Leu?Gln?Lys?Lys?Ala?Ile

100 105 110

Asn?Tyr?Gln?Ala?Ala?Asn?Ile?Val?Ser?Ser?Ser?Ile?Gln?Pro?Leu?Gln

115 120 125

Asn?Leu?Ala?Val?Leu?Lys?Tyr?Ile?Glu?Glu?Lys?Val?Ser?Pro?Asp?Glu

130 135 140

Lys?Leu?Glu?Trp?Val?Lys?Val?His?Ile?Gly?Lys?Gly?Phe?Ser?Ala?Leu

145 150 155 160

Glu?Glu?Leu?Leu?Asn?Asn?His?Ala?Gly?Lys?Tyr?Ala?Thr?Gly?Glu?Glu

165 170 175

Val?Tyr?Met?Ala?Asp?Leu?Phe?Leu?Ala?Pro?Gln?Val?Tyr?Ala?Ala?Ile

180 185 190

Arg?Phe?Gln?Leu?Asp?Met?Thr?Gln?Phe?Pro?Leu?Leu?Asn?Arg?Met?His

195 200 205

Glu?Ala?Tyr?Lys?Lys?Ile?Pro?Ala?Phe?Leu?Asp?Val?Ile?Pro?Glu?Lys

210 215 220

Gln?Pro?Asp?Ala?Leu?Phe?Pro

225 230

Claims

1. a torch pear haloduric gene PpGST is characterized in that having the base sequence described in the sequence table, coding for glutathion sulphur-transferring enzyme.

2. torch pear haloduric gene PpGST according to claim 1, the coding region that it is characterized in that gene are the nucleotide sequence shown in the 63-755 position or coded protein other dna sequence dnas identical with SEQ ID coded protein in the sequence table.

3. torch pear haloduric gene PpGST according to claim 1, it is characterized in that the PpGST full-length cDNA is 864bp, have the open reading frame of 693bp, the 5 ' non-translational region of 62bp and the 3 ' non-translational region of 109bp, coding contains 231 amino acid whose protein.

4. the nucleotides sequence of the described torch pear haloduric gene PpGST of claim 1 is listed in and improves tobacco and other plant to the application in the salt stress resistance.

5. the application of torch pear haloduric gene PpGST according to claim 4 is characterized in that being applied to improve the anti-adversity ability of plant, and concrete operations are as follows:

(1) acquisition of gene: with torch pears red peel is material, extracts total RNA of plant, utilizes the increase gene order of PpGST of RT-PCR, is connected to then on the pMD-18T carrier, obtains to have the clone of goal gene through order-checking;

(2) plant expression vector construction and genetic transformation: cut the pMD-18T-PpGST carrier with restriction enzyme BamH I and EcoR I enzyme, reclaim by glue and obtain target gene fragment.With same restriction endonuclease digestion plant expression vector pCAMBIA2300s, glue reclaims and obtains the big fragment of carrier; Target gene fragment is connected with the pCAMBIA2300s carrier segments, makes up overexpression vector pCAMBIA2300s-PpGST; By the frozen-thawed method pCAMBIA2300s-PpGST plant expression vector is imported among the agrobacterium strains LBA4404; Utilize agriculture bacillus mediated genetic transformation method, will express in the plants such as PpGST encoding sequence importing tobacco; Screen positive transfer-gen plant by antibiotic-screening, genomic dna PCR and RT-PCR;

(3) the transfer-gen plant resistance is analyzed: with the transfer-gen plant and the wild-type plant tissue cultured seedling of robust growth, subculture is on the MS substratum that contains 200mM, 240mM, 280mM NaCl respectively, in the incubator of identical intensity of illumination and temperature, cultivate after 10-12 days, the phenotype of transfer-gen plant and wild-type plant under the observation salt stress, thus filter out the transfer-gen plant that salt damage is had obvious resistibility.