CN101701249B - Molecular marker method for detecting resistance of powdery mildew of bottlegourd and kit thereof - Google Patents
Molecular marker method for detecting resistance of powdery mildew of bottlegourd and kit thereof Download PDFInfo
- Publication number
- CN101701249B CN101701249B CN2009101542779A CN200910154277A CN101701249B CN 101701249 B CN101701249 B CN 101701249B CN 2009101542779 A CN2009101542779 A CN 2009101542779A CN 200910154277 A CN200910154277 A CN 200910154277A CN 101701249 B CN101701249 B CN 101701249B
- Authority
- CN
- China
- Prior art keywords
- bottle gourd
- sample
- resistance
- pcr
- powdery mildew
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a molecular marker method for detecting the resistance of powdery mildew of bottlegourd and a kit thereof, belonging to the technical field of molecule genetic breeding of vegetables. The method comprises the following steps of: (1) extraction of DNA of genome of bottlegourd; (2) PCR amplification; (3) gel electrophoresis of amplified products of PCR; and (4) identification of resistance of powdery mildew of bottlegourd samples and the like. Whether the material is resistant to powdery mildew of bottlegourd can be determined only by detecting whether specific fragments closely linked to powdery mildew resistance genes exist in the genome of bottlegourd sample material. The method is simple, easy , rapid and sensitive, and has accurate results and low cost and the like. It takes only 4-5 hours to detect, while cost is only about 1/20 of that of traditional phenotype identification. The method can be generalized and applied in vegetable breeding and seed certification departments.
Description
Technical field
The present invention relates to vegetables molecular genetic breeding technical field, relate in particular to a kind of molecular marking technique that utilizes, accurately, the rapid detection bottle gourd to the detection method of powder mildew resistance and with the matching used test kit of this method.
Background technology
Bottle gourd (Lagenaria siceraria (Molina) Standl) Powdery Mildew (Powdery mildew), be to infect a kind of common bottle gourd fungal disease that causes, under the in all parts of the country and various planting types generation arranged all by monofilament shell powdery mildew (Sphaerotheca fuliginea).This disease from seedling stage to becoming the strain phase all can cause harm, heavier with growth intermediary and later stages harm especially, often cause a large amount of underproduction and quality to descend, production has caused serious threat (to take charge of phoenix and lift, take charge of more the generation of bottle gourd Powdery Mildew and control to bottle gourd, the Changjiang river vegetables, 2007,7:31).Cultivating disease-resistant variety is one of the safest, effective and economic measure of control bottle gourd Powdery Mildew.But the generation of bottle gourd Powdery Mildew is affected by environment very big, and its pathogenic bacteria need live body preservation, and this identifies the indoor and outdoor bacterial classification inoculation that must carry out in breeding process and has brought very big inconvenience; Simultaneously, present evaluation, fractionation of complex to this disease disease resistance, and still do not have unified standard.Therefore, traditional bottle gourd mildew-resistance breeding for quality method has defectives such as subjectivity is strong, and accuracy is low; Particularly the plant type of bottle gourd plant is bigger, relies on the method that the phenotype of lot of materials is carried out examination, and is then more time-consuming, take ground, require great effort.
The appearance of RFLP, RAPD, AFLP equimolecular labeling technique is for plant breeding provides a new approach.Molecular mark (Molecular Marker-assisted Selection, be called for short MAS), be breeding material to be detected and selects from dna level by molecular marking technique, this each tissue organism, each developmental stage all can be implemented, be not subjected to season, environmental limit, there is not the problem that to express, thereby can select to obtain having the offspring (Fang Xuanjun of purpose proterties fast, Wu behaves, Tang Jiliang, crop dna marker assistant breeding. Beijing: Science Press, 2001).Therefore, research and development and the chain molecule marker of bottle gourd powdery mildew gene, and utilize this mark fast, stable, the antagonism genetic material detects, screens reliably, thereby significantly accelerate the process of bottle gourd mildew-resistance breeding, breeding has using value to the bottle gourd mildew-resistance for this.
In melon crops such as cucumber, muskmelon, the molecular marking technique of relevant mildew-resistance has many reports, (Liu Xiubo, Professor Daniel Tsui Chye, Cui Chongshi, cucurbits powdery mildew resistance breeding progress, Northeast Agricultural University's journal, 2005,6:774), but had not yet to see report with closely linked molecule marker of bottle gourd mildew-resistance gene and application thereof.
Summary of the invention
The object of the invention is, identify at existing dependence phenotype resistance in traditional bottle gourd mildew-resistance breeding method, the grade scale disunity, subjectivity is strong, accuracy is low, time-consuming, take defectives such as ground, effort, provide a kind of energy fast, accurately, the low-cost molecular mark detection method of identifying the bottle gourd powder mildew resistance; Another purpose of the present invention is that a kind of test kit that can conveniently implement above-mentioned molecular mark detection method is provided.
Cardinal principle of the present invention is: we at first pass through the disease-resistant parent of bottle gourd, susceptible parent and filial generation F thereof
1And F
2The classification evaluation of individual plant Powdery Mildew and the genetics of resistance analysis of segregating population, clear and definite bottle gourd is controlled by single recessive gene the resistance system of Powdery Mildew; By the screening also obtained with the closely linked AFLP molecule marker of this bottle gourd powdery mildew gene be E-ATG/M-CTC, and and then be translated into PCR-based, fast, easy, SCAR is labeled as Primer1:5 '-CATGAAAGAAAATCGGCTTGG-3 ' cheaply, Primer2:5 '-TAACTCCAGCACTCCCTTCCC-3 ', and transfer to Shanghai Ying Jun biotech company synthetic primer; Based on above-mentioned basis, only need whether to have and the closely linked specific fragment of mildew-resistance gene, can determine the resistance of this material the bottle gourd Powdery Mildew by in the genome that detects the bottle gourd specimen material, contain specific fragment if detect, illustrate that then tested plant is disease-resistant plant; Otherwise if illustrate that then tested plant is a disease plant.
The object of the invention is achieved through the following technical solutions.
Detect the molecule marking method of bottle gourd powder mildew resistance, this method is carried out according to the following steps:
(1) extraction of bottle gourd genomic dna: behind each bottle gourd sample usefulness CTAB method extraction genomic dna to be detected, preserve respectively, standby;
(2) pcr amplification of genomic dna: with each sample gene group DNA 20ng of bottle gourd, add respectively in each PCR pipe, and add each the 0.2 μ M of upstream and downstream primer that identifies the bottle gourd powder mildew resistance, dNTP 0.25mM, MgCl successively at each Guan Zhongzai
22.0mM, 1 times PCR damping fluid and Taq archaeal dna polymerase 1 unit, and after adding aseptic redistilled water to 20 μ l, at 94 ℃ of pre-sex change 2min, 94 ℃ of 30seconds, 48~50 ℃ of annealing 30seconds, 72 ℃ are extended 60seconds, 30 circulations are increased 4 ℃ of preservations of product under 72 ℃ of extension 10min;
Describedly identify that the upstream primer sequence of bottle gourd powder mildew resistance is 5 '-CATGAAAGAAAATCGGCTTGG-3 '; The downstream primer sequence is 5 '-TAACTCCAGCACTCCCTTCCC-3 ';
(3) gel electrophoresis analysis of pcr amplification product: each sample is got amplified production 10 μ l respectively, and adds by 0.25% bromjophenol blue and the formulated sample-loading buffer 2 μ l of 40% sucrose, mixing; Mixture is carried out electrophoretic separation on 2% sepharose, 2/3 position that arrives gel to bromjophenol blue stops electrophoresis; Gel is observed, is taken a picture with gel imaging system after EB dyeing;
(4) evaluation of bottle gourd sample powder mildew resistance: on gel, have or not the appearance of band according to each sample, can determine this sample whether tool to the resistance of Powdery Mildew.
Detect the test kit of bottle gourd powder mildew resistance, this test kit comprises box body and 7 PCR pipes, dNTP is housed, MgCl respectively in 5 PCR pipes
2, PCR damping fluid, Taq archaeal dna polymerase and developer EB; Wherein, upstream primer and the sequence that the sequence of identifying the bottle gourd powder mildew resistance is 5 '-CATGAAAGAAAATCGGCTTGG-3 ' being housed in other 2 PCR pipes respectively is the downstream primer of 5 '-TAACTCCAGCACTCCCTTCCC-3 '.
Beneficial effect of the present invention:
1, simple, the rapid sensitive of method, result are accurate.This method adopts the primer of independent development and the round pcr of laboratory routine, need 4~5 hours from being sampled to detect only to finish, and Zhou Nianjun can carry out; And the inoculation of conventional field is identified, only growing seedlings just needs generally to need for 2 all left and right sides times could see the result again after the inoculation about 3 weeks, and simultaneously, the environmental factors that influences success ratio of inoculation during this period is more, so the accuracy of detected result is just lower.
2, this method is by the detection to genetic material, convenient, good reproducibility, and just can carry out in seedling stage, can promptly eliminate a large amount of disease plants in early days, the workload of follow-up transplanting, management, evaluation etc. is minimized, having saved the detection cost in a large number, only is about 1/20th of traditional phenotypic evaluation cost.
3, test kit provided by the present invention, to detect with primer and related reagent and comprehensively be assembled in the box, make things convenient for implementation and operation, detected result is reliable and stable, and the molecular biology equipment in conjunction with conventional just can carry out actual detected by the schedule of operation that provides, be easy to realize stdn, once can detect duplicate samples up to a hundred, only need 4-5 hour detection time, improved the efficient and the standardization level that detect.
Description of drawings
Fig. 1. figure is identified in each parent of bottle gourd mildew-resistance seed selection, hybridization individual plant resistance in seedling stage from generation to generation;
The M:100bpDNA molecular weight standard; 1 is disease-resistant parent, and 2 is susceptible parent, and 3-14 is F
2For disease-resistant individual plant, 15 is F
1For individual plant, 16-22 is F
2For susceptible individual plant;
Fig. 2. the bottle gourd different varieties is identified figure to powder mildew resistance;
M is the 100bpDNA molecular weight standard; 1 is disease-resistant contrast, and 2 is susceptible contrast, and 3,4 is local disease-resistant variety, and 5,13,16 is that free disease-resistant strain is; 6-12 and 14,15,17 is that susceptible strain is.
Fig. 3. detect different bottle gourd kind powder mildew resistances with test kit;
M is the 100bpDNA molecular weight standard; 1 is disease-resistant contrast, and 2 is susceptible contrast, and 3,4 is local disease-resistant variety, and 5 free disease-resistant strains are that 6-10 is that free susceptible strain is.
Embodiment
Also the present invention is described in further detail in conjunction with the accompanying drawings below by embodiment, but following description does not constitute the qualification of going up in all senses to protection scope of the present invention.
Embodiment 1:(bottle gourd parent, F
1And F
2For detection in individual plant seedling stage) to powder mildew resistance
This routine described bottle gourd material:
The disease-resistant parent of bottle gourd: J083 is numbered 1; The susceptible parent of bottle gourd: the long melon in Hangzhou is numbered 2; F
1For individual plant: be numbered 15; F
2For individual plant: be numbered 3-14 and 16-22;
Detection method is carried out according to the following steps:
1, the extraction of bottle gourd genomic dna: get disease-resistant, susceptible parent of bottle gourd and F
1, F
2For each individual plant sample young leaflet tablet in seedling stage 0.1 gram, add the liquid nitrogen grind into powder, after the CTAB method is extracted DNA routinely, preserve respectively, standby;
2, the pcr amplification of genomic dna: after in each PCR pipe, adding each bottle gourd sample gene group DNA 20ng of step (1) extraction respectively, add each 0.2 μ M of upstream and downstream primer more successively, dNTP 0.25mM, MgCl
22.0mM, 1 times PCR damping fluid, Taq archaeal dna polymerase 1 unit, add aseptic redistilled water to 20 μ l after, press the PCR response procedures: 94 ℃ of pre-sex change 2min, 94 ℃ of 30seconds, 48~50 ℃ of annealing 30seconds, 72 ℃ of 60seconds, 30 circulations are increased, 72 ℃ are extended 10min, 4 ℃ of preservations of product; Describedly identify that the upstream primer sequence of the molecule marker E-ATG/M-CTC of bottle gourd powder mildew resistance is 5 '-CATGAAAGAAAATCGGCTTGG-3 '; The downstream primer sequence is 5 '-TAACTCCAGCACTCCCTTCCC-3 ';
3, the gel electrophoresis analysis of pcr amplification product: each sample is got amplified production 10 μ l respectively and is added the formulated sample-loading buffer of 40% sucrose 2 μ l by 0.25% bromjophenol blue, mixing, mixture is carried out electrophoretic separation on 2% sepharose, 2/3 position that arrives gel to bromjophenol blue stops electrophoresis, and gel is observed, taken a picture with gel imaging system after EB dyeing;
4, the evaluation of bottle gourd sample powder mildew resistance: according to the gel electrophoresis result, the detected sample of analysis and judgement is to the resistance (see figure 1) of Powdery Mildew: wherein, disease-resistant parent 1 and disease-resistant individual plant 3-14 all amplify the 75bp band, and susceptible parent 2, F
1All do not amplify respective strap for individual plant 15 and susceptible individual plant 16-22, amplification shows that present method qualification result and the field tradition phenotypic evaluation rate of coincideing reach about 95%, and has advantages such as fast, accurately, not being subjected to the external environment restriction.
The different bottle gourd kinds of embodiment 2:(are to the detection of powder mildew resistance)
This routine described bottle gourd material: disease-resistant check variety: J083 is numbered 1; Susceptible check variety: the long melon in Hangzhou is numbered 2; Local disease-resistant variety: waist cucurbit, bracket Pu are numbered 3,4; Free disease-resistant strain is: be numbered 5-7 and 10,11; Free susceptible strain is: be numbered 8-9 and 12-16;
Detection method is carried out according to the following steps:
1, the extraction of bottle gourd genomic dna: get each 0.1 gram of bottle gourd sample young leaflet tablet in seedling stage to be detected, add the liquid nitrogen grind into powder, press after the CTAB method extracts DNA, preservation is standby respectively;
2, the pcr amplification of genomic dna: after in each PCR pipe, adding each bottle gourd sample gene group DNA 20ng of step (1) extraction respectively, add each 0.2 μ M of upstream and downstream primer more successively, dNTP 0.25mM, MgCl
22.0mM, 1 times PCR damping fluid, Taq archaeal dna polymerase 1 unit adds aseptic redistilled water to 20ul; Amplification condition, program are with embodiment 1;
3, the gel electrophoresis analysis of pcr amplification product: each sample is got amplified production 10 μ l respectively and is added the formulated sample-loading buffer of 40% sucrose 2 μ l by 0.25% bromjophenol blue, mix, mixture is carried out electrophoretic separation at 2.0% sepharose, and concrete technology is with embodiment 1;
4, the evaluation of bottle gourd sample powder mildew resistance: according to the gel electrophoresis result, the detected sample of analysis and judgement is to the resistance (see figure 2) of Powdery Mildew, wherein, disease-resistant check variety 1 and local disease- resistant variety 3,4 and free disease-resistant strain are the band that 5-7 and 10,11 all amplifies a 75bp, all do not amplify respective strap and susceptible check variety 2 and free susceptible strain are 8-9 and 12-16.
Embodiment 3:(adopts the detection of test kit of the present invention to different bottle gourd kind powder mildew resistances)
This routine described bottle gourd material: disease-resistant check variety: J083 is numbered 1; Susceptible check variety: the long melon in Hangzhou is numbered 2; Local disease-resistant variety: waist cucurbit, bracket Pu are numbered 3,4; Free disease-resistant strain is numbering 5; Free susceptible strain is: be numbered 6-10.
Detection method is carried out according to the following steps:
1, the extraction of bottle gourd genomic dna: get each 0.1 gram of bottle gourd sample young leaflet tablet in seedling stage to be detected, add the liquid nitrogen grind into powder, press after the CTAB method extracts DNA, preservation is standby respectively;
2, the pcr amplification of genomic dna: the reagent and the primer that provide with test kit carry out pcr amplification, and the amplification volume is 20 μ l; Add template DNA 20ng, each 0.2 μ M of upstream and downstream primer, dNTP 0.25mM, MgCl
22.0mM, 1 times PCR damping fluid, Taq archaeal dna polymerase 1 unit adds aseptic redistilled water to 20 μ l, and amplification condition, program are with embodiment 1;
3, the gel electrophoresis analysis of pcr amplification product: each sample is got amplified production 10 μ l respectively and is added the formulated sample-loading buffer of 40% sucrose 2 μ l by 0.25% bromjophenol blue, mix, mixture is carried out electrophoretic separation at 2.0% sepharose, observe, take a picture with gel imaging system behind the chromogenic reagent that utilizes test kit to provide;
4, the evaluation of bottle gourd sample powder mildew resistance: according to the gel electrophoresis result, the detected sample of analysis and judgement is to the resistance (see figure 3) of Powdery Mildew.
The simultaneous test of embodiment 4:(detection method of the present invention and traditional inoculation identification method)
The inventive method: material therefor and step are with embodiment 1;
The tradition inoculation identification method: material therefor is with embodiment 1, and method is carried out according to the following steps:
1, get kind to be measured and check variety planting seed respectively in nutrition pot, each nutrition pot of back of emerging stays a strain, more than every kind 100 strains; 2, the daily administration in seedling stage routinely cultivation technique carry out; 3, inoculate in four leaves, one heart stage employing bottle gourd Powdery Mildew spore suspension, the 10-15 days " Invest, Then Investigate " state of an illness, the sorus number on 5 blades of every strain investigation calculates disease index; Determine the anti-perception of each material behind the statistics disease index.
The comparison of the inventive method identification of species resistance and traditional inoculation identification method
Project name | The inventive method | The tradition authentication method | Remarks |
Detection speed | Hurry up, need 5 days approximately | Slowly, need 45-50 days altogether | Finger is finished from being seeded into to detect |
Detect cost | Low, about 30 yuan (every sample) | Height, about 500 yuan (every sample) | By detecting 100 seeds |
Detect season | At any time | Susceptible season | |
Accuracy | High | Low | |
Affected by environment | Do not have | Easily |
Sequence table
<110〉Zhejiang Academy of Agricultural Science
<120〉molecule marking method and the test kit thereof of detection bottle gourd powder mildew resistance
<160>21
<210>1
<211>21
<212>DNA
<213〉artificial sequence
<220>
<223〉design according to known array, synthetic by Shanghai Ying Jun biotech company, as the E-ATG/M-CTC molecule marker
Upstream primer
<400>1
CATGAAAGAAAATCGGCTTGG?21
<210>2
<211>21
<212>DNA
<213〉artificial sequence
<220>
<223〉design according to known array, synthetic by Shanghai Ying Jun biotech company, as the E-ATG/M-CTC molecule marker
Downstream primer
<400>2
TAACTCCAGCACTCCCTTCCC?21
Claims (2)
1. detect the molecule marking method of bottle gourd powder mildew resistance, it is characterized in that carrying out according to the following steps:
(1) extraction of bottle gourd genomic dna: behind each bottle gourd sample usefulness CTAB method extraction genomic dna to be detected, preserve respectively, standby;
(2) pcr amplification of genomic dna: with each sample gene group DNA 20ng of bottle gourd, add respectively in each PCR pipe, and add each the 0.2 μ M of upstream and downstream primer that identifies the bottle gourd powder mildew resistance, dNTP 0.25mM, MgCl successively at each Guan Zhongzai
22.0mM, 1 times PCR damping fluid and Taq archaeal dna polymerase 1 unit, and after adding aseptic redistilled water to 20 μ l, at 94 ℃ of pre-sex change 2min, 94 ℃ of 30seconds, 48~50 ℃ of annealing 30seconds, 72 ℃ are extended 60seconds, 30 circulations are increased 4 ℃ of preservations of product under 72 ℃ of extension 10min;
Describedly identify that the upstream primer sequence of bottle gourd powder mildew resistance is 5 '-CATGAAAGAAAATCGGCTTGG-3 '; The downstream primer sequence is 5 '-TAACTCCAGCACTCCCTTCCC-3 ';
(3) gel electrophoresis analysis of pcr amplification product: each sample is got amplified production 10 μ l respectively, and adds by 0.25% bromjophenol blue and the formulated sample-loading buffer 2 μ l of 40% sucrose, mixing; Mixture is carried out electrophoretic separation on 2% sepharose, 2/3 position that arrives gel to bromjophenol blue stops electrophoresis; Gel is observed, is taken a picture with gel imaging system after EB dyeing;
(4) evaluation of bottle gourd sample powder mildew resistance: on gel, there is band to occur according to each sample, determines that promptly this sample has resistance to Powdery Mildew, if the appearance of no band, determine that this sample is to the Powdery Mildew non-resistant.
2. detect the test kit of bottle gourd powder mildew resistance, this test kit comprises box body and 7 PCR pipes, dNTP is housed, MgCl respectively in 5 PCR pipes
2The PCR damping fluid, Taq archaeal dna polymerase and developer EB is characterized in that: it is the downstream primer of 5 '-TAACTCCAGCACTCCCTTCCC-3 ' that upstream primer and the sequence that the sequence of identifying the bottle gourd powder mildew resistance is 5 '-CATGAAAGAAAATCGGCTTGG-3 ' is housed respectively in other 2 PCR pipes.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009101542779A CN101701249B (en) | 2009-11-19 | 2009-11-19 | Molecular marker method for detecting resistance of powdery mildew of bottlegourd and kit thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009101542779A CN101701249B (en) | 2009-11-19 | 2009-11-19 | Molecular marker method for detecting resistance of powdery mildew of bottlegourd and kit thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101701249A CN101701249A (en) | 2010-05-05 |
CN101701249B true CN101701249B (en) | 2011-10-05 |
Family
ID=42156176
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009101542779A Expired - Fee Related CN101701249B (en) | 2009-11-19 | 2009-11-19 | Molecular marker method for detecting resistance of powdery mildew of bottlegourd and kit thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101701249B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102251042B (en) * | 2011-07-22 | 2013-02-06 | 浙江省农业科学院 | Method for quickly detecting purity of seeds of bottle gourd varieties and kit used by same |
CN104480107B (en) * | 2014-11-13 | 2016-11-30 | 浙江省农业科学院 | Molecular marker is utilized to differentiate method and the primer thereof of calabash courd kind fruit bitterness |
-
2009
- 2009-11-19 CN CN2009101542779A patent/CN101701249B/en not_active Expired - Fee Related
Also Published As
Publication number | Publication date |
---|---|
CN101701249A (en) | 2010-05-05 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Prasanna et al. | Cyanobacterial diversity in the rhizosphere of rice and its ecological significance | |
Haling et al. | Direct measurement of roots in soil for single and mixed species using a quantitative DNA-based method | |
CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
Tominaga et al. | Quantitative trait locus analysis of symbiotic nitrogen fixation activity in the model legume Lotus japonicus | |
Zuo et al. | Genetic basis of allelopathic potential of winter wheat based on the perspective of quantitative trait locus | |
CN101701249B (en) | Molecular marker method for detecting resistance of powdery mildew of bottlegourd and kit thereof | |
Mirzapour et al. | Identification of resistant sources in chickpea against Fusarium wilt under greenhouse condition | |
CN108707692B (en) | Method and primer for rapidly identifying purity of hybrid seed of watermelon variety' Hubei watermelon No. 16 | |
Zhou et al. | High temperature reduces the viability of pollen from upland cotton in china | |
CN106701967A (en) | Molecular marker for regulating and controlling major QTL (Quantitative Trait Loci) of included angle of corn leaves and application method of mMolecular marker | |
Rafique et al. | DNA sequence analysis, morphology and pathogenicity of Fusarium oxysporum f. sp. lentis isolates inciting lentil wilt in Pakistan | |
CN107868840B (en) | SSR molecular marker associated with full growth number of days and application in a kind of flax | |
CN102816860A (en) | Molecular marker assisted selection method for female line breeding of cucumber | |
CN105602948A (en) | Genes and method for identifying gossypium hirsutum linn. variety verticillium wilt resistance by fluorescence quantitative PCR technique | |
CN113061639B (en) | Method for determining pathogenicity of potato verticillium wilt pathogenic bacteria | |
Ho et al. | An assessment of DNA polymorphisms and genetic relationships of Casuarina equisetifolia using RAPD markers | |
CN112725521B (en) | Dendrobium chrysotoxum SSR molecular marker primer composition and application thereof | |
Jing et al. | Genetic diversity of a dominant species Stipa bungeana and its conservation strategy in the Loess Plateau of China | |
CN109735651B (en) | Resistance evaluation method for wheat stripe rust and method for controlling wheat stripe rust by using variety of articles | |
CN104212896B (en) | The Molecular Identification primer of a kind of Tobacco Angular Leaf Spot Disease bacterium and authentication method | |
CN109609588B (en) | Method for accurately identifying disease resistance of newly planted sugarcane leaf blight | |
Zhou et al. | Detection and quantification of three distinct Neotyphodium lolii endophytes in Lolium perenne by real time PCR of secondary metabolite genes | |
Rosyara et al. | Variation in south Asian wheat germplasm for seedling drought tolerance traits | |
CN105861637B (en) | For quickly detecting the kit of edible sunflower cenospecies SH338 authenticity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111005 Termination date: 20201119 |