CN101698848B

CN101698848B - Goldfish autonomous transposon gene gfTol2, transposase coded by gene, and use of gene

Info

Publication number: CN101698848B
Application number: CN200910194599A
Authority: CN
Inventors: 邹曙明; 蒋霞云; 何为; 袁剑; 杜雪地; 沈睿杰
Original assignee: Shanghai Maritime University
Current assignee: Shanghai Maritime University; Shanghai Ocean University
Priority date: 2009-08-26
Filing date: 2009-08-26
Publication date: 2012-10-03
Anticipated expiration: 2029-08-26
Also published as: CN101698848A

Abstract

The invention discloses a goldfish autonomous transposon gene gfTol2, which has a nucleotide sequence shown as SEQ ID No:1. The invention also discloses a transposase coded by the gene gfTol2, which has an amino acid sequence shown as SEQ ID No:2. The invention also discloses use of the gene gfTol2 as a gene medicament or a gene reagent for goldfish; and the rate of graded product of the goldfish is improved and offspring mutation is induced by adjusting the concentration of a transcription product of the gene.

Description

The transposase of goldfish autonomous transposon gene gfTol2, this genes encoding and the purposes of this gene

Technical field

The present invention relates to the transposase of a kind of goldfish autonomous transposon gene gfTol2, this genes encoding and the purposes of this gene; The present invention relates to the separation of goldfish autonomous transposon gene; And the separation of transposase code cDNA, also relate to the percentage of A-class goods of utilizing this gene product adjusting goldfish simultaneously and bring out offspring's variation.Belong to fish genetically engineered field.

Background technology

Transposon mainly is divided into two types: one type is the I type transposon with similar retrovirus structure; " duplicating stickup " mechanism of employing; At first DNA is transcribed into RNA; Synthetic DNA under the effect of ThermoScript II, the DNA of reverse transcription inserts other positions of human chromosome, and the position of result on karyomit(e) taken place to move.Another kind of is II type transposon; The swivel base mechanism that main the employing " sheared-sticking card "; Directly be inserted into other position after DNA scaled off from karyomit(e); By the short inverted repeats in two ends (inverted terminal repeat, ITR) with the genomic constitution of coding transposase, but the transposase of this type of transposon inactivation in very long evolution mostly.II type transposon exists in invertebrates such as plants such as petunia, Common Snapdragon, Root of Rocket Consolida, Lathyrus odoratus and some are low, and is widely used in the function and the transgenic research of the catching of crop excellent genes and gene regulating element, gene.

Discovery and the application of II type transposon in vertebrates for a long time always is blank.Up to 1996; The Japan scholar finds a kind of hAT family transposon in a kind of medaka (Oryzias latipes) of whitening variation; This transposon family is representative with the Tam3 transposon of hobo transposon, corn Ac transposon and the Common Snapdragon of fruit bat; Therefore be called hAT family, and called after Tol2 transposon.Blue or green Medaka Tol2 transposon be so far to be found first naturally have an active vertebrates transposon.Blue or green Medaka Tol2 swivel base pattern is the same also through " shearing-sticking card " mode swivel base with other unicellular lower eukaryote DNA transposon, mainly contains 3 processes: 1. be that transposable element drives the purpose functional gene and promotor is cut from getting off from original site; 2. reintegrate in the genome that is transferred species, thereby realize transgenic and heredity in the offspring; 3. above-mentioned 2 processes must be accomplished by the transposase gene catalysis of blue or green Medaka Tol2 self coding.

Goldfish (Carassius auratus Linnaeus; The variation at positions such as the bodily form Goldfish), body colour, head dummy, scale, fin, eye, nose, opercular bone is very outstanding; Through the artificial culture of centuries, at present, China has the goldfish strain of record that kind more than 500 is arranged approximately.Can be divided into grass goldfish (Common goldfish), literary composition plant goldfish (Fantail goldfish) like coloured glaze gold (Ryukin goldfish) and pearl (Fantail pearlscale), telescope goldfish (Goldfish with moor) like butterfly tail (Moor with butterfly tail) and egg kind goldfish (Egg-fish goldfish) 4 class greatly.The seed selection lack of scientific foundation of goldfish breeding and new variety very blindly, causes the descendant inheritting variation serious, and yield rate reduces greatly, and the percentage of A-class goods is below 10%.That is to say that 10,000 tail small fish are cultivated in every breeding, finally can reach the outgoing quality requirement, have only the hundreds of tail.This has not only wasted lot of manpower and material resources, and finished product quantity can not satisfy the demand of world market.Outlet producer usually reduces choice criteria in order to gather together enough quantity, has had a strong impact on Chinese goldfish good reputation in the international market, has destroyed the brand of Chinese goldfish.Find through studying us; The body colour of goldfish is relevant with the gfTol2 transposon insertion mutagenesis of existence in its genome with the build variation; Goldfish gfTol2 transposon has natural radioactivity; In some goldfish kinds of China, extensively exist, goldfish gfTol2 transposon is the second routine vertebrates transposon of finding so far.Highly active goldfish gfTol2 transposon can cause the insertion sudden change; It is one of important motivating force of goldfish genome mutation; Closely related with the genetic stability of proterties such as the body colour of goldfish and build, our practice shows the percentage of A-class goods that can improve the goldfish offspring through transposase activity in the control goldfish embryoid body and brings out offspring's variation.

Summary of the invention

The technical problem that the present invention will solve is a kind of goldfish transposon gene gfTol2 of screening, and the transposase cDNA of this genes encoding, and this gene product and goldfish offspring's genetic stability is closely related.The purpose of this invention is to provide a kind of method that can improve the goldfish offspring percentage of A-class goods and degree of variation.

The technical problem that will solve required for the present invention, can realize through following technical scheme:

As first aspect of the present invention, a kind of goldfish autonomous transposon gene gfTol2 is characterized in that, is the nucleotide sequence of transposase of the aminoacid sequence of coding SEQ ID No:2.

Said gene gfTol2 nucleotide sequence such as SEQ ID No:1.The transposase cDNA of said gene gfTol2 coding, said cDNA is made up of a kind of nucleotide sequence, and the 2170th～3229,3315～3630 and 4018～4498 bit bases of said nucleotide sequence and SEQID No:1 have at least 90% homology.

As second aspect of the present invention, a kind of as above-mentioned transposase of gfTol2 genes encoding is characterized in that the aminoacid sequence of this transposase sequence shown in SEQ ID No:2.

The aminoacid sequence of generation one or several amino acid whose disappearances, replacement or interpolation in the aminoacid sequence of said transposase.

As the third aspect of the invention, a kind of goldfish autonomous transposon gene gfTol2 is as the genomic medicine of goldfish or the purposes of gene reagent.This gene gfTol2 utilizes this gene gfTol2 product to regulate the percentage of A-class goods of goldfish and brings out the offspring to make a variation as a kind of genomic medicine.

Said goldfish is the goldfish of coloured glaze gold, butterfly tail and pearl strain.

Morpholine oligonucleotide (Morpholino oligo) according to the design of the nucleotide sequence shown in SEQ ID No:1 gfTol2; The sequence of said morpholine oligonucleotide is shown in SEQ ID No:21; The morpholine oligonucleotide is injected in the goldfish 1-2 cell stage embryo; Make the endogenous transposase down-regulated expression of goldfish, improve the percentage of A-class goods of goldfish.

GfTol2mRNA according to the design of the nucleotide sequence shown in the SEQ ID No:1; The sequence of said mRNA is injected into gfTol2mRNA in the goldfish 1-2 cell stage embryo shown in SEQ ID No:22, and goldfish transposase concentration is raised; Bring out goldfish offspring variation, be used to obtain new lines.

The present invention is through the separation of Protocols in Molecular Biology means and analysis and the closely-related autonomous transposon gene of goldfish heritable variation, and the goldfish percentage of A-class goods of breeding in the production process for raising lays the foundation with the new variation of acquisition strain.

The inventor is surprised to find that the existence of in coloured glaze gold, pearl and butterfly tail 3 strain goldfish, finding to have Tol2 transposon (called after gfTol2) through extensive and deep research and test.Accomplished the present invention on this basis.In a preference, goldfish autonomous transposon gene gfTol2 of the present invention and uses thereof can comprise: design suitable primer extensively carries out the Tol2 transposon in different fish screening; The separation of goldfish autonomous transposon gene gfTol2; Goldfish gfTol2 transposase Full Length cDNA Cloning; The gfTol2 gene and the goldfish percentage of A-class goods are described in detail as follows with the aspects such as relation of bringing out offspring's variation, related technology:

(1) extensively carries out fish Tol2 screening.

1996; The Inagaki H of Japan Nagoya university and Koga A etc. suddenly change blue or green Medaka (Oryzias latipes) when linkage analysis is carried out in mutation to albefaction; Find that its tyrosinase cdna has inserted the fragment about a 4.7kb; Can in blue or green Medaka genome, carry out autonomous swivel base, after after deliberation this transposable element called after Tol2 transposon is belonged to hAT family.This is first natural activated transposon of in vertebrates, finding so far.The contriver finds on second coding region of second coding region of corn AC and blue or green Medaka Tol2 transposon; It is 100% aminoacid sequence that two sections similarities are arranged; Wherein the segmental size of first amino acid similarity is 9 amino acid (CACHILNLV), and second amino acid similarity fragment is 6 amino acid (TRWNST) sequences.According to this 2 amino acid conserved regions design primer SEQ ID No:3 and SEQ ID No:4; In nearly 20, screen in cultured fishes and the 6 strain goldfish, in coloured glaze gold (Gold plating goldfish), pearl (Genuine pearl goldfish) and butterfly tail (Butterfly Tailgoldfish) 3 strain goldfish, find to have the existence of complete Tol2 transposon gfTol2 gene at last.

(2) separation of goldfish autonomous transposon gene gfTol2.

Since sequence and blue or green Medaka sequence that primer SEQ ID No:3 and SEQ ID No:4 increase in coloured glaze gold goldfish have very high similarity.Next; The inventor with reference to the Tol2 transposon (AB031079.1) of the blue or green Medaka among the GenBank designed SEQ ID No:5 respectively and SEQ ID No:6, SEQ ID No:5 and SEQ ID No:7, SEQ ID No:3 and SEQ ID No:8, SEQ ID No:4 and SEQ ID No:9, SEQ ID No:7 and SEQ ID No:8, SEQ ID No:10 and SEQ ID No:11 are many to combination of primers; Go forward side by side performing PCR fragment amplification, order-checking and juxtaposition fragment assembly have finally obtained complete goldfish gfTol2 transposon dna sequence dna (SEQ ID No:1).

(3) goldfish gfTol2 transposase Full Length cDNA Cloning.

When the embryo of gfTol2 genetic expression is arranged phase cDNA carry out 3 '-with 5 '-RACE amplification.Compare 5 '-/3 '-RACE sequence lap with the CLUSTAL W program in BioEdit 7.0 softwares; Remove the primer part that add at 5 '-/3 '-RACE sequence two ends; Splicing obtains goldfish gfTol2 full length cDNA sequence, and infers and goldfish gfTol2 transposase encoding amino acid sequence (SEQ ID No:2).

(4) improve the goldfish percentage of A-class goods through morpholine oligonucleotide (Morpholino oligo) silent technology

The morpholine oligonucleotide of external synthetic gfTol2 transposase gene is gone into the goldfish embryo of 1-2 cell stage through microinjection, can disturb and lower the expression amount of gfTol2 transposase mRNA, improves the ratio with the similar offspring of parent's proterties, the raising goldfish percentage of A-class goods.

(5) bring out goldfish offspring variation through the concentration that increases gfTol2 transposase mRNA

The mRNA of external synthetic gfTol2 transposase gene; Go into the goldfish embryo of 1-2 cell stage through microinjection, can increase the expression amount of gfTol2 transposase mRNA, improve the activity of goldfish endogenous transposon; Cause swivel base and insert mutagenesis, improve the variation frequency of goldfish.

Beneficial effect of the present invention:

In goldfish, find to have the autonomous gfTol2 transposon gene and the transposase code cDNA of natural radioactivity, the heredity of goldfish transposon gfTol2 and goldfish is closely related with variation.Through reducing the expression amount of transposase mRNA, reduce the insertion mutagenesis of gfTol2, can make more goldfish offspring keep parent's inherited character, improve the percentage of A-class goods of goldfish, reduce human and material resources consumption, improve the benefit of goldfish plant; In addition,, increase the insertion mutagenesis of gfTol2, can make more goldfish offspring produce the variation that is different from the parent, thereby create breeding material, be used to obtain new lines through increasing the expression amount of transposase mRNA.

Description of drawings

Further specify the present invention below in conjunction with accompanying drawing and embodiment.

Fig. 1 is the electrophorogram that in coloured glaze gold, pearl and 3 goldfish strains of butterfly tail, is amplified the gfTol2 transposon by SEQ ID No:10 and SEQ ID No:11, SEQ ID No:3 and SEQ ID No:8 combination of primers;

Annotate: wherein M is a molecular weight marker; 1-10: the band that uses SEQ ID No:10 and SEQ ID No:11 combination of primers to amplify; Size is about 1447bp, 11-20: the band that uses SEQ ID No:3 and SEQ IDNo:8 combination of primers to amplify, size is about 1882bp.

Fig. 2 amplifies the expression figure of gfTol2 by SEQ ID No:10 and SEQ ID No:11 combination of primers at the different times of coloured glaze gold goldfish fetal development, and the hatching water temperature is 16-19 ℃.

Fig. 3 is the expression figure that is amplified gfTol2 by SEQ ID No:10 and SEQ ID No:11 combination of primers at coloured glaze gold goldfish adult fish different tissues.

Fig. 4 be behind coloured glaze gold goldfish 1-2 cell stage embryo's microinjection morpholine oligonucleotide (Morpholinooligo) and gfTol2 transposase mRNA gastrul stage embryo gfTol2 transposase gene real-time quantitative PCR express and scheme.* * is extremely significantly p＜0.001 of difference.

Embodiment

In order to make technique means of the present invention, creation characteristic, to reach purpose and effect and be easy to understand and understand,, further set forth the present invention below in conjunction with concrete diagram.

Below in conjunction with the practical implementation case, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, unspecified technology is a routine techniques.

The separation of embodiment 1, goldfish autonomous transposon gene gfTol2

Through comparing corn AC transposon (GenBank accession number: P08770) with blue or green Medaka Tol2 transposon (GenBank accession number: aminoacid sequence AB031079.1); We find on second coding region of second coding region of corn AC and blue or green Medaka Tol2 transposon; It is 100% aminoacid sequence that two sections similarities are arranged; Wherein the segmental size of first amino acid similarity is 9 amino acid (CACHILNLV), and second amino acid similarity fragment is 6 amino acid (TRWNST) sequences.Nucleotide sequence according to these two sections amino acid conserved sequences; Design primer SEQ ID No:3 and SEQID No:4 respectively; Utilize this a pair of primer (SEQ ID No:3 and SEQ ID No:4) to carry out the amplification of hAT family transposon small segment, the PCR response procedures is: 94 ℃ of 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 60s, 35 circulations; 72 ℃ prolong 5min.2008, we attempted utilizing this primer in the nearly 20 kinds of common cultured fishes described in the materials and methods (green grass or young crops, grass, silver carp, flathead, carp, crucian carp, bream, tilapia, perch, flower perch, lefteye flounder etc.), to seek transposon.Yet, all can not amplify the fragment similar in these cultured fishes genomes with this conservative fragments.

Under the situation of chance; Through using this to carrying out pcr amplification, the discovery that we are pleasantly surprised among the DNA of primer (SEQ ID No:3 and SEQ ID No:4) to coloured glaze gold strain goldfish (literary composition is planted): this can amplify small segment to primer in the genome of coloured glaze gold strain goldfish.The respective regions of small segment that from goldfish, amplifies and blue or green Medaka Tol2 transposon has very high genetic resemblance degree (99%).Since sequence and blue or green Medaka sequence that primer SEQ IDNo:3 and SEQ ID No:4 increase in coloured glaze gold goldfish have very high similarity.Next; We with reference to the Tol2 transposon (AB031079.1) of the blue or green Medaka among the GenBank designed SEQ ID No:5 respectively and SEQ ID No:6, SEQ ID No:5 and SEQ ID No:7, SEQ ID No:3 and SEQ ID No:8, SEQ ID No:4 and SEQ ID No:9, SEQ ID No:7 and SEQ ID No:8, SEQ ID No:10 and SEQ ID No:11 are many to combination of primers, (the PCR response procedures is the performing PCR fragment amplification of going forward side by side: 94 ℃ of 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 60s, 35 circulations; 72 ℃ prolong 5min), order-checking and juxtaposition fragment assembly, finally obtained complete goldfish Tol2 transposon dna sequence dna (SEQ ID No:1).

Behind the dna sequence dna that has obtained coloured glaze gold strain goldfish Tol2 transposon; We further in the common goldfish of 6 strains (grass goldfish, red lion, butterfly tail, coloured glaze gold, pearl, Lan Shou) and other nearly edge aquarium fish (bright and beautiful carp, color carp) carry out the amplification analysis of Tol2 transposon, each 10 tail of each strain.Through use primer SEQ ID No:10 and SEQ ID No:11 combination, and SEQ ID No:3 and SEQ ID No:8 combination, (the PCR response procedures is: 94 ℃ of 5min to carry out a strain pcr amplification; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 60s, 35 circulations; 72 ℃ prolong 5min), these two pairs of primers have been contained the dna sequence dna of the transposase of almost whole goldfish Tol2.Experiment finds in coloured glaze gold, pearl, butterfly tail, to exist complete Tol2 transposon (Fig. 1), and the goldfish of strains such as the grass goldfish that detects in addition, red lion, Lan Shou, bright and beautiful carp, color carp does not amplify similar or complete PCR band.

Through using SEQ ID No:10 and SEQ ID No:11 combination of primers to amplify the expression of gfTol2 at 10 hours, 24 hours, 34 hours, 48 hours of the golden goldfish fetal development of coloured glaze and week age; The hatching water temperature is 16-19 ℃, and the result is as shown in Figure 2.The result shows: gfTol2 has a higher expression in early days the fetal development of coloured glaze gold goldfish, and along with growth is carried out, the expression amount of gfTol2 is on a declining curve.

Through using SEQ ID No:10 to become fish ovaries, spermary, the heart, liver, spleen, stomach, kidney, intestines, eye, flesh, the gill and fin to amplify the expression figure of gfTol2 with SEQ ID No:11 combination of primers coloured glaze gold goldfish, the result is as shown in Figure 3.The result shows: gfTol2 expression amount in coloured glaze gold goldfish ovary is the highest, be liver secondly, and expression amount is lower in spermary, the heart, spleen, stomach, kidney, intestines, eye, flesh, the gill and fin.

Embodiment 2, goldfish gfTol2 transposase Full Length cDNA Cloning

Coloured glaze gold goldfish is derived from the different times embryo; Get 10 respectively and extract total RNA with TRIZOL (Invitrogen) reagent; Be reversed to 3 ' end strand cDNA with the reversed transcriptive enzyme among TaKaRa RNA PCR Kit (AMV) Ver.3.0; Design 1 aligns anti-primer (SEQ ID No:12 and SEQ ID No:13) amplification goldfish gfTol2 small segment, and clones and sequencing analysis (trust Huada Gene Research Center, Beijing), to judge whether to exist the gfTol2 expression of gene.When the embryo of gfTol2 genetic expression is arranged phase cDNA carry out 3 '-with 5 '-RACE amplification.

3 '-RACE: according to survey small segment sequences Design 3 '-RACE primer (SEQ ID No:14) and 3 '-RACE nested primer (SEQ ID No:15); With 3 ' end strand cDNA is template; As reverse primer, 3 '-RACE primer (SEQID No:14) carries out pcr amplification for forward primer with the M13Primer M4 in 3 '-RACE test kit (SEQ ID No:16); And then be template with primary PCR product, carrying out the PCR second time with M13Primer M4 and 3 '-RACE nested primer (SEQ ID No:15), amplified production is through 1.2% sepharose; With TBE is damping fluid, and after electrophoretic separation under the voltage of 5V/cm, the purpose fragment is reclaimed in rubber tapping; To reclaim product and be connected in the pMD-19T carrier (TaKaRa), and change bacillus coli DH 5 alpha over to, the picking positive colony; Being inoculated into penbritin content is in the liquid LB substratum of 50 μ g/mL; 37 ℃ of shaken overnight are cultivated, and get 200ml bacterium liquid glycerine and preserve, and be sent to the Huada Gene Research Center, Beijing and carry out two-way order-checking.Above-mentioned 2 take turns the PCR response procedures is: 94 ℃ of 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 60s, 35 circulations; 72 ℃ prolong 5min.

5 '-RACE: on 3 '-RACE sequencing result basis, according to SMART ^TMThe requirement of RACE cDNAAmplification Kit specification sheets, design 5 '-RACE primer (SEQ ID No:17) and 5 '-RACE nested primer (SEQ ID No:18).Obtain 5 ' end, the first chain cDNA with the test kit counter-rotating, (SEQ ID No:17) carries out PCR with 10 * Universal Primer A (UPM) and 5 '-RACE primer in the test kit.The PCR response procedures is: 94 ℃ of 5min; 94 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 1min, 35 circulations; 72 ℃ prolong 5min.Then with the first time PCR product be template, be the PCR second time with Nested Universal PrimerA (NUP) with the 5 '-RACE nested primer (SEQ ID No:18) that designs, the PCR response procedures is: 94 ℃ of 5min; 94 ℃ of 30s, 52 ℃ of 30s, 72 ℃ of 50s, 35 circulations; 72 ℃ prolong 5min.The nest-type PRC products therefrom is a damping fluid with TBE, after electrophoretic separation under the voltage of 5V/cm through 1.2% sepharose; Tap rubber and reclaim the purpose fragment, will reclaim product and be connected in the pMD-19T carrier (TaKaRa), and change bacillus coli DH 5 alpha over to; The picking positive colony, being inoculated into penbritin content is in the liquid LB substratum of 50 μ g/mL, 37 ℃ of shaken overnight are cultivated; Get 200ml bacterium liquid glycerine and preserve, and be sent to the Huada Gene Research Center, Beijing and carry out two-way order-checking.

Compare 5 '-/3 '-RACE sequence lap with the CLUSTAL W program in BioEdit 7.0 softwares; Remove the primer part that add at 5 '-/3 '-RACE sequence two ends; Splicing obtains goldfish gfTol2 full length cDNA sequence; Said cDNA is made up of a kind of nucleotide sequence, and the 2170th～3229,3315～3630 and 4018～4498 bit bases of said nucleotide sequence and SEQ IDNo:1 have at least 90% homology.And infer and goldfish gfTol2 transposase encoding amino acid sequence (SEQ ID No:2).

The relation of embodiment 3, gfTol2 gene overexpression and goldfish variation

Coloured glaze gold goldfish is derived from the different times embryo; Get 10 respectively and extract total RNA with TRIZOL (Invitrogen) reagent; Be reversed to 3 ' end strand cDNA with the reversed transcriptive enzyme among TaKaRa RNA PCR Kit (AMV) Ver.3.0; Design 1 aligns anti-primer (SEQ ID No:19 and SEQ ID No:20) amplification goldfish gfTol2 full-length cDNA, and the PCR response procedures is: 94 ℃ of 5min; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 60s, 35 circulations; 72 ℃ prolong 5min.The PCR product is behind BamHI and XbaI double digestion, and subclone is in the pCS2+ carrier of BamHI and XbaI double digestion.The pCS2+ recombinant plasmid adopts Sp6 mMessage mMachine kit (Ambion) test kit to carry out gfTol2mRNA and synthesizes after the NotI linearizing.The coloured glaze gold goldfish embryo that the gfTol2 mRNA that obtains injects the 1-2 cell stage through microinjection, each embryo's injection 1nl gfTol2mRNA solution, ID is about 200pg.The result shows that the expression amount of the gfTol2 transposase mRNA of the experimental group of injection gfTol2mRNA reaches 2.83, is significantly higher than control group (0.91) (Fig. 4).

Test one: inject 200 of coloured glaze gold goldfish embryos altogether, through raising in 6 months, 152 tails that become to live, test group offspring is 6 with the ratio that the parent has similar proterties (build and body colour), ratio is 3.9%; And control group 200 tails, it is 18 that the offspring has similar proterties ratio with the parent, ratio is 9.0%.

Test two: inject 230 of coloured glaze gold goldfish embryos altogether, through raising in 6 months, 198 tails that become to live, test group offspring is 10 with the ratio that the parent has similar proterties, ratio is 5.0%; And control group 200 tails, it is 21 that the offspring has similar proterties ratio with the parent, ratio is 10.5%.The result shows that gfTol2 gene mRNA overexpression can significantly increase the variation of goldfish, can be used for the seed selection process of good new lines.

The relation of embodiment 4, gfTol2 gene silencing and the goldfish percentage of A-class goods

According to the 2160-2184 shown in the goldfish gfTol2 SEQ ID No:1, the interval nucleotide sequence design morpholine oligonucleotide (Morpholino oligo) of 3305-3329; Be injected in the goldfish 1-2 cell stage embryo; Each embryo's injection 1nl solution, the about 15ng of ID.The result shows that the expression amount of the gfTol2 transposase mRNA of the experimental group of injection morpholine oligonucleotide is merely 0.08, significantly is lower than control group (0.98) (Fig. 4).

Test one: inject 200 of coloured glaze gold goldfish embryos altogether, through raising in 6 months, 168 tails that become to live, test group offspring is 44 with the ratio that the parent has similar proterties (build and body colour), ratio is 26.2%; And control group 200 tails, it is 18 that the offspring has similar proterties ratio with the parent, ratio is 9.0%.

Test two: inject 223 of coloured glaze gold goldfish embryos altogether, through raising in 6 months, 155 tails that become to live, test group offspring is 45 with the ratio that the parent has similar proterties, ratio is 29.0%; And control group 200 tails, it is 21 that the offspring has similar proterties ratio with the parent, ratio is 10.5%.The result shows that the gfTol2 gene silencing makes endogenous transposase down-regulated expression, significantly improves the percentage of A-class goods of goldfish, can be used for increasing in the propagation production process goldfish percentage of A-class goods.

More than show and described ultimate principle of the present invention, principal character and advantage of the present invention.The technician of the industry should understand; The present invention is not restricted to the described embodiments; That describes in the foregoing description and the specification sheets just explains principle of the present invention; The present invention also has various changes and modifications under the prerequisite that does not break away from spirit and scope of the invention, and these variations and improvement all fall in the scope of the invention that requires protection.The present invention requires protection domain to be defined by appending claims and equivalent thereof.

Attach: dna nucleotide sequence involved in the present invention is following

SEQUENCE LISTING

< 110>Shanghai Ocean University

< 120>purposes of the transposase of goldfish autonomous transposon gene gfTol2, this genes encoding and this gene

< 130>specification sheets sequence table

<160>22

<170>PatentIn version 3.3

<210>SEQ ID No：1

<211>4686

<212>DNA

<213>carassius auratus(linnaeus)

<400>1

cagaggtgta aaagtacttg agtaatttta cttgattact gtacttaagt attatttttg 60

gggatttttt actttacttg agtacaatta aaaatcaata cttttacttt tacttaatta 120

catttttttt agaaaaaaag tactttttac tccttacaat tttatttaca gtcaaaaagt 180

acttattttt tggagatcac ttcattctat tttcccttgc tattaccaaa ccaattgaat 240

tgcgctgatg cccagtttaa tttaaatgtt atttattctg cctatgaaaa tcgttttcac 300

attatatgaa attggtcaga catgttcatt ggtcctttgg aagtgacgtc atgtcacatc 360

tattaccaca atgcacagca ccttgacctg gaaattagag aaattataac agtcaatcag 420

tggaagaaaa tggaggaagt atgtgattca tcagcagctg cgagcagcac agtccaaaat 480

cagccccagg atcaagagca cccgtggccg tatcttcgcg aattcttttc ttttagtggt 540

gtaaataaag attcattcaa gatgaaatgt gtcctctgtc tcccgcttaa taaagaaata 600

tcggccttca aaagttcgcc atcaaaccta aggaagcata ttgaggtaag tacattaagt 660

attttgtttt actgatagtt tttttttttt ttttgggtgt gcatgttttg acgttgatgg 720

ctcgcctttt atatgtgtag taggcctatt ttcactaatg catgcgattg acaatataag 780

gctcacgtaa taaaatgcta aaatgcattt gtaattgtct gtaaattatt tgctatggta 840

acgttaggtc cacgggaaat ttggcaccta ttgcagcttt gaataatcat tatcattccg 900

tgctctcatt gtgtttgaat tcatgcaaaa cataagaaaa tcaagcgaga aatttttatt 960

tttaataatt accaaacatg ttgtattgtc aaaacggtaa cactttacaa tgaggttgat 1020

tagttcatgt attaactaac attaaataac catgagcaat acatttgtta ctgtatctgt 1080

taatcttggt taacgttagt taatagaaat acagatgttc attgtttgtt catgttagtt 1140

cacagtgcat taactaatgt taacaagata taaagtatta gtaaatgttg aaattaacat 1200

gtatacgtgc agttcattat tagttcatgt taactaatgt agttaactaa cgaaccttat 1260

tgtaaaagtg ttaccatcaa aactaatgta atgaaatcaa ttcaccctgt catgtcagcc 1320

ttacagtcct gtgtttttgt caatataatc agaaataaaa ttaatgtttg attgtcacta 1380

aatgctactg tatttctaaa atcaagtatt taacattata aagtgtgcaa ttggctgcaa 1440

atgtcagttt tattaaaggg ttagttcacc caaaaatgaa aataatgtca ttaatgactc 1500

gccctcatgt cgttccaagc ccgtaagacc tccgttcatc ttcagaacac agtttaagat 1560

attttagatt tagtccgaga gctttctgtg cctccattga gaatgtatgt acggcatact 1620

gtccatgtcc agaaaggtaa ttaaaacatc atcaaagtag tccatgtgac atcagtgggt 1680

tagttagaat tttttgaacc atcgaataca ttttgacttt attcggcatt gtattctctt 1740

ccgggtctgt tgtcaatccg cgttcacgac ttcgcagtga cgctacaatg ctgaataaag 1800

tcgtaggttt tgttattttc ggaccaaaat gtattttcga tgcttcaaat aattctacct 1860

aacccactga tgtcacatgg actactttga tgatgttttt attacctttc tggacatgga 1920

cagtataccg tacatacatt ttcagtggag ggacagaaag ctctcggact aaatcctaaa 1980

atatcttaaa ctgtgttccg aagatgaacg gaggtgttac gggcttgtaa tgacatgagg 2040

gtgagtcatt aataacatct tttcattttt gggtgaacta accctttaat gctgtaatca 2100

gagagtgtat gtgtaattgt tacatttatt gcatacaata taaatattta tttgttgttt 2160

ttacagagaa tgcacccaaa ttacctcaaa aactactcta aattgacagc acagaagaga 2220

aagatcggga cctccaccca tgcttccagc agtaagcaac tgaaagttga ctcagttttc 2280

ccagtcaaac atgtgtctcc agtcactgtg aacaaagcta tattaaggta catcattcaa 2340

ggacttcatc ctttcagcac tgttgatctg ccatcattta aagagctgat tagtgcactg 2400

cagcctggca tttctgtcat tacaaggcct actttacgct ccaagatagc tgaagctgct 2460

ctgatcatga aacagaaagt gactgctgcc atgagtgaag ttgaatggat tgcaaccaca 2520

acggattgtt ggactgcacg tagaaagtca ttcattggtg taactgctca ctggatcaac 2580

cctggaagtc ttgaaagaca ttccgccttt gcacttgcct gcaaaagatt aatgggctct 2640

catacttttg aggtactggc cagtgccatg aatgatatcc actcagagta tgaaatacgt 2700

gacaaggttg tttgcacaac cacagacagt ggttccaact ttctgaaggc tttcagagtt 2760

tttggtgtgg aaaacaatga tatcgagact caggcaagaa ggtgtgaaag tgatgacact 2820

gattctgaag gctgtggtga gggaagtgat ggtgtggaat gccaagatgc ctcacgagtc 2880

ctggaccaag acgatggctt cgaattccag ctaccaaaac atcaaaagtg tgcctgtcac 2940

ttacttaacc tagtctcaag cgttgatgcc caaaaagctc tctcaaatga acactacaag 3000

aaactctaca gatctgtctt tggcaaatgc caagctttat ggaataaaag cagccgatcg 3060

gctctagcag ctgaagctgt tgaatcagaa agccggcttc agcttttaag gccaaaccaa 3120

acgcggtgga attcaacttt tatggctgtt gacagaattc ttcaaatttg caaagaagca 3180

ggagaaggcg cacttcggaa tatatgcacc tctcttgagg ttccaatgta agtgtttttc 3240

ccctctatcg atgtaaacaa atgtgggttg ttgttgttta atactctttg attatgctga 3300

tttctcctgt aggtttaatc cagcagaaat gctgttcttg acagagtggg ccaacacaat 3360

gcgtccagtt gcaaaagtac tcgacatctt gcaagcggaa acgaatacac agctggggtg 3420

gctgctgcct agtgtccatc agttaagctt gaaacttcag cgactccacc attctctcag 3480

gtactgtgac ccacttgtgg atgccctaca acaaggaatc caaacacgat tcaagcatat 3540

gtttgaagat cctgagatca tagcagctgc catccttctc cctaaatttc ggacctcttg 3600

gacaaatgat gaaaccatca taaaacgagg taaatgaatg caagcaacat acacttgacg 3660

aattctaatc tgggcaacct ttgagccata ccaaaattat tcttttattt atttattttt 3720

gcacttttta ggaatgttat atcccatctt tggctgtgat ctcaatatga atattgatgt 3780

aaagtattct tgcagcaggt tgtagttatc cctcagtgtt tcttgaaaca aaactcatat 3840

gtatcatatg tggtttggaa atgcagttag attttatgct aaaataaggg atttgcatga 3900

ttttagatgt agatgactgc acgtaaatgt agttaatgac aaaatccata aaatttgttc 3960

ccagtcagaa gcccctcaac caaacttttc tttgtgtctg ctcactgtgc ttgtaggcat 4020

ggactacatc agagtgcatc tggagccttt ggaccacaag aaggaattgg ccaacagttc 4080

atctgatgat gaagattttt tcgcttcttt gaaaccgaca acacatgaag ccggcaaaga 4140

gttggatgga tatctggcct gtgtttcaga caccagggag tctctgctca cgtttcctgc 4200

tatgtgcagc ctctctatca agactaatac acctcttccc gcatcggctg cctgtgagag 4260

gcttttcagc actgcaggat tgcttttcag ccccaaaaga gctaggcttg acactaacaa 4320

ttttgagaat cagcttctac tgaagttaaa tctgaggttt tacaactttg agtagcgtgt 4380

actggcatta gattgtctgt cttatagttt gataattaaa tacaaacagt tctaaagcag 4440

gataaaacct tgtatgcatt tcatttaatg ttttttgaga ttaaaagctt aaacaagagt 4500

ctctagtttt cattcttgtt tttattttta cttctttaat actcaagtac aaatttaatg 4560

tggcactttt ttacttttac tcaagtatga ttctggccag atacttttag ttttaattga 4620

gtaaaatttt tcctaaatac ttgtactttc actttagtaa atatttttag tacttttaca 4680

cctctg 4686

<210>SEQ ID No：2

<211>578

<212>PRT

<213>carassius auratus(linnaeus)

<400>2

Met His Pro Asn Tyr Leu Lys Asn Tyr Ser Lys Leu Thr Ala Gln

5 10 15

Lys Arg Lys Ile Gly Thr Ser Thr His Ala Ser Ser Ser Lys Gln

20 25 30

Leu Lys Val Asp Ser Val Phe Pro Val Lys His Val Ser Pro Val

35 40 45

Thr Val Asn Lys Ala Ile Leu Arg Tyr Ile Ile Gln Gly Leu His

50 55 60

Pro Phe Ser Thr Val Asp Leu Pro Ser Phe Lys Glu Leu Ile Ser

65 70 75

Ala Leu Gln Pro Gly Ile Ser Val Ile Thr Arg Pro Thr Leu Arg

80 85 90

Ser Lys Ile Ala Glu Ala Ala Leu Ile Met Lys Gln Lys Val Thr

95 100 105

Ala Ala Met Ser Glu Val Glu Trp Ile Ala Thr Thr Thr Asp Cys

110 115 120

Trp Thr Ala Arg Arg Lys Ser Phe Ile Gly Val Thr Ala His Trp

125 130 135

Ile Asn Pro Gly Ser Leu Glu Arg His Ser Ala Phe Ala Leu Ala

140 145 150

Cys Lys Arg Leu Met Gly Ser His Thr Phe Glu Val Leu Ala Ser

155 160 165

Ala Met Asn Asp Ile His Ser Glu Tyr Glu Ile Arg Asp Lys Val

170 175 180

Val Cys Thr Thr Thr Asp Ser Gly Ser Asn Phe Leu Lys Ala Phe

185 190 195

Arg Val Phe Gly Val Glu Asn Asn Asp Ile Glu Thr Gln Ala Arg

200 205 210

Arg Cys Glu Ser Asp Asp Thr Asp Ser Glu Gly Cys Gly Glu Gly

215 220 225

Ser Asp Gly Val Glu Cys Gln Asp Ala Ser Arg Val Leu Asp Gln

230 235 240

Asp Asp Gly Phe Glu Phe Gln Leu Pro Lys His Gln Lys Cys Ala

245 250 255

Cys His Leu Leu Asn Leu Val Ser Ser Val Asp Ala Gln Lys Ala

260 265 270

Leu Ser Asn Glu His Tyr Lys Lys Leu Tyr Arg Ser Val Phe Gly

275 280 285

Lys Cys Gln Ala Leu Trp Asn Lys Ser Ser Arg Ser Ala Leu Ala

290 295 300

Ala Glu Ala Val Glu Ser Glu Ser Arg Leu Gln Leu Leu Arg Pro

305 310 315

Asn Gln Thr Arg Trp Asn Ser Thr Phe Met Ala Val Asp Arg Ile

320 325 330

Leu Gln Ile Cys Lys Glu Ala Gly Glu Gly Ala Leu Arg Asn Ile

335 340 345

Cys Thr Ser Leu Glu Val Pro Met Phe Asn Pro Ala Glu Met Leu

350 355 360

Phe Leu Thr Glu Trp Ala Asn Thr Met Arg Pro Val Ala Lys Val

365 370 375

Leu Asp Ile Leu Gln Ala Glu Thr Asn Thr Gln Leu Gly Trp Leu

380 385 390

Leu Pro Ser Val His Gln Leu Ser Leu Lys Leu Gln Arg Leu His

395 400 405

His Ser Leu Arg Tyr Cys Asp Pro Leu Val Asp Ala Leu Gln Gln

410 415 420

Gly Ile Gln Thr Arg Phe Lys His Met Phe Glu Asp Pro Glu Ile

425 430 435

Ile Ala Ala Ala Ile Leu Leu Pro Lys Phe Arg Thr Ser Trp Thr

440 445 450

Asn Asp Glu Thr Ile Ile Lys Arg Gly Met Asp Tyr Ile Arg Val

455 460 465

His Leu Glu Pro Leu Asp His Lys Lys Glu Leu Ala Asn Ser Ser

470 475 480

Ser Asp Asp Glu Asp Phe Phe Ala Ser Leu Lys Pro Thr Thr His

485 490 495

Glu Ala Gly Lys Glu Leu Asp Gly Tyr Leu Ala Cys Val Ser Asp

500 505 510

Thr Arg Glu Ser Leu Leu Thr Phe Pro Ala Met Cys Ser Leu Ser

515 520 525

Ile Lys Thr Asn Thr Pro Leu Pro Ala Ser Ala Ala Cys Glu Arg

530 535 540

Leu Phe Ser Thr Ala Gly Leu Leu Phe Ser Pro Lys Arg Ala Arg

545 550 555

Leu Asp Thr Asn Asn Phe Glu Asn Gln Leu Leu Leu Lys Leu Asn

560 565 570

Leu Arg Phe Tyr Asn Phe Glu

575

<210>SEQ ID No：3

<211>22

<212>DNA

< 213>artificial sequence

<400>3

TGTGCCTGTCACTTACTTAACC 22

<210>SEQ ID No：4

<211>18

<212>DNA

< 213>artificial sequence

<400>4

AGTTGAATTCCACCGCGT 18

<210>SEQ ID No：5

<211>18

<212>DNA

< 213>artificial sequence

<400>5

CAGAGGTGTAAAAGTACT 18

<210>SEQ ID No：6

<211>22

<212>DNA

< 213>artificial sequence

<400>6

GGCCGATATTTCTTTATTAAGC 22

<210>SEQ ID No：7

<211>22

<212>DNA

< 213>artificial sequence

<400>7

ATGGACTACATCAGAGTGCATC 22

<210>SEQ ID No：8

<211>22

<212>DNA

< 213>artificial sequence

<400>8

CTACTCAAAGTTGTAAAACCTC 22

<210>SEQ ID No：9

<211>21

<212>DNA

< 213>artificial sequence

<400>9

ATAGCTGAAGCTGCTCTGATC- 21

<210>SEQ ID No：10

<211>22

<212>DNA

< 213>artificial sequence

<400>10

GCTTAATAAAGAAATATCGGCC 22

<210>SEQ ID No：11

<211>21

<212>DNA

< 213>artificial sequence

<400>11

GATCAGAGCAGCTTCAGCTAT 21

<210>SEQ ID No：12

<211>20

<212>DNA

< 213>artificial sequence

<400>12

CCCACTTGTGGATGCCCTAC 20

<210>SEQ ID No：13

<211>20

<212>DNA

< 213>artificial sequence

<400>13

AACTCTTTGCTGGCTTCATG 20

<210>SEQ ID No：14

<211>20

<212>DNA

< 213>artificial sequence

<400>14

-TTGTCCAAGAGGTCCGAAAT 20

<210>SEQ ID No：15

<211>22

<212>DNA

< 213>artificial sequence

<400>15

ATGGACTACATCAGAGTGCATC 22

<210>SEQ ID No：16

<211>17

<212>DNA

< 213>artificial sequence

<400>16

GTTTTCCCAGTCACGAC 17

<210>SEQ ID No：17

<211>25

<212>DNA

< 213>artificial sequence

<400>17

AGACTTCCAGGGTTGATCCAGTGAG 25

<210>SEQ ID No：18

<211>23

<212>DNA

< 213>artificial sequence

<400>18

GCAGCAGTCACTTTCTGTTTCAT 23

<210>SEQ ID No：19

<211>25

<212>DNA

< 213>artificial sequence

<400>19

GGATCCGTGATTTGAATCGCGGTGT 25

<210>SEQ ID No：20

<211>28

<212>DNA

< 213>artificial sequence

<400>20

TCTAGATCTTGTTTAAGCTTTTAATCTC 28

<210>SEQ ID No：21

<211>25

<212>DNA

< 213>artificial sequence

<400>21

CTCTCTTACGTGGGTTTAATGGAGT 25

<210>SEQ ID No：22

<211>1734

<212>DNA

< 213>artificial sequence

<400>22

atgcacccaa attacctcaa aaactactct aaattgacag cacagaagag aaagatcggg 60

acctccaccc atgcttccag cagtaagcaa ctgaaagttg actcagtttt cccagtcaaa 120

catgtgtctc cagtcactgt gaacaaagct atattaaggt acatcattca aggacttcat 180

cctttcagca ctgttgatct gccatcattt aaagagctga ttagtgcact gcagcctggc 240

atttctgtca ttacaaggcc tactttacgc tccaagatag ctgaagctgc tctgatcatg 300

aaacagaaag tgactgctgc catgagtgaa gttgaatgga ttgcaaccac aacggattgt 360

tggactgcac gtagaaagtc attcattggt gtaactgctc actggatcaa ccctggaagt 420

cttgaaagac attccgcctt tgcacttgcc tgcaaaagat taatgggctc tcatactttt 480

gaggtactgg ccagtgccat gaatgatatc cactcagagt atgaaatacg tgacaaggtt 540

gtttgcacaa ccacagacag tggttccaac tttctgaagg ctttcagagt ttttggtgtg 600

gaaaacaatg atatcgagac tcaggcaaga aggtgtgaaa gtgatgacac tgattctgaa 660

ggctgtggtg agggaagtga tggtgtggaa tgccaagatg cctcacgagt cctggaccaa 720

gacgatggct tcgaattcca gctaccaaaa catcaaaagt gtgcctgtca cttacttaac 780

ctagtctcaa gcgttgatgc ccaaaaagct ctctcaaatg aacactacaa gaaactctac 840

agatctgtct ttggcaaatg ccaagcttta tggaataaaa gcagccgatc ggctctagca 900

gctgaagctg ttgaatcaga aagccggctt cagcttttaa ggccaaacca aacgcggtgg 960

aattcaactt ttatggctgt tgacagaatt cttcaaattt gcaaagaagc aggagaaggc 1020

gcacttcgga atatatgcac ctctcttgag gttccaatgt ttaatccagc agaaatgctg 1080

ttcttgacag agtgggccaa cacaatgcgt ccagttgcaa aagtactcga catcttgcaa 1140

gcggaaacga atacacagct ggggtggctg ctgcctagtg tccatcagtt aagcttgaaa 1200

cttcagcgac tccaccattc tctcaggtac tgtgacccac ttgtggatgc cctacaacaa 1260

ggaatccaaa cacgattcaa gcatatgttt gaagatcctg agatcatagc agctgccatc 1320

cttctcccta aatttcggac ctcttggaca aatgatgaaa ccatcataaa acgaggcatg 1380

gactacatca gagtgcatct ggagcctttg gaccacaaga aggaattggc caacagttca 1440

tctgatgatg aagatttttt cgcttctttg aaaccgacaa cacatgaagc cggcaaagag 1500

ttggatggat atctggcctg tgtttcagac accagggagt ctctgctcac gtttcctgct 1560

atgtgcagcc tctctatcaa gactaataca cctcttcccg catcggctgc ctgtgagagg 1620

cttttcagca ctgcaggatt gcttttcagc cccaaaagag ctaggcttga cactaacaat 1680

tttgagaatc agcttctact gaagttaaat ctgaggtttt acaactttga gtag 1734

Claims

1. a goldfish autonomous transposon gene gfTol2 is characterized in that, is the nucleotide sequence of transposase of the aminoacid sequence of coding SEQ ID No:2.

2. goldfish autonomous transposon gene gfTol2 according to claim 1 is characterized in that, said gene gfTol2 nucleotide sequence such as SEQ ID No:1.

3. the transposase of a gfTol2 genes encoding according to claim 1 or claim 2 is characterized in that, the aminoacid sequence of this transposase sequence shown in SEQ ID No:2.

A goldfish autonomous transposon gene gfTol2 as claimed in claim 1 the percentage of A-class goods of preparation adjustable goldfish with bring out offspring's application in the medicine that makes a variation.

5. application according to claim 4 is characterized in that, said goldfish is the goldfish of coloured glaze gold, butterfly tail and pearl strain.

6. application according to claim 4 is characterized in that, according to the morpholine oligonucleotide of the design of the nucleotide sequence shown in SEQ ID No:1 gfTol2, the sequence of said morpholine oligonucleotide is shown in SEQ ID No:21.

7. application according to claim 4 is characterized in that, according to the gfTol2mRNA of the design of the nucleotide sequence shown in the SEQ ID No:1, the sequence of said mRNA is shown in SEQ ID No:22.