CN101696453B - Method for preparing reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit for detecting bovine viral diarrhea viruses - Google Patents
Method for preparing reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit for detecting bovine viral diarrhea viruses Download PDFInfo
- Publication number
- CN101696453B CN101696453B CN2009100731260A CN200910073126A CN101696453B CN 101696453 B CN101696453 B CN 101696453B CN 2009100731260 A CN2009100731260 A CN 2009100731260A CN 200910073126 A CN200910073126 A CN 200910073126A CN 101696453 B CN101696453 B CN 101696453B
- Authority
- CN
- China
- Prior art keywords
- bovine viral
- viral diarrhea
- mediated isothermal
- reverse transcription
- diarrhea virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for detecting bovine viral diarrhea viruses as well as a preparation method and a use method of a reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit, relating to a preparation method and a use method of a reaction kit. The invention solves the problems that the traditional method for detecting bovine viral diarrhea viruses has expensive cost, needs professional equipment and professional staff to participate in detection, and is not suitable for the development state of the animal husbandry at the present stage of China. The preparation method comprises the following steps: firstly, designing a primer, preparing RT-LAMP reaction liquid, and then, finishing the preparation. The use method comprises the following steps: adding RNA extract containing bovine viral diarrhea virus samples into the reaction liquid, ungergoing RT-LAMP reaction after mixing, and then, centrifugally detecting; or adding 10,000*SYBR GREEN I, and putting below an ultraviolet lamp for detecting; or carrying out electrophoresis detection; or carrying out insulation reaction detection by adopting a Real-time PCR instrument. The reaction kit has convenient detection, does not need expensive instruments in routine tests and reduces the cost.
Description
Technical field
The present invention relates to the preparation and the method for use thereof of reaction kit.
Background technology
(Bovine viral diarrhea virus BVDV) claims that again (Bovine viral diarrhea-mucosal disease virus BVD-MDV), is the sub-thread positive chain RNA virus to bovine viral diarrhoea-bovine diarrhoea virus to bovine viral diarrhea virus; Ox contagious infection, symptom mainly show as diarrhoea, acute and chronic mucosal disease, persistent infection and immunological tolerance, immunosuppression, dam miscarriage, stillborn foetus and monster etc.; This disease mainly betides ox, but also infected pigs, sheep, deer, camel and other wild ruminating animal.It is less that BVDV has distinctive clinical symptom, in actual production, usually is difficult for being diagnosed, and this sick case fatality rate is not high in addition, fail to cause enough attention of people and ignore this sick existence, so each cattle farm cows lacks the anti-system measure of monitoring of system.BVDV forms persistent infection to the part ox; Can have a strong impact on breeding and the production of ox, cause serious economy loss, hinder the sound development of China's ox aquaculture to cattle-raising; Therefore cows are generally investigated; Detect its infection conditions, eliminate infected individuals, become the important step of the anti-system of this disease.Applied detection means must effectively be distinguished infected individuals and non-infected individuals.
At present; Common serology detection method not only can't be distinguished the individual and vaccine immunity individuality of natural infection; Also can't detect simultaneously because of long-term persistent infection does not have the individuality that antibody produces, traditional etiology lock out operation means are complicated, consuming time can't to be applied to extensive examination detection.Use RT-PCR and detect bovine viral diarrhea virus nucleic acid poor sensitivity, difficult detection persistent infection ox only.Use Real-time PCR and detect, though sensitivity is higher, Real-time PCR detects the cost costliness, needs professional equipment and professional to participate in detecting, and is inappropriate for present stage Animal Husbandry in China Status of development, and more difficult large-scale promotion is used.
Summary of the invention
The present invention seeks to exist cost expensive in order to solve the existing method that detects bovine viral diarrhea virus; Need professional equipment and professional to participate in detecting and being inappropriate for the problem of present stage Animal Husbandry in China Status of development, and the preparation and the method for use thereof of the reverse transcription loop-mediated isothermal amplification reaction reagent box that detects bovine viral diarrhea virus are provided.
Detection of bovine viral diarrhea virus reverse transcription loop-mediated isothermal amplification reaction kit preparation method? According to the following steps: First, from the genetic databases to retrieve all the bovine viral diarrhea virus gene sequence analysis software to identify through Clustalw conserved specific target DNA sequence, and then using the Primer? Explorer? 4 6 software design primers; Second, according to the obtained preparation 6 reverse primers loop-mediated isothermal amplification reaction solution, to complete the detection of bovine viral diarrhea virus reverse loop-mediated isothermal amplification reaction for preparing kit; wherein in step one target DNA sequence is conserved: TGAGGGACAAATCCTCCTTAGCGAAGGCCGAAAAGAGGCTAGCCATGCCCTTAGTAGGACTAGCAAAACAAGGAGGGTAGCAACAGTGGTGAGTTCGTTGGATGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTTGTGCGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAGCGGGGGTCGTTCAGGTGAAAACGGTTTAACCAACCGCTACGAATACAGCCTGATAGGGTGCTGCAGAGGCCCACTGTATCGCTACTAAAAATCTCTGCTGTACATGGCACATGGAGTTGATTACAAATG;
6 primers are respectively in the step 1:
The title sequence
F3 5’-TGCCCTTAGTAGGACTAGCA-3’
B3 5’-AGCACCCTATCAGGCTGTA-3’
FIP 5’-CGAACCACTGACGACTACCCTGTTTTGGTAGCAACAGTGGTGAGTT-3’
BIP 5’-CAAGCCTCGAGATGCCACGTTTTTCCGTTTTCACCTGAACGACC-3’
FL 5’-AGGGCTTCAGCCATCCAACG-3’
BL 5’-CAGCACATCTTAACCTGAGCGG-3’；
The reverse transcription loop-mediated isothermal amplification reaction solution is the water of per 20 μ l reaction solutions by 1.9 μ l in the step 2; 2.5 10 * ThermoPol reaction buffer of μ l; 0.1 the 1M sal epsom of μ l; The 5M trimethyl-glycine of 2 μ l; The 10mM dNTP of 4 μ l; 20 * SYBR GREEN I of 1 μ l; The 5 μ M primers F 3 of 1 μ l; The 5 μ M primer B3 of 1 μ l; The 20 μ M primers F L of 1 μ l; The 20 μ M primer BL of 1 μ l; The 40 μ M primers F IP of 1 μ l; The 40 μ M primer BIP of 1 μ l; The 8U/ μ lBstDNA polysaccharase of 1 μ l; 0.5 the 10U/ μ l AMV reversed transcriptive enzyme of the 40U/ μ l ribonuclease inhibitor of μ l and 1 μ l is formed.
Detect the method for use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus:
One, gets the RNA extract that 5 μ l contain bovine viral diarrhea virus samples, add 20 μ l reverse transcription loop-mediated isothermal amplification reaction solutions, be positioned over behind the uniform mixing and carry out reverse transcription loop-mediated isothermal amplified reaction 1h under 62 ℃; Two, behind the amplified reaction with the centrifugal 1min of the rotating speed of 10000r/min, reaction tubes bottom has deposition to produce, and then has bovine viral diarrhea virus in the testing sample, the reaction tubes bottom does not have deposition and produces, and does not then have bovine viral diarrhea virus in the testing sample.
Detect the method for use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus: one, get the RNA extract that 5 μ l contain bovine viral diarrhea virus samples; Add 20 μ l reverse transcription loop-mediated isothermal amplification reaction solutions, be positioned over behind the uniform mixing and carry out reverse transcription loop-mediated isothermal amplified reaction 1h under 62 ℃; Two, the 10000 * SYBR GREEN I that adds 5 μ l behind the amplified reaction; Place then under the uv lamp, reaction solution becomes green, then has bovine viral diarrhea virus in the testing sample; Reaction solution is a safran, does not then have bovine viral diarrhea virus in the testing sample.
Detect the method for use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus:
One, gets the RNA extract that 5 μ l contain bovine viral diarrhea virus samples, add 20 μ l reverse transcription loop-mediated isothermal amplification reaction solutions, be positioned over behind the uniform mixing and carry out reverse transcription loop-mediated isothermal amplified reaction 1h under 62 ℃; Two, getting liquid behind the 1 μ l amplified reaction, to use mass concentration be that 1.5% sepharose carries out electrophoresis; Be disperse shape band; Then there is bovine viral diarrhea virus in the testing sample, do not have disperse shape band, then do not have bovine viral diarrhea virus in the testing sample.
Detect the method for use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus:
One, gets the RNA extract that 5 μ l contain bovine viral diarrhea virus samples, add 20 μ l reverse transcription loop-mediated isothermal amplification reaction solutions, be positioned over behind the uniform mixing and carry out reverse transcription loop-mediated isothermal amplified reaction 1h under 62 ℃; Two, adopt Real-time PCR appearance to carry out insulation reaction behind the amplified reaction; Every have amplification curve at a distance from 1min collection first order fluorescence signal in 1h, then have bovine viral diarrhea virus in the testing sample; In 1h, do not have amplification curve, then do not have bovine viral diarrhea virus in the testing sample.
The present invention detects the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus; Filled up and be not used in this blank of reverse transcription loop-mediated isothermal amplification reaction reagent box that detects bovine viral diarrhea virus both at home and abroad; The preparation method is simple, can produce in batches; The present invention detects 4 kinds of method of use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus, all can under constant temperature, carry out, and only just can reach the purpose of detection through single step reaction; Easy to detect quick, specificity is high, and is highly sensitive; Need not complex instrument, reduce cost, the non-specialised staff also can be familiar with operation fast simultaneously; Be fit to extensively promote the use of; Can satisfy needs, also can be used for the quarantine and examination work to bovine viral diarrhea virus such as inspection and quarantining for import/export, be applicable to present stage Animal Husbandry in China Status of development a poultry on-the-spot quarantine.
Description of drawings
Fig. 1 is the collection of illustrative plates of agarose gel electrophoresis in the embodiment four, and wherein there is not disperse shape band in " 1 " negative control group; There is bovine viral diarrhea virus in " 2 " for there being disperse shape band in the testing sample.Fig. 2 is a Real-time PCR fluoroscopic examination collection of illustrative plates in the embodiment five, no amplification curve in " 1 " negative control group wherein, 1h; " 2 " have amplification curve in the 1h, have bovine viral diarrhea virus in the testing sample.
Embodiment
Technical scheme of the present invention is not limited to following cited embodiment, also comprises the arbitrary combination that each embodiment is asked.
Specific Embodiment 1: The above embodiment of bovine viral diarrhea virus reverse transcriptase loop-mediated isothermal amplification reaction kit according to the following preparation method steps: First, from the gene database to retrieve all the bovine viral diarrhea virus gene sequences through Clustalw software analysis to identify specific target DNA sequence conserved, then use Primer? Explorer? 4 6 software design primers; Second, according to the obtained preparation 6 reverse primers loop-mediated isothermal amplification reaction solution, to complete Detection of bovine viral diarrhea virus reverse transcription loop-mediated isothermal amplification reaction kit preparation; wherein step a target DNA sequence is conserved: TGAGGGACAAATCCTCCTTAGCGAAGGCCGAAAAGAGGCTAGCCATGCCCTTAGTAGGACTAGCAAAACAAGGAGGGTAGCAACAGTGGTGAGTTCGTTGGATGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTTGTGCGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAGCGGGGGTCGTTCAGGTGAAAACGGTTTAACCAACCGCTACGAATACAGCCTGATAGGGTGCTGCAGAGGCCCACTGTATCGCTACTAAAAATCTCTGCTGTACATGGCACATGGAGTTGATTACAAATG; Step one in six primers were as follows:
The title sequence
F3 5’-TGCCCTTAGTAGGACTAGCA-3’
B3 5’-AGCACCCTATCAGGCTGTA-3’
FIP 5’-CGAACCACTGACGACTACCCTGTTTTGGTAGCAACA?GTGGTGAGTT-3’
BIP 5’-CAAGCCTCGAGATGCCACGTTTTTCCGTTTTCACCTGAACGACC-3’
FL 5’-AGGGCTTCAGCCATCCAACG-3’
BL 5’-CAGCACATCTTAACCTGAGCGG-3’；
The reverse transcription loop-mediated isothermal amplification reaction solution is the water of per 20 μ l reaction solutions by 1.9 μ l in the step 2; 2.5 10 * ThermoPol reaction buffer of μ l; 0.1 the 1M sal epsom of μ l; The 5M trimethyl-glycine of 2 μ l; The 10mM dNTP of 4 μ l; 20 * SYBR GREEN I of 1 μ l; The 5uM primers F 3 of 1 μ l; The 5 μ M primer B3 of 1 μ l; The 20 μ M primers F L of 1 μ l; The 20 μ M primer BL of 1 μ l; The 40 μ M primers F IP of 1 μ l; The 40 μ M primer BIP of 1 μ l; The 8U/ μ l BstDNA polysaccharase of 1 μ l; 0.5 the 10U/ μ l AMV reversed transcriptive enzyme of the 40U/ μ l ribonuclease inhibitor of μ l and 1 μ l is formed.
6 primers in this embodiment step 1, synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
10 * ThermoPol reaction buffer is available from NEB (Beijing) ltd in this embodiment step 2; 1M sal epsom is available from Sigma's aldrich (Shanghai) trade Co., Ltd; The 5M trimethyl-glycine is available from Sigma's aldrich (Shanghai) trade Co., Ltd; 10mM dNTP is available from precious biotechnology (Dalian) ltd; 20 * SYBR GREEN I is available from Beijing hundred Tyke Bioisystech Co., Ltd; 8U/ μ lBstDNA polysaccharase is available from NEB (Beijing) ltd; 40U/ μ l ribonuclease inhibitor is available from precious biotechnology (Dalian) ltd; 10U/ μ l AMV reversed transcriptive enzyme is available from Pu Luomaige (Beijing) Bioisystech Co., Ltd.
Embodiment two: this embodiment detects the method for use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus: one, get the RNA extract that 5 μ l contain bovine viral diarrhea virus samples; Add 20 μ l reverse transcription loop-mediated isothermal amplification reaction solutions, be positioned over behind the uniform mixing and carry out reverse transcription loop-mediated isothermal amplified reaction 1h under 62 ℃; Two, behind the amplified reaction with the centrifugal 1min of the rotating speed of 10000r/min, reaction tubes bottom has deposition to produce, and then has bovine viral diarrhea virus in the testing sample, the reaction tubes bottom does not have deposition and produces, and does not then have bovine viral diarrhea virus in the testing sample.
Detect in this embodiment and can set up negative control group, negative control group is to replace the RNA extract with water, and all the other components are all identical.
Embodiment three: this embodiment detects the method for use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus: one, get the RNA extract that 5 μ l contain bovine viral diarrhea virus samples; Add 20 μ l reverse transcription loop-mediated isothermal amplification reaction solutions, be positioned over behind the uniform mixing and carry out reverse transcription loop-mediated isothermal amplified reaction 1h under 62 ℃; Two, the 10000 * SYBR that adds 5 μ l behind the amplified reaction
GREEN I places under the uv lamp then, and reaction solution becomes green, then has bovine viral diarrhea virus in the testing sample, and reaction solution is a safran, does not then have bovine viral diarrhea virus in the testing sample.
Detect in this embodiment and can set up negative control group, negative control group is to replace the RNA extract with water, and all the other components are all identical.
Embodiment four: this embodiment detects the method for use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus: one, get the RNA extract that 5 μ l contain bovine viral diarrhea virus samples; Add 20 μ l reverse transcription loop-mediated isothermal amplification reaction solutions, be positioned over behind the uniform mixing and carry out reverse transcription loop-mediated isothermal amplified reaction 1h under 62 ℃; Two, getting liquid behind the 1 μ l amplified reaction, to use mass concentration be that 1.5% sepharose carries out electrophoresis; Be disperse shape band; Then there is bovine viral diarrhea virus in the testing sample, do not have disperse shape band, then do not have bovine viral diarrhea virus in the testing sample.
Detect in this embodiment and can set up negative control group, negative control group is to replace the RNA extract with water, and all the other components are all identical.
Electrophoresis adopts the nucleic acid electrophoresis method in this embodiment step 2; The result is as shown in Figure 1, has disperse shape band, has bovine viral diarrhea virus in the testing sample, and does not have disperse shape band in the negative control group, does not then have bovine viral diarrhea virus in the testing sample.
Embodiment five: this embodiment detects the method for use of the reverse transcription loop-mediated isothermal amplification reaction reagent box of bovine viral diarrhea virus: one, get the RNA extract that 5 μ l contain bovine viral diarrhea virus samples; Add 20 μ l reverse transcription loop-mediated isothermal amplification reaction solutions, be positioned over behind the uniform mixing and carry out reverse transcription loop-mediated isothermal amplified reaction 1h under 62 ℃; Two, adopt Real-time PCR appearance to carry out insulation reaction behind the amplified reaction; Every have amplification curve at a distance from 1min collection first order fluorescence signal in 1h, then have bovine viral diarrhea virus in the testing sample; In 1h, do not have amplification curve, then do not have bovine viral diarrhea virus in the testing sample.
Detect in this embodiment and can set up negative control group, negative control group is to replace the RNA extract with water, and all the other components are all identical.
This embodiment detected result is as shown in Figure 2, and amplification curve is arranged in 1h, then has bovine viral diarrhea virus in the testing sample, and in 1h, does not have amplification curve, does not then have bovine viral diarrhea virus in the testing sample.
Sequence table
< 110>Northeast Agricultural University
< 120>preparation and the method for use thereof of the method reverse transcription loop-mediated isothermal amplification reaction reagent box of detection bovine viral diarrhea virus
<160>7
<210>1
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>sequence of reverse transcription loop-mediated isothermal amplification primer F3.
<400>1
tgcccttagt?aggactagca?20
<210>2
<211>19
<212>DNA
< 213>artificial sequence
<220>
< 223>sequence of reverse transcription loop-mediated isothermal amplification primer B3.
<400>2
agcaccctat?caggctgta?19
<210>3
<211>46
<212>DNA
< 213>artificial sequence
<220>
< 223>sequence of reverse transcription loop-mediated isothermal amplification primer FIP.
<400>3
cgaaccactg?acgactaccc?tgttttggta?gcaacagtgg?tgagtt?46
<210>4
<211>44
<212>DNA
< 213>artificial sequence
<220>
< 223>sequence of reverse transcription loop-mediated isothermal amplification primer BIP.
<400>4
caagcctcga?gatgccacgt?ttttccgttt?tcacctgaac?gacc?44
<210>5
<211>20
<212>DNA
< 213>artificial sequence
<220>
< 223>sequence of reverse transcription loop-mediated isothermal amplification primer LF.
<400>5
agggcttcag?ccatccaacg?20
<210>6
<211>22
<212>DNA
< 213>artificial sequence
<220>
< 223>sequence of reverse transcription loop-mediated isothermal amplification primer LB.
<400>6
cagcacatct?taacctgagc?gg?22
<210>7
<211>340
<212>DNA
< 213>artificial sequence
<220>
< 223>the conservative target DNA sequence of bovine viral diarrhea virus.
<400>7
tgagggacaa?atcctcctta?gcgaaggccg?aaaagaggct?agccatgccc?ttagtaggac 60
tagcaaaaca?aggagggtag?caacagtggt?gagttcgttg?gatggctgaa?gccctgagta 120
cagggtagtc?gtcagtggtt?cgacgctttg?tgcgacaagc?ctcgagatgc?cacgtggacg 180
agggcatgcc?cacagcacat?cttaacctga?gcgggggtcg?ttcaggtgaa?aacggtttaa 240
ccaaccgcta?cgaatacagc?ctgatagggt?gctgcagagg?cccactgtat?cgctactaaa?300
aatctctgct?gtacatggca?catggagttg?attacaaatg?340
Claims (1)
1 of bovine viral diarrhea virus reverse transcriptase loop-mediated isothermal amplification reaction kit preparation, characterized in that the detection of bovine viral diarrhea virus reverse loop-mediated isothermal amplification reaction kit according to the following preparation method steps: First, from the gene database to retrieve all the bovine viral diarrhea virus gene sequence analysis software by Clustalw conserved identify specific target DNA sequence, and then use Primer? Explorer? 4 6 software design primers; Second, according to The resulting six primer formulated loop-mediated isothermal reverse transcription amplification reactions, to complete detection of bovine viral diarrhea virus reverse transcription loop-mediated isothermal amplification reaction kit preparation; wherein step a target DNA sequence is conserved: TGAGGGACAAATCCTCCTTAGCGAAGGCCGAAAAGAGGCTAGCCATGCCCTTAGTAGGACTAGCAAAACAAGGAGGGTAGCAACAGTGGTGAGTTCGTTGGATGGCTGAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCTTTGTGCGACAAGCCTCGAGATGCCACGTGGACGAGGGCATGCCCACAGCACATCTTAACCTGAGCGGGGGTCGTTCAGGTGAAAACGGTTTAACCAACCGCTACGAATACAGCCTGATAGGGTGCTGCAGAGGCCCACTGTATCGCTACTAAAAATCTCTGCTGTACATGGCACATGGAGTTGATTACAAATG; Step one in six primers were as follows:
The title sequence
F3 5’-TGCCCTTAGTAGGACTAGCA-3’
B3 5’-AGCACCCTATCAGGCTGTA-3’
FIP 5’-CGAACCACTGACGACTACCCTGTTTTGGTAGCAACA
GTGGTGAGTT-3’
BIP 5’-CAAGCCTCGAGATGCCACGTTTTTCCGTTTTCACCTG
AACGACC-3’
FL 5’-AGGGCTTCAGCCATCCAACG-3’
BL 5’-CAGCACATCTTAACCTGAGCGG-3’；
The reverse transcription loop-mediated isothermal amplification reaction solution is the water of per 20 μ l reaction solutions by the nuclease free of 1.9 μ l in the step 2; 2.5 10 * ThermoPol reaction buffer of μ l; 0.1 the 1M sal epsom of μ l; The 5M trimethyl-glycine of 2 μ l; The 10mM dNTP of 4 μ l; 20 * SYBR GREEN I of 1 μ l; The 5 μ M primers F 3 of 1 μ l; The 5 μ M primer B3 of 1 μ l; The 20 μ M primers F L of 1 μ l; The 20 μ M primer BL of 1 μ l; The 40 μ M primers F IP of 1 μ l; The 40 μ M primer BIP of 1 μ l; The 8U/ μ l BstDNA polysaccharase of 1 μ l; 0.5 the 10U/ μ l AMV reversed transcriptive enzyme of the 40U/ μ l ribonuclease inhibitor of μ l and 1 μ l is formed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100731260A CN101696453B (en) | 2009-11-02 | 2009-11-02 | Method for preparing reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit for detecting bovine viral diarrhea viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100731260A CN101696453B (en) | 2009-11-02 | 2009-11-02 | Method for preparing reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit for detecting bovine viral diarrhea viruses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101696453A CN101696453A (en) | 2010-04-21 |
| CN101696453B true CN101696453B (en) | 2012-01-25 |
Family
ID=42141579
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100731260A Expired - Fee Related CN101696453B (en) | 2009-11-02 | 2009-11-02 | Method for preparing reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit for detecting bovine viral diarrhea viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101696453B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102296064B (en) * | 2010-06-22 | 2012-12-26 | 中国人民解放军军事医学科学院微生物流行病研究所 | Specific primer for detecting enterovirus 71 (EV71) and application thereof |
| AR084358A1 (en) | 2010-12-27 | 2013-05-08 | Lilly Co Eli | COMPOSITIONS AND METHODS FOR IDENTIFYING AND DIFFERING VIRAL COMPONENTS OF MULTIVALENT VACCINES OF THE “BOILING FEVER” (BOVINE RESPIRATORY DISEASE COMPLEX (BRDC)) |
| CN106511375A (en) * | 2016-10-11 | 2017-03-22 | 西北农林科技大学 | Application of carbon monoxide releasing molecules in preparation of anti-bovine viral diarrhea virus drug |
| CN106701961B (en) * | 2017-01-16 | 2020-05-15 | 南阳师范学院 | Reverse transcription loop-mediated isothermal amplification primer, kit and detection method for visually detecting Hobi-like pestivirus |
| CN116334306A (en) * | 2022-07-29 | 2023-06-27 | 山东省动物疫病预防与控制中心(山东省人畜共患病流调监测中心) | Primer probe set and kit for simultaneously detecting classical swine fever virus and bovine viral diarrhea virus based on microdroplet digital PCR |
| CN117004747B (en) * | 2023-08-16 | 2024-08-13 | 河北科技师范学院 | Primer probe set for multiplex real-time fluorescence PCR, detection method and application |
-
2009
- 2009-11-02 CN CN2009100731260A patent/CN101696453B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101696453A (en) | 2010-04-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101696453B (en) | Method for preparing reverse transcription loop-mediated isothermal amplification (RT-LAMP) reaction kit for detecting bovine viral diarrhea viruses | |
| WO2006000140A1 (en) | Primers, probes sequences and methods, useful in the multiple real time fluorescent rt-pcr assay of avian influenza virus subtypes h5, h7 and h9 | |
| CN102140543B (en) | Multiple real-time quantitative PCR primer, probe and detection method for identifying viral pathogens relevant to fever with eruption syndrome as infection diseases | |
| CN104032034A (en) | Method for simultaneously detecting influenza A virus, influenza B virus and influenza C virus and kit | |
| CN102140512A (en) | LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila | |
| CN105296673A (en) | Influenza A virus molecular detection kit and preparation method thereof | |
| CN111206121A (en) | Kit for detecting novel coronavirus orflab and S genes | |
| CN105296674A (en) | Detecting kit for severe fever with thrombocytopenia syndrome viruses (SFTSV) and preparation method of detecting kit | |
| CN104263838B (en) | Listeria monocytogenes LAMP-LFD detection kit and detection method thereof | |
| CN103074447B (en) | Establishment of PCR-HRM analysis method for rapid differential diagnosis of different serotypes of avian leukemia viruses | |
| CN113249517A (en) | Primer, probe and kit for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of bovine plague | |
| CN104032035A (en) | Method and kit for simultaneously detecting human I type, II type and III type parainfluenza viruses | |
| CN103993101A (en) | Method and kit for simultaneous detection of human coronavirus 229E, OC43 and NL63 | |
| CN105567872A (en) | RT-RPA detection reagent kit for quickly detecting pest des petits ruminant viruses and application thereof | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| CN102251061A (en) | Nucleic acid dual fluorescence PCR (Polymerase Chain Reaction) detection kit for influenza A/B virus | |
| CN103509880A (en) | LAMP detection kit of highly-pathogenic porcine reproductive and respiratory syndrome viruses | |
| CN102286639A (en) | Type A H1N1/influenza A virus nucleic acid dual fluorescent polymerase chain reaction (PCR) detection kit | |
| CN105296675A (en) | Nucleic acid detecting kit for influenza B viruses and preparation method of nucleic acid detecting kit | |
| CN106191308A (en) | For detecting primer and the probe combinations of cytomegalovirus, Epstein-Barr virus and adenovirus | |
| CN102337352A (en) | Kit for detecting multiple influenza viruses by polymerase chain reaction (PCR) microarray | |
| CN101921869B (en) | Method for identifying virulent strain and attenuated strain in Newcastle disease virus by pyrosequencing technology | |
| CN101845515A (en) | Method for detection of swine influenza A H1N1 virus based on pyrosequencing technology | |
| CN100582240C (en) | Real time fluorescence quantitative determination method for pneumonia chlamydia and kit thereof | |
| CN101294224B (en) | Primer and probe sequence for testing pig parvoviral nucleotide fragment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120125 Termination date: 20171102 |