CN101684468A - Synthetic human insulin gene and use thereof in cultivation of transgenic tomatoes - Google Patents

Abstract

The invention relates to the field of plant gene engineering and provides a sequence of a human insulin gene designed and synthesized according to plant preferred codons. A plant expression vector isbuilt for the synthetic human insulin gene, so that the gene can be transferred into tomatoes by an agrobacterium rhizogenes-mediated method under the drive of a CaMV 35S promoter and a fruit-specificpromoter 2A12 to express human insulin in tomato fruit. The tomatoes capable of making human insulin can be used as a convenient oral product for preventing and treating insulin-dependent diabetes mellitus and autoimmune disorder diabetes mellitus, and human insulin can be extracted from the tomatoes to be made into injection preparations.

Description

A kind of human insulin gene of synthetic and the application in cultivating transgenic Fructus Lycopersici esculenti thereof

The application is dividing an application of CN03109739.1, and the original application name is called: utilize transgenic Fructus Lycopersici esculenti production insulin human's method, the applying date of original application is: on April 14th, 2003.

Technical field:

The present invention relates to a kind of method of utilizing transgenic plant production insulin human and products thereof.

Background technology:

Bio-reactor is the field that recently not many biotechnologys research and development department extremely pays close attention to.Produce people's somatomedin such as milk cow, milk goat galactophore biological reactor.The research that utilizes potato tuber to produce Hepatitis B virus vaccine in plant bioreactor research is subjected to paying attention to widely.Romaine lettuce and tomato produce oral polypeptide drug with it and have very big application potential as eating vegetables or fruit.The insulin human is crucial for the urine patient's of insulin-dependent treatment.Some diabetic subject's metabolism adjusting is relevant with the autoimmunity function.

It is effective (Reddy S et at, Pancreas2000,20 (1): 55-60 that oral insulin has been proved to be sick treatment of the urine of some type; Ploix C et at, Diabetes 1999,48 (1) 2150-6; Ramiya VK, MaclarenNK, Horm Res 1997,48 suppl 4:67-70).For the therapy of type i diabetes, that generally uses now has two kinds, and a kind of is insulin injection, and another kind is to transplant.Yet, insulin injection is owing to be not the general process of imitation pancreatic beta cell excreting insulin, therefore be merely able to the development of disease controlling, and the situation of disease is made moderate progress, and might cause side effects such as optic atrophy, allergic and neurodynia; Transplant and then cause stronger immunological rejection through regular meeting.Meanwhile, the non-selective medicine of now used inhibition immunity since other side effect such as its infectibility that causes and wound healing of their poor efficiency, low target, toxicity and some cross and seem slowly and more and be not suitable for.So we wish to find a kind of methods of treatment always, the direct self-immunprocess of target and disease-related and do not influence remaining functions of immune system.Vaccinate gets around mucous membrane basically, be difficult to trigger mucosal immune response usually, and edible vaccine can contact with gastral lining, and promptly in theory, they can activate mucous membrane simultaneously and reply with whole body and reply.This double effect can strengthen the defence (William H.R.L., 2000) to many dangerous microorganisms.

Oral tolerance is the immune response for the oral protein antigen-specific, and it is thought a kind of good method for the treatment of autoimmune disease and preventing transplant rejection by increasing people recently.As a kind of approach that reaches oral tolerance, oral insulin becomes a kind of emerging methods of treatment, and has caused people's attention.It has broken through traditional methods of treatment, and therapeutic purpose are to disturb the autoimmune infringement of β cell, and intention stoped its destruction before hyperglycemia occurs.Experiment shows that oral insulin can play improvement to a certain degree to the state of an illness of type i diabetes, and can prevent or postpone the generation of type i diabetes; Simultaneously type ii diabetes also there is certain curative effect.

Have many people to think, oral protein antigen is invalid, because they were degraded before having an effect under one's belt.In fact, this degradation process can't produce very big influence to oral tolerance, on the contrary, because proteantigen is cut into the little peptide for the easier absorption of gut-associated lymphoid tissue, this process helps causing oral tolerance (ZhangZ.J.et al., 1991).Although most of protein had been cut into amino acid, dipeptides or the tripeptides of no antigen matter in the food before being absorbed by intestinal epithelial cell, also exists some long little peptides and can not absorbed by GALT by complete digestion.These antigens can at first pass and be present between Peyer ' the s district intestinal epithelial cells or microfold cell (or M cell) that the top specialization forms, and the top microvillus of these cells can be absorbed in adjacent lymphocyte at basolateral part.Specific antigen or the soluble protein that links to each other with immune annex can cross M cell and the pipeline by its cell interior and enter Peyer ' s district and activating immune system (Muir A.and Ramiya V., 1996) then.Then, the effector T cell that many kinds are relevant with tolerance or immunity is activated, and has wherein just comprised the T cell of secrete cytokines TGF-β, thereby oral tolerance is activated.Intestines ring model electron microscopic observation experiment to mouse shows that the Salmonellas of intrusion can pass the M cell and enter the intestines wall, and they have been resisted immune clearance and have also therefore entered basilar membrane and disseminate initiation enteritis in the gut epithelium tissue.So, after the dilution, Salmonellas just can be used as a kind of approach (McGheeJ.R.et al., 1992) that antigen enters GALT and activate immunity reaction that mediates.Simultaneously, the dendritic cell that intersperses among in the intestinal cells also can be taken in enteric cavity with interior antigen, and by lymphoid cyclic activation immune response, but this process is brought out the generation tolerance or immunity is still unclear.

The treatment of oral tolerance has certain therapeutic action owing to can cause the immune response of antigen-specific to disease, but it has been subjected to some practical problemss and has been restricted, no matter promptly this therapy need be that people or laboratory animal all need amounts of protein antigen.In order to address this problem, comprise that several traditional expression systems such as microbial fermentation and mammalian cell all are carried out experiment, yet they all exist the restriction of method self.The subject matter of bacterial expression system is the process that they can't carry out the necessary translation post-treatment of many mammalian proteins, as glycosylation.Although and mammalian cell expression system has overcome this problem, the culture apparatus of its high cost and its relatively low output make its expense expensive and unrealistic.Plant bioreactor is that a kind of in this case very ideal is selected, not only because it can the high-quality target protein matter of mass production and expense cheap, and transgenic plant can be used as a kind of simple of transportation autoantigen and direct method.By contrast transgenic plant be one can be on a large scale, the suitable candidate system of the various medical proteins of low cost production.So far, existing many important medical proteins, as human epidermal growth factor, Regular Insulin, granulocyte, macrophage colony stimulating factor (GM-CSF), enkephalin, Interferon, rabbit, human serum albumin, r-hirudin etc. and multiple antibody and vaccine successful expression (Li Yuyang etc., 2001) in plant.

Producing vaccine with plant-bioreactor is one of focus of current research.Many virus antigens and bacterial antigens gene successfully change in the plant, and have given expression to immunocompetent product.For example, use the external source vaccine of expression of plants to carry out the B subunit (LT-B) of the heat labile enterotoxin of the enterotoxigenic Escherichia coli of expressing in the potato of human clinical's experiment first, after feeding the potato tuber of raising expression LT-B, can induce the generation of serum antibody and mucoantibody to mouse.Be suitable for the expression vector of plant by further structure, make LT-B can be accumulate to 0.15% (Mason H.S.et al., 1998) of soluble protein.This expression level makes that clinical oral immunity experiment is carried out.In the clinical experiment, take the raw potato stem tuber (containing 0.5mg or 1mgLT-B approximately) of 50g or 100g product LT-B every day respectively to the volunteer, the result shows that the mucous membrane and the systemic immunity that have all produced special anti-LT-B among two groups of volunteers reply (Tacket C.O.et al., 1998).

In people's (1998) such as Arakawa T. experiment, proinsulin is connected amalgamation and expression with the nontoxic B subunit (CTB) of vibrio cholera toxin, and potato is transformed.CTB can make the Regular Insulin of phytosynthesis directly be transported to gut-associated lymphoid tissue (GALT) and activate mucosal immune response and general immunity is replied.This Expression of Fusion Protein amount is about 0.1% of soluble protein in the piece root of transgenic Rhizoma Solani tuber osi.The clothes experiment of raising to the NOD mouse shows that this potato can make insulitis disease (insulitis) produce certain alleviating, and has obviously postponed the disease process of diabetes.

This shows, utilize transgenic plant to produce oral insulin human and have important use value as bio-reactor.Provided by the invention is exactly a kind of method of utilizing transgenic plant as bio-reactor production insulin human, this transgenic Fructus Lycopersici esculenti can become a kind of orally administrable prod easily, be used to prevent and treat some insulin-dependent and the diabetes autoimmunity obstacle, and the insulin human that can therefrom purify out makes the formulation of injection.

Summary of the invention:

Above-mentioned problems of the prior art are that the expression amount of human insulin gene in transgenic plant is not high, and the render transgenic plant produces transgenosis easily.The objective of the invention is to solve the problems of the technologies described above, improve the expression amount of human insulin gene in the transgenic plant, and the render transgenic plant can not produce transgenosis.For this reason, technical scheme of the present invention is as follows: the synthetic human insulin gene, and formation has the transgenic plant of described gene, and can produce described Regular Insulin in the plant of described plant; Part base in the described insulin gene substitutes with the codon of plant-preference, and described Regular Insulin has the three-dimensional structure of similar natural insulin.

1. design and the synthetic human insulin gene

(1) in order to improve the expression amount of human insulin gene, this gene all uses plant-preference codon;

(2) can correctly be folded into natural conformation in order to be beneficial to synthetic insulin human, between insulin human's A chain and B chain, design one 6 the amino acid whose small peptides that flexibly connect to replace insulinogenic C peptide.Its design reasons is as follows: the three-dimensional structure to natural insulin is analyzed discovery, the space linear range of B chain C end and A chain N end is 16.12 dusts, and the minimum space of linearly aligned pentapeptide distance is 16.0 dusts, for the conformation of A chain in the polypeptide chain that does not change fusion and B chain, infer that the Minimum Residual radix of the connection peptides between them should be no less than 5 residues.Consider B chain C end and A chain N end opposite orientation spatially, connection peptides preferably can form β-corner structure.Different aminoacids has different tendencies and ability when forming secondary structure, wherein Pro and Gly seldom form alpha-helix and beta sheet, and Pro, Gly, Asn, Ser is the most common in the conformation of β-corner, infers that the structure of Gly-Pro-Ser most possibly forms β-corner.So the connection peptides sequence of selecting for use in this experiment is Gly-Gly-Pro-Ser-Gly-Gly (SEQ ID NO:2).

2. use the 35S promoter of cauliflower mosaic virus (CaMV) the most frequently used in the plant genetic engineering in romaine lettuce, this promotor is applicable to most of plants and starts very capable.For tomato, cucumber, watermelon, muskmelon, eggplant, pumpkin, other fruit plants such as banana, apple, pears, pineapple and the piece root tuberous plant of other plant such as greengrocery and melon and fruit class such as Radix Dauci Sativae, radish, sweet potato, cassava, potato etc., the CaMV35S promotor that derives from cauliflower mosaic virus all can drive the expression of insulin gene in these plants.Foreign gene is expressed in specific room and time if desired, will use some organs and tissue specificity promotor that express or that be subjected to abduction delivering.In order to improve the translation skill of mRNA, need be to 5 ' and 3 ' adjustment signal of its gene, the use of translation starting point place sequence and codon is optimized.In order to make foreign gene be suitable in plant, expressing, sometimes even need again synthetic foreign gene.

3. in tomato, use fruit specific promoter 2A12

(1) tamato fruit specificity promotor 2A12 is the fragment that has amplified 868bp by round pcr in the positive control region of tomato 2A11 gene promoter.The mRNA of 2A11 gene can detect in the ovary of the day before yesterday of blooming, and during fully matured in the fruit 2A11mRNA level account for 1% of total mRNA.And all do not detect the mRNA of 2A11 in other tissue and etap, illustrate that this gene has the strict single-minded expression characterization (Van Haaren etal., 1993) of organizing.Change 2A12 promotor and gus gene fusion over to tomato, and root, stem, leaf, the floral organ official rank of transgenic plant carried out the GUS activation analysis with histochemical staining method, the result shows that the gus gene under this promoter regulation is homogeneity and expresses in fruit tissue, and in root, stem, leaf, detect less than GUS activity (Zhen Wei, 2000).Confirmed that the 2A12 promotor has the promotor specificity and the very high promoter activity of height in tamato fruit, the promoter activity of estimating it is 5-10 a times of CaMV35S promotor.

(2) using fruit specific promoter is for human insulin gene is only efficiently expressed in the fruit of tomato, avoided because foreign gene the institute of tomato plant in a organized way in constitutive expression and the plant resources that causes by the eubolism of mass consumption, plant disorder and the toxicity that vegetable cell caused owing to a large amount of accumulations of foreign protein.Thereby guarantee the synthetic insulin human of this transgenic Fructus Lycopersici esculenti mass production in normal growth.

4. add KDEL (four amino-acid residues) endoplasmic reticulum retention sequence at synthetic insulin human's C end, avoided the degraded of Regular Insulin in vegetable cell.

Behind designed protein sequence, add the end of KDEL, its advantage have following some: (1) expressed protein can be stranded in the endoplasmic reticulum, thereby makes things convenient for isolation and purification; (2) often along with the growth of plant, the foreign protein that is accumulated in the plant cytoplasm can be degraded gradually, and this method can be avoided synthetic insulin human's degraded; (3) the Plants and Animals iuntercellular is proteinic glycosylatedly is not both an important problem, because unnecessary glycosylation might make foreign protein produce unwanted immune response in vivo in the plant.Find in the comparison of glycosylation process that in to Plants and Animals both processes of synthetic high mannose core in endoplasmic reticulum are similar, and the key distinction is the route of synthesis of the interior complicated polysaccharide of golgi body thereafter.This method can make protein be stranded in the endoplasmic reticulum, and avoids the synthetic of complicated polysaccharide.

With tomato, romaine lettuce as bio-reactor

Tomato and romaine lettuce are the vegetables of common cultivated in the world, cultivate easily and are of high nutritive value, and can produce in the anniversary.Simultaneously, can be directly vaccine be transported to enteron aisle and reacts with activating immune system as the carrier of oral vaccine because it can be eaten raw.With vegetable cell is that its hard cell walls can produce the certain protection effect to its entrained antigen when passing digestive tube as an advantage of carrier directly, and it just is released when being transported to enteron aisle gradually.

What should particularly point out here is, though in following embodiment of the present invention with transgenic Fructus Lycopersici esculenti, generation of romaine lettuce and tobacco and detection have described in further detail the present invention for example, but this synthetic human insulin gene and used plant expression vector thereof of meaning that never the present invention prepares only are used to transform and produce the tomato that contains the insulin human, romaine lettuce and tobacco, because technical essential of the present invention is the design of plant-preference codon human insulin gene, the application of CaMV35S promotor and fruit specific promoter p2A12, the application of the application of KDEL endoplasmic reticulum retention sequence and location recombination system, the human insulin gene expression vector of the present invention that contains that those skilled in the art can utilize known method to build transforms tomato, romaine lettuce, tobacco and other plant.Therefore, use the constructed plant that contains the insulin human that human insulin gene and plant expression vector obtained of the present invention, all in claim of the present invention, these plants comprise: greengrocery and melon or fruit type crops such as tomato, romaine lettuce, cucumber, watermelon, muskmelon, eggplant, pumpkin, other fruit plants such as banana, apple, pears, pineapple and piece root tuberous plant such as Radix Dauci Sativae, radish, sweet potato, cassava, potato etc.

The invention provides and a kind ofly utilize transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco as bio-reactor production insulin human method.Comprise: the principle according to plant-preference codon designs contained codon, by the some dna fragmentations of synthetic, a successive opening code-reading frame (ORF) is spliced, this opening code-reading frame is the synthetic human insulin gene, this gene connects the B chain and the A chain of Regular Insulin with 6 amino acid (GGPSGG), and adds the endoplasmic reticulum retention sequence of KDEL at the C of Regular Insulin end; The CaMV35S promotor (cauliflower mosaic virus 35S promoter) that the plant of being familiar with those skilled in the art is commonly used is this gene promoter, is terminator with Nos polyA, structure plant expression vector pCAM35S-InsK; 2A12 is this gene promoter with tamato fruit specificity promotor, is terminator with Nos polyA, makes up plant expression vector pCAM2A12-InsK; PCAM35S-InsK and pCAM2A12-InsK are transformed in the Agrobacterium LBA4404 bacterial classification by freeze-thaw method respectively; Human insulin gene is changed in the callus of tomato, romaine lettuce and tobacco over to the transfer-gen plant of regenerating by agriculture bacillus mediated leaf dish method; Transfer-gen plant is carried out PCR and ELISA detection, obtain positive transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco, wherein utilize transgenic Fructus Lycopersici esculenti, romaine lettuce and the tobacco equal expressing human Regular Insulin in whole strain plant of CaMV35S promotor gained, utilize transgenic Fructus Lycopersici esculenti great expression insulin human in fruit of tamato fruit specificity promotor 2A12 gained.

In one embodiment of the invention, about synthesizing of human insulin gene, select the codon of plant-preference for use.In 63 bases of insulin human A chain, 13 bases have been changed for this reason.In 90 bases of B chain, change 18 bases, added 12 alkali yl coding endoplasmic reticulum retention sequence KDEL at 3 ' end in addition.We have designed 6 amino acid whose junction fragments between A chain and B chain, and these 6 amino acid are GGPSGG.The principle of design of the amino acid kind of this junction fragment and order is to keep the natural Three Dimensions Structure of insulin human.We clone EcoRI and BamHI site in the pGEM-11Z carrier with comprise the insulin human A chain and B chain and the middle segment order of connection of synthetic, and are determined this plasmid called after p11Z-InsK through the analysis and the sequential analysis of plasmid enzyme restriction collection of illustrative plates.In this embodiment, the human insulin gene fragment can obtain by pcr amplification, and during amplification, the primer of use is as follows:

InsK?5’：5’-GAT?CCA?TGT?TCG?TTA?ACC?AAC?ACC-3’(SEQ?ID?NO：3)

InsK?3’：5’-CTC?GTC?CTT?GTT?GCA?GTA?GTT?CTC-3’(SEQ?ID?ON：4)。

According to this embodiment of the present invention, the design of plant-preference codon not only comprises in the INSULIN A chain has changed 13 bases in 63 bases, in 90 bases of B chain, change 18 bases, should comprise that also other has changed the some amount base, met the plant-preference codon principle.

According to this embodiment of the present invention, the insulin gene of synthetic is not limited only to the application of vegetable codon, should expand to other and help the gene structure transformation that expression amount improves.

According to this embodiment of the present invention, the base that is added in synthetic insulin gene 3 ' end not only comprises four amino acid whose 12 bases of coding endoplasmic reticulum retention sequence KDEL, should comprise that also other similar purpose is in order to make Regular Insulin be trapped in other a plurality of amino-acid sequences in the endoplasmic reticulum.

According to this embodiment of the present invention, be connected with amino acid between the B chain at the A chain and not only comprise these 6 amino-acid sequences of GGPSGG, should comprise that also other purpose is a plurality of amino-acid sequences that can be folded into similar natural insulin three-dimensional structure for the Regular Insulin of expressing.

According to this embodiment of the present invention, the transformation of insulin structure except the B chain of Regular Insulin with the A chain is connected with these 6 amino acids formed corner structures of GGPSGG or other several amino acid that can form corner structure, also comprise the design of fault structure autonomous between B chain and the A chain, and the coded sequence of B chain and A chain is placed on respectively among the different transcription units.

In one embodiment of the invention, human insulin gene places under the regulation and control of composition type expression promoter CaMV35S promotor, changes in the intermediate carrier again.Further change binary expression vector pCAMBIA1390 again over to, finish the structure of a plant expression vector and (see the clone of human insulin gene of Fig. 1, synthetic and the structure schema of plant expression vector.Wherein human insulin gene is under the control of constitutive promoter CaMV35S).

According to this embodiment of the present invention, the promotor that drives human insulin gene is except composition type expression promoter CaMV35S, should comprise that also other purpose is in order to drive promotor such as the ubiquitin Ubiqutin promotor that insulin gene efficiently expresses, actin promotor etc. in plant.

According to this embodiment of the present invention, make up the pCAMBIA1390 expression vector that selected primordial plant expression vector is a CAMBIA company, its plant screening mark gene is hptII, coding Totomycin (htgromycin) resistance protein.The promotor of HptII coding region is the CaMV35S promotor, and terminator is CaMV35S polyA.The promotor that drives insulin gene is the CaMV35S promotor, and terminator is no polyA.

According to this embodiment of the present invention, make up selected primordial plant expression vector except the pCAMBIA1390 expression vector of CAMBIA company, can also select other expression vector or other constructed plant expression vector such as pGPTV series commonly used of those skilled in the art of CAMBIA company for use, pBI series pCB series etc.The marker gene of these plant expression vectors is hptII, NPTII and bar.The coded product of HptII gene provides the hygromycin resistance function, and the coded product of NPTII gene provides the kalamycin resistance function, and the coded product of bar gene provides the Herbicid resistant function.

In one embodiment of the invention, human insulin gene places under the regulation and control of fruit specific promoter p2A12, changes in the intermediate carrier again.Further change binary expression vector again over to, finish the structure of a plant expression vector and (see the clone of human insulin gene of Fig. 2, synthetic and the structure schema of plant expression vector.Wherein human insulin gene is under the control of fruit specific promoter p2A12).

According to this embodiment of the present invention, the promotor that drives human insulin gene is except fruit specific promoter P2A12, should comprise that also purpose is in order to efficiently express other promotor of Regular Insulin in plant certain or some particular organization organ, these promotors have satisfied insulin gene simultaneously and have expressed in different plants.These plants comprise greengrocery and melon or fruit type crops such as tomato, romaine lettuce, cucumber, watermelon, muskmelon, eggplant, pumpkin, other fruit plants such as banana, apple, pears, pineapple and piece root tuberous plant such as Radix Dauci Sativae, radish, sweet potato, cassava, potato etc.

According to this embodiment of the present invention, make up the pCAMBIA1390 expression vector that selected primordial plant expression vector is a CAMBIA company, its plant screening mark gene is hptII, coding Totomycin (htgromycin) resistance protein.The promotor of HptII coding region is the CaMV35S promotor, and terminator is CaMV35S polyA.The promotor that drives insulin gene is the CaMV35S promotor, and terminator is no polyA.

According to this embodiment of the present invention, make up selected primordial plant expression vector except the pCAMBIA1390 expression vector of CAMBIA company, can also select other expression vector or other constructed plant expression vector such as pGPTV series commonly used of those skilled in the art of CAMBIA company for use, pBI series pCB series etc.

In one embodiment of the invention, the method for plant expression vector importing Agrobacterium is a freeze-thaw method.Freeze-thaw method is the technological operation that those skilled in the art are familiar with very much, is not key of the present invention.Detect the male agrobacterium strains by PCR, be used to transform tomato, romaine lettuce and tobacco.

According to this embodiment of the present invention, selected agrobacterium strains is LBA4404.

According to this embodiment of the present invention, selected agrobacterium strains also should comprise other bacterial strain of Agrobacterium except LBA4404.The feature of these bacterial strains is itself to contain Vir toxic protein district, and the T-DNA in the plant expression vector that can help to change over to transfers in the genome of plant.

In one embodiment of the invention, the method for conversion tomato, romaine lettuce and tobacco is to be agriculture bacillus mediated Ye Panfa.Picking has transformed the single bacterium colony of Agrobacterium LBA4404 of plant expression vector, is inoculated in the Km50mg/L YEB liquid nutrient medium, and 28 ℃, the 165rpm overnight incubation.When bacterial concentration to OD ₆₀₀It is 0.2～0.6 o'clock, tomato stem section and the leaf explant cultivated in advance 2 days were infected 3～5 minutes, taking-up places on the aseptic filter paper and blots slightly, receiving not contain cultivates about two days altogether on the antibiotic substratum, be inoculated into Hyg (Totomycin) 5mg/L then, in the screening culture medium of Cb500mg/L, every subsequently subculture once finally screens resistant buds in the screening culture medium of suitable hyg concentration.Compare without the plants stems section and the leaf explant that infect, other culture condition are all identical.During regeneration plant length to the 2 to be transformed～3cm left and right sides, it is inserted in the root media of additional Hyg5mg/l, Cb500mg/l take root.

According to this embodiment of the present invention, the used microbiotic of foliage filter screening also comprises kantlex and weedicide except Totomycin, specifically selects for use which kind of screening to see and selects the pairing marker gene of plant expression vector for use.As select for use the pCAMBIA1390 carrier then selection markers be Totomycin (Hyg), select for use the pCAMBIA2390 carrier then selection markers be kantlex (Km), select for use the pCAMBIA3390 carrier then selection markers be weedicide.

The actual method for transformation that the present invention is used for the target plant is not crucial to the present invention, can use various transformation technology well-known to those skilled in the art that recombinant DNA sequence is imported target vegetable cell to be transformed.These methods are including but not limited to the Agrobacterium infestation method, microprojectile bombardment methods, and microinjection, coprecipitation method, electroporation, and ovary injection plant fertilization blastular method etc.Those skilled in the art can be by obtaining details with reference to relevant document.Preferably make in the stable genome that is incorporated into the target vegetable cell of the sequence that transformed, thereby it is not lost in the process that goes down to posterity.In addition, the nucleotide sequence that is used to transform the target plant can be with linearity, and the form of annular or other recombinant vectors such as the form of artificial chromosome exist.

Being used for the method for the whole plant of transformant regeneration is not crucial to the present invention, can use anyly to the suitable method of target plant, and those skilled in the art can be by obtaining details with reference to relevant document.

Beneficial effect of the present invention is as follows:

(1) plant is high eukaryote, can be similar to mammiferous to protein fold, glycosylation and assembling, this is very important for the proteic production of the medical animal with activity in vivo;

(2) different with the mammalian cell cultivation with microbial fermentation is that the growth of plant is not subjected to the restriction of culture apparatus and substratum.By the method for agricultural, actual therapeutic and the experiment required proteinic amount can be easy to and reach and expense cheap;

(3) can localization for a geographic kind of method for planting, because many edible plants regenerate easily, crop can go down in unconfined plantation, has solved long-distance transport traditional vaccine ingredients, has kept in the way and a difficult problem that the point of destination cold storage environment is faced;

(4) plant can avoid the infection of animal pathogen easily as reactor, and uses additive method production, in order to eliminate possibility of infection, generally needs high-temperature sterilization, and meanwhile makes the partial protein inactivation;

(5) the more important thing is, the edible portion of plant can be directly as the carrier of oral tolerance treatment, thereby avoided the extraction and the downstream purification process of high cost, and make the transportation for the candidate autoantigen become simple;

(6) and because edible vaccine without any need for syringe, had both avoided using the relative costs of syringe, also avoided the infection of the other diseases that brings by the syringe contamination of heavy.

Brief Description Of Drawings:

Fig. 1 and Fig. 1 are continuous to be the diagrammatic sketch that expression plant expression vector pCAM35S-InsK makes up flow process.

Fig. 2 and Fig. 2 are continuous to be the diagrammatic sketch that expression plant expression vector pCAM2A12-InsK makes up flow process.

Fig. 3 is that expression adopts location recombination system Cre/lox and FLP/FRT to control insulin gene at F2 deleted diagrammatic sketch in generation.

The acting in conjunction that Fig. 4 is expression by location recombination system and hormone regulation makes generation insulin human's the tomato can not normal blocky diagrammatic sketch.

Fig. 5 is the PCR evaluation figure of expression transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco.

Table 1 is plant-preference codon conclusive table (according to Murray E.E.).

Table 2 be synthesize 8 oligonucleotide fragments, molecular weight and dilution information slip

Table 3 is that raising for a long time of NOD mouse obeyed transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco testing data table

Table 4 is Agrobacterium YEB substratum composition tables

Table 5 is that tomato, romaine lettuce and tobacco tissue culture are cultivated base table with MS

Embodiment:

All (Jin Dongyan etc. translate with reference to " molecular cloning: laboratory operation guide " for microbial culture among all embodiment and DNA operation, Science Press, Beijing (1993)) and " fine works molecular biology guide " (Yan Ziying etc. translate, Science Press, Beijing (1998)).Toolenzyme in the molecule manipulation such as restriction enzyme be all available from Promega company, NewEnglandBiolabs company.

Embodiment 1 insulin human's synthetic:

Access to your password in the plant that provides according to people such as the Murray E.E. situation of son is inferred plant-preference codon.Sum up as table 1.

In GENEBANK, find proinsulin human's sequence, therefrom obtain the sequence of insulin human A chain and B chain, and according to plant-preference codon, base is replaced in design.Between the synthetic insulin human's who designs B chain and A chain, add the connection small peptide that designs; Before the B chain, add initiator codon ATG, add dna sequence dna and the terminator codon TAA of encoded K DEL behind the A chain; And add the restriction enzyme site BamHI and the EcoRI of two restriction enzymes respectively in the front and back of this synthetic gene; Just obtained designed synthetic human insulin gene.

The two strands of synthetic human insulin gene is divided into 8 sections (seeing Table 2), makes that an end of two chains, 5 ' end is slightly short, can be used as the primer of PCR reaction simultaneously, other 3 ' end is slightly long, overlapping each other and covering gene total length.Try one's best with G, C as ending when noting segmentation.

According to the base sequence of 8 sections oligonucleotide, 8 sections oligonucleotide have only above a kind of complementary pairing form, and the double chain nucleotide sequence of human insulin gene is as follows:

1

TT?CGTTAACCAA?CACCTTTGCG?GATCTCACCT?TGTTGAGGCT

AA?GCAATTGGTT?GTGGAAACGC?CTAGAGTGGA?ACAACTCCGA

BamHI??????????????Insulin?B-chain

51? CTTTACCTTG?TTTGCGGAGA?GAGGGGATTC?TT℃TACACCC?CAAAGACC

GAAATGGAAC?AAACGCCTCT?CTCCCCTAAG?AAGATGTGGG?GTTTCTGG

(Insulin?B-chain)????????????????Gly

101

GGAA?TCGTTGAGCA?ATGCTGCACC?TCTATCTGCT

CCTT?AGCAACTCGT?TACGACGTGG?AGATAGACGA

Gly?Pro?Ser?Gly?Gly?????????????????Insulin?A-chain

151? CTCTTTACCA?ACTTGAGAAC?TACTGCAAC

(SEQ?ID?NO：5)

GAGAAATGGT?TGAACTCTTG?ATGACGTTG (SEQ?ID?NO：6)

(Insulin?A-chain)????????????????stop?codon?EcoRI

Above-mentioned sequence is the double-stranded complete sequence of synthetic human proinsulin gene, wherein 1-5bp is the restriction enzyme site of designed BamHI, 183-187bp is the restriction enzyme site of designed EcoRI, and these two restriction enzyme sites make and when synthetic this gene of double-stranded method it directly are cloned on the carrier pGEM-11Z; 6-8bp is the initiator codon of transcribing, and 180-182bp is the terminator codon of transcribing; 9-98bp coding insulin human's B chain, 117-179bp coding insulin human's A chain, its aminoacid sequence and insulin human are identical, and nucleotide sequence all uses plant-preference codon; 99-116bp is that 6 designed amino-acid residues connect small peptide, to form a typical β-corner.

The final synthetic insulin human sequence of determining is shown in SEQ ID NO:1:

ATGTTCGTTA?ACCAACACCT?TTGCGGATCT?CACCTTGTTG?AGGCTCTTTACCTTGTTTGC?GGAGAGAGGG?GATTCTTCTA?CACCCCAAAG?ACCGGAGGACCATCTGGAGG?AGGAATCGTT?GAGCAATGCT?GCACCTCTAT?CTGCTCTCTTTACCAACTTG?AGAACTACTG?CAACTAA

Behind 8 sections oligonucleotide sequences of synthetic, it is as follows to make its formation finish the concrete operations step of human insulin gene:

(1) the synthetic oligonucleotide fragment of every pipe (2.5OD) is diluted with sterilized water according to last table, make that the final concentration of each bar oligonucleotide chain is 0.11nmol/ul

(2) 5 ' ends add phosphorus reaction:

Above-mentioned 8 pipes are respectively got in the Eppendorf pipe that 10ul adds 0.5ml respectively, place 15min on ice, add phosphorus reaction thereafter.Phosphorating reacts on more than 37 ℃ of reaction 1hr, and its system is:

The 25ul system:

Oligonucleotide fragment 10ul

T4 oligonucleotide kinases (diluting 10 times) 2.5ul

10X buffered soln 2.5ul

Sterilized water 10ul

(3) annealing:

8 fragments after phosphorating are respectively got 5ul, add in the 0.2ml Eppendorf pipe, add 10ul 10X T4 ligase enzyme buffered soln and 15ul sterilized water again, mixing; Place 10min for 95 ℃, be cooled to room temperature gradually with boiling water bath, after be transferred to 4 ℃ of refrigerators, slowly cooling;

With EcoRI and BamHI digestion pGEM-11Z carrier, enzyme is cut the back of spending the night and is mended sterilized water 400ul, with 2 times of dehydrated alcohol precipitations, is dissolved to 30ul thereafter.The enzyme system of cutting is:

The 100ul system:

PGEM-11Z plasmid 59ul

10X buffered soln 10ul

EcoRI???????????????3ul

BamHI???????????????3ul

Rnase???????????????4ul

Sterilized water 21ul

System after the annealing is taken out, place 10min on ice, add big fragment 27ul and 8ul T4DNA ligase enzyme (3U/ul) that carrier pGEM-11Z enzyme is cut postprecipitation again, 16 ℃ of connections are spent the night.The summary linked system is:

The 100ul system:

Oligonucleotide chain 8 * 5ul

The big fragment 27ul of carrier

10X ligase enzyme buffered soln 10ul

T4DNA ligase enzyme 8ul

Sterilized water 15ul

With connection product transformed into escherichia coli DH5 α bacterial strain, and utilize blue white sieve and PCR reaction pair recon to identify.The basic skills of plant expression vector construction is seen in concrete operations.To identifying that the male recon checks order, after the implementation sequence confirmation, with its called after p11Z-InsK.

The structure of embodiment 2 plant expression vector pCAM35S-InsK:

The structure flow process of plant expression vector pCAM35S-InsK sees that Fig. 1 and Fig. 1 continue:

(1) the pBI221 plasmid and the p11Z-InsK plasmid that will contain 35S promoter respectively carries out complete degestion with HindIII and XbaI, reclaim carrier behind the agarose gel electrophoresis respectively and insert fragment, by inserting fragment: carrier segments mol ratio 3:1 connects, the upstream that makes 35S insert synthetic human insulin gene is with its called after p11Z-InsK-35S;

The p11Z-InsK-35S and the expression of plants that contain the insulin gene under the 35S promoter driving that (2) will build respectively carry out complete degestion at carrier pCAMBIA1390 with HindIII and EcoRI, obtain plant expression vector pCAM35S-InsK after the connection.

HinidIII and BamHI double digestion cut out the small segment of 0.8kb, and pcr amplification also can obtain the small segment of 0.8kb, and the structure that proves carrier is correct.

The structure of embodiment 3 plant expression vector pCAM2A12-InsK:

The structure flow process of plant expression vector pCAM35S-InsK sees that Fig. 2 and Fig. 2 continue:

(1) the pTM plasmid and the p11Z-InsK plasmid that will contain the 2A12 promotor respectively carries out complete degestion with HindIII and XbaI, reclaim carrier behind the agarose gel electrophoresis respectively and insert fragment, by inserting fragment: carrier segments mol ratio 3:1 connects, the upstream that makes 2A12 insert synthetic human insulin gene is with its called after p11Z-InsK-2A12;

P11Z-InsK-2A12 that contains the insulin gene under the 2A12 promoters driven that (2) will build respectively and expression of plants carry out complete degestion at carrier pCAMBIA1390 with HindIII and EcoRI, obtain plant expression vector pCAM2A12-InsK after the connection.

HinidIII and BamHI double digestion cut out the small segment of 0.8kb, and PCR protects and increases the small segment that also can obtain 0.8kb, and the structure that proves carrier is correct.(P2A12 and CaMV35S's is big or small similar)

The conversion of embodiment 4 soil Agrobacteriums:

The competent preparation of soil Agrobacterium:

(1) soil Agrobacterium bacterial strain LBA4404 is inoculated in contains in the suitable antibiotic YEB liquid nutrient medium, 28 ℃ of shaking culture are to logarithmic phase;

(2) 4 ℃, 8, centrifugal 5 minutes of 000rpm collects thalline in little centrifuge tube;

(3) with the resuspended washed cell of 500mM CaCl2 of 600ul ice precooling;

(4) 4 ℃, 8, centrifugal 5 minutes of 000rpm adds the 500mM CaCl2 that 200ul ices precooling in the cell precipitation, standby behind the mixing (24hr to 48hr uses best);

The conversion of soil Agrobacterium:

(1) add the plant expression carrier plasmid DNA that about 1ug builds respectively, mixing gently, quick-frozen is 5 minutes in liquid nitrogen, and 37 ℃ of incubations are 5 minutes then;

(2) add 600ul YEB liquid nutrient medium, 28 ℃ jog 2-4 hour;

(3) get 200ul bacterium liquid and evenly coat and contain suitable antibiotic YEB and select on the flat board, be inverted for 28 ℃ and cultivated two days.Choose several bacterium colonies and carry out the PCR detection, obtain positive strain.

Genetic transformation and the plant regeneration of embodiment 5 tomatoes:

Genetic transformation of tomato and plant regeneration

The preparation of explant

(1) chooses full tomato seeds, with 70% Ethanol Treatment 1 minute;

(2) receive solution-treated with 20% hypochlorous acid and carried out surface sterilization in 20 minutes, and with sterile water wash 3-5 time;

(3) be seeded on the tomato solids substratum [common MS substratum], be used for when two cotyledons launch fully after 10-14 days transforming.

Leaf dish method transforms tomato and plant regeneration

(1) near eqpidemic disease 1/3 place clip tomato cotyledon as outside grow body, immerse in the soil Agrobacterium diluent that has goal gene and infected 20 minutes, during shake gently;

(2) remove unnecessary bacterium liquid with the aseptic filter paper suction, shift these blades dark cultivation two days in tomato substratum [MS+BA (0.5)+NAA (0.1)+Hyg (1.0)+Cb (500), unit is mg/L];

(3) after blade being grown body outward changes in [MS+BA (0.5)+NAA (0.1)+Hyg (1.0), unit is mg/L], in 25 ℃ of illumination cultivation;

(4) succeeding transfer culture repeatedly the back callus grow the tomato seedling, treat that seedling is cut after big slightly to insert in the 1/2MS substratum to take root.

(5) treat to transplant in the engagement behind the well developed root system, and carry out molecular biology identification.

PCR assay certificate insulin gene is incorporated in the genome of tomato, and ELISA detects the proof insulin gene and efficiently expresses in transgenic Fructus Lycopersici esculenti.

The genetic transformation and the plant regeneration of embodiment 6 romaine lettuce:

The genetic transformation of romaine lettuce and plant regeneration

The preparation of explant

(1) chooses full romaine lettuce seed, with 70% Ethanol Treatment 1 minute;

(2) receive solution-treated with 20% hypochlorous acid and carried out surface sterilization in 20 minutes, and with sterile water wash 3-5 time;

(3) be seeded on the romaine lettuce solid medium [common MS substratum], be used for when two cotyledons launch fully after 10-14 days transforming.

Leaf dish method transforms romaine lettuce and plant regeneration

(1) choose big slightly romaine lettuce blade, be cut into 0.5 square centimeter fritter, immerse in the soil Agrobacterium diluent have goal gene and infected 20 minutes, during shake gently;

(2) remove unnecessary bacterium liquid with the aseptic filter paper suction, shift these blades dark cultivation two days in romaine lettuce substratum [MS+BA (0.5)+NAA (0.1)+Hyg (1.0)+Cb (500), unit is mg/L];

(3) after blade is grown body outward and change among the SM2, in 25 ℃ of illumination cultivation;

(4) succeeding transfer culture repeatedly the back callus grow the romaine lettuce seedling, treat that seedling is cut after big slightly to insert in the 1/2MS substratum to take root.

(5) treat to transplant in the engagement behind the well developed root system, and carry out molecular biology identification.

PCR assay certificate insulin gene is incorporated in the genome of romaine lettuce, and ELISA detects the proof insulin gene and efficiently expresses in transgenic lettuce.

Genetic transformation and the plant regeneration of embodiment 7 tobaccos:

Leaf dish method transformation of tobacco and plant regeneration

(1) the single bacterium colony of inoculation Agrobacterium was cultivated 1-2 days for 28 ℃ in containing suitable antibiotic 2ml YEB liquid nutrient medium, and switching is gone in the 40ml YEB liquid nutrient medium, 28 ℃ are continued to be cultured to OD600 about 0.5,8, centrifugal 10 minutes of 000g, thalline suspends again with 40ml MS liquid nutrient medium.

(2) get aseptic tobacco leaf and do not contain the stem section of axillalry bud, 25 ℃ of pre-cultivations one day in the MS solid medium.

(3) retrieve material, be cut into small pieces with scissors and put into the Agrobacterium that aseptic MS liquid nutrient medium diluted, soaked 15-20 minute, jog several times therebetween.

(4) remove unnecessary bacterium liquid with the aseptic filter paper suction, 25 ℃ of dark cultivations two days in tobacco substratum [MS+BA (0.5)+NAA (0.1)+Hyg (1.0)+Cb (500), unit is mg/L].

(5) material is changed in the tobacco substratum [MS+BA (0.5)+NAA (0.1)+Hyg (1.0), unit is mg/L], 25 ℃ of illumination cultivation are to differentiating callus, until growing bud; Every 14-20 days succeeding transfer culture once;

(6) bud that will grow to 3-5cm changes tobacco root media [1/2MS substratum] over to and goes up root induction;

(7) about 2-3 root system formation after week is transplanted in the soil of sterilization and is cultivated.

PCR assay certificate insulin gene is incorporated in the genome of tobacco, and ELISA detects the proof insulin gene and efficiently expresses in transgenic lettuce.

Embodiment 8 adopts location recombination system Cre/lox and FLP/FRT to control insulin gene at F ₂Deletion in generation:

Change the insulin gene that fruit specific promoter drives in parent 1 over to, the both sides of this promotor and Regular Insulin are LoxP element (Cre recombinase recognition component) in the same way, and the carrier with copper inducible promoters driven FLP gene changes among the parent 1 simultaneously; In parent 2, change the Cre recombinase gene of embryo's specificity promoters driven over to, between promotor and Cre recombinase, be the blocking-up sequence, and these blocking-up sequence both sides are FRT element (FLP recombinase recognition component) in the same way.With parent 1 and parent's 2 hybridization, under the inducing of 0.5 μ M cupric ion, F1 for plant in because the blocking-up sequence between two FRT elements of the effect of FLP recombinase deletion, form the stage at F1 for growing to seed, in ovule because the effect of Cre recombinase, but the sequence of expressing human Regular Insulin is because between two LoxP elements in the same way, thereby deleted.Detailed process is seen Fig. 3.

The acting in conjunction of embodiment 9 by location recombination system and hormone regulation makes generation insulin human's the tomato can not be normally solid:

The plant expression vector that will contain fruit specific promoter driving insulin gene and embryo's specificity promoters driven Cre recombinase gene changes parent 1 over to by the Agrobacterium infestation method; In parent 2, change the ipt gene (isopentenyl transferase genes of embryo's specificity promoters driven over to, promote cell to produce growth hormone), between promotor and ipt gene, be the blocking-up sequence, and these blocking-up sequence both sides are LoxP element (Cre recombinase recognition component) in the same way.With parent 1 and parent's 2 hybridization, at F ₁In embryo development procedure, because two blocking-up sequences between the LoxP element have in the same way been deleted in the effect of Cre recombinase, make the ipt gene to promote in generation that vegetable cell produces growth hormone, disturbed the formation of seed, make tomato can not normally produce seed at F2.Detailed process is seen Fig. 4.

The evaluation and the detection of embodiment 10 transfer-gen plants:

The preparation of plant genome DNA

(1) takes by weighing 0.1g plant leaf or stem tissue, in mortar, grind to powder with liquid nitrogen fast and change in the 1.5ml centrifuge tube, add extraction damping fluid (the 500mM NaCl of 500ul immediately, 50mM Tris-Cl PH8.0,50mM EDTA, 1% (V/V) beta-mercaptoethanol), mixing gently;

(2) be positioned on ice after thawing, add ice-cold 20% storage solution PVP (being stored in-20 ℃) to final concentration be 6%.

(3) add 50ul 20%SDS, gently behind the mixing in 65 ℃ of water-baths 10 minutes;

(4) add 250ul 5M KAc in reacting 30 minutes centrifugal (15000rpm, 10 minutes, 4 ℃) on ice.

(5) get and change a new centrifuge tube mutually over to, add 0.6 times of volume Virahol, mixing is three times gently, places 10 minutes on ice again.Centrifugal (15000rpm, 10 minutes, 4 ℃), supernatant discarded;

(6) throw out vacuumizes or after room temperature dries up, is dissolved in 500ul 1 * TE (pH8.0).Saturated phenol with 1 times of volume: chloroform: primary isoamyl alcohol (25: 24: 1) extracting one to twice, get phase;

(7) centrifugal (12000rpm, 10 minutes, 20 ℃) are got and are changed a new centrifuge tube mutually over to;

(8) add the Virahol (20 ℃, 5 minutes) of 1 times of volume, and will manage and put upside down 5 times at least;

(9) centrifugal (15000rpm, 10 minutes, 4 ℃) with 70% alcohol flushing throw out, vacuumize or dry up, and are dissolved at last among an amount of TE (pH8.0).

The PCR of transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco identifies:

After obtaining complete pCAM35S-InsK transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco, at early growth period, get transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco leaf and also carry out the PCR evaluation with total DNA of SDS method extraction plant, with the synthetic human insulin gene fragment of synthetic human insulin gene two ends primer amplification, can obtain the band of about 180bp, illustrate that synthetic human insulin gene has been integrated into the genome of transfer-gen plant.(see Fig. 5: the PCR of transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco identifies)

The PCR that fruit specific promoter drives transgenic Fructus Lycopersici esculenti identifies:

After obtaining complete pCAM2A12-InsK transgenic Fructus Lycopersici esculenti, at early growth period, get the transgenic Fructus Lycopersici esculenti blade and also carry out the PCR evaluation with total DNA of SDS method extraction tomato, with the synthetic human insulin gene fragment of synthetic human insulin gene two ends primer amplification, can obtain the band of about 180bp, illustrate that synthetic human insulin gene has been integrated into the genome of tomato.(see Fig. 5: the PCR of transgenic lettuce, tomato and tobacco identifies)

The ELISA of embodiment 11 transfer-gen plants detects:

The preparation of solution:

1) coating buffer: 50mM Na2CO3-NaHCO3, pH9.6

2) washings: 0.05%Tween-20,0.01M phosphoric acid salt-NaCl damping fluid (PBS), pH7.4

3) confining liquid: 1-2% bovine serum albumin, washings

4) an anti-solution: get the antiserum(antisera) dry powder formulations of one bottle of rabbit, add the dissolving of 1ml washings, face with preceding with 10 times of washings dilutions

5) two anti-solution: goat anti-rabbit igg-AP face with preceding with 2000 times of washings dilutions

6) colour developing damping fluid: 0.1M NaCl, 0.05M MgCl2,0.1M Tris-HCl, pH 9.5

7) colour developing liquid: 30ml colour developing damping fluid, 50 μ l NBT/BCIP[contain 33 μ l NBT stock solutions (100mgNBT, 2ml 70%DMF) and 17 μ l BCIP stock solutions (100mg BCIP, 2ml 100%DMF)]

8) stop buffer: 0.15MNaCl, the 0.1M toxilic acid transfers to pH7.5 with NaOH

The concrete steps that ELISA detects are:

1) bag quilt: the material that will change tomato, romaine lettuce and the tobacco of human insulin gene is put in the Effendorf pipe with not genetically modified contrast (about 0.1-0.2g weight in wet base), adding liquid nitrogen freezing fully ground it after the several seconds, add 500 μ l coating buffers, the centrifugal 5min of 12000rpm behind the mixing, get supernatant, suitably respectively add 100 μ l in reacting hole after the dilution with coating buffer, adding 100 μ l washingss simultaneously is blank, adds a cover rearmounted 4 ℃ and spends the night or 37 ℃ of constant temperature oven temperature,s bath 2h.

2) sealing: discard liquid in the hole, add 200 μ l washingss in every hole, discard after leaving standstill 3min, repeat 3 times, be buckled in suck dry moisture on the filter paper.Every hole adds 200 μ l confining liquids, adds a cover rearmounted 37 ℃ of thermostat container 1h, discards liquid in the hole, with washings washing 3 times.

3) adding one resists: get 100 μ l, one anti-solution and be added in the hole, add a cover rearmounted 37 ℃ of thermostat container 1-2h, with washings washing 3 times.

4) adding two resists: get 100 μ l, two anti-solution and be added in the hole, add a cover rearmounted 37 ℃ of thermostat container 1-2h, with washings washing 3 times, wash 2 times with the colour developing damping fluid, be buckled in suck dry moisture on the filter paper.

5) colour developing: every hole adds 100 μ l colour developing liquid, and Sptting plate places the room temperature dark place to carry out color reaction, and every hole adds 50 μ l stop buffer termination reactions.

With not genetically modified tomato, romaine lettuce and tobacco is contrast, a plurality of genetically modified tomatoes, romaine lettuce and tobacco strain system have been carried out enzyme linked immunological absorption to be detected, the result shows, the transgenosis strain all has stronger immunocompetence, very weak non-special absorption is only arranged in contrast, human insulin gene high level expression in transfer-gen plant is described, insulin human's average content in romaine lettuce is to account for 0.3% of soluble protein, the average content of insulin human in tamato fruit is to account for 0.8% of soluble protein, and insulin human's average content in tobacco is to account for 0.3% of soluble protein.Be to improve the repeatability of experiment, each step of reaction all should thorough washing, to remove residue, to reduce non-specific adsorption, also fixedly washing times and storage period, avoids concussion or pollutes mutually.In addition, be convenient to comparison for making color reaction, the time of putting the room temperature dark place during colour developing should be consistent.

Embodiment 12 extracts the insulin human from transgenic Fructus Lycopersici esculenti, romaine lettuce and tobacco:

The entire operation process is carried out in the workshop of GMP standard.Pluck sophisticated transgenic Fructus Lycopersici esculenti, fresh romaine lettuce blade or fresh tobacco leaf, clean with sterile distilled water after the surface sterilization, add 82% ethanol after cutting into pieces, add the 12mol/L sulfuric acid in 10～12 ℃, transfer pH2.8～3.0, stir and extract 0.5h.Add 6mol/L hydrochloric acid and transfer pH to 2.0, continue to stir extraction 2.5h, separate residue, residue adds 65% ethanol, transfers pH2.0 with 6mol/L hydrochloric acid, and 10～12 ℃ are stirred extraction 2h, separate residue.Merge No. 2 times extracting solution.

The alkalization extracting solution is chilled to 0～5 ℃, transfers pH7.8～8.0 with strong aqua, adds diatomite, filter press uses mixing acid (hydrochloric acid 4000ml, sulfuric acid 1000ml, water 4000ml) to be acidified to pH2.5 immediately, waits to precipitate complete back siphon clear liquid, hang filter, remove precipitation, temperature is controlled at 0～3 ℃.

Zinc precipitation clear liquid adds liquor zinci chloridi (being made into 30～50% solution earlier, with adding behind the 6mol/L hydrochloric acid accent pH2.5), 2～4 ℃ of temperature for the first time, after treating that precipitation fully, the siphon clear liquid hangs filter, remove precipitation, clear liquid is transferred pH to 6.8～7.0 with strong aqua, spends the night in 5 ℃.

Clear liquid is removed in degreasing, siphon next day of saltouing, and sedimentation and filtration, collection are dissolved in 5 times of amount distilled water, transfer pH2.7～2.8,12～15 ℃ placement with 6mol/L hydrochloric acid.Emit subnatant (reclaim subnatant, use for following batch of zinc resolution of precipitate) next day, clear liquid is transferred pH to 2.5 with 6mol/L hydrochloric acid, adds 16% sodium-chlor again and saltouts, and filters, and collects the pickle change thing.

The 2nd zinc of 30% acetone fractional precipitation precipitates the thing of saltouing and is dissolved in 7 times of water gagings, adds 3 times of amount acetone, transfers pH4.5 with 4mol/L ammoniacal liquor, be chilled to 0～5 ℃ and spend the night, remove precipitation (precipitation reclaims separately), clear liquid is transferred pH6.0 with 4mol/L ammoniacal liquor, add 20% zinc acetate, separate out white precipitate.

Collecting precipitation is filtered in crystallization, and press following prescription crystallization: 2% citric acid 500ml, 20% zinc acetate 6.5ml, acetone 160ml, distilled water diluting are to 1000ml, and crystal solution is cooled to 0～5 ℃, alkalizes to pH8.0 with 4mol/L ammoniacal liquor, removes by filter precipitation.Regulate pH6.0 with 10% citric acid, stirred crystallization two days, clear liquid is removed in siphon, and is centrifugal, collect, crystallization, with distillation washing 2 times, acetone is washed 2 times, Vanadium Pentoxide in FLAKES vacuum-drying.

The clothes of raising of embodiment 13NOD mouse are tested:

The NOD mouse is the mouse model of type i diabetes, and female NOD mouse has the spontaneous generation type i diabetes of 75-85% meeting after about 30 weeks.By the short-term of NOD mouse being raised the clothes experiment, with 5 the week age mouse per week 5mg consumption raise clothes 5 weeks, after get pancreas section and carry out electron microscopic observation, relatively raise the NOD mouse of romaine lettuce blade, tobacco protein extracting solution or the tamato fruit of obeying synthetic human insulin transgenic and the damage status of control group pancreatic beta cell, and judge according to this whether it is effective.Test shows that the NOD mouse β cells injury situation of raising the clothes transgenic plant will be significantly better than raising the not genetically modified control group of clothes.

Test by the clothes of raising for a long time the NOD mouse, 5mg continues to raise clothes weekly, or raise clothes and stop after several weeks, detection and the record that experimental group and the control group of NOD mouse carried out the onset diabetes rate weekly, relatively and judge that this raises the generation that NOD mouse type i diabetes was postponed or prevented to the clothes experiment whether.Test shows that the NOD mouse onset diabetes rate of raising clothes transgenic lettuce blade, tobacco protein extracting solution, tamato fruit for a long time all is starkly lower than control group.(seeing Table 3)

Table 1 plant-preference codon conclusive table (according to Murray E.E.)

	Amino acid	Codon		Amino acid	Codon
						??1	??Gly(G)	??GGA	??11	??Ile(I)	??ATC
??2	??Glu(E)	??GAG	??12	??Thr(T)	??ACC
						??3	??Asp(D)	??GAT	??13	??Trp(W)	??TGG
??4	??Val(V)	??GTT	??14	??Cys(C)	??TGC
						??5	??Ala(A)	??GCT	??15	??Tyr(Y)	??TAC
??6	??Arg(R)	??AGG	??16	??Leu(L)	??CTT
						??7	??Ser(S)	??TCT	??17	??Phe(F)	??TTC
??8	??Lys(K)	??AAG	??18	??Gln(Q)	??CAA
						??9	??Asn(N)	??AAC	??19	??His(H)	??CAC
??10	??Met(M)	??ATG	??20	??Pro(P)	??CCA

Table 2 synthesizes 8 oligonucleotide fragments, molecular weight and dilution situation

No.1?5′-GATCCATGTT?CGTTAACCAA?CACC-3′

No.2?5′-TTTGCGGATC?TCACCTTGTT?GAGGCTCTTT?ACCTTGTTTG?CGGAGAGAGG?GGATTC-3′

No.3?5′-TTCTACACCC?CAAAGACCGG?AGGACCATCT?GGAGGAGGAA?TCGTTGAGCA?ATG-3′

No.4?5′-CTGCACCTCT?ATCTGCTCTC?TTTACCAACT?TGAGAACTAC?TGCAACTAAG-3′

No.5?5’-AATTCTTAGT?TGCAGTAGTT?CTC-3’

No.6?5’-AAGTTGGTAA?AGAGAGCAGA?TAGAGGTGCA?GCATTGCTCA?ACGATTCC-3’

No.7?5’-TCCTCCAGAT?GGTCCTCCGG?TCTTTGGGGT?GTAGAAGAAT?CCCCTCTCTC?CGCAAAC-3’

No.8?5’-AAGGTAAAGA?GCCTCAACAA?GGTGAGATCC?GCAAAGGTGT?TGGTTAACGA?ACATG-3’

??No.	??1	??2	??3	??4	??5	??6	??7	??8
									Sequence number	??K ??14166	??K ??14167	??K ??14168	??K ??14169	??K ??14170	??K ??14171	??K ??14172	??K ??14173
The total alkali radix	??24	??56	??53	??50	??23	??48	??57	??55
									??A	??7	??8	??16	??13	??5	??16	??10	??20
??G	??3	??17	??15	??6	??4	??14	??13	??16
									??C	??8	??11	??13	??16	??4	??8	??19	??9
??T	??6	??20	??9	??15	??10	??10	??15	??10
									Molecular weight	??72 ??29	??17 ??299	??16 ??382	??15 ??176	??69 ??93	??14 ??857	??17 ??340	??17 ??049
Every pipe quality (ug)	??82 ??.5	??82 ??.5	??82 ??.5	??82 ??.5	??82 ??.5	??82 ??.5	??82 ??.5	??82 ??.5
									Mole number (nmol)	??11 ??.4	??4. ??77	??5. ??04	??5. ??44	??11 ??.8	??5. ??55	??4. ??76	??4. ??84
Be diluted to (ul)	??10 ??6.4	??44 ??.4	??46 ??.8	??50 ??.8	??11 ??0.0	??51 ??.6	??44 ??.4	??45 ??.2

Raise for a long time clothes transgenic Fructus Lycopersici esculenti, romaine lettuce and the tobacco of table 3NOD mouse are tested

	Quantity (individual)	Time (moon)	The survival number	The onset diabetes rate
					Transgenic lettuce	??20	??6	??12	??40％
Transgenosis	??20	??6	??14	??30％

Tomato
					Transgene tobacco	??20	??6	??11	??45％
Control group	??20	??6	??3	??85％

Table 4 Agrobacterium YEB culture medium prescription

Table 5 tomato, romaine lettuce and tobacco tissue culture MS substratum

The bacterial classification that this patent relates to is in China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation, Zhong Guan-cun, unit address BeiJing, China, this microorganism classification name is called colon bacillus (E coli.), the preservation code name is p11Z-InsK, deposit number is CGMCC NO.0723, and preservation date is on March 8th, 2002.

In a word, the invention provides a kind of transgenic Fructus Lycopersici esculenti that utilizes, romaine lettuce and tobacco produce insulin human's method as bio-reactor, and provide dna sequence dna by plant-preference codon synthetic human insulin gene, the CaMV35S promoters driven human insulin gene of constitutive expression and the high-efficiency plant expression vector that fruit specific promoter drives human insulin gene have been made up, transform tomato by agrobacterium-mediated transformation, romaine lettuce and tobacco, prove that this synthetic gene can efficiently express in plant, animal experiment also proves effectively, can be used in scale operation.

Sequence table

＜110〉woods, loyal flat

＜120〉a kind of human insulin gene of synthetic and the application in cultivating transgenic Fructus Lycopersici esculenti thereof

<160>6

<170>PatentIn?version?3.3

<210>1

<211>177

<212>DNA

＜213〉artificial sequence

<400>1

atgttcgtta?accaacacct?ttgcggatct?caccttgttg?aggctcttta?ccttgtttgc?????60

ggagagaggg?gattcttcta?caccccaaag?accggaggac?catctggagg?aggaatcgtt????120

gagcaatgct?gcacctctat?ctgctctctt?taccaacttg?agaactactg?caactaa???????177

<210>2

<211>6

<212>PRT

＜213〉artificial sequence

<400>2

Gly?Gly?Pro?Ser?Gly?Gly

1???????????5

<210>3

<211>24

<212>DNA

＜213〉artificial sequence

<400>3

gatccatgtt?cgttaaccaa?cacc?????????????????????????????????????????????24

<210>4

<211>24

<212>DNA

＜213〉artificial sequence

<400>4

ctcgtccttg?ttgcagtagt?tctc?????????????????????????????????????????????24

<210>5

<211>183

<212>DNA

＜213〉artificial sequence

<400>5

gatccatgtt?cgttaaccaa?cacctttgcg?gatctcacct?tgttgaggct?ctttaccttg????60

tttgcggaga?gaggggattc?ttctacaccc?caaagaccgg?aggaccatct?ggaggaggaa???120

tcgttgagca?atgctgcacc?tctatctgct?ctctttacca?acttgagaac?tactgcaact????180

aag??????????????????????????????????????????????????????????????????183

<210>6

<211>183

<212>DNA

＜213〉artificial sequence

<400>6

gtacaagcaa?ttggttgtgg?aaacgcctag?agtggaacaa?ctccgagaaa?tggaacaaac?????60

gcctctctcc?cctaagaaga?tgtggggttt?ctggcctcct?ggtagacctc?ctccttagca????120

actcgttacg?acgtggagat?agacgagaga?aatggttgaa?ctcttgatga?cgttgattct????180

taa??????????????????????????????????????????????????????????????????183

Claims (10)

1, a kind of human insulin gene of synthetic has the nucleotide sequence shown in SEQ ID NO:1.

2, the human insulin gene of a kind of synthetic according to claim 1 is characterized in that: described nucleotide sequence has adopted the plant-preference codon.

3, the human insulin gene of a kind of synthetic according to claim 1, it is characterized in that: have 13 bases different in the human insulin gene of described synthetic in the insulin human A chain gene, have 18 bases different in the insulin human B chain gene of described synthetic with the base of natural human insulin B chain gene with the base of natural human insulin A chain gene.

4, the human insulin gene of a kind of synthetic according to claim 1, it is characterized in that: the B chain gene is preceding in the human insulin gene of described synthetic, the A chain gene after, B chain gene and A chain gene are to couple together with the small peptide gene that is different from C peptide gene.

5, the human insulin gene of a kind of synthetic according to claim 4 is characterized in that: the small peptide aminoacid sequence of described small peptide genes encoding is shown in SEQ ID NO:2.

6, the human insulin gene of a kind of synthetic according to claim 1 is characterized in that: the human insulin gene 3 ' terminal nucleotide sequence of described synthetic coding can make the insulin human of described synthetic be trapped in peptide sequence in the endoplasmic reticulum.

7, the human insulin gene of a kind of synthetic according to claim 1 is characterized in that: described peptide sequence is KDEL.

8, the plant expression vector that contains the human insulin gene of the described synthetic of claim 1.

9, the application of the human insulin gene of the described synthetic of claim 1 in the kind that cultivates plants.

10, the application of the human insulin gene of the described synthetic of claim 1 in cultivating transgenic Fructus Lycopersici esculenti.

Images