CN101665801A - Method for enhancing reverse resistance of microorganisms - Google Patents

Method for enhancing reverse resistance of microorganisms Download PDF

Info

Publication number
CN101665801A
CN101665801A CN200910178094A CN200910178094A CN101665801A CN 101665801 A CN101665801 A CN 101665801A CN 200910178094 A CN200910178094 A CN 200910178094A CN 200910178094 A CN200910178094 A CN 200910178094A CN 101665801 A CN101665801 A CN 101665801A
Authority
CN
China
Prior art keywords
bacterium
acid
gene
bacillus
pha
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN200910178094A
Other languages
Chinese (zh)
Other versions
CN101665801B (en
Inventor
陈国强
张晋宇
吴琼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Priority to CN2009101780940A priority Critical patent/CN101665801B/en
Publication of CN101665801A publication Critical patent/CN101665801A/en
Application granted granted Critical
Publication of CN101665801B publication Critical patent/CN101665801B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a method for regulating and controlling the metabolism of microorganisms and enhancing the reverse resistance of the microorganisms. In the method provided by the invention, poly-hydroxy fatty acid ester is synthesized in the microorganisms by introducing the relevant gene of a synthesis approach of the poly-hydroxy fatty acid ester into the microorganisms. By applying themethod into various microbial production bacteria, the metabolism approach of the production bacteria can be effectively influenced, the reverse resistance of the bacteria is increased, and the production efficiency of biological engineering products comprising hyaluronic acid, pyruvic acid, ergosterine, beer, carnine, elastolytic enzymes, carotenoid, glutamine, lysine, phenylalanine, gluconic acid, amylase, alcohol, glycerol, twelve-carbon dibasic acid, fifteen-carbon dibasic acid, entobakterin powder, vernine, glutathione, erythrol, D-ribose, 1,3-propylene glycol and the like is enhanced.

Description

A kind of method that improves reverse resistance of microorganisms
The application is that application number is 200510068113.6, the applying date the dividing an application for " a kind of regulating microorganism metabolism and improve the method for reverse resistance of microorganisms " that be on 04 26th, 2005, invention and created name.
Technical field
The present invention relates to a kind of regulating microorganism metabolism in the biological technical field and improve the method for reverse resistance of microorganisms.
Background technology
Polyhydroxyalkanoate (Polyhydroxyalkanoate or PHA) be the bacterium of numerous species can both a kind of cell of synthetic in polyester, mainly there is (Lemoigne M.Products of dehydration and of polymerization of-hydroxybutyricacid.Bull.Soc.Chem.Biol. in vivo as the storage material of the cell internal carbon source and the energy, 1926,8:770-782).The general structure of PHA as:
Figure G2009101780940D00011
(formula I)
Wherein n can be 1,2,3 or 4, represents the 3-hydroxy fatty acid during n=1; M is the polymerization degree; R is variable side-chain radical, as saturated or unsaturated, straight chain or contain side chain and the alkyl of substituent different chain length.
According to the length difference of PHA side chain, PHA can be divided into three types:
(1) short chain PHA (short-chain-length PHA, scl PHA), as poly butyric ester (polyhydroxybutyrate, PHB), the multipolymer of butyric ester and hydroxyl valerate [poly (hydroxybutyrate-co-hydroxyvalerate), PHBV], monomer contains 3-5 carbon atom.
(2) long-chain PHA (medium-chain-length PHA, mcl PHA) in, as poly-hydroxycaproic ester (PHHx), poly-Hydroxyoctanoic acid ester (PHO), monomer contains 6 above carbon atoms.Can contain multiple functional group among the mcl PHA, as two keys (Huigberts GNM, Eggink G, Waard P, Huisman GW and Witholt B.Pseudomonas putitaKT2442cultivated on glucose accumulates poly-β-hydroxyalkanoates consistingof saturated and unsaturated momnomers.Appl Envron.Microbiol., 1992,58:536-544), three key, halogen (Doi Y and Abe C.Biosynthesis and characterization ofa new bacterial copolyester of 3-hydroxyalkanoates and3-hydroxy-w-chloroalkanoates.Macromolecules, 1990,23:2705-3707), phenol (FritzscheK, Lenz RW and Fuller RC.An unusual bacterial polyesters with a phenyl pendantgroup.Macromol Chem, 1990,191:1957-1968) and cyanogen (Schulz C, Wolk S, Lenz RW andFuller RC.Growth and polyester production by Pseudomonas oleovorans on branchedoctanoic acid substrates.Macromolecules.1995,27:6358-6362) etc.Mcl PHA is two or more monomeric randomcopolymers mostly.
(3) contain short chain and the monomeric PHA of middle long-chain, mostly be two or more monomeric randomcopolymer (LageveenRG, Huisman GW, Preusting H, Ketelaar H, Eggink G and Witholt B.Formation ofPolyesters by Pseudomonas oleovorans:Effect of Substrates on formation andcomposition of poly-(R)-3-hydroxyalkanoates and poly-(R)-3-hydroxyalkenoates.Appl.En viron.Microbiol, 1988,54:2924-2932).
PHA has great importance for variation and the existence that bacterium adapts to external environment.With PHB is example, and the PHB in some bacterium born of the same parents can slow down important component-RNA and the degraded of protein under starvation conditions in the cell, thereby can increase the resistivity of bacterium to the existence adverse circumstance.In addition in some bacillus, although the essential PHB of the formation of spore, thus the chance for survival that the energy when PHB can be used as sporulation and carbon source increase these bacterium.In addition, PHB can also form the carbon source and the energy that provides necessary for the packing of some Azotobacter.The fixed nitrogen of Rhizobium sp.ORS 571 and formation and the Research on degradation of PHB are shown; when the oxygen concn in the joint knot increases; PHB can be by injury-free (the Anderson AJ and Dawes EA.Occurense of degraded protection nitrogenase of oneself; Metabolism; Metabolic Role; and Industrial Use of Bacterial Polyhydroxyalkanoates.Microb.Rev., 1990,54:450-472).
PHA can also be as the mark of environment.Studies show that the microorganism in the settling of river bend is carried out,, can monitor extraneous factor to sedimental influence degree by the synthetic ratio of phosphatide and PHA wherein.And the bacterium of many PHA of synthesizing is all at active sludge and be rich in screened come out in the organic environment of carbon source.Some are being had a liking for studies show that Mare Frigoris ocean microorganism carries out by serious local isolating of crude oil pollution, most of microbe wherein can be at intracellular accumulation PHA (Alvarez HM under the condition of limit nitrogen, Pucci OH and Steinb ü chel A.Lipid storagecompounds in marine bacteria.Appl.Microbiol.Biotechnol., 1997,47:132-139).These explanation most of bacteriums in the more rich environment of these carbon sources all possess excessive carbon source are converted into the ability that PHA stores.
PHB is the interior carbon source of bacterium born of the same parents and the reserve of the energy.But find that recently it also is present in prokaryotic organism and the Eukaryotic film.In prokaryotic organism, it is present in its plasmalemma; And in eukaryote, serve as maximum with the ratio in plastosome and microbody membrane then.High molecular weight polymers in the born of the same parents, the PHB molecule that is present on the film is less, has only 100-200 monomer.To studies show that of this small molecular weight PHB, it may play a part the ionic channel on the film.Recently, in people's hemocyte, also find this small molecules PHB of more amount.This is for utilizing PHB to come packaging medicine to carry out directed quantitatively discharge and PHA provides theoretic foundation in the application aspect medical.
PHA is as a kind of ecotypic bioabsorbable polymer material, not only can in plastics industry, be able to promotion and application, become novel biodegradable plastic, and because its some special propertys, as biocompatibility, optical activity, piezoelectricity, being separated by property of gas etc. and other many still undiscovered character, thereby might be used at some value segment.To the research of PHA become a basic theory combine with application in practice Application Areas very closely.
The synthetic way Jing of dissimilar PHA in bacterium is different, present known route of synthesis mainly contains three (Anderson AJ and Dawes EA.Occurense, Metabolism, Metabolic Role, and IndustrialUse of Bacterial Polyhydroxyalkanoates.Microb.Rev., 1990,54:450-472; Lee SY.Bacterial Polyhydroxyalkanoates.Biotech.Bioeng.1996,49:1-14):
1. (be Ralstonia eutropha in the past with Wautersia eu tropha, also be Alcaligeneseutrophus) for representative by the directly synthetic PHB approach of acetyl-CoA: its PHB synthase systems comprises three kinds of enzymes by pha operon for synthesizing phbCAB (SEQ ID NO:1) genes encoding: beta-keto thiolase (Acetoacetyl-CoA reductase (acetoacyl-CoA reductase) and PHB synthetic enzyme (PHBsynthase) that β-ketothiolase), NADPH rely on; Above-mentioned three kinds of enzymes are respectively by phbA, phbB and phbC genes encoding, and are positioned on the same operon.The product acetyl-CoA is at beta-keto thiolase (β-ketothiolase in the intracellular metabolism, PhaA) katalysis forms acetoacetyl-CoA down, under the effect of the reductase enzyme (PhaB) that NADPH relies on, be reduced to (R)-maloyl group coenzyme A then, (R)-the maloyl group coenzyme A aggregates into PHB under the effect of PHB synthetic enzyme.This process need consumes NADPH, produces NADP.
2. with Pseudomonas aeruginosa the lipid acid de novo synthesis of representative: need the catalysis of two enzymes from the synthetic PHA of this approach: the PHA synthase of the 3-hydroxy acyl of phaG coding-acyl group transfer protein coenzyme A transhipment enzyme (3-Hydroxyacyl-ACP-CoA transferase) and phaC coding.The intermediate product 3-hydroxy acyl-acyl group transfer protein of lipid acid de novo synthesis aggregates into PHA by the PHA synthase again by the precursor 3-hydroxyl ester acyl coenzyme A of 3-hydroxy acyl-acyl group transfer protein coenzyme A transhipment enzyme (PhaG) catalysis formation PHA.The route of synthesis of same approach foul smelling pseudomonas (Pseudomonas putita), the Genbank searching number of the encoding gene of the PhaG of pseudomonas putida (Pseudomonas putita) is AF052507.
3. with Pseudomonas oleovorans the β-Yang Hua approach of representative: need the effect of two enzymes from the synthetic PHA of this approach: the PHA synthase of (R)-enoyl--hydratase ((R)-enoyl-CoA hydratase) of phaJ coding and phaC coding.Intermediate product enoyl--acyl group the transfer protein of lipid acid β-Yang Hua aggregates into PHA by the PHA polysaccharase again by the precursor 3-hydroxyl ester acyl coenzyme A of (R)-enoyl--hydratase (PhaJ) catalysis formation PHA.Same approach has the route of synthesis of Aeromonas hydrophila (Aeromonas hydrophila), the Genbank searching number of the pha synthesizing enzyme operon of Aeromonas hydrophila (Aeromonas hydrophila) (PHA synthase operon) encoding gene is AY093685, comprises the encoding gene of PhaJ and PhaC.
With 13C-NMR to the lipid acid synthetic of Pseudomonas putida studies show that the de novo synthesis of lipid acid and β-Yang Hua and PHA synthetic be (the Huijberts GN that independently carries out, De Rijk TC, De Waard P and Eggink G..13C nuclear magnetic resonance studies of Pseudomonas putidas fatty acidsmetabolic routes involved in PHA syntheses.J.Bacteriol.1994,176:1661-1666), the nearest research of long-chain PHA in may synthesizing with two kinds of approach simultaneously in a kind of bacterium is though these two kinds of approach are not to work equably. is found also to be related between these two approach; The intermediate product acyl-ACP of aliphatic acid de novo synthesis can be changed into the intermediate product acyl-CoA (Rehm BHA andSteinb ü chel A.Heterologous expression of the acyl-acyl carrier proteinthioesterase gene from the plant UmbelluLaria californica mediatespolyhydroxyalkanoates biosynthesis in recombinant Escherichia coli.Appl.Microbiol.Biotechnol.2001,55:205-209) of degradation pathway under the effect of a thioesterase. This new discovery shows that it is very diversified that PHA synthetic monomer provides approach, and the synthetic research of carrying out metabolic engineering also has more selection to PHA.
In the pathways metabolism of PHA, the metabolism of existing energy (NAD/NADH, NADP/NADPH etc.) also has the metabolism (acetyl-CoA, lipid acid etc.) of material, so the metabolic process of PHA, in fact also is the change process of an intracellular energy and material.Because PHA can be present in the various cells widely, this also is that the PHA synthesis mechanism is regulated its energy and levels of substance as regulating measure in various microorganism, and then influences meta-bolites and provide the foundation.
Summary of the invention
An object of the present invention is to provide a kind of method of regulating microorganism metabolism.
The method of regulating microorganism metabolism provided by the present invention is a synthesizing polyhydroxyalkanoateby in microorganism; Described polyhydroxyalkanoate synthetic is by the dependency basis of introducing the polyhydroxyalkanoate route of synthesis in described microorganism thereby realization.
Described metabolism comprises energy and substance metabolism.
The genes involved of described polyhydroxyalkanoate route of synthesis is selected from following 1), 2) and 3) in any one:
1) phbCAB gene, 2) phaG and phaC gene, 3) phaJ and phaC gene.
Described phbCAB gene is preferably the dna sequence dna with SEQ ID NO:1 in the sequence table; Described PhaG gene is preferably AF052507, and described phaC gene is preferably and comes from AY093685, and described phaJ gene is preferably and comes from AY093685.
The genes involved of PHA route of synthesis can import in the host microorganism by the conventional means of this area, for example, can utilize expression vector such as plasmid, clay, phage etc., imports in the host microorganism by means such as conversion, transduction, joints; Also can utilize means such as protoplastis fusion to realize.
Described regulating microorganism metabolism is the throughput of regulating and controlling microbial to tunning.
Described microorganism is a bacterium, archeobacteria and fungi; Described tunning comprises organic acid, alcohols, microbiotic, amino acid and VITAMIN.
Wherein, described microorganism can be streptococcus zooepidemicus (Streptococcus zooepidemicus), is preferably streptococcus zooepidemicus (Streptococcus zooepidemicus) ATCC 39920, and described tunning is lactic acid and hyaluronic acid;
Described microorganism can be torulopsis glabrata (Torulopsis glabrata), is preferably torulopsis glabrata (Torulopsis glabrata) CCTCCM202019, and described tunning is a pyruvic acid;
Described microorganism can be yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), is preferably yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) IFFI 01338, and described tunning is an ergosterol;
Described microorganism can be subtilis (Bacillus subtilis), is preferably subtilis (Bacillus subtilis) ATCC 19162, and described tunning is an inosine;
Described microorganism can be Alkaliphilic bacillus (Bacillus alcalophilus), is preferably Alkaliphilic bacillus (Bacillus alcalophilus) Ya-B, and described tunning is an elastoser;
Described microorganism can be rhodotorula (Rhodotorula glutinis), is preferably rhodotorula (Rhodotorulaglutinis) NCIM 3353, and described tunning is a carotenoid;
Described microorganism can be Corynebacterium glutamicum (Corynebacterium glutamicum), is preferably Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC 13032, and described tunning is a glutamine;
Described microorganism can be Brevibacterium lactofermentus (Brevibacterium lactofermentum), is preferably Brevibacterium lactofermentus (Brevibacterium lactofermentum) ATCC 31269, and described tunning is a Methionin;
Described microorganism can be intestinal bacteria (Escherichia.coli), is preferably intestinal bacteria (Escherichia.coli) ATCC 31882, and described tunning is a phenylalanine;
Described microorganism can be Pseudomonas fluorescens (Pseudomonas fluorescens), is preferably Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55, and described tunning is a gluconic acid;
Described microorganism can be subtilis (Bacillus subtilis), is preferably subtilis (Bacillus subtilis) ATCC 21556, and described tunning is a α-Dian Fenmei;
Described microorganism can be yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), is preferably yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063, and described tunning is an ethanol;
Described microorganism can be candida krusei (Candida krusei), is preferably candida krusei (Candida krusei) ACCC 2196, and described tunning is a glycerine;
Described microorganism can be candida tropicalis (Candida tropicalis), is preferably candida tropicalis (Candida tropicalis) UH22248, and described tunning is a SL-AH;
Described microorganism can be candida tropicalis (Candida tropicalis), is preferably candida tropicalis (Candida tropicalis) T 25-14, described tunning is 15 carbon dicarboxylic acids;
Described microorganism can be subtilis (Bacillus subtilis), is preferably subtilis (Bacillus subtilis) ATCC 19220, and described tunning is a guanosine;
Described microorganism can be yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), is preferably yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) KY6186, and described tunning is a gsh;
Described microorganism can be torulopsis (ToruLopsis sp), is preferably torulopsis (ToruLopsis sp) B845, and described tunning is an erythritol;
Described microorganism can be bacillus pumilus (Bacilluspumilus), is preferably bacillus pumilus (Bacilluspumilus) ATCC 31095, and described tunning is a D-ribose;
Described microorganism can be butyric acid shuttle genus bacillus (Clostridium butyricum), is preferably butyric acid shuttle genus bacillus (Clostridium butyricum) ATCC 8260, and described tunning is 1, ammediol;
Described microorganism can be Pseudomonas fluorescens (Pseudomonas fluorescens), is preferably Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55, and described tunning is a gluconic acid;
Described microorganism can be subtilis (Bacillus subtilis), is preferably subtilis (Bacillus subtilis) ATCC 19162, and described tunning is an inosine;
Described microorganism can be mobile pseudomonas (Zymomonas mobilis), is preferably mobile pseudomonas (Zymomonas mobilis) NRRL B-4286, and described tunning is an ethanol.
Another object of the present invention provides a kind of method that improves reverse resistance of microorganisms.
The method of raising reverse resistance of microorganisms provided by the present invention is a synthesizing polyhydroxyalkanoateby in microorganism; Described polyhydroxyalkanoate synthetic is by the dependency basis of introducing the polyhydroxyalkanoate route of synthesis in described microorganism thereby realization.
The genes involved of described polyhydroxyalkanoate route of synthesis is selected from following 1), 2) and 3) in any one: 1) phbCAB gene, 2) phaG and phaC gene, 3) phaJ and phaC gene.
Described phbCAB gene is preferably the dna sequence dna with SEQ ID NO:1 in the sequence table; Described PhaG gene is preferably AF052507, and described phaC gene is preferably and comes from AY093685, and described phaJ gene is preferably and comes from AY093685.
Wherein, in the described method, described microorganism can be yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), is preferably yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063, and described environment stress is cold coercing or heat stress;
Described microorganism can be intestinal bacteria (Escherichia coli), is preferably intestinal bacteria (Escherichiacoli) JM109, and described environment stress is that heavy metal ion is coerced; Described heavy metal ion can be Hg 2+
Described microorganism is mobile pseudomonas (Zymomonas mobilis), is preferably mobile pseudomonas (Zymomonasmobilis) NRRL B-4286, and described environment stress is coerced or osmotic pressure stress for low pH;
Described microorganism can be Lactobacterium acidophilum (Lactobacillus acidophilus), is preferably Lactobacterium acidophilum (Lactobacillus acidophilus) ATCC 53671, and described environment stress is coerced for low pH;
Described microorganism can be genus bacillus, is preferably bacillus thuringiensis (Bacillus thuringiensis), especially is preferably bacillus thuringiensis (Bacillus thuringiensis) ACCC 10068;
Described microorganism can be genus bacillus, is preferably genus bacillus (Bacillus sp) L-23; Described environment stress is that crude oil is coerced.
The present invention makes the metabolism of microorganism itself obtain regulation and control by introducing the PHA synthetic gene, has improved the resistance to environment stress.
Described PHA synthesis mechanism comprises the eutropha with Wautersia, Rhodospirillum rubrum be representative by the directly synthetic PHB approach of acetyl-CoA; With Pseudomonas aeruginasa is the lipid acid de novo synthesis of representative, is lipid acid β-Yang Hua approach of representative etc. with Pseudomonas oleovorans.
In the method for regulating microorganism metabolism of the present invention and raising reverse resistance of microorganisms, PHA synthetic genes involved can be cloned on the plasmid vector that is directed to the purpose bacterium, the plasmid that makes up is imported to acquisition reorganization bacterium in the purpose bacterium, and fermentation reorganization bacterium obtains required product or raising resistance.PHA synthetic genes involved can be on the plasmid or on the karyomit(e).
For improving transformation efficiency, the method that recombinant plasmid expression vector is imported in the purpose bacterium is preferably electrotransformation, but also can adopt method commonly used in other bioengineering field, comprises heat shock method, protoplast transformation method and engages conversion method.
The present invention is by introducing the PHA route of synthesis in microorganism recombinant production bacterium, regulated intracellular NAD (P)/NAD (P) H metabolism and acetyl-CoA, the flow direction of mesostates such as pyruvic acid, for required tunning provides adjustable synthetic environment, the accumulation of PHA simultaneously can improve the tolerance of recombinant production bacterium to severe environment, the feedback inhibition of product particularly, the raising that also helps improving fermentation yield.
The present invention utilizes the PHA synthesis path to regulate microbial metabolism, improves the production efficiency of microbial fermentation product, further improves reverse resistance of microorganisms.Method provided by the invention is to make up the plasmid that contains the PHA synthesis related gene, expresses in importing corresponding bacterial strain.Described bacterial strain can be various microorganisms producing bacterium.Method of the present invention is applied in the various microorganisms producing bacterium, the pathways metabolism of can effective influence producing bacterium, increase the resistance of bacterium, improve and comprise hyaluronic acid, pyruvic acid, ergosterol, beer, inosine, elastoser, carotenoid, glutamine, Methionin, phenylalanine, gluconic acid, amylase, alcohol, glycerine, SL-AH, 15 carbon dicarboxylic acids, thuringiensis bacillus powder, guanosine, gsh, erythritol, D-ribose, 1, the production efficiency of Bio-engineering Products such as ammediol.
Under situation without departing from the spirit and scope of the present invention; those of ordinary skill in the art can make various changes and improvements to it in form and details; these are all within protection scope of the present invention; as utilize according to codon degeneracy principle or base complementrity principle that obtained with the essentially identical nucleic acid molecule of genes involved function polyhydroxyalkanoate route of synthesis of the present invention; relevant enzyme for the polyhydroxyalkanoate route of synthesis; carry out aminoacid insertion and/or disappearance in its site that does not play a major role and/or replace the encoding gene of essentially identical protein of resulting function or polypeptide; realize purpose of the present invention, all be considered to fall into protection scope of the present invention.
Embodiment
Experimental technique among the following embodiment if no special instructions, is ordinary method.
Percentage composition among the following embodiment is the quality percentage composition if no special instructions.
Employed term " PHA " is meant by microorganism synthetic polyhydroxyalkanoate among the present invention, its general structure is suc as formula shown in (I), the PHA molecular formula that comprises for example the copolymer p HBHHx of copolymer p HBV, 3-hydroxybutyric acid and the 3-hydroxycaproic acid of polyhydroxybutyrate (PHB), 3-hydroxybutyric acid and 3-hydroxypentanoic acid and middle long-chain monomer such as 3-hydroxycaproic acid HHx to single polymers or the multipolymer of 3-hydroxyl dodecanoic acid 3-HDD.
Employed term among the present invention " genes involved of PHA route of synthesis " is meant, in the PHA route of synthesis, has participated in the various relevant synthetic enzyme and the pairing gene of modulin of PHA entire synthesis process; PHA synthase gene phaC for example, 3-hydroxy acyl-acyl group transfer protein coenzyme A transhipment enzyme gene phaG, (R)-enoyl--hydratase gene phaJ gene etc.
Employed term " resistance " is meant the viability in the environment of microorganism under departing from its optimal growth condition among the present invention, such as higher or lower temperature, higher or lower pH, higher or lower osmotic pressure, higher feedback inhibition, the existence of toxic substance etc.
Employed term " microorganism " comprises bacterium, archeobacteria, fungi (for example yeast) etc. among the present invention.
Employed term " tunning " is meant the product that all obtain by microbial fermentation or conversion among the present invention, such as organic acid, alcohol, other alcohols, microbiotic, amino acid, VITAMIN etc.
Embodiment 1, in streptococcus zooepidemicus, express phbCAB effect gene lactic acid and the hyaluronic acid volume of production of Wautersia eutropha
Bacterial classification: streptococcus zooepidemicus (Streptococcus zooepidemicus) ATCC 39920
1) under the condition of the polymerase chain reaction of standard, with pBHR68 plasmid (Spiekermann P, Rehm BHA, Kalscheuer R, Baumeister D, Steinb ü chel A.A sensitive, viable-colony stainingmethod using Nile red for direct screening of bacteria that accumulatepolyhydroxyalkanoic acids and other storage compounds.Arch Microbiol 1999,171:73-80) be template, amplify the phbCAB gene with primer ATAAAGCTT (HindIII) AAGGAGGATGGCGACCGGCAAAGGC and GTTATCGAT (ClaI) CGGCAGGTCAGCCCATAT, after process HindIII and ClaI enzyme are cut processing then, be inserted into plasmid pEU308 (Eichenbaum Z.and Federle MJ.Use of the lactococcalnisA promoter to regulate gene expression in Gram-positive bacteria:comparisonof induction level and promoter strength.Appl.Environ.Microbiol.1998, between the recognition site of restriction enzyme HindIII and ClaI, obtain plasmid pEUHB under Spac promotor 64:2763-2769).Cut the excision of the LacI gene on the plasmid by the SphI enzyme then, make the phbCAB expression of gene not need IPTG to induce, obtain plasmid pEUHBNOI.
2) competent cell of preparation streptococcus zooepidemicus, and plasmid pEUHBNOI electricity consumption method for transformation changed in the streptococcus zooepidemicus.
The preparation of competent cell:
Streptococcus zooepidemicus (Streptococcus zooepidemicus) ATCC 39920 is cultivated 12h the substratum that contains THYB (Todd-Hewitt broth) (buying from OXOID) 36.4g/L and yeast extract 0.5%; Then it is inoculated in the fresh THYB substratum of 50mL, inoculation back D530 is no more than 0.05, cultivates OD530=0.25 and gets final product; And before cultivate finishing half an hour add Unidasa 0.4mg/mL;
4 ℃, 8000g centrifugal 10 minutes, abandons supernatant, with 20mL 0.5mmol/L sucrose solution re-suspended cell;
4 ℃, 8000g, centrifugal 10 minutes, abandon supernatant, centrifugal again with 1mL 0.5mmol/L sucrose solution re-suspended cell, abandon supernatant; Cell is resuspended in the 0.5mmol/L sucrose solution that 250 μ L contain 10% glycerine, by using volume integral to install in the Eppendorf pipe; Place-80 ℃ of preservations rapidly.
The electricity of streptococcus zooepidemicus transforms
In 200 μ L competent cells, add 500-5000ng plasmid pEUHBNOI, ice bath 10 minutes; Mixed system is transferred to 2mm electricity swash that electricity swashs in the cup, voltage is made as 2.5kv;
The THYB ice-cold with 1mL transfers to mixed system among the 10mLTHYB, ice bath 30-60 minute; 37 ℃ leave standstill cultivation 1 hour then; Then at 14 ℃, 6000g, centrifugal 10 minutes, thalline was resuspended and be applied to the screening of carrying out transformant on the resistant panel with 1mL THYB, and streptococcus zooepidemicus (streptococcus zooepidemicus (Streptococcus zooepidemicus) ATCC 39920 that contains pEUHBNOI) obtains recombinating.
3) fermentation of reorganization streptococcus zooepidemicus
The seed culture based component is sucrose: 20g/L, yeast powder: 10g/L, extractum carnis: 10g/L, MgSO 47H 2O:2g/L, MnSO 44H 2O:0.1g/L, KH 2PO 4: 2g/L, liquid microelement: 1mL/l, seed damping fluid: 40mL/l.The fermentation culture based component is yeast powder: 20g/L, Na 2HPO 412H 2O:6.2g/L, MgSO 47H 2O:2g/L, K 2SO 41.3g/L, FeSO 47H 2O:5mg/L, liquid microelement: 2.5mL/l, sucrose: 70g/L.Wherein liquid microelement contains CaCl 2: 2g/L, MnSO 44H 2O:24mg/L, ZnCl 2: 46mg/L, CuSO 45H 2O:19mg/L; The seed damping fluid contains Na 2HPO 412H 2O:36.76g/L, NaH 2PO 412H2O:15.98g/L, NaHCO 3: 12.5g/L.
With streptococcus zooepidemicus (Streptococcus zooepidemicus) ATCC 39920 on the transfering loop difference picking flat board and reorganization bacterium bacterial classification, insert respectively and be equipped with in the 500mL triangular flask of 150mL seed culture medium, cultivated 14-16 hour on the shaking table of 200rpm, culture temperature is made as 37 ℃; Inoculum size by 10% (volume ratio) inserts fermentor tank (in 7.5 liters of fermentor tanks (USA) middle liquid amount is 3 liters for NBS Bioflo 3000, NJ) with seed then.37 ℃ of fermentor tank controlled temperature, pH value 7.0, air flow 5L/min.Initial stirring velocity 200rpm, the rising rotating speed is to 500rpm when dissolved oxygen drops to 0, and dissolved oxygen drops to 0 o'clock rotating speed once more and is adjusted to 650rpm, and is maintained to fermentation ends, streptococcus zooepidemicus (Streptococcus zooepidemicus) ATCC 39920 fermentations 14 hours, reorganization bacterium fermentation 16 hours.Measure the hyaluronic acid in the fermention medium and the content of lactic acid respectively.The result shows 14 hours hyaluronic acid of streptococcus zooepidemicus (Streptococcuszooepidemicus) ATCC 39920 fermentations, and (Hyaluronic acid HA) is respectively 5.4g/L and 65g/L with lactic acid production.The fermentation of reorganization bacterium 14 hours hyaluronic acid and lactic acid production are 5.6g/L and 38g/L, and lactic acid production descends 42%; 16 hours output is 7.3g/L and 41g/L, and hyaluronic acid volume of production rises 34%, and lactic acid production descends 37%.Lactic acid is synthetic to be streptococcus zooepidemicus main approach that obtains oxidizing power in the cell (NAD) under anoxia condition, so bacterium produces a large amount of lactic acid during the fermentation.And introducing PHB route of synthesis provides the NAD regeneration approach of an external source for cell, thereby can reduce the pressure of lactic acid approach, lactic acid is synthesized to significantly reduce, a large amount of minimizings of lactic acid, make more carbon source can flow to other pathways metabolism, thereby hyaluronic acid volume of production also is increased.
Wherein, hyaluronic acid contents is measured and is adopted Bitter-MuirShi method (Bitter T., Muri HM.A modifieduronic acid carbazol reaction.Anal.Biochem.1962,4:330-334), the measure sample preparation method of fermented liquid is as follows: a) get the 1mL fermented liquid and accurately be diluted to 4mL, 6000 left the heart 10 minutes; B) get the 1mL supernatant and join in the 4mL dehydrated alcohol, vibration, 6000 left the heart 5 minutes; C) supernatant discarded adds 2mL 0.2mmol/LNaCl, place, or vibration, until final dissolving; D) add the 4mL dehydrated alcohol, vibration, 6000 left the heart 5 minutes; E) supernatant discarded, the sample that precipitation is measured as HA with the 2mL deionized water dissolving.The mensuration of lactate concentration: adopt HPLC (SpectroSYSTEM P2000, Thermo Separation Products, USA) method.Refraction detector, ion exchange column Aminex HPX-87H, 300mm * 7.8mm, moving phase is the 0.005mmol/L sulphuric acid soln, flow velocity 0.50mL/min.Before the detection, get the 0.2mL fermented sample, accurately be diluted to 4mL, centrifugal 5 minutes of 10000rpm/min removes supernatant, behind the 0.45 μ m membrane filtration as the stratographic sample.
Embodiment 2, in torulopsis glabrata, express phbCAB effect gene output of pyruvic acid
Bacterial classification: torulopsis glabrata (Torulopsis glabrata) CCTCCM202019
Substratum: inclined-plane and seed culture medium (L): glucose 20g/L, peptone 10g/L, KH 2PO 41g/L, MgSO 47H2O 0.15g/L, agar 20g/L (inclined-plane is used), pH 5.5.
Fermention medium: glucose 80g/L, peptone 15g/L (nitrogen content 12%), KH 2PO 45g/L, KCl 5g/L, MgSO 47H2O 0.18g/L, nicotinic acid 4mg/L, vitamin 20 μ g/L, pyridoxine hydrochloride 100 μ g/L, vitamin H 10 μ g/L, riboflavin 50 μ g/L, pH5.0.
After plasmid pBHR68 cut processing with BamHI and EcoRI enzyme, the fragment of the 5.2kb that obtains is inserted between the recognition site of the BamHI of plasmid pPIC9K (purchasing company) and EcoRI, obtains plasmid pPICHB in Invitrogen.The method that this plasmid transforms with electricity is transferred to the bacterium (torulopsis glabrata (Torulopsis glabrata) CCTCCM202019 that contains pPICHB) that obtains among torulopsis glabrata (Torulopsis glabrata) CCTCCM202019 to recombinate and carries out fermenting experiment.
Torulopsis glabrata (Torulopsis glabrata) CCTCCM202019 and the reorganization bacterium of getting slant culture respectively are inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 30 ℃, 200rpm, cultivate after 12 hours, insert fermention medium with 10% (v/v) inoculum size.7.5L fermentor tank liquid amount 3L, 30 ℃ of temperature, air flow 2L/min, mixing speed 700rpm, pH is 5.0 with 5mol/L KOH control.When residual sugar reduced to 4%, the Glucose Liquid that adds 400g/L by given pace stream carried out feeding culture, fermentation time 48 hours.
Get the 2mL fermented liquid after 8000g is centrifugal 5 minutes, supernatant is measured pyruvic acid content (Lamperecht W, Heinz F.In:Methods of enzymatic analysis with the lactic dehydrogenase enzyme process, ed.Bergmeyer, H.U.VCH, Weinheim, 1984,6:pp570-577).Cell is washed twice final vacuum ice with deionized water and is done.The result shows that the output of pyruvic acid of the bacterium of recombinating is 68g/L, has improved about 31% than the 52g/L of torulopsis glabrata (Torulopsis glabrata) CCTCCM202019.The approach that glycolysis-produces pyruvic acid is to consume NAD, and it then is the process of synthetic NAD that pyruvic acid is fallen by metabolism in cell.Therefore accumulate the environment that pyruvic acid need a high oxidation power in the cell in a large number.The introducing of phbCAB gene can provide oxidizing power for cell, thereby has improved the output of pyruvic acid.
Embodiment 3, in yeast saccharomyces cerevisiae, express phbCAB effect gene ergosterol output
Bacterial classification: yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) IFFI 01338 (Microbe Inst., Chinese Academy of Sciences's bacterial classification center preserving number)
The inclined-plane, seed culture medium and fermention medium are: glucose 40g/L, peptone 20g/L, yeast powder 10g/L, agar 20g/L (inclined-plane is used), pH 5.5.
The method that will transform with lithium acetate according to the plasmid pPICHB that embodiment 2 methods obtain is transferred to the bacterium (yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) IFFI 01338 that contains pPICHB) that obtains among yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) IFFI 01338 to recombinate and carries out fermenting experiment.
Get yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) IFFI 01338 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 30 ℃, 200rpm, cultivate after 12 hours, insert fermention medium with 10% (v/v) inoculum size.7.5L fermentor tank liquid amount 3L, 30 ℃ of temperature, air flow 2L/min, dissolved oxygen are controlled at 15% automatically, and control pH is 5.5.Ferment after 10 hours once, add 40g glucose, add Geneticin 0.2g/L in the reorganization bacterium culture medium every feed supplement in 6 hours.Ferment after 30 hours, stop fermentation.(She Chenxing thanks to Hua Ling to ergosterol Determination on content reference literature, Lin Zhijun for Xu Xuping, Li Huizhen.Ergosterol produces the research of bacterium Torullopsis famata optimization of fermentation conditions.The biology magazine, 2002,19:15-17).
Measurement result shows that the ergosterol content of the bacterium of recombinating is 1.2%, has improved 33% than 0.9% of yeast saccharomyces cerevisiae (Saccharomycescerevisiae) IFFI 01338.There are some researches show, the synthetic feature of ergosterol with oxygen metabolism, aerobic conditions helps it and synthesizes.Therefore, the introducing of phbCAB gene for cell provides more oxidizing power, thereby has promoted the synthetic of the interior ergosterol of cell.
Embodiment 4, in yeast saccharomyces cerevisiae, express the phbCAB gene and improve saccharomycetic anti-adversity ability
Bacterial classification: yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063
The method that will transform with lithium acetate according to the plasmid pPICHB that embodiment 2 methods obtain is transferred to the bacterium (yeast saccharomyces cerevisiae (the Saccharomyces cere visiae) ACCC 2063 that contains pPICHB) that obtains among yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063 to recombinate and carries out fermenting experiment.
Get yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 30 ℃, 200rpm, cultivate after 12 hours, insert new substratum with 10% (v/v) inoculum size.Medium component is: glucose 40g/L, and peptone 20g/L, yeast powder 10g/L, agar 20g/L (inclined-plane is used), pH 5.5.The seed of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC2063 and reorganization bacterium respectively was divided into three groups before inserting new substratum, placed 1 hour at 48 ℃ for one group, placed 48 hours at-80 ℃ for one group, and another group does not process.After then seed being inserted new substratum respectively, measure its growth curve.Calculate the poor of undressed seed and treated seed lag phase time.After the result showed that the seed of the bacterium of recombinating passes through cold or thermal treatment, its activity was not subjected to significantly reducing, and promptly lag phase time and undressed seed are more or less the same.And the seed activity of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063 is subjected to bigger influence after passing through cold or thermal treatment.After Overheating Treatment, the time difference of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063 is 7 hours, and the reorganization bacterium time difference is 1 hour, and two differed 6 hours.The cell that is to say accumulation PHA has better severe environment tolerance, has stronger vitality.This has important meaning for wine industry, can influence ferment because yeast is dead in the fermenting process, brings uncomfortable taste simultaneously, and therefore strong bacterial strain has the better application prospect.
Embodiment 5, in subtilis, express the biosynthesizing that phbCAB influences inosine
Bacterial classification: subtilis (Bacillus subtilis) ATCC 19162.
The seed culture based component is glucose 20g/L, yeast powder 15g/L, peptone 10g/L, corn liquid 7g/L, sodium-chlor 2.5g/L, urea 2g/L, pH value 7.0.The fermentation culture based component is glucose 140g/L, corn liquid 16g/L, yeast powder 16g/L, urea 9g/L, ammonium sulfate 16g/L, magnesium sulfate heptahydrate 4g/L, dipotassium hydrogen phosphate 5g/L, lime carbonate 20g/L.
The method that the plasmid pEUHB that obtains according to embodiment 1 method transforms with electricity is transferred to the bacterium (subtilis (Bacillus subtilis) ATCC 19162 that contains pEUHB) that obtains among subtilis (Bacillussubtilis) ATCC 19162 to recombinate and carries out fermenting experiment.
Get subtilis (Bacillus subtilis) ATCC 19162 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 32 ℃, 200rpm, cultivate after 12 hours, insert fermention medium with 5% (v/v) inoculum size.7.5L fermentor tank liquid amount 3L, 35 ℃ of A.T.Cs, pH 6.5, stirring velocity 600rpm, air flow 1L/min, to inosine output no longer increase stop the fermentation, fermentation time 68 hours.Inosine content is measured with HPLC, and moving phase is 0.5% dipotassium hydrogen phosphate, flow velocity 1.2mL/min, and chromatographic column is a HypersilODS C18 reversed-phase column, the detection wavelength is 254nm.The HPLC measurement result shows that the glycosides output of subtilis (Bacillussubtilis) ATCC 19162 is 19g/L, and the output of reorganization bacterium is 24g/L, has improved 26%.In the endocellular metabolism approach, provide the hexose monophosphate approach of precursor can consume a large amount of NADP for inosine is synthetic, regulation and control enzyme glucose-6-phosphate dehydrogenase from the 6-glucose 1-phosphate1-to phosphopentose pathway is subjected to the feedback inhibition of NADPH simultaneously, so the minimizing of NADPH can promote the conversion of glucose to phosphopentose pathway.Generally speaking, inosine is synthetic to be the biochemical metabolism process of a large amount of oxidizing powers of needs, and high NADP/NADPH level can effectively promote the synthetic of inosine.The introducing of phbCAB gene just can realize this requirement, therefore can improve the output of inosine significantly.
Embodiment 6, in Alkaliphilic bacillus, express phbCAB effect gene elastin production of enzyme
Bacterial classification: Alkaliphilic bacillus (Bacillus alcalophilus) Ya-B (Takagi H, Tsai YC, NakamoriS, Yamasaki M.Improved Production and Recovery of Alkaline Elastase fromAlkalophilic Bacillus Strains by a Change of Medium Composition.Biosci BiotechBiochem, 1995,59:1591-1592)
The seed culture based component is glucose 10g/L, peptone 5g/L, yeast powder 5g/L, dipotassium hydrogen phosphate 1g/L, magnesium sulfate heptahydrate 0.2g/L, sodium-chlor 5g/L, yellow soda ash 10g/L.The fermentation culture based component is glucose 20g/L, soybean cake powder 5g/L, yeast powder 2.5g/L, dipotassium hydrogen phosphate 0.75g/L, magnesium sulfate heptahydrate 0.2g/L, sodium-chlor 20g/L, yellow soda ash 10g/L.
The method that the pEUHB that obtains among the embodiment 1 is transformed with electricity is transferred to and obtains reorganization bacterium (Alkaliphilic bacillus (Bacillus alcalophilus) Ya-B that contains pEUHB) among Alkaliphilic bacillus (Bacillusalcalophilus) Ya-B and carry out fermenting experiment.Obtain the reorganization bacterium and carry out fermenting experiment.
Get Alkaliphilic bacillus Alkaliphilic bacillus (Bacillus alcalophilus) Ya-B of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively with the reorganization bacterium, under 37 ℃, 250rpm, cultivate after 12 hours, insert fermention medium (50mL/500mL Erlenmeyer flask) with 1% (v/v) inoculum size, 37 ℃, 250rpm cultivated 48 hours, stopped fermentation.With fermented liquid 8000g centrifugal ten minutes, collect supernatant, with grade ammonium sulfate salting-out (30%-65% saturation ratio), precipitation is dissolved in 0.05mol/l pH 9.0 borate buffers, obtains crude enzyme liquid.Add 1mL 0.05mol/L pH 9.0 borate buffers respectively in 55 ℃ of water bath heat preservations one hour in the 1mL crude enzyme liquid with in 20mg orcein-elastin, vibration frequently.Respectively with 2mL 0.7mol/L pH6.0 phosphoric acid buffer termination reaction, centrifugal 10 minutes of 8000g, supernatant is surveyed absorbance in 590nm.After 20mg orcein-elastin complete hydrolysis, half of 590nm place absorbance value is 10 enzyme activity units.
Through after 48 hours fermentation culture, the enzyme of reorganization bacterium the 198U/mL that lives is higher by 12.5% than Alkaliphilic bacillus (Bacillusalcalophilus) 176U/mLYa-B, and the reorganization bacterium has higher elastin production of enzyme.Studies show that high dissolved oxygen helps the synthetic of elastoser, it is synthetic to be a process that needs oxidizing power.The introducing of phbCAB gene just in time can be for cell provides more oxidizing power, and this is the synthetic that helps elastoser.
Embodiment 7, in rhodotorula, express phbCAB effect gene carotenoid output
Bacterial classification: rhodotorula (Rhodotorula glutinis) NCIM 3353 (the Indian country Research for Industrial Microbial Germ is preserved the center)
The slant culture based component is: glucose 35g/L, malt extract 3g/L, yeast powder 2g/L, KH 2PO 43g/L, K 2HPO 43g/L, MgSO 47H2O 0.2g/L, agar 20g/L, pH 6.0.
Liquid nutrient medium is: glucose 25g/L, yeast powder 10g/L, KH 2PO 42g/L, K 2HPO 42g/L, pH 6.0.
The method that the pPICHB that obtains among the embodiment 2 is transformed with lithium acetate is transferred to and obtains reorganization bacterium (rhodotorula (Rhodotorula glutinis) NCIM 3353 that contains pPICHB) among rhodotorula (Rhodotorulaglutinis) NCIM 3353 and carry out fermenting experiment.
Get rhodotorula (Rhodotorula glutinis) NCIM 3353 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 28 ℃, 240rpm, cultivate after 18 hours, insert fresh liquid substratum (100mL/500mL Erlenmeyer flask) with 5% (v/v) inoculum size, 28 ℃, 240rpm cultivated 72 hours.Fermented liquid 3000rpm collected thalline in centrifugal ten minutes, washed dried the weighing of back ice twice with deionized water.Every gram thalline adds 5mL 3mol/L HCl, soaks 1 hour under the room temperature, boils in boiling water bath 4 minutes, cooling rapidly, centrifugal 15 minutes of 3000g, supernatant discarded adds 3mL acetone after precipitate with deionized water is washed twice, vibration is 30 minutes under the room temperature, 3000g is centrifugal 20 minutes again, and supernatant is the carotenoid extracting solution, after the extracting solution dilution, survey 475nm place absorbance, be calculated as follows carotene carotene content: carotene carotene content (μ g/g thalline)=A 475* V * D/0.16w.A475 is the carotene absorbance, and V is for extracting solvent for use amount (mL), and D is the diluted sample multiple, and w is biomass (g), and 0.16 is the molar extinction coefficient of carotene.
The result shows that the carotenoid content of rhodotorula (Rhodotorula glutinis) NCIM 3353 is 76 μ g/g, and the content of reorganization bacterium is 92 μ g/g, has improved 21%.The high oxidation force environment helps the synthetic of carotenoid.The importing of phbCAB gene can provide oxidizing power for cell, thereby promotes the synthetic of carotenoid.
Embodiment 8, express phbCAB in the Corynebacterium glutamicum kind and influence glutamine and synthesize
Bacterial classification: Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC 13032.
Seed culture medium and fermented ingredient are: DEXTROSE MONOHYDRATE BP 50g/L, (NH 4) 2SO 47.5g/L, NaCl 2g/L, CH 3COONa2H 2O 3g/L, CaCl 22H 2O 0.1g/L, K 2HPO 43H 2O 8g/L, KH 2PO 42g/L, urea 5g/L, MgSO 47H 2O 0.5g/L, salts solution 10mL/l, vitamin H 6 μ g/L, VITMAIN B1 1mg/L, kantlex 20mg/L.Wherein salts solution is: MnSO 47H 2O 20mg, Na 2B 4O 710H 2O 2mg, (NH 4) 5MO 7O 244H 2O 1mg, FeCl 26H 2O 20mg, ZnSO 47H 2O 5mg, CuSO 45H 2O 2mg, FeSO 47H 2O 250mg is dissolved among the 50mL 1mol/L HCl.
The method that the plasmid pEUHB that obtains among the embodiment 1 is transformed with electricity is transferred to and obtains reorganization bacterium (Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC 13032 that contains pEUHB) among Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC 13032 and carry out fermenting experiment.
Get Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC13032 of cultivation on fresh inclined-plane and reorganization bacterium respectively, be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 30 ℃, 200rpm, cultivate after 12 hours, insert fermention medium with 5% (v/v) inoculum size.7.5L fermentor tank liquid amount 3L, 30 ℃ of A.T.Cs, pH 6.5, stirring velocity 600rpm, air flow 1L/min fermented 48 hours, stopped fermentation, measured glutamine content in the fermented liquid.The mensuration of glutamine is at room temperature launched with unsaturated method with No. 3 filter paper of Xinhua, and the developping agent volume ratio is 5: 2 the n-propyl alcohol and the mixed solution of strong aqua, and ascending method is launched.Take by weighing the glutamine standard substance, be made into the solution of 1%, 1.5%, 2%, 2.5%, 3% concentration such as different mass such as grade, every kind of solution point sample 1 μ L, fermented liquid centrifuging and taking supernatant point sample 1 μ L.Air-dry filter paper after exhibition is analysed and finished with the colour developing of 0.5g/L triketohydrindene hydrate acetone soln, was dried 5 minutes for 105 ℃, occurred red-purple amino acid spot on the filter paper, cut the amino acid spot, and (volume ratio is 2: 38 0.1g/L CuSO with elutriant 45H 2O and 75% alcoholic acid mixed solution) wash-out 30 minutes, absorb in the photometry of 520nm place then, try to achieve glutamine content the fermented liquid from typical curve.The result shows that the glutamine output of Corynebacterium glutamicum (Corynebacterium glutamicum) ATCC 13032 is 11g/L, and reorganization bacterium output is 14g/L, improves about 27%.The introducing of phbCAB gene, can reduce the metabolism of pyruvic acid, promote pyruvic acid to be converted into acetyl-CoA to lactic acid, and the precursor of the glutamine intermediate product of tricarboxylic acid cycle just, like this can be for the synthetic of glutamine provide more precursor, so output is improved.
Embodiment 9, in Brevibacterium lactofermentus, express phbCAB and influence lysine production
Bacterial classification: Brevibacterium lactofermentus (Brevibacterium lactofermentum) ATCC 31269.
The slant culture based component is: extractum carnis 0.3%, and peptone 1%, NaCl 0.5%, agar 2%, pH 7.2-7.4.
The seed culture based component is: glucose 2%, KH 2PO 40.1%, (NH 4) 2SO 41%, MgSO 47H 2O 0.04%, FeSO 47H 2O 1mg/L, MnSO 4H 2O 0.8mg/L, vitamin H 5 μ g/L, VB120mg/L, soya-bean cake hydrolyzed solution 5%, pH 7.0.
The fermentation culture based component is: glucose 14%, KH 2PO 40.1%, (NH 4) 2SO 44%, MgSO 47H 2O 0.04%, FeSO 47H 2O 1mg/L, MnSO 4H 2O 0.8mg/L, vitamin H 5 μ g/L, VITMAIN B1 20mg/L, soya-bean cake hydrolyzed solution 5%, lime carbonate 2%, pH 7.0.
The method that the plasmid pEUHB that obtains among the embodiment 1 is transformed with electricity is transferred to and obtains reorganization bacterium (Brevibacterium lactofermentus (Brevibacterium lactofermentum) ATCC 31269 that contains pEUHB) among Brevibacterium lactofermentus (Brevibacterium lactofermentum) ATCC 31269 and carry out fermenting experiment.
Get Brevibacterium lactofermentus (Brevibacterium lactofermentum) ATCC 31269 and the reorganization bacterium of cultivation on fresh inclined-plane respectively, be inoculated in the first order seed substratum, 500mL shakes bottled liquid measure 30mL, on shaking table 30 ℃, 110rpm cultivated 12 hours.Inoculation 2mL first order seed is in the 30mL secondary seed medium, and on shaking table 30 ℃, 110rpm cultivated 10-12 hour.Get the 1mL secondary seed then and be inoculated in fermention medium, 500mL shakes bottled liquid measure 20mL, and 30 ℃, 110rpm cultivated 72 hours.Lysine content is measured with ninhydrin colorimetry: fermented liquid centrifugal 15 minutes through 3500g, and get supernatant 0.1mL and be diluted to 100mL, get the 1mL diluent and join the 4mL ninhydrin reagent (triketohydrindene hydrate 1.0g is closed in water intaking, adds ethylene glycol monomethyl ether 75mL, and other gets 1.34g CuCl 22H 2O adds among the pH1.3 citrate buffer solution 25mL, mixes two kinds of solution after, adding distil water 100mL obtains ninhydrin solution again) in, boiling water bath heating 20 minutes, mensuration 478nm place, cooling back absorbance fast.According to the standard curve determination lysine content.
The result shows that Brevibacterium lactofermentus (Brevibacterium lactofermentum) ATCC 31269 lysine productions are 53g/L, and the output of reorganization bacterium is 58g/L, and 10% raising is arranged approximately.In anabolism, the precursor substance oxaloacetic acid of Methionin has three approach synthetic, but all relevant with the metabolism of pyruvic acid and NADP/NADPH, so the importing of phbCAB gene can exert an influence to the output of Methionin.
Embodiment 10, in expression in escherichia coli phbCAB effect gene phenylalanine output
Bacterial classification: intestinal bacteria (Escherichia.coli) ATCC 31882.
The seed culture based component is: peptone 1%, and yeast powder 0.5%, NaCl 1%, glucose 2%, pH 7.5.
The fermentation culture based component is: Na 2HPO 412H 2O:20g/L, Trisodium Citrate 6g/L, Sodium Glutamate 0.4g/L, tyrosine 0.6g/L, glucose 20g/L.
Supplemented medium: CaCl 22H 2O 0.6g/L, tyrosinase 15 00mg/L, glucose 500g/L, MgSO 47H 2O1g/L, vitamin B15 00mg/L, ammoniacal liquor 28%.
The method that the pBHR68 plasmid is transformed with electricity is transferred to and obtains reorganization bacterium (intestinal bacteria (Escherichia.coli) ATCC 31882 that contains pBHR68) among intestinal bacteria (Escherichia.coli) ATCC 31882 and carry out fermenting experiment.
Get intestinal bacteria (Escherichia.coli) ATCC 31882 and the reorganization bacterium of cultivation on fresh inclined-plane respectively, be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 37 ℃, 200rpm, cultivate after 12 hours, insert fermention medium with 5% (v/v) inoculum size.7.5L fermentor tank liquid amount 3L, 38.5 ℃ of A.T.Cs, pH 7.0, and dissolved oxygen 20% is controlled glucose concn 1.5% by feed supplement, fermentation time 48 hours.The phenylalanine content measuring method is as follows: get 2 μ L fermented liquid supernatant point samples on filter paper, place the unidirectional up exhibition of chromatographic solution to analyse 16 hours, the oven dry back is with triketohydrindene hydrate spraying colour developing, with the standard amino acid is contrast, cut the painted spot behind the chromatography, place 65% ethanolic soln decolouring 2 hours, measure photoabsorption under the 520nm, amount of amino acid=standard amino acid strength of solution * tested fermented liquid optical density(OD)/standard amino acid solution optical density(OD).
The result shows that it is 8.2g/L that intestinal bacteria (Escherichia.coli) ATCC 31882 fermentations obtain phenyl-alanine concentration, and reorganization bacterium production concentration is 10.6g/L, has improved 29%.Synthetic for colibacillary amino acid, if can obtain effect preferably with the metabolic regulation of the overall situation.And the introducing of phbCAB gene, one is effectively regulated and control is to strengthen phosphopentose pathway, helps amino acid whose synthetic.
Embodiment 11, in Pseudomonas fluorescens, express phbCAB effect gene gluconic acid output
Bacterial classification: Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55
The slant culture based component is: extractum carnis 0.5%, and peptone 1%, NaCl 0.5%, agar 2%, pH7.0.
The seed culture based component is: glucose 2%, corn steep liquor 1%, urea 0.2%, KH 2PO 40.2%, MgSO 47H 2O 0.05%, pH7.0.
The fermentation culture based component is: amylum hydrolysate of the sugar 14%, and corn steep liquor 1.5%, light calcium carbonate 4%, pH 6.7.
After plasmid pBHR68 cut processing through HindIII and BamHI enzyme, be inserted into plasmid pBBR1MCS2 (KovachME, Elzer PH, Hill DS, Robertson GT, Farris MA, Roop RM, Peterson KM.Four newderivatives of the broad-host-range cloning vector pBBR1MCS, carrying differentantibiotic-resistance cassettes.Gene.1995, between HindIII 166:175-176) and the recognition site of BamHI, obtain plasmid pBBRHB.The method that this plasmid transforms with electricity is transferred to the bacterium (Pseudomonas fluorescens (Pseudomonasfluorescens) AS 1.55 that contains pBBRHB) that obtains among Pseudomonas fluorescens (Pseudomonasfluorescens) AS 1.55 to recombinate and carries out fermenting experiment.
Get Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 30 ℃, 230rpm, cultivate after 16 hours, insert fermention medium with 10% (v/v) inoculum size.Fermentation flask 500mL liquid amount 50mL cultivated 72 hours under 30 ℃, 230rpm.Ketone group gluconic acid content is measured with polarimetry in the fermented liquid: ketone group gluconic acid content in the fermented liquid=25 ℃ of bottom fermentation liquid specific rotation absolute value/0.88.
Ketone group gluconic acid content is 13.4g/L in the fermented liquid of Pseudomonas fluorescens (Pseudomonas fluorescens) K1005, the output of reorganization bacterium is 16g/L, improved about 19%, the importing of phbCAB gene, help improving bacterium tolerance, grow better, thereby obtain higher transformation efficiency.
Embodiment 12, to express phbCAB effect gene α-Dian Fenmei in subtilis synthetic
Bacterial classification: subtilis (Bacillus subtilis) ATCC 21556.
The seed culture based component is (300mL): glucose 1g, extractum carnis 1g, peptone 1g, NaCl 1g, KH 2PO 41g, starch 1g, pH 7.0.
The fermentation culture based component is (200mL): extractum carnis 1g, peptone 1g, NaCl 1g, KH 2PO 41g, NaH 2PO 41g, starch 3g.
The method that will transform according to the plasmid pEUHB lithium acetate that embodiment 1 method obtains is transferred to the bacterium (subtilis (Bacillussubtilis) ATCC 21556 that contains pEUHB) that obtains among subtilis (Bacillus subtilis) ATCC 21556 to recombinate and carries out fermenting experiment.
Get subtilis (Bacillus subtilis) ATCC 21556 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 32 ℃, 200rpm, cultivate after 12 hours, insert fermention medium (50mL/500mL Erlenmeyer flask) with 10% (v/v) inoculum size, 32 ℃, 200rpm cultivated 72 hours, measured the α-Dian Fenmei enzyme activity.Enzyme activity determination: get the 5mL fermented liquid, centrifugal 15 minutes of 4000g gets supernatant and 5-acetal-Fructus Hordei Germinatus heptose-right-oil of mirbane reaction, and enzyme activity unit is defined as: 37 ℃, 1 minute decomposes 1 μ mol starch is that glucose is 1 enzyme unit alive.
The result shows that enzyme is lived in the fermented liquid of subtilis (Bacillus subtilis) ATCC 21556 and is 67U/L, and reorganization bacterium enzyme is lived and is 76U/L.In the fermented liquid of reorganization bacterium higher amylase activity is arranged, this may be because the phbCAB gene causes intracellular pathways metabolism to change, making it tend to help the direction of cell growth, improved cell and utilized the ability of starch as carbon source, promptly is the amylase productive rate that has increased cell.
Embodiment 13, in yeast saccharomyces cerevisiae, express phbCAB effect gene alcohol output
Bacterial classification: yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063.
The method that will transform with lithium acetate according to the plasmid pPICHB that embodiment 2 methods obtain is transferred to the bacterium (yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063 that contains pPICHB) that obtains among yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063 to recombinate and carries out fermenting experiment.
Solid medium preparation: measure 5Bx wheat juice 200mL and put into the 500mL beaker, under boiling state, add 4g agar, constantly stir, be sub-packed in the sterilization of test tube mesohigh, put the inclined-plane then until melting fully; Liquid nutrient medium preparation: measure 5Bx wheat juice 110mL and pack in the 250mL triangular flask, transfer pH4.8-5.0, autoclaving then; Fermention medium preparation: claim starch 300g to pour in 40 ℃ of warm water of 1200mL, stir, add 0.2% calcium chloride, regulate pH6.0-6.2, take by weighing Ye Huamei 1g, liquefaction is 30 minutes under 90 ℃ of-93 ℃ of temperature, and until adding the nondiscoloration of iodine liquid, liquefaction is cooled to 58 ℃-60 ℃ rapidly with it after finishing, and adjust pH is 4.4-4.6, add 1mL saccharifying enzyme (100,000 unit) and carry out saccharification, stop during at 23Bx, add 2% corn steep liquor in the pol of starch hydrolyzate, and boiled 1 hour, cold filtration transfers pH to 4.8-5.0 then, and it is stand-by to sterilize.Inoculum size by 10% (v/v) during fermentation is linked in the fermention medium, 30 ℃ of heat-preservation fermentations 72 hours.Alcohol concn high-efficient liquid phase color spectrometry: fermented liquid 8000g centrifugal ten minutes gets supernatant and filters the back as sample; Chromatographic column is the L2Spherogel of a Beckman company ligand exchange column, and moving phase is 98% the vitriol oil: H 2O (volume ratio is 0.5: 1000), flow velocity 1mL/min.
The result shows that yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) ACCC 2063 fermented liquid alcohol concn are 15%, and the alcohol concn of recombination yeast is 20%, improved 33%, the introducing of phbCAB gene, not only can change intracellular metabolism stream, and synthesizing of PHA can improve the tolerance of recombination yeast, thereby improved alcoholic acid output to high ethanol environment.
Embodiment 14, in candida krusei, express phbCAB effect gene glycerine output
Bacterial classification: candida krusei (Candida krusei) ACCC 2196.
The slant culture based component is: glucose 50g/L, yeast extract paste 20g/L, lime carbonate 5g/L, agar 20g/L.
The seed culture based component is: glucose 200g/L, urea 2g/L, corn steep liquor 7g/L.
The fermentation culture based component is: glucose 200g/L, urea 2g/L, corn steep liquor 6g/L.
The method that will transform with lithium acetate according to the plasmid pPICHB that embodiment 2 methods obtain is transferred to the bacterium (candida krusei (Candidakrusei) ACCC 2196 that contains pPICHB) that obtains among candida krusei (Candida krusei) ACCC 2196 to recombinate and carries out fermenting experiment.
Get candida krusei (Candida krusei) ACCC 2196 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (40mL/500mL Erlenmeyer flask) respectively, under 30 ℃, 230rpm, cultivate after 12 hours, insert fermention medium with 10% (v/v) inoculum size, 7.5L fermentor tank liquid amount 3L controls pH 5.5 automatically, 30 ℃ of temperature, air flow 0.5L/min, mixing speed 450rpm, residual sugar stopped fermentation near 0 o'clock, measured glycerol content in the fermented liquid.Glycerol content detects with high performance liquid chromatography in the fermented liquid: fermented liquid 8000g centrifugal ten minutes, get supernatant and filter the back as sample; Chromatographic column is the L2Spherogel of a Beckman company ligand exchange column, and moving phase is 98% the vitriol oil: H 2O (volume ratio is 0.5: 1000), flow velocity 1mL/min.
The result shows that candida krusei (Candida krusei) ACCC 2196 final glycerol concentrations are 62g/L, and the reorganization bacterium is 75g/L, has improved 21%.During the fermentation, there have the carbon source of considerable part can flow to ethanol to be synthetic, and this has reduced the yield of glycerine.The ethanol approach is the approach that oxidizing power is provided for cell, and the phbCAB gene must be introduced, and can reduce the pressure of ethanol approach, promotes glycolysis-, and it is synthetic to make more carbon source flow to glycerine, has increased the yield of glycerine.
Embodiment 15, in candida tropicalis, express the synthetic of phbCAB effect gene SL-AH
Bacterial classification: candida tropicalis (Candida tropicalis) UH22248 (appoint just, Chen Yuantong, the fermentation research of SL-AH, the biotechnology journal, 2000,16:198-202).
The slant culture based component is: the wort of 10Bx, 1.5% agar powder.
The seed culture based component is: yeast extract paste 5g, corn steep liquor 3g, sucrose 5g, KH 2PO 48g adds water and is settled to the 1L sterilization, adds urea 0.3% during inoculation again, and is heavy by cured 5%.
Fermention medium is: yeast extract paste 2g, corn steep liquor 1g, sucrose 2g, KH 2PO 48g, NaCl 1g adds water and is settled to 100mL sterilization, adds n-dodecane 20% during inoculation again, urea 0.12%, heavy cured 3.3%, pH 7.3.
The method that will transform with lithium acetate according to the plasmid pPICHB that embodiment 2 methods obtain is transferred to the bacterium (candida tropicalis (Candidatropicalis) UH22248 that contains pPICHB) that obtains among candida tropicalis (Candida tropicalis) UH22248 to recombinate and carries out fermenting experiment.
48 hours candida tropicalis of slant culture (Candida tropicalis) UH22248 and reorganization bacterium are inoculated into (100mL/500mL shakes bottle) in the seed culture medium respectively, under 30 ℃, 180rpm, cultivate after 48 hours, 3mL is in the 100mL fermention medium in inoculation, 30 ℃, 180rpm were cultivated 4 days, fermentation ends.Get the 15ml fermented liquid, with 6mol/LHCl adjust pH to 3.0, add the 120mL ether, shake 100 times, placed 30 minutes, pour out the 40mL ether extracted liquid then, the air-dry white solid that obtains in the stink cupboard dissolves its neutral hot ethanol with 95% then, add a phenolphthalein, with the titration of standard NaOH solution, write down used NaOH, calculate SL-AH output.
The result shows that reorganization bacterium (SL-AH output is 92g/L) has demonstrated the higher SL-AH output than tropical candiyeast (Candidatropicalis) UH22248 (SL-AH output is 78g/L), fermented liquid is thickness relatively, cell is in a kind of environment of low dissolved oxygen level, the introducing of phbCAB gene can provide oxidizing power for cell under this condition, it may also have restraining effect to the Fatty Acid Oxidation approach simultaneously, thereby has increased the diprotic acid output in the fermented liquid.
Embodiment 16, in candida tropicalis, express the synthetic of phbCAB effect gene 15 carbon dicarboxylic acids
Bacterial classification: candida tropicalis (Candida tropicalis) T 25-14(Chen Yuantong, Hao Xiuzhen, Pang Yuechuan, the fermentation research of 15 carbon dicarboxylic acids, the microorganism journal, 1995,35:433-437).
The slant culture based component is: the wort of 10Bx, 1.5% agar powder.
The seed culture based component is: yeast extract paste 5g/L, corn steep liquor 3g/L, sucrose 5g/L, KH 2PO 48g/L prepares sterilization, adds urea 0.3% during inoculation again, and is heavy by cured 5%.
Fermention medium is: yeast extract paste 2g/L, corn steep liquor 1g/L, sucrose 1g/L, KH 2PO 48g/L, NaCl 1g/L add water and are settled to the 100mL sterilization, add Pentadecane 20% during inoculation again, urea 0.12%, and pH 7.5.
To be transferred to candida tropicalis (Candida tropicalis) T with the method that lithium acetate transforms according to the plasmid pPICHB that embodiment 2 methods obtain 25-14Middle reorganization bacterium (candida tropicalis (Candidatropicalis) T that contains pPICHB that obtains 25-14) carry out fermenting experiment.
With 48 hours candida tropicalis of slant culture (Candida tropicalis) T 25-14Be inoculated in the seed culture medium (50mL/500mL shakes bottle) respectively with the seed of reorganization bacterium, under 30 ℃, 220rpm, cultivate 48 hours after, 5% (v/v) inoculum size is inoculated into (50mL/500mL shakes bottle) in the fermention medium, 30 ℃, 220rpm were cultivated 72 hours.Get the 15ml fermented liquid, with 6mol/l HCl adjust pH to 3.0, add 120ml ether mixing, place up to layering, remove water layer, emit ether extracted liquid, the air-dry white solid that obtains in the stink cupboard dissolves its neutral hot ethanol with 95% then, add a phenolphthalein, with the titration of standard NaOH solution, write down used NaOH, calculate diprotic acid output.
The result shows candida tropicalis (Candida tropicalis) T 25-14Diprotic acid output be 36g/L, the reorganization bacterium is 43g/L, has improved 19%.The reorganization fermented liquid is thickness relatively, cell is in a kind of environment of low dissolved oxygen level, the introducing of phbCAB gene can be for cell provides oxidizing power under this condition, and it may also have restraining effect to the Fatty Acid Oxidation approach simultaneously, thereby has increased the diprotic acid output in the fermented liquid.
Embodiment 17, the influence that expression phbCAB gene pairs gemma forms in bacillus thuringiensis
Bacterial classification: bacillus thuringiensis (Bacillus thuringiensis) ACCC 10068.
The method that will transform with electricity according to the plasmid pEUHB that embodiment 1 method obtains is transferred to the bacterium (bacillus thuringiensis (Bacillus thuringiensis) ACCC 10068 that contains pEUHB) that obtains among bacillus thuringiensis (Bacillus thuringiensis) ACCC 10068 to recombinate and carries out fermenting experiment.
Get bacillus thuringiensis (Bacillus thuringiensis) ACCC 10068 and the reorganization bacterium of cultivation on fresh inclined-plane respectively, be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 25 ℃, 220rpm, cultivate after 12 hours, insert fermention medium (50mL/500mL Erlenmeyer flask) with 1% (v/v) inoculum size, 25 ℃, 220rpm fermentation 36 hours.Medium component is: extractum carnis 0.3%, and peptone 0.5%, pH 7.2.Spore content is measured with blood counting chamber in the fermentation back.
Can see the biomass (10.2*10 of reorganization bacterium by microscopic 9Individual/ml) and spore count (1.5*10 9Individual/as ml) all to be higher than bacillus thuringiensis (Bacillus thuringiensis) ACCC 10068 (biomass 9.1*10 9Individual/ml, spore count 1.1*10 9Individual/ml).Fermenting experiment shows that high dissolved oxygen helps sporulation.The introducing of phbCAB gene can promote sporulation.
Embodiment 18, in subtilis, express phbCAB and influence guanosine and synthesize
Bacterial classification: subtilis (Bacillus subtilis) ATCC 19220.
The seed culture based component is glucose 20g/L, yeast powder 10g/L, peptone 10g/L, corn liquid 10g/L, sodium-chlor 5g/L, urea 2g/L, monosodium glutamate 5g/L, pH 7.0-7.2.
The fermentation culture based component is glucose 120g/L, soya-bean cake hydrolyzed solution 50g/L, yeast powder 16g/L, ammonium sulfate 15g/L, magnesium sulfate heptahydrate 4g/L, dipotassium hydrogen phosphate 2g/L, monosodium glutamate 10g/L, lime carbonate 2g/L, pH 7.0-7.2.
The method that will transform by lithium acetate according to the plasmid pEUHB that embodiment 1 method obtains is transferred to the bacterium (subtilis (Bacillussubtilis) ATCC 19220 that contains pEUHB) that obtains among subtilis (Bacillus subtilis) ATCC 19220 to recombinate and carries out fermenting experiment.
Get subtilis (Bacillus subtilis) ATCC 19220 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 36 ℃, 140rpm, cultivate after 10 hours, insert fermention medium (50mL/500mL Erlenmeyer flask) with 10% (v/v) inoculum size, 36 ℃, 220rpm were cultivated 60 hours down, measured guanosine content.Guanosine content is measured with HPLC, and moving phase is 0.5% dipotassium hydrogen phosphate, flow velocity 1.2mL/min, and chromatographic column is a Hypersil ODS C18 reversed-phase column, the detection wavelength is 254nm.
The result shows that subtilis (Bacillus subtilis) ATCC 19220 guanosine output are 16g/L, and the output of reorganization bacterium is 20g/L, has improved 25%.In the endocellular metabolism approach, provide the hexose monophosphate approach of precursor can consume a large amount of NADP for guanosine is synthetic, high NADP/NADPH level can effectively promote the synthetic of guanosine.The introducing of phbCAB gene just can realize this requirement, therefore can improve the output of guanosine significantly.
Embodiment 19, in yeast saccharomyces cerevisiae, express phbCAB effect gene gsh output
Bacterial classification: yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) KY6186 (Sakato K, Tanaka H.Advancedcontrol of glutathione fermentation process.Biotechnol Bioeng, 1992,40:904-912).
The slant culture based component is: wort 10g/L, yeast powder 3g/L, peptone 5g/L, glucose 10g/L, agar 20g/L, pH 7.0-7.2.
The seed culture based component is: glucose 30g/L, yeast powder 6g/L, Secondary ammonium phosphate 3g/L, sal epsom 0.8g/L, dipotassium hydrogen phosphate 1g/L, potassium primary phosphate 1g/L, pH 7.0-7.2.
Fermention medium is: glucose 70g/L, yeast powder 15g/L, wheat juice 60g/L, Secondary ammonium phosphate 10g/L, sal epsom 5g/L, honey 28g/L, corn steep liquor 16g/L, dipotassium hydrogen phosphate 1g/L, potassium primary phosphate 1g/L, ZnCl 210mg/L, FeCl 26mg/L, CuCl 26mg/L, MnCl 26mg/L, pH 7.0-7.2.
To be transferred to the bacterium (yeast saccharomyces cerevisiae that contains (Saccharomycescerevisiae) KY6186) that obtains among yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) KY6186 to recombinate with lithium acetate according to the plasmid pPICHB that embodiment 2 methods obtain and carry out fermenting experiment.
Get yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) KY6186 of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively with the reorganization bacterium, under 30 ℃, 180rpm, cultivate after 24 hours, insert fermention medium with 10% (v/v) inoculum size, 7.5L liquid amount 3L fermentation in the fermentor tank, 30 ℃ of A.T.Cs, pH 5.4, air flow 2L/min, preceding two hours rotating speed 200rpm, 100rpm afterwards per hour raises, up to 600rpm, be maintained to fermentation ends, stopped to ferment in 36 hours.Getting after the fresh yeast that obtains of fermentation gives a baby a bath on the third day after its birth time with distilled water, in 40% ethanol, 30 ℃ extracted 2 hours, 3000g is centrifugal, (Shanghai City medicine assay office clinical biochemical is checked (first volume) with the ALLOXAN method to get supernatant, Shanghai, Shanghai science and technology press, 1979) the mensuration glutathione content.
The result shows that yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) KY6186 fermented liquid glutathione concentrations is 1.3g/L, and the glutathione concentrations of reorganization bacterium is 1.6g/L, has improved 23%.Studies show that the ethanol synthetic reduces helps the synthetic of gsh, is one and consumes reducing power that obtain the process of oxidizing power, it is synthetic that the introducing of phbCAB gene can suppress alcoholic acid, improves gsh output and ethanol is synthetic.
Embodiment 20, in torulopsis, express the influence of phbCAB gene pairs erythritol output
Bacterial classification: torulopsis (ToruLopsis sp) B845 (Wu Yan, Yang Xiaowei, Lu Maolin, erythritol produces the form of bacterium B845, physiological characteristic, biotechnology, 2002,12:20-21).
The slant culture based component is: glucose 10%, yeast extract paste 1%, urea 0.1%, agar 2%, pH 7.0-7.2.
Seed and fermention medium are: glucose 20%, yeast extract paste 0.5%, urea 0.1%, pH 7.0-7.2.
The method that will transform with electricity according to the plasmid pPICHB that embodiment 2 methods obtain is transferred to the bacterium (torulopsis (ToruLopsis sp) B845 that contains pPICHB) that obtains among torulopsis (ToruLopsis sp) B845 to recombinate and carries out fermenting experiment.
Get torulopsis (ToruLopsis sp) B845 of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (40mL/500mL Erlenmeyer flask) respectively with the reorganization bacterium, under 30 ℃, 180rpm, cultivate after 3 days, insert in the fermention medium (50mL/500mL Erlenmeyer flask) with 5% (v/v) inoculum size, 30 ℃, 180rpm were cultivated 3 days down, measured the output of tetrahydroxybutane.Erythritol output with periodate oxidation method measure (open country, Ying Xiangxian, Fan Guangxian, Zhu Gejian, periodate oxidation method directly measure the fermented liquid mesoerythrit, Wuxi Light Industry Univ.'s journal, 2000,19:72-75).The result shows that the erythritol output of torulopsis (ToruLopsis sp) B845 is 50g/L, the reorganization bacterium is 55g/L, raising is about 10%, produce bacterium as erythritol, need good anti-height and ooze ability and metabolism carbon source ability, and the introducing of phbCAB gene causes the synthetic of intracellular PHA, help improving aforementioned capabilities, therefore also there is certain promoter action synthesizing of erythritol.
Embodiment 21, in bacillus pumilus, express phbCAB effect gene D-ribose output
Bacterial classification: bacillus pumilus (Bacillus pumilus) ATCC 31095.
The seed culture based component is: glucose 20g/L, and corn steep liquor 26g/L, dipotassium hydrogen phosphate 0.03g/L, potassium primary phosphate 0.01g/L, pH 6.7.
The fermentation culture based component is: glucose 180g/L, and corn steep liquor 28g/L, ammonium sulfate 13g/L, manganous sulfate 0.05g/L, pH 7.0.
The method that will transform with lithium acetate according to the plasmid pEUHB that embodiment 1 method obtains is transferred to the bacterium (bacillus pumilus (Bacilluspumilus) ATCC 31095 that contains pEUHB) that obtains among bacillus pumilus (Bacillus pumilus) ATCC 31095 to recombinate and carries out fermenting experiment.
Get bacillus pumilus (Bacillus pumilus) ATCC 31095 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 37 ℃, 180rpm, cultivated 18-20 hour, be linked in the fermention medium with the inoculum size of 10% (v/v).7.5L fermentor tank liquid amount 3L, 37 ℃ of controlled temperature, air flow 3L/min, stirring velocity 650rpm fermented 72 hours, measured the D-ribose content in the fermented liquid.D-ribose is measured with orcin method: centrifugal 10 minutes of fermented liquid 5000g, and the supernatant distilled water diluting is controlled in the 10-90g/3mL scope ribose amount; Get the 3mL diluent, add 0.1% iron(ic) chloride concentrated hydrochloric acid solution 3mL successively, 0.1% orcinol ethanolic soln 0.3mL shakes up, boiling water bath 40 minutes, and the 670nm absorbance was measured in tap water cooling back in 60 minutes, calculate ribose concentration by typical curve.The result shows that the ribose concentration of bacillus pumilus (Bacillus pumilus) ATCC 31095 is 55g/L, and the reorganization bacterium can reach 72g/L, has risen 31%.The synthetic of intracellular nucleic sugar is to pass through phosphopentose pathway, the interior oxidizing power of cell that this approach consumption is a large amount of, and by increasing the formation that metabolic demand that dissolved oxygen satisfies cell can promote spore, this is unfavorable for producing ribose by the cytotrophy growth, therefore the introducing of phbCAB gene, can provide certain oxidizing power NADPH for cell from endogenous approach, thereby help the synthetic of ribose.
Embodiment 22, improve the tolerance of bacterium to heavy metal ion Hg2+ at expression in escherichia coli phbCAB
Bacterial classification: intestinal bacteria (Escherichia coli) JM109.
The minimum medium of intestinal bacteria (Escherichia coli) JM109 is LB substratum (g/100mL): peptone 1.0; Yeast extract 0.5; NaCl 1.0, and pH 7.0.
The minimum medium of reorganization bacterium is: add penbritin in the LB substratum to final concentration 60 μ g/mL.
The method that plasmid pBHR68 electricity consumption is transformed changes intestinal bacteria (Escherichia coli) JM109 acquisition reorganization bacterium (intestinal bacteria (Escherichia coli) JM109 that contains pBHR68) over to.Wild-type E.coli JM109 in contrast.
Intestinal bacteria (Escherichia coli) JM109 and reorganization bacterium are inserted respectively and added 1mg/L, 2mg/L, 3mg/L, 4mg/L, 5mg/L, 6mg/L, 8mg/L or 10mg/L HgCl 2Minimum medium separately in, culture condition is 500mL triangular flask liquid amount 100mL, 37 ℃, 200rpm cultivated 24 hours, measured the OD of fermented liquid 600The result shows and works as Hg 2+When concentration was 4mg/L, the growth of reorganization bacterium was subjected to certain inhibition, maximum OD 600Dropped to 1.9 from 2.7; Work as Hg 2+When concentration rose to 10mg/L, thalli growth almost completely stopped.Experiment also shows the original host bacterium E.coli JM109 that transforms for without foreign gene, at Hg 2+When being 2mg/L, concentration just can not grow fully.Changing over to of PHB gene makes bacterium obtain enhancing to the tolerance of mercury.
Two kinds of thalline are from 2.5mg/L Hg under the same operation condition 2+Enrichment mercury ion in the simulated wastewater of concentration, the final enriching quantity of reorganization bacterium is the 5.1mg/g dry cell weight, original E.coli JM109 then only is the 1.7mg/g dry cell weight.Wherein, dry cell weight is measured with cryochem.
Testing the reorganization bacterium that shows adding PHB synthetic gene compares for Hg with intestinal bacteria (Escherichia coli) JM109 2+Tolerance degree be enhanced, in the substratum that can better contain heavy metal ion under the identical condition, grow.
Express in embodiment 23, the mobile Zymomonas mobilis phbCAB improve bacterium to high alcohol environmental resistance
Bacterial classification: mobile pseudomonas (Zymomonas mobilis) NRRL B-4286.
The method that the plasmid pBBRHB that will obtain according to the method for embodiment 11 transforms with electricity is transferred to the bacterium (mobile pseudomonas (Zymomonas mobilis) the NRRL B-4286 that contains pBBRHB) that obtains among mobile pseudomonas (Zymomonas mobilis) the NRRL B-4286 to recombinate and carries out fermenting experiment.
Seed culture medium component (g/L): glucose 100, peptone 10, yeast extract paste 15, pH 6.0.
Fermention medium component (g/L): glucose 150, peptone 25, yeast extract paste 25, pH 4.5 or pH6.0.
The mensuration of ethanol mass concentration, cell concentration, reducing sugar mass concentration is with reference to (Ingram LO in the fermented liquid, GomezPF, Lai X, Moniruzzaman M, Wood BE, Yomano LP and York SW.Metabolic engineeringof bacteria for ethanol production.Biotechnol.Bioeng.1998,58:204-214)
Culture condition:
The bacterial classification of refrigerator preservation inserts respectively in the seed culture medium, cultivates after 12 hours, inserts respectively in the fermention medium with the inoculum size of 10% (v/v), carries out static anaerobism ethanol fermentation.
Fermentation triangular flask 250mL, liquid amount is 100mL, fermentation pH 4.5 (reorganization bacterium), 35 ℃ of temperature, fermentation time 48 hours.The fermentation pH 4.5 and 6.0 of mobile pseudomonas (Zymomonas mobilis) NRRL B-4286 in contrast.
Experiment shows, the ethanol production of mobile pseudomonas (Zymomonas mobilis) NRRL B-4286 in pH 4.5 and 6.0 is respectively 21.1g/L and 62.5g/L, the reorganization bacterium is 59.2g/L at the ethanol production of pH 4.5, near the level of mobile pseudomonas (Zymomonas mobilis) NRRL B-4286 when pH 6.0, show that changing over to of phbCAB gene effectively raises the acid resistance of bacterium, further optimization of fermentation conditions can realize the alcoholic acid High-efficient Production under lower pH.
Embodiment 24, in mobile pseudomonas, express phbCAB and improve the utilize ability of bacterium glucose
Bacterial classification: mobile pseudomonas (Zymomonas mobilis) NRRL B-4286.
The method that the plasmid pBBRHB that will obtain according to the method for embodiment 11 transforms with electricity is transferred to the bacterium (mobile pseudomonas (Zymomonas mobilis) the NRRL B-4286 that contains pBBRHB) that obtains among mobile pseudomonas (Zymomonas mobilis) the NRRL B-4286 to recombinate and carries out fermenting experiment.
Seed culture medium component (g/L): peptone 10, yeast extract paste 15, pH 6.0.
Fermention medium component (g/L): peptone 25, yeast extract paste 25, pH 6.0, glucose.Wherein, the concentration of glucose is respectively 120,150,160,180, the 210g/L gradient.
The mensuration of ethanol mass concentration, cell concentration, reducing sugar mass concentration is with reference to (Ingram LO in the fermented liquid, GomezPF, Lai X, Moniruzzaman M, Wood BE, Yomano LP and York SW.Metabolic engineeringof bacteria for ethanol production.Biotechnol.Bioeng.1998,58:204-214)
Culture condition:
The bacterial classification of refrigerator preservation inserts respectively in the seed culture medium, cultivates after 12 hours, inserts respectively in the fermention medium with the inoculum size of volume fraction 10%, carries out static anaerobism ethanol fermentation.
Fermentation triangular flask 500mL, liquid amount is 100mL, fermentation pH 6.0,35 ℃ of temperature, fermentation time 48h.Under the glucose condition of different concns, cultivate mobile pseudomonas (Zymomonas mobilis) NRRL B-4286 and reorganization bacterium respectively.
Experimental result shows, mobile pseudomonas (Zymomonasmobilis) NRRL B-4286 is when glucose concn 150g/L, and it is maximum that alcoholic acid output reaches, and is 65g/L, and reorganization bacterium alcoholic acid output when glucose concn is increased to 210g/L is ascendant trend always, is 95g/L to the maximum.The importing of PHB route of synthesis makes bacterium strengthen for the resistance of osmotic pressure, just sugaredly still keeps good growth when dense.The ethanol fermentation process of mobile pseudomonas (Zymomonas mobilis) NRRL B-4286 has the utilization ratio of the glucose higher than yeast, but after initial glucose concn acquired a certain degree, ethanol production descended on the contrary.Behind the synthetic gene that changes PHB over to, the first sugared concentration ratio that fermentation reaches the ethanol maximum production moves pseudomonas (Zymomonas mobilis) NRRL B-4286 and improves.Show that changing over to of phbCAB helps improving bacterium osmotic pressure is resisted degree.
Embodiment 25, in butyric acid shuttle genus bacillus, express phbCAB and improve from glycerol fermentation preparation 1, and ammediol (1, production 3-PDO)
Bacterial classification: butyric acid shuttle genus bacillus (Clostridium butyricum) ATCC 8260.
The method that will transform with lithium acetate according to the plasmid pEUHB that embodiment 1 method obtains is transferred to the bacterium (butyric acid shuttle genus bacillus (Clostridium butyricum) ATCC 8260 that contains pEUHB) that obtains among butyric acid shuttle genus bacillus (Clostridium butyricum) ATCC 8260 to recombinate and carries out fermenting experiment.
This fermentation needs anaerobism to cultivate, and fermention medium is: glycerine 6%, glucose 1%, corn steep liquor 2%, (NH 4) 2SO 40.2%.Leavening temperature is 34 ℃, and initial pH is 6.5～7.
Culture condition:
Batch fermentation be divided into two the step carry out, at first butyric acid shuttle genus bacillus (Clostridium butyricum) ATCC 8260 and reorganization bacterium are connected to respectively in the 150mL triangular flask that liquid amount is 100mL, under anaerobic, in 36 ℃, 100rpm cultivates 15h, and the inoculum size access liquid amount with 10% (v/v) is in the 250mL triangular flask of 200mL then, the paraffin fluid-tight is fermented in 34 ℃, 150rpm, initial pH 6.8.Period sampling measuring glycerine residual volume and 1, the growing amount of 3-PDO.
Glycerine and 1 in the fermented liquid, the concentration of 3-PDO detects with vapor-phase chromatography, and chromatographic column is the heavy caliber kapillary, 0.5mm * 20m, 170 ℃ of column temperatures, 260 ℃ of vaporizer temperature, carrier gas is a nitrogen, flow velocity 50mL/min adopts marker method (internal standard substance matter is 1,62 hexylene glycol) quantitative.
Product separates: after fermented liquid was centrifugal, supernatant liquor obtained 1, the 3-PDO product with the oil bath distillation.
The biomass of thalli growth: detect (OD with colorimetry 650Nm).
1 of butyric acid shuttle genus bacillus (Clostridium butyricum) ATCC 8260, ammediol output is 15.7g/L, and the reorganization bacterium is 20.4g/L.The growth pH of butyric acid fusobacterium is between 6～7.5, and it is that the by product of the fermentating metabolism of substrate is mainly butyric acid and acetate with glycerine, thereby the rising of acidity during the fermentation will have a strong impact on thalli growth, suppresses 1 simultaneously, and 3-PDO generates.This shows to obtain 1 of high yield, 3-PDO must be controlled at pH between 6.5～7 during the fermentation.If the synthetic gene of PHB is imported in the bacterium, make bacterium strengthen to the tolerance of acidic conditions, then can under the condition that need not regulate pH, obtain higher 1,3-PDO output.
Express the decomposition under the phbCAB raising bacterium anaerobic condition in embodiment 26, the genus bacillus to crude oil
Bacterial classification: genus bacillus (Bacillus sp) L-23 (Wang Hao opens long armour for Li Qingxin, Kang Congbao, the optimization of fermentation of bacillus condition and under indoor conditions, improve the preliminary study of oil recovery factor, and industrial microorganism, 2002,32:28-31).
The acquisition of reorganization bacterium: the method that will transform with lithium acetate according to the plasmid pEUHB that embodiment 1 method obtains is transferred to the bacterium (genus bacillus (Bacillus sp) L-23 that contains pEUHB) that obtains among genus bacillus (Bacillus sp) L-23 to recombinate and carries out fermenting experiment.
Seed culture medium (g/L): glucose 20, peptone 2, Na 2HPO 44, KH 2PO 42, MgSO 40.5, CaCl 20.005 pH 7.2.
Fermention medium (g/L): glucose 30, (NH 4) 2SO 415, Na 2HPO 42, KH 2PO 42, MgSO 40.5 pH 7.2.
Genus bacillus (Bacillus sp) L-23 and reorganization bacterium bacterial classification are inserted respectively in the seed culture medium, cultivate after 12 hours, insert in the fermention medium respectively with the inoculum size of volume fraction 10%, fermentation triangular flask 500mL, liquid amount is 100mL, 35 ℃ of temperature, fermentation time 48 hours.
Cell concentration is measured in the fermented liquid
Get nutrient solution and after centrifugal 30 minutes, make bacteria suspension, then dilution with equivalent distilled water through 6000g, measure the OD value of bacteria suspension in the 660nm place with 722 type spectrophotometers, perform typical curve in advance, try to achieve the equation of typical curve, record cell concentration in the fermented liquid then according to this.
Reducing crude oil viscosity experiment: with genus bacillus (Bacillus sp) L-23 of different concns or the fermented liquid of reorganization bacterium, join in the different crude oil in source, cultivate 24h for 45 ℃, after the whizzer centrifuge dehydration, use the viscosimetric variation of viscometer again, obtain viscosity break ratio.For the different crude oil in source, the viscosity reducing effect of bacterium is different, may be due to the moiety difference of these crude oil.Contain materials such as abundant hydro carbons, colloid, bituminous matter class in the crude oil, thereby make crude oil have certain viscosity.Bacterium can utilize composition in the crude oil as the carbon source of its growth when growing in crude oil, therefore, for its analysis of causes that can reduce viscosity of crude have following two kinds may: the one, make the viscosity degradation of crude oil by degraded to hydro carbons in the crude oil and other material; The 2nd, microorganism utilizes crude oil to produce some meta-bolitess, and the effect of these products descends viscosity of crude.
By wild bacterium (genus bacillus (Bacillus sp) L-23) and change over to the PHB synthetic gene the reorganization bacterium more as can be seen, the reorganization bacterium is more obvious for the viscosity reduction effect of crude oil, result with a kind of crude oil is an example, the result shows that the growing state of reorganization bacterium in crude oil is better than genus bacillus (Bacillus sp) L-23, thereby better to the viscosity reducing effect of crude oil.This is because changing over to of PHB synthetic gene makes bacterium improve the resistance of osmotic pressure, can better growth in crude oil.
The viscosity reducing effect of wild bacterium of table 1 and reorganization bacterium relatively
Figure G2009101780940D00261
Embodiment 27, in Lactobacterium acidophilum, express phbCAB and improve the survival rate of bacterium under acidic conditions
Bacterial classification: Lactobacterium acidophilum (Lac tobacillus acidophilus) ATCC 53671.
The method that the plasmid pEUHB that obtains according to the method for embodiment 1 transforms with electricity is transferred to and obtains reorganization bacterium (Lactobacterium acidophilum (Lactobacillus acidophilus) ATCC 53671 that contains pEUHB) among Lactobacterium acidophilum (Lactobacillus acidophilus) ATCC 53671 and carry out fermenting experiment.
Experimental technique is as follows:
The bacterial classification substratum that goes down to posterity: the 12.8g skim-milk is dissolved in the 100mL distilled water, 121 ℃ of sterilization 15min.
Counting substratum: extractum carnis 0.5%, peptone 1.0%, yeast extract paste 0.6%, glucose 0.5%, agar 1.8%, 6.8,121 ℃ of sterilizations of pH 20min.
The preparation of fermented bean drink: soybean room temperature (about 20 ℃) was soaked 48 hours, make the abundant swelling of soybean, (water: beans=3: 1), two-layer filtered through gauze is removed bean dregs promptly to defibrination.115 ℃ of sterilization 15min.
The preparation of different pH value fermented bean drink: as conditioning agent, fermented bean drink pH value is transferred to 4.0,4.5,5.0 or 5.5 respectively with lactic acid.The natural pH value of fermented bean drink is about 6.5, and preparation is to carry out on magnetic stirring apparatus, with the monitoring of pH acidometer.
Preserve experiment: Lactobacterium acidophilum (Lactobacillus acidophilus) ATCC 53671 and reorganization bacterium are respectively at cultivating 48 hours in the fermented bean drink substratum (pH 6.5), get then in the sterilization fermented bean drink that bacterium liquid is added into different pH values (4.0,4.5,5.0,5.5) respectively, making the viable bacteria number is 1 * 10 7-10 8Cfu/ml places 4 ℃ of refrigerators to preserve for 10 weeks, detects the viable bacteria number of variations.Wherein, method of counting: the difference of bacteria containing amount per sample, does 10 times of series concentration dilutions, to fall dull and stereotypedly, 37 ℃ of constant temperature culture 72 hours are counted colony number.The calculating of survival rate: initial viable bacteria number * 100% in the viable bacteria number/sample of survival rate=sample.
The result shows that Lactobacterium acidophilum (Lactobacillus acidophilus) ATCC 53671 preserves in the fermented bean drink of different pH values, survival rate difference, 4.0 times survival rates of pH minimum (2%), pH 5.0 the highest (11%).Preserve in pH 4.5-pH5.5, survival rate changes not obvious all about 9%.10 weeks preserved result of experiment and show, the survival rate under the pH 5.5 (9%) only is higher than one times of less than under the pH 4.5 (8.2%).From the viable bacteria number, 4.0 times viable bacteria numbers of 10 week back pH still can maintain 1 * 10 6The above level of cfu/ml, pH 4.5-5.5 is 1 * 10 7The above level of cfu/ml.
The survival rate of reorganization bacterium changes not obvious down at several pH (4.0,4.5,5.0,5.5) of experiment, all about 20%, the wilder bacterium of the number of viable bacteria is significantly improved, and 10 weeks were preserved the viable bacteria number of experiment all 1 * 10 7The above level of cfu/ml.The synthetic viable bacteria number of bacterium under acidic conditions that improved that shows PHB.
The Lactobacterium acidophilum of reorganization has higher survival rate under low pH value (4.0,4.5) culture condition and the viable bacteria number has great importance in production: can improve survival rate on the one hand, make preparation have higher viable count: on the other hand, lower pH value environment can prevent living contaminants.
Embodiment 28, from the expression affecting glucose acid yield of genes involved Pseudomonas fluorescens of the synthetic PHA of lipid acid β-Yang Hua approach
Bacterial classification: Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55.
The slant culture based component is: extractum carnis 0.5%, and peptone 1%, NaCl 0.5%, agar 2%, pH7.0.
The seed culture based component is: glucose 2%, corn steep liquor 1%, urea 0.2%, KH 2PO 40.2%, MgSO 47H 2O 0.05%, pH7.0.
The fermentation culture based component is: amylum hydrolysate of the sugar 14%, and corn steep liquor 1.5%, light calcium carbonate 4%, pH 6.7.
Under the condition of the polymerase chain reaction of standard, with plasmid pEE32 (Fukui T, Doi Y.Cloning andanalysis of the poly (3-hydroxybutyrate-co-3-hydroxyhexanoate) biosynthesis geneof Aeromonas caviae.J.Bacteriol., 1997,179:4821-4830) be template, amplify the phaCJ gene with primer TAAGGTACCGAAGGAGAGCACATGAGCCA and TCTAAGCTTGGCTGATTGTGCCTGCGTG, after process KpnI and HindIII enzyme are cut processing then, be inserted between the recognition site of the restriction enzyme KpnI of plasmid pBBR1MCS2 and HindIII, obtain plasmid pBBRCJ.The method that pBBRCJ transforms with electricity is transferred to the bacterium (Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55 that contains pBBRCJ) that obtains among Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55 to recombinate and carries out fermenting experiment.
Get Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 30 ℃, 230rpm, cultivate after 16 hours, insert fermention medium respectively with 10% (v/v) inoculum size.Fermentation flask 500mL liquid amount 50mL cultivated 72 hours under 30 ℃, 230rpm, measured ketone group gluconic acid content in the fermented liquid.Ketone group gluconic acid content is measured with polarimetry in the fermented liquid: ketone group gluconic acid content in the fermented liquid=25 ℃ of bottom fermentation liquid specific rotation absolute value/0.88.
The result shows that ketone group gluconic acid content is 13.6g/L in the fermented liquid of Pseudomonas fluorescens (Pseudomonas fluorescens) AS 1.55, the output of reorganization bacterium is 15.8g/L, improved about 16%, the importing of phaCJ gene, can in cell, accumulate PHA, help improving bacterium tolerance, grow better, thereby obtain higher transformation efficiency.
Embodiment 29, influence the biosynthesizing of inosine from the expression of genes involved subtilis of the synthetic PHA of lipid acid de novo synthesis
Bacterial classification: subtilis (Bacillus subtilis) ATCC 19162.
The seed culture based component is glucose 20g/L, yeast powder 15g/L, peptone 10g/L, corn liquid 7g/L, sodium-chlor 2.5g/L, urea 2g/L, pH value 7.0.
The fermentation culture based component is glucose 140g/L, corn liquid 16g/L, yeast powder 16g/L, urea 9g/L, ammonium sulfate 16g/L, magnesium sulfate heptahydrate 4g/L, dipotassium hydrogen phosphate 5g/L, lime carbonate 20g/L, pH value 7.0.
Under the condition of the polymerase chain reaction of standard, with plasmid pQH-CG (Qiu Yuanzheng, polyhydroxybutyrate hydroxycaproic ester biosynthetic pathway genetic engineering modified, Tsing-Hua University, 2005, Ph D dissertation.) be template, amplify the phaGC gene with primer ATACGACTCACTATAGGGC and AGTGCCAGATCTCGCAACGCAATTAATG, after process BamHI and BglII enzyme are cut processing then, be inserted between the recognition site of the restriction enzyme BglII of plasmid pEU308 and BamHI, obtain plasmid pEUGC.The method that pEUGC transforms with lithium acetate is transferred to the bacterium (subtilis (Bacillus subtilis) ATCC 19162 that contains pEUGC) that obtains among subtilis (Bacillussubtilis) ATCC 19162 to recombinate and carries out fermenting experiment.
Get subtilis (Bacillus subtilis) ATCC 19162 and the reorganization bacterium of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively, under 32 ℃, 200rpm, cultivate after 12 hours, insert fermention medium with 5% (v/v) inoculum size.7.5L fermentor tank liquid amount 3L, 35 ℃ of A.T.Cs, pH 6.5, stirring velocity 600rpm, air flow 1L/min, fermentation time 68 hours (inosine output no longer increases) is measured inosine content in the fermented liquid.Inosine content is measured with HPLC, and moving phase is 0.5% dipotassium hydrogen phosphate, flow velocity 1.2mL/min, and chromatographic column is a Hypersil ODS C18 reversed-phase column, the detection wavelength is 254nm.The result shows that the inosine output of subtilis (Bacillussubtilis) ATCC 19162 is 19.7g/L, and the output of reorganization bacterium is 24.9g/L, has improved 26.4%.In the endocellular metabolism approach, provide the hexose monophosphate approach of precursor can consume a large amount of NADP for inosine is synthetic, regulation and control enzyme glucose-6-phosphate dehydrogenase from the 6-glucose 1-phosphate1-to phosphopentose pathway is subjected to the feedback inhibition of NADPH simultaneously, so the minimizing of NADPH can promote the conversion of glucose to phosphopentose pathway.Generally speaking, inosine is synthetic to be the biochemical metabolism process of a large amount of oxidizing powers of needs, and high NADP/NADPH level can effectively promote the synthetic of inosine.The introducing of phaG C gene can promote the de novo synthesis of lipid acid to improve intracellular oxidizing power, therefore can improve the output of inosine significantly.
Embodiment 30, in mobile pseudomonas, express phbCAB effect gene ethanol production
Bacterial classification: mobile pseudomonas (Zymomonas mobilis) NRRL B-4286.
The slant culture based component is: glucose 10g/L, peptone 10g/L, yeast powder 15g/L, potassium primary phosphate 1g/L, ammonium sulfate 1g/L, magnesium sulfate heptahydrate 1g/L, NaCl 1g/L, agar 15g/L, pH value 7.0.
The seed culture based component is: glucose 100g/L, yeast powder 15g/L, peptone 10g/L, pH value 7.0.
The fermentation culture based component is: glucose 200g/L, yeast powder 15g/L, peptone 10g/L, pH value 7.0.
The method that the plasmid pBBRHB that will obtain according to the method for embodiment 11 transforms with electricity is transferred to the bacterium (mobile pseudomonas (Zymomonas mobilis) the NRRL B-4286 that contains pBBRHB) that obtains among mobile pseudomonas (Zymomonas mobilis) the NRRL B-4286 to recombinate and carries out fermenting experiment.
Get mobile pseudomonas (Zymomonas mobilis) the NRRL B-4286 of cultivation on fresh inclined-plane respectively and be inoculated into seed culture medium (50mL/500mL Erlenmeyer flask) respectively with the reorganization bacterium, under 30 ℃, 200rpm, cultivate after 16 hours, insert fermention medium respectively with 10% (v/v) inoculum size.Fermentation flask 500mL liquid amount 50mL cultivated 72 hours under 30 ℃, 200rpm, measured the ethanol content in the fermented liquid.Alcohol concn high-efficient liquid phase color spectrometry: fermented liquid 8000g centrifugal ten minutes gets supernatant and filters the back as sample; Chromatographic column is the L2Spherogel of a Beckman company ligand exchange column, and moving phase is 98% the vitriol oil: H 2O (volume ratio is 0.5: 1000), flow velocity 1mL/min.
The result shows that the fermented liquid alcohol concn of wild bacterium is 14%, the alcohol concn of reorganization bacterium is 18%, improved 28%, the introducing of phbCAB gene, not only can change intracellular metabolism stream, and synthesizing of PHA can improve the tolerance of bacterium, thereby improved alcoholic acid output to high ethanol environment.
Sequence table
<160>1
<210>1
<211>3884
<212>DNA
<213>Wautersia?eutropha
<400>1
ataaagctta?aggaggatgg?cgaccggcaa?aggcgcggca?gcttccacgc?aggaaggcaa 60
gtcccaacca?ttcaaggtca?cgccggggcc?attcgatcca?gccacatggc?tggaatggtc 120
ccgccagtgg?cagggcactg?aaggcaacgg?ccacgcggcc?gcgtccggca?ttccgggcct 180
ggatgcgctg?gcaggcgtca?agatcgcgcc?ggcgcagctg?ggtgatatcc?agcagcgcta 240
catgaaggac?ttctcagcgc?tgtggcaggc?catggccgag?ggcaaggccg?aggccaccgg 300
tccgctgcac?gaccggcgct?tcgccggcga?cgcatggcgc?accaacctcc?catatcgctt 360
cgctgccgcg?ttctacctgc?tcaatgcgcg?cgccttgacc?gagctggccg?atgccgtcga 420
ggccgatgcc?aagacccgcc?agcgcatccg?cttcgcgatc?tcgcaatggg?tcgatgcgat 480
gtcgcccgcc?aacttccttg?ccaccaatcc?cgaggcgcag?cgcctgctga?tcgagtcggg 540
cggcgaatcg?ctgcgtgccg?gcgtgcgcaa?catgatggaa?gacctgacac?gcggcaagat 600
ctcgcagacc?gacgagagcg?cgtttgaggt?cggccgcaat?gtcgcggtga?ccgaaggcgc 660
cgtggtcttc?gagaacgagt?acttccagct?gttgcagtac?aagccgctga?ccgacaaggt 720
gcacgcgcgc?ccgctgctga?tggtgccgcc?gtgcatcaac?aagtactaca?tcctggacct 780
gcagccggag?agctcgctgg?tgcgccatgt?ggtggagcag?ggacatacgg?tgtttctggt 840
gtcgtggcgc?aatccggacg?ccagcatggc?cggcagcacc?tgggacgact?acatcgagca 900
cgcggccatc?cgcgccatcg?aagtcgcgcg?cgacatcagc?ggccaggaca?agatcaacgt 960
gctcggcttc?tgcgtgggcg?gcaccattgt?ctcgaccgcg?ctggcggtgc?tggccgcgcg 1020
cggcgagcac?ccggccgcca?gcgtcacgct?gctgaccacg?ctgctggact?ttgccgacac 1080
gggcatcctc?gacgtctttg?tcgacgaggg?ccatgtgcag?ttgcgcgagg?ccacgctggg 1140
cggcggcgcc?ggcgcgccgt?gcgcgctgct?gcgcggcctt?gagctggcca?ataccttctc 1200
gttcttgcgc?ccgaacgacc?tggtgtggaa?ctacgtggtc?gacaactacc?tgaagggcaa 1260
cacgccggtg?ccgttcgacc?tgctgttctg?gaacggcgac?gccaccaacc?tgccggggcc 1320
gtggtactgc?tggtacctgc?gccacaccta?cctgcagaac?gagctcaagg?taccgggcaa 1380
gctgaccgtg?tgcggcgtgc?cggtggacct?ggccagcatc?gacgtgccga?cctatatcta 1440
cggctcgcgc?gaagaccata?tcgtgccgtg?gaccgcggcc?tatgcctcga?ccgcgctgct 1500
ggcgaacaag?ctgcgcttcg?tgctgggtgc?gtcgggccat?atcgccggtg?tgatcaaccc 1560
gccggccaag?aacaagcgca?gccactggac?taacgatgcg?ctgccggagt?cgccgcagca 1620
atggctggcc?ggcgccatcg?agcatcacgg?cagctggtgg?ccggactgga?ccgcatggct 1680
ggccgggcag?gccggcgcga?aacgcgccgc?gcccgccaac?tatggcaatg?cgcgctatcg 1740
cgcaatcgaa?cccgcgcctg?ggcgatacgt?caaagccaag?gcatgacgct?tgcatgagtg 1800
ccggcgtgcg?tcatgcacgg?cgccggcagg?cctgcaggtt?ccctcccgtt?tccattgaaa 1860
ggactacaca?atgactgacg?ttgtcatcgt?atccgccgcc?cgcaccgcgg?tcggcaagtt 1920
tggcggctcg?ctggccaaga?tcccggcacc?ggaactgggt?gccgtggtca?tcaaggccgc 1980
gctggagcgc?gccggcgtca?agccggagca?ggtgagcgaa?gtcatcatgg?gccaggtgct 2040
gaccgccggt?tcgggccaga?accccgcacg?ccaggccgcg?atcaaggccg?gcctgccggc 2100
gatggtgccg?gccatgacca?tcaacaaggt?gtgcggctcg?ggcctgaagg?ccgtgatgct 2160
ggccgccaac?gcgatcatgg?cgggcgacgc?cgagatcgtg?gtggccggcg?gccaggaaaa 2220
catgagcgcc?gccccgcacg?tgctgccggg?ctcgcgcgat?ggtttccgca?tgggcgatgc 2280
caagctggtc?gacaccatga?tcgtcgacgg?cctgtgggac?gtgtacaacc?agtaccacat 2340
gggcatcacc?gccgagaacg?tggccaagga?atacggcatc?acacgcgagg?cgcaggatga 2400
gttcgccgtc?ggctcgcaga?acaaggccga?agccgcgcag?aaggccggca?agtttgacga 2460
agagatcgtc?ccggtgctga?tcccgcagcg?caagggcgac?ccggtggcct?tcaagaccga 2520
cgagttcgtg?cgccagggcg?ccacgctgga?cagcatgtcc?ggcctcaagc?ccgccttcga 2580
caaggccggc?acggtgaccg?cggccaacgc?ctcgggcctg?aacgacggcg?ccgccgcggt 2640
ggtggtgatg?tcggcggcca?aggccaagga?actgggcctg?accccgctgg?ccacgatcaa 2700
gagctatgcc?aacgccggtg?tcgatcccaa?ggtgatgggc?atgggcccgg?tgccggcctc 2760
caagcgcgcc?ctgtcgcgcg?ccgagtggac?cccgcaagac?ctggacctga?tggagatcaa 2820
cgaggccttt?gccgcgcagg?cgctggcggt?gcaccagcag?atgggctggg?acacctccaa 2880
ggtcaatgtg?aacggcggcg?ccatcgccat?cggccacccg?atcggcgcgt?cgggctgccg 2940
tatcctggtg?acgctgctgc?acgagatgaa?gcgccgtgac?gcgaagaagg?gcctggcctc 3000
gctgtgcatc?ggcggcggca?tgggcgtggc?gctggcagtc?gagcgcaaat?aaggaagggg 3060
ttttccgggg?ccgcgcgcgg?ttggcgcgga?cccggcgacg?ataacgaagc?caatcaagga 3120
gtggacatga?ctcagcgcat?tgcgtatgtg?accggcggca?tgggtggtat?cggaaccgcc 3180
atttgccagc?ggctggccaa?ggatggcttt?cgtgtggtgg?ccggttgcgg?ccccaactcg 3240
ccgcgccgcg?aaaagtggct?ggagcagcag?aaggccctgg?gcttcgattt?cattgcctcg 3300
gaaggcaatg?tggctgactg?ggactcgacc?aagaccgcat?tcgacaaggt?caagtccgag 3360
gtcggcgagg?ttgatgtgct?gatcaacaac?gccggtatca?cccgcgacgt?ggtgttccgc 3420
aagatgaccc?gcgccgactg?ggatgcggtg?atcgacacca?acctgacctc?gctgttcaac 3480
gtcaccaagc?aggtgatcga?cggcatggcc?gaccgtggct?ggggccgcat?cgtcaacatc 3540
tcgtcggtga?acgggcagaa?gggccagttc?ggccagacca?actactccac?cgccaaggcc 3600
ggcctgcatg?gcttcaccat?ggcactggcg?caggaagtgg?cgaccaaggg?cgtgaccgtc 3660
aacacggtct?ctccgggcta?tatcgccacc?gacatggtca?aggcgatccg?ccaggacgtg 3720
ctcgacaaga?tcgtcgcgac?gatcccggtc?aagcgcctgg?gcctgccgga?agagatcgcc 3780
tcgatctgcg?cctggttgtc?gtcggaggag?tccggtttct?cgaccggcgc?cgacttctcg 3840
ctcaacggcg?gcctgcatat?gggctgacct?gccggatcga?taac 3884

Claims (2)

1, a kind of method that improves reverse resistance of microorganisms is a synthesizing polyhydroxyalkanoateby in microorganism; Described polyhydroxyalkanoate synthetic is by the dependency basis of introducing the polyhydroxyalkanoate route of synthesis in described microorganism thereby realization;
Described microorganism is mobile pseudomonas (Zymomonas mobilis);
The genes involved of described polyhydroxyalkanoate route of synthesis is the phbCAB gene, and the base sequence of described phbCAB gene is shown in SEQ ID NO:1;
Described environment stress is coerced or osmotic pressure stress for low pH.
2, method according to claim 1 is characterized in that: described mobile pseudomonas is mobile pseudomonas NRRL B-4286.
CN2009101780940A 2005-04-26 2005-04-26 Method for enhancing reverse resistance of microorganisms Expired - Fee Related CN101665801B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2009101780940A CN101665801B (en) 2005-04-26 2005-04-26 Method for enhancing reverse resistance of microorganisms

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2009101780940A CN101665801B (en) 2005-04-26 2005-04-26 Method for enhancing reverse resistance of microorganisms

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN200510068113A Division CN100593571C (en) 2005-04-26 2005-04-26 Method of raising microbial stress tolerance

Publications (2)

Publication Number Publication Date
CN101665801A true CN101665801A (en) 2010-03-10
CN101665801B CN101665801B (en) 2011-09-14

Family

ID=41802577

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2009101780940A Expired - Fee Related CN101665801B (en) 2005-04-26 2005-04-26 Method for enhancing reverse resistance of microorganisms

Country Status (1)

Country Link
CN (1) CN101665801B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103320484A (en) * 2013-06-28 2013-09-25 四川柯森油田化学有限公司 Method for improving the fermentation yield of hyaluronic acid (HA)
CN105199977A (en) * 2014-06-25 2015-12-30 陆祖军 Culture medium for bacteria capable of resisting high temperature and generating polyhydroxybutyrate
CN108251330A (en) * 2017-12-28 2018-07-06 江苏世邦生物工程科技有限公司 Complex micro organism fungicide for administering soil pollution and its preparation method and application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1084349C (en) * 1998-06-19 2002-05-08 清华大学 Process for preparing poly-beta-hydroxy-butyrate

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103320484A (en) * 2013-06-28 2013-09-25 四川柯森油田化学有限公司 Method for improving the fermentation yield of hyaluronic acid (HA)
CN105199977A (en) * 2014-06-25 2015-12-30 陆祖军 Culture medium for bacteria capable of resisting high temperature and generating polyhydroxybutyrate
CN108251330A (en) * 2017-12-28 2018-07-06 江苏世邦生物工程科技有限公司 Complex micro organism fungicide for administering soil pollution and its preparation method and application

Also Published As

Publication number Publication date
CN101665801B (en) 2011-09-14

Similar Documents

Publication Publication Date Title
CN100593571C (en) Method of raising microbial stress tolerance
Colin et al. Effects of acetate and butyrate during glycerol fermentation by Clostridium butyricum
Himmi et al. Propionic acid fermentation of glycerol and glucose by Propionibacterium acidipropionici and Propionibacterium freudenreichii ssp. shermanii
Barbirato et al. Propionic acid fermentation from glycerol: comparison with conventional substrates
Anderson et al. Occurrence, metabolism, metabolic role, and industrial uses of bacterial polyhydroxyalkanoates
Quillaguaman et al. Poly (β‐hydroxybutyrate) production by a moderate halophile, Halomonas boliviensis LC1 using starch hydrolysate as substrate
Biebl Fermentation of glycerol by Clostridium pasteurianum—batch and continuous culture studies
US10428357B2 (en) Preparation of (R)-3-hydroxybutyric acid or its salts by one-step fermentation
US5000000A (en) Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes
EP0824148B1 (en) Polyester synthase gene and process for producing polyester
CN113583922B (en) Method for producing PHA (polyhydroxyalkanoate) by culturing halophilic bacteria in low-salt culture medium
CN102212501B (en) Recombinant escherichia coli and method for applying same to produce poly(3-hydroxybutyrate-3-hydroxyvalerate) (PHBV) by utilizing single carbon source
CN110857449B (en) Improved method for producing polyhydroxyalkanoate
EP0111683B1 (en) Improved strain of clostridium acetobutylicum and process for its preparation
EP0396289B1 (en) Copolymer production
US5229277A (en) Process for the production of dextran polymers of controlled molecular size and molecular size distributions
Chung et al. Effect of levulinic acid on the production of poly (3-hydroxybutyrate-co-3-hydroxyvalerate) by Ralstonia eutropha KHB-8862
Ashby et al. Poly (ethylene glycol)-mediated molar mass control of short-chain-and medium-chain-length poly (hydroxyalkanoates) from Pseudomonas oleovorans
CN113999869A (en) Promoter with expression intensity regulated by synthesis of bacterial intracellular Polyhydroxyalkanoate (PHA) and application thereof
De Wulf et al. Optimized synthesis of L‐sorbose by C5‐dehydrogenation of D‐sorbitol with Gluconobacter oxydans
CN101665801B (en) Method for enhancing reverse resistance of microorganisms
Malaoui et al. Influence of glucose on glycerol metabolism by wild-type and mutant strains of Clostridium butyricum E5 grown in chemostat culture
KR20140085917A (en) Method of produciton for 3-hydroxypropionic aicd by using glycerol and glucose
Trotsenko et al. Biosynthesis of poly (3-Hydroxybutyrate) and poly (3-hydroxybutyrate-co-3-hydroxyvalerate) and its regulation in bacteria
Biswas et al. Production of poly-3-hydroxyalkanoic acids by a moderately halophilic bacterium, Halomonas marina HMA 103 isolated from solar saltern of Orissa, India

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20110914

Termination date: 20160426