CN101653462B - Application of plant virus in preparing medicine for treating malignant tumours - Google Patents
Application of plant virus in preparing medicine for treating malignant tumours Download PDFInfo
- Publication number
- CN101653462B CN101653462B CN2009100633751A CN200910063375A CN101653462B CN 101653462 B CN101653462 B CN 101653462B CN 2009100633751 A CN2009100633751 A CN 2009100633751A CN 200910063375 A CN200910063375 A CN 200910063375A CN 101653462 B CN101653462 B CN 101653462B
- Authority
- CN
- China
- Prior art keywords
- virus
- cell
- transfection
- hela
- hela cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the field of biomedicine, in particular to an application of a plant virus in preparing a medicine for treating malignant tumours. The invention takes the research of the invasion of span biological world far-edge viruses as a starting point and takes the guide of a novel direction for treating tumours as a target, the plant virus (a tobacco mosaic virus) is successfully transfected into malignant tumour cells (Hela) for the first time and is reproduced in the tumour cells, and the tumour cells are induced to generate autophagy and apoptosis. The invention can be used as a novel means for malignant tumour gene therapy and creates a novel situation for treating the malignant tumours.
Description
Technical field
The present invention relates to biomedical sector, more particularly relate to the application of tobacco mosaic virus (TMV) in the medicine of preparation treatment malignant tumor.
Behind plant virus (tobacco mosaic virus (TMV)) the transfection malignant cell (Hela), not only in malignant cell, taken place to duplicate, and made tumor cell formation of vacuoles effect induce it that autophagy (programmed cell property II type apoptosis) and apoptosis have taken place.
Background technology
Medical report was delivered in U.S. virologist Louth in 1911; Proposing tumor first is virogenetic this theory; And Nobel's medical science and the physiology that obtain 1966 encourage; Germany scientist Chu Er Hao Sen is because of finding that (human papilloma virus HPV) causes cervical cancer and obtains Nobel physiology's prize in 2008 human papillomavirus, has proved this theory once more after more than halfth century.
At the beginning of last century, the doctor observes some patients that suffer from tumor surprised discovery tumor after experience a bout of illness poison infects clinically and has disappeared.This mystery always last century the '20s just be able to untie, and cause numerous scientists and clinician's attention, also risen the trial that utilizes the viral therapy tumor thus.To the middle of last century, the existing virus of kind more than 50 is used to human or animal's tumor treatment [Mullen JT, Tanabe KK.2002.Viral oncolysis.Oncologist.7 (2): 106-19; McCormick is gene therapy:fringe or cutting edge F.2001.Cancer? Nat Rev Cancer.1 (2): 130-41].1956; At the American National ICR; Mr. Smith leader's seminar [Smith et al. (1956) 9:1211-1218], the patient that the lysis supernatant that utilizes 10 kinds of wild human adenovirus to infect Hela cell or the generation of KB cell suffers from uterus tumor to 30 multidigits carries out in-situ injection and intravenously administrable treatment.All patients tumor lump after receive treatment dwindles and tumor cell cracking phenomenon occurs.
All the time; There is the mutual interference phenomenon between different genera in the biosphere; For example nineteen twenty-eight Britain's bacteriologist Alexandria Fu Laiming finds that penicillium can suppress aureus growth and invent penicillin; And therefore obtaining Nobel Prize in medicine in 1945, from then on the mankind come into the antibiotic epoch; Then nineteen forty-six U.S. scientist Sai Erman Waksman finds that streptomycete can suppress growth of bacillus tubercle, thereby makes streptomycin be widely used in antituberculosis therapy, and therefore obtains the nineteen fifty-two Nobel Prize in medicine.
It is human constantly to stride biosphere edge poisoning intrusion far away in recent years, derives from the wild animal bondar such as SARS virus; The HIV viral source is in the Zimbabwe orangutan.Along with the height variation of virus itself, can virus invade human body cell, not exclusively has been decided by having or not of specific receptor.In the biological evolution process; Whole biocenose is also striden the brand-new virus of biosphere or the original virus that morphs in reply constantly; The expansion of advanced biotechnology; Weakened original biosphere species barrier, multiple rotaring dyeing technology can be with albumen, nucleic acid, the direct transfered cell of large particulate matter; Human exploration activity is to depth all over the world, and the distance between people and different plant species of having furthered is striden the biosphere living matter and than whenever all take place more easily in the past intersected with warm.
The present invention is exactly to stride biosphere edge poisoning intrusion far away; Be that plant virus invasion human cell is starting point; New direction with guiding treatment tumor is a target, for exploring edge virus far away related science research has been done in the interference of human disease's virus, and invention is adopted not to be had specific receptor, do not have initiatively invasive plant virus (tobacco mosaic virus (TMV) the mankind; TMV; Hereinafter to be referred as T virus), and in whole world cell research, uses the earliest, most widely used human cell Hela cell line carries out correlational study as representative, by biological rotaring dyeing technology with the direct importing Hela cell of T virus.
Summary of the invention
The objective of the invention is to through exploring the interference between edge virus far away and human disease's virus; Plant virus (T virus) is imported in the malignant cell (Hela); Observation of plant virus is to the effect and the influence of tumor cell, and then the application of T virus in the medicine of preparation treatment malignant tumor is provided.
For reaching above-mentioned purpose, the present invention has taked following technical measures:
1) observes plant virus and can get into tumor cell effectively.
2) observing plant virus RNA expresses in tumor cell.
3) observing plant virus albumen expresses in tumor cell.
4) observing plant virus has taken place to duplicate in tumor cell.
5) observe plant virus synthetic complete progeny virion in tumor cell.
5) observe plant virus inducing tumor cell generation autophagy.
6) observe plant virus inducing tumor cell generation apoptosis.
Technical scheme provided by the invention is: the application of plant virus in the medicine of preparation treatment malignant tumor.
Said plant virus is a tobacco mosaic virus (TMV).
The malignant tumor of said malignant tumor for causing by viral infection.
Said malignant tumor is the cervical cancer that is caused by the human papillomavirus.
Said medicine is promoted the input of plant virus with carrier format, like liposomal pharmaceutical prepn etc.
The present invention successfully imports plant virus (T virus) in the malignant cell, and further virus protein has taken place to duplicate and express in tumor cell T virus, has finally induced tumor cell (Hela) that autophagy and apoptosis take place.
The present invention still belongs to initiative, and the plant virus of wild type (T virus) progeny virion has been taken place to duplicate and synthesized, further inducing tumor cell generation autophagy and apoptosis phenomenon by in transfection to the tumor cell (Hela) effectively in tumor cell.Can use it for tumor treatment to this characteristic of this plant virus, shown in specific embodiment result subsequently, T virus still is that protein level all has good tumor killing effect for tumor cell in nucleic acid level.This virus can prepare the application of the medicine that is used for treating tumor; Can be made into active component, administered by various routes includes but not limited in the tumor administration and local tumor intravascular administration or should virus be that a kind of liposomal pharmaceutical prepn directly imports performance killing tumor cells effect in the tumor cell through the liposome packing in oncotherapy.In addition, also can its form with liquid be made into injection, spray, dropping liquid etc., directly be used for treating malignant tumor.In addition, this virus also can be used for the means of associating other treatment malignant tumor such as non-operative treatment means such as X-ray therapy in chemical medicinal treatment, part or the tumor, and presses down the tumor means as a kind of assisting, or is used for the treatment of malignant tumor postoperative tumor bed.In addition, the plant virus exogenous gene that also portability is bigger gets into target organs like the gene of inhibition angiogenesis or the gene of ability immune stimulating activity, and has higher stability.Than some got into the carrier system of tumor cell in the past, plant virus also has the following advantages and effect: at first it is easy to preparation, and this virus can be cultivated in plant on a large scale; Secondly biological safety is high, compares animal virus, treats human malignancies with the plant virus of edge far away and has higher safety.
The present invention is applied to the treatment of malignant tumor, and the indication malignant tumor comprises carcinoma and pernicious non-epithelial tumor etc.
Carcinoma comprises cancer and adenocarcinoma; Comprising but be not limited to cervical cancer, breast carcinoma, nasopharyngeal carcinoma, pulmonary carcinoma, hepatocarcinoma etc.
Pernicious non-epithelial tumor includes but not limited to Kaposi sarcoma, leiomyosarcoma, osteosarcoma, malignant melanoma, lymphoma (Hodgkin lymphoma and non-Hodgkin lymphoma), hemangioma etc.
Description of drawings
Fig. 1 gropes the T viral RNA is transfected into the Hela cell through Lippofectamine2000 condition for the present invention;
Fig. 2 detects the positive strand RNA of T virus in the intracellular expression of Hela for RT-PCR of the present invention;
Fig. 3 detects the positive strand RNA relative quantity of T virus in the Hela cell for Real-Time PCR of the present invention;
Fig. 4 detects the expression of T virus CP in the Hela cell for Western blot of the present invention;
Fig. 5 detects the expression of CP in the Hela cell for immunofluorescence of the present invention;
Fig. 6 detects the intracellular situation of Hela of transfection T virus for transmission electron microscope of the present invention;
Fig. 7 is the intracellular autophagic vacuole of Hela of optical microscope of the present invention and scanning electron microscope observation transfection T virus;
Fig. 8 changes expression for the nucleic acid level that RT-PCR of the present invention detects the Hela cell autophagy gene beclin-1 of transfection T virus;
Fig. 9 changes expression for Hela cell autophagy gene beclin-1 protein level that Western blot of the present invention detects transfection T virus;
Figure 10 is the key factor of induced Hcla cell generation autophagy for RT-PCR of the present invention detects the T viral RNA;
Figure 11 detects the Hela apoptosis rate of transfection T virus for flow cytometer of the present invention.
The specific embodiment
Further set forth the present invention below in conjunction with specific embodiment:
Reagent source:
Lipofectamine2000 (liposome 2000 transfection reagents) is provided by Invitrogen company.
Reverse transcription test kit, TRIzol reagent, PCR test kit, real-time quantitative PCR test kit are provided by MBI company.
T viral capsid proteins (CP) polyclonal antibody, this chamber prepares rabbit anti-serum, affinitive layer purification.
The Beclin-1 monoclonal antibody is provided by crystalline substance U.S. Bioisystech Co., Ltd.
Pvdf membrane, DTT, Tween-20, DAB colour reagent box are provided by Ling Fei science and technology company limited.
AnnexinV/PI apoptosis kit is provided by MULTISCIENCES company.
Cell fixation agent: Wuhan University structure centre Electron Microscopy Room preparation.
Transmission electron microscope: Hitachi H-600 is provided by preclinical medicine institute of Wuhan University medical structure center.
One, extracts T virus
From fresh plant, directly extract T virus, concrete steps are following: 1) grind: fresh (or freezing) blade is put into mortar, adds liquid nitrogen and grinds rapidly, to green powder.2) filter: powder moves into measuring cup, and (PB pH7.2), adds 0.1% mercaptoethanol again, stirs 10min, and three layers of filtered through gauze are collected filtrating to add 3 times of volume 0.1M phosphate buffers.3) chloroform deposition: stir filtrating, slowly add 10% chloroform (V/V), mixing 30min leaves standstill 30min, and centrifugal (12000rpm 20min), carefully collects supernatant.4) salt/PEG deposition: stir supernatant, slowly add 4% (W/V) NaCl powder, slowly add 4% (w/v) PEG, 6000 powder after the dissolving again, stir 4-10h, leave standstill 10h, centrifugal (12000rpm, 20min), collecting precipitation.5) washing precipitation: add the 0.01M hydrochloride buffer in the deposition, 20-30ml stirs 4-10h, and to all dissolvings, centrifugal (12000rpm 20min), carefully collects supernatant.Deposition reprocessing 1 time.6) the sucrose pad is ultra leaves: careful 20% (W/V) sucrose 10ml that adds in supernatant bottom, centrifugal (40000rpm, 1-2h), collecting precipitation.7) collecting precipitation: add 0.01M PB in the deposition, 3-5ml, resuspended after, packing-20 ℃ preservation is subsequent use.
Two, set up the stable transfection system that T virus gets into tumor cell (Hela)
1) carry viral RNA: the total RNA of incidence of leaf extracts with reference to [Logemann J, Schell J, WillmitzerL.1987.Improved method for the isolation of RNA from plant tissues.AnalBiochem.15; 163 (1): 16-20] method is carried out.
2) grope transfection conditions: after extracting the T virus total RNA by above-mentioned steps, set up the rotaring redyeing system of T virus transfection malignant cell (Hela) earlier, grope the T viral RNA is transfected into the Hela cell through Lipofectamine2000 condition.The transfection step is carried out with reference to the Lipofectamine2000 description; With Lipofectamine2000 and T-RNA respectively with 1: 1,1: 2,1: 3 ratio transfection Hela cell; Get T viral RNA 8 μ g, 16 μ g, 24 μ g respectively, be dissolved in 500 μ l serum-free mediums respectively, obtain A liquid; Get Lipofectamine2000 10 μ l and add in the 500 μ l serum-free mediums, obtain B liquid.With A, B liquid difference mixing, incubated at room 20min.With serum-free medium the Hela cell is washed one time between incubation period, and added serum-free medium, with A, the B mixed liquor joins in the cell, and mixing is placed in 37 ℃ of incubators and hatched 4-6h gently.
3) detect through round pcr; Concrete steps are following: adopt the Trizol method cell total rna of three kinds of transfection ratios of extracting (1: 1,1: 2,1: 3) respectively, respectively with 5 ' TTAAGTTGCAGGACCAGAGG3 ' and 5 ' ATGTCTTATAGTATCACTACTCCATC3 ' and Oligo (dT)
18Be primer together; Press the synthetic cDNA of explanation of MBI company reverse transcription test kit; Reuse PCR test kit; With cDNA is template, respectively with the forward primer (5 ' TCGTGTTCTTGTCATCAGCGTGGG3 ') of T virus CP and reverse primer (5 ' the GCCACCGTTGCGTCGTCTACTCT3 ') target DNA that increases.Reaction system is: Template (reverse transcription product: promptly add T virus CP primer, Oligo (dT) respectively
18Carry out T virus cDNA and Actin cDNA that reverse transcription obtains) 4 μ l, 10 * Taq Buffer (NH
4SO
4) 5 μ l, 2.5mM dNTPmix 5 μ l, Forward primer (25 μ M) 2 μ l, Reverse primer (25 μ M) 2 μ l, Taq enzyme (5u/ μ l) 0.4 μ l, ddH
2O 31.6 μ l.Reaction condition is: 94 ℃ of preparatory degeneration 5min; 94 ℃ of 45sec, 53 ℃ of 45sec, 72 ℃ of 45sec, 35 circulations; Extend 5min in 72 ℃ at last.The PCR product detects through 1% sepharose electrophoresis and observes the purpose band, and internal reference Actin is 297bp.
4) experimental result is as shown in Figure 1, with RNA: LIP=1: under 1 the situation, can be to the Hela cell with the transfection of T viral RNA.This explanation, we successfully set up the rotaring redyeing system of T virus transfection malignant cell, as T-RNA: LIP=1: be best transfection conditions in the time of 1.
Three, detect the T virus transfection to the intracellular situation of duplicating of Hela
1.RT-PCR detect the expression of the positive strand RNA of Hela cell T viral capsid proteins (T-CP)
1) the Heal cell after the collection transfection T virus extracts its total RNA, carries out RT-PCR and detects.Concrete experimental procedure is following: experiment is divided into 2 groups, and wherein (normalcell NC) is normal control to the Hela cell of untransfected T viral RNA, the Hela cell of behind Lipofectamine2000 transfection T-RNA, collecting respectively at 24h, 48h, 72h.
Adopt Trizol method 2 groups of Hela cell total rnas of extracting cell respectively, respectively with 5 ' TTAAGTTGCAGGACCAGAGG3 ' and 5 ' ATGTCTTATAGTATCACTACTCCATC3 ' and Oligo (dT)
18Be primer together; Press the synthetic T virus of the explanation CPcDNA of MBI company reverse transcription test kit; Reuse PCR test kit; With cDNA is template, respectively with T virus CP forward primer (5 ' TCGTGTTCTTGTCATCAGCGTGGG3 ') and reverse primer (5 ' GCCACCGTTGCGTCGTCTACTCT3 ') and Actin forward primer (5 ' TCACCCACACTGTGCCCCATCTACGA3 ') and reverse primer (5 ' CAGCGGAACCGCTCATTGCCAATGG3 ') amplification target DNA.Reaction system is: Template (reverse transcription product: promptly add the forward and reverse primer of T viral capsid proteins gene, Oligo (dT) respectively
18Carry out the cDNA that reverse transcription obtains) 4 μ l, 10 * Taq Buffer (NH
4SO
4) 5 μ l, 2.5mM dNTP mix 5 μ l, Forward primer (25 μ M) 2 μ l, Reverse primer (25 μ M) 2 μ l, Taq enzyme (5u/ μ l) 0.4 μ l, ddH
2O 31.6 μ l.Reaction condition is: 94 ℃ of preparatory degeneration 5min; 94 ℃ of 45sec, 53 ℃ of 45sec, 72 ℃ of 45sec, 35 circulations; Extend 5min in 72 ℃ at last.Actin is an internal reference.The PCR product detects through 1% sepharose electrophoresis and observes the purpose band.
2) result is as shown in Figure 2, the band of the positive and negative chain RNA of high-visible T viral genome capsid protein CP in the 24h that collects respectively after the Lipofectamine2000 transfection, 48h, the 72hHela cell.Explain that thus the positive strand RNA of T virus CP continues to exist in the Hela cell to reach 72h, the T viral RNA, and has taken place to duplicate in the Hela cell through the successful transfection of Lipofectamine2000 to the Hela cell.
2.Real-Time PCR detects the positive strand RNA relative quantity of Hela cell T viral capsid proteins (T-CP)
1) the T viral RNA to the Hela cell, is collected Hela cell respectively at 6h, 24h, 48h, 72h, 96h through the Lipofectamine2000 transfection, detects the relative quantity of the positive strand RNA of Hela cell T virus CP through Real-Time PCR.
2) concrete experimental procedure is following: the Hela cell total rna that is extracted in collection of different periods (6h, 24h, 48h, 72h, 96h) with Trizol reagent; With T virus CP reverse primer (5 ' TTAAGTTGCAGGACCAGAGG3 ') is primer, presses the synthetic cDNA of explanation of MBI company reverse transcription test kit.Real-time quantitative PCR is a fluorescent labeling with SYBR Green I, and detects with ABI PRISM 7700 systems, and the fluorescence signal that produces in each PCR circulation is that real-time quantitative PCR provides information.Specific primer sequence is T virus CP forward primer (5 ' TCGTGTTCTTGTCATCAGCGTGGG3 ') and reverse primer (5 ' GCCACCGTTGCGTCGTCTACTCT3 '), Actin forward primer (5 ' TCACCCACACTGTGCCCCATCTACGA3 ') and reverse primer (5 ' CAGCGGAACCGCTCATTGCCAATGG3 ').Reaction system is: Template (reverse transcription product: promptly add the forward and reverse primer of T viral capsid proteins gene, Oligo (dT) respectively
18Carry out the cDNA that reverse transcription obtains) 4 μ l, 10 * Taq Buffer (NH
4SO
4) 5 μ l, MgCl
23 μ l, 2.5mM dNTP mix 5 μ l, Forward primer (25 μ M) 2 μ lReverse primer (25 μ M) 2 μ l, Taq enzyme (5u/ μ l) 2 μ l, ddH
2O 27 μ l.Reaction condition is: 94 ℃ of preparatory degeneration 5min; 94 ℃ of 45sec, 53 ℃ of 45sec, 72 ℃ of 45sec, 35 circulations; Extend 5min in 72 ℃ at last.Actin is an internal reference.
3) as shown in Figure 3; Left side figure is the interior T virus of a Hela cell CP positive chain RNA relative quantity after the transfection; 6h, 24h, 48h, 72h, 96h are respectively the Hela cells of collecting the corresponding time period, and the result is as shown in the figure, and the Hela cell of different time sections is all expressed T virus CP positive chain RNA; And with respect to section At All Other Times, the Hela cell of 48h is high expressed T virus CP positive chain RNA especially; Right figure is the interior T virus of a Hela cell CP strand RNA relative quantity after the transfection, and 6h, 24h, 48h, 72h, 96h are respectively the Hela cells that the time corresponding section is collected.The result is as shown in the figure, and along with the prolongation of time, T virus CP strand RNA relative quantity is expressed and increased gradually in the Hela cell of transfection T viral RNA, and the 96hHela cell peaks.This result has confirmed that from the quantitative nucleic acid level T virus successful transfection to the Hela cell has taken place to duplicate in malignant cell Hela cell, and As time goes on the positive strand RNA relative quantity of the interior T virus of Hela cell increases gradually.
3. detect the protein level variation of T viral capsid proteins (CP) in the Hela cell through Western blot
1) the T viral RNA through the Lipofectamine2000 transfection to the Hela cell; Protein content to its CP has been done respective detection; Concrete steps are following: A.SDS-PAGE: preparation 12%SDS-PAGE glue; With the last appearance of protein sample supernatant (sample that cracking Hela cell obtains) that protein dyes Marker in advance and handles well, electrophoresis; B. change film: the gel behind the electrophoresis is laid on electricity to be changeed on the filter paper that buffer soaked, and covers pvdf membrane on the glue, catches up with the bubble between most glue and the film, by being followed successively by to anodal order from the electrophoresis tank negative pole: filter paper-gel-pvdf membrane-filter paper; Connect power supply, 4 ℃, 200mA changes film 60min; C. sealing: add the PBST solution soaking pvdf membrane that contains 5% (W/V) defatted milk powder, 37 ℃, 1h; Outwell lock solution then, clean pvdf membrane, about 30min with PBST solution; D. one is anti-: add an anti-solution covering pvdf membrane of pressing the proper proportion dilution with the PBST solution of 5% (W/V) defatted milk powder, and 37 ℃, 1h; Outwell lock solution then, clean pvdf membrane, about 30min with PBST solution; E. two is anti-: add the two anti-solution covering pvdf membranes of pressing the proper proportion dilution with the PBST solution of 5% (W/V) defatted milk powder, and 37 ℃, 1h; Outwell lock solution then, clean pvdf membrane, about 30min with PBST solution; F. detect: add the reagent in the DAB colour reagent box, room temperature is placed 5min, puts into the dark place, treats film colour developing 5min, observes the development situation.
2) result is as shown in Figure 4, and N refers to the Hela cell without transfection, as normal control; A, b are respectively the Hela cell CP protein content of collecting in 24h, 48h after the transfection.Experimental result shows: do not express the CP gene in the normal Hela cell of untransfected T viral RNA, behind transfection T viral RNA 24h, the 48h, can detect the expression of CP in the Hela cell.Presentation of results T virus can be expressed T virus CP in the Hela cell.
4. utilize immunofluorescence to detect the expression of CP in the Hela cell
1) the T viral RNA to the Hela cell, with through the cellular immunofluorescence technology its CP being detected behind the cell culture 48h, is contrast with the normal Hela cell of untransfected T viral RNA through the Lipofectamine2000 transfection.
2) concrete steps are following: A. places 24 orifice plates with the sterility cover slide; B. trypsin digestion cell is inoculated and 24 orifice plates, and every hole 1ml seals the film capping and cultivates 24h for 37 ℃; C. wash plate 3 times with PBS, each 5min; D.4% fixing 30min under the formaldehyde room temperature; E.PBS washes 3 times, each 5min; F.0.2%Triton X-100 permeable membrane 4min; G PBS washes 3 times, each 5min; H. prepare 5%BSA with PBS, sealing 30min; I. one is anti-: the anti-people's antibody of rabbit, and 2.5mg/ml dilutes by 1: 25,1: 50,1: 100,1: 200 with 1%BSA respectively; Each concentration adds 3 holes, every hole 400 μ l, and last two holes add equivalent PBS; As negative control, Tissue Culture Plate is put into wet box, and 4 ℃ are spent the night; J. remove one and resist, PBS washes 3 times, each 5min; K. two is anti-: the anti-rabbit igg of FITC labelling by dilution in 1: 50,1: 100,1: 200, adds in anti-three holes anti-, two an anti-concentration such as following tables in every hole respectively; L.37 ℃, lucifuge is hatched 1h altogether; M. remove two under the lucifuge condition and resist, PBS washes 3 times; N. take out coverslip, place on the microscope slide, 50% glycerol mounting, fluorescence microscope is observed down;
Table 1: anti-/ two anti-concentration tables
3) detect discovery B3 the best through tiring, the anti-concentration of I-is 1: 50, and the anti-concentration of II-is 1: 200.As shown in Figure 5, A is the normal control of untransfected; B-D is the Hela cell of transfection T virus-4 8h; C is under the light microscopic; It is green that arrow is depicted as CP-FITC dyeing among B, the D, Bar 10 μ m; Experimental result shows that behind the transfection T viral RNA, CP has than strongly expressed in most of Hela cells, CP is positioned at specific site (figure-5B), and be not the whole cytoplasm of disperse; CP and autophagosome position closely related (figure-5D).Explain the T viral RNA can be in human Hela cell expressing protein, and closely related with autophagy.
5. detect the situation of duplicating of progeny virus plastochondria in the transfection T virus Hela cell through transmission electron microscope
1) the T viral RNA is collected the Hela cell through the Lipofectamine2000 transfection after 48h hour, with the situation of duplicating of progeny virus plastochondria in the Hela cell of transmission electron microscope observation 48h.Concrete steps are following: A.PBS washed cell 2 times; It is B. centrifugal that (1000rpm 5min), carefully abandons supernatant, and EP pipe floor cells deposition keeps; C.4 ℃ pre-cooling cell fixation agent (2.5% glutaraldehyde) 300 μ l slowly add along tube wall;
D. send medical college structure centre Electron Microscopy Room embedding film-making.
2) result is as shown in Figure 6, and A is that the normal Hela cell of untransfected compares; B-C is the progeny virion of after transfection T virus, finding in the Hela cell of 48h under the Electronic Speculum, shown in red arrow.Bar 500nm among the 6-B, Bar 200nm among the 6-C.The result more a step explanation T viral RNA success transfection to the Hela cell, at the Hela cell except that expressing T virus gene genome nucleic acid and albumen, and the further synthetic complete granule of progeny virus, confirmation T virus has taken place to duplicate in human Hela cell really.
More than 5 experimental results; All are proof T virus biological behaviours in malignant cell; Explain that plant virus T virus can get in the malignant cell in transfection; And the enzyme system, raw material and the energy that utilize human host cell (Hela) duplicate the nucleic acid of T virus, by the ribosome translation T viral capsid proteins (CP) of host cell, and have synthesized complete progeny virion.
Four, induce the autophagy situation of its generation behind detection T virus transfection to the Hela cell
1. through the autophagic vacuole in light microscopic and the scanning electron microscope observation Hela cell
1) the T viral RNA is behind Lipofectamine2000 transfection Hela cell, with the morphological change of light microscopic and scanning electron microscope film-making observation of cell autophagy.Concrete steps are following: A.PBS washed cell 2 times; It is B. centrifugal that (1000rpm 5min), carefully abandons supernatant, and EP pipe floor cells deposition keeps; C.4 ℃ pre-cooling cell fixation agent (2.5% glutaraldehyde) 300 μ l slowly add along tube wall; D. send medical college structure centre Electron Microscopy Room embedding film-making.
2) after Lipofectamine2000 is with T virus transfection RNA to Hela cell, collect the Hela cell of 72h and under light microscopic and Electronic Speculum, observe respectively, as shown in Figure 7, A, B are respectively the normal morphology of normal Hela cell under light microscopic and Electronic Speculum; C is the Hela cell behind the transfection T virus 72h under the light microscopic, the autophagy cavity for occurring in the cell cytosol shown in the arrow, Bar 10 μ m; D is the autophagic vacuole structure that occurs in the Hela cell of transfection T virus under the Electronic Speculum, Bar 20nm, and right figure is a partial enlarged drawing; The result shows that with respect to normal cell behind the transfection T virus 72h, typical autophagy phenomenon appears in the Hela cell.(Fig. 7-C), Electronic Speculum shows that cavity is a duplicature to a large amount of cavity spline structures of cytoplasm region visible under the light microscopic, and the bubble intracavity exists film appearance or wadding appearance material (Fig. 7-D), infer to be born of the same parents' intracellular metabolite, degraded composition.Explanation can induce human Hela cell that autophagy phenomenon has clearly taken place through the T of liposome virus, and this is a kind of inducing cell II type apoptosis of approach deathward.
2. detect the expression of autophagy gene beclin-1 in the Hela cell through RT-PCR
1) when the T virus transfection to the Hela cell, observe the situation of change of its autophagy effect through the nucleic acid level that detects autophagy gene beclin-1 in the cell.
2) concrete steps are following: collect the Hela cell of different time points after the transfection (0,6h, 24h, 48h, 72h) respectively, with Trizol reagent extracting cell total rna.After obtaining the Hela cell total rna, with Oligo (dT)
18Primer during for reverse transcription; Press the synthetic cDNA of explanation of reverse transcription test kit; Reuse PCR test kit; With cDNA is template, respectively with gene beclin-1 forward primer (5 ' ATACCGACTTGTTCCTTAC3 ') and reverse primer (5 ' GTCTTCAATCTTGCCTTT3 '), and Gene A ctin forward primer (5 ' TCACCCACACTGTGCCCCATCTACGA3 ') and reverse primer (5 ' CAGCGGAACCGCTCATTGCCAATGG3 ') amplification target DNA.Reaction system is: Template (reverse transcription product: promptly add Oligo (dT)
18Carry out the cDNA that reverse transcription obtains) 4 μ l, 10 * Taq Buffer (NH
4SO
4) 5 μ l, MgCl
23 μ l, 2.5mM dNTP mix 5 μ l, Forward primer (25 μ M) 2 μ l Reverse primer (25 μ M) 2 μ l, Taq enzyme (5u/ μ l) 2 μ l, ddH
2O 27 μ l.Reaction condition is: 94 ℃ of preparatory degeneration 5min; 94 ℃ of 45sec, 51 ℃ of 45sec, 72 ℃ of 45sec, 35 circulations; Extend 5min in 72 ℃ at last.The PCR product detects through 1% sepharose electrophoresis.
3) as shown in Figure 8, corresponding band is respectively the result of the RT-PCR of the Hela cytogene Beclin-1 that 0h after the transfection, 24h, 48h, 72h collect; SF (Serum free) is the hungry Induces Autophagy of cultivating when being serum-free, as positive control; Actin is the RT-PCR result of internal control gene Actin; M is Marker; The result shows that the autophagy marker molecule is expressed significantly in the Hela cell increases, and 6h can detect the Bclin-1mRNA that significantly increases behind T viral RNA transfection to the cell, and high level expression lasts till 72h.The high expressed of autophagy gene beclin-1 can suppress the propagation of malignant cell (Hela), and induces its apoptosis.
3. detect the protein level variation of Hela cell autophagy gene through Western blot
1) the T viral RNA through the Lipofectamine2000 transfection to the Hela cell; Collect the Hela cell of different time points (0,6h, 24h, 72h) respectively and the protein content of its Beclin-1 has been done respective detection; Concrete steps are following: A.SDS-PAGE: preparation 12%SDS-PAGE glue; With the last appearance of protein sample supernatant (sample that cracking Hela cell obtains) that protein dyes Marker in advance and handles well, electrophoresis; B. change film: the gel behind the electrophoresis is laid on electricity to be changeed on the filter paper that buffer soaked, and covers pvdf membrane on the glue, catches up with the bubble between most glue and the film, by being followed successively by to anodal order from the electrophoresis tank negative pole: filter paper-gel-pvdf membrane-filter paper; Connect power supply, 4 ℃, 200mA changes film 60min; C. sealing: add the PBST solution soaking pvdf membrane that contains 5% (W/V) defatted milk powder, 37 ℃, 1h; Outwell lock solution then, clean pvdf membrane, about 30min with PBST solution; D. one is anti-: add an anti-solution covering pvdf membrane of pressing the proper proportion dilution with the PBST solution of 5% (W/V) defatted milk powder, and 37 ℃, 1h; Outwell lock solution then, clean pvdf membrane, about 30min with PBST solution; E. two is anti-: add the two anti-solution covering pvdf membranes of pressing the proper proportion dilution with the PBST solution of 5% (W/V) defatted milk powder, and 37 ℃, 1h; Outwell lock solution then, clean pvdf membrane, about 30min with PBST solution; F. detect: add the reagent in the DAB colour reagent box, room temperature is placed 5min, puts into the dark place, treats film colour developing 5min, observes the development situation.
2) as shown in Figure 9, corresponding band is respectively the protein content of autophagy gene beclin-1 in the Hela cell that 0h after the transfection, 24h, 48h, 72h collect; SF (Serum free) is the hungry Induces Autophagy of cultivating when being serum-free, as positive control; Actin is internal control gene Actin; M is Marker; Experimental result shows: the Hela cell autophagy gene beclin-1 protein content high expressed of transfection T viral RNA, and continued 72h.
Five, detect the central factor of induced Hcla cell autophagy through RT-PCR
1) utilize RT-RCR to detect Beclin-1-mRNA in each processed group Hela cell; Collect at first respectively the Hela cell singly add the T viral RNA (RNA, (lipofectine2000 is L) and through the Hela cell (RNA+lipofectine2000 of Lipofectamine2000 transfection T viral RNA R), singly to add the Hela cell of Lipofectamine2000; RL), the Hela cell of no any processing; And extract its total RNA, and to carry out PCR and detect, the concrete operations step sees four-2.
2) shown in figure 10, M is marker; SF (Serum free) is the hungry Induces Autophagy of cultivating when being serum-free, as positive control; Blank is a non-processor Hela cell; Lip is liposome transfection (RL, RNA+Lip; R, RNA; L, Lip); The result shows liposome-treated groups of cells (L), does not have obvious Beclin-1 to express, and prompting can not be brought out autophagy; The extracellular exposes T viral RNA (R), UV treatment inactivation virus does not have obvious Beclin-1 to express yet, and prompting can not Induces Autophagy.Groups of cells, the activated complete T virion groups of cells (RL) of having only transfection T viral RNA can significantly induce Beclin-1 to express, and the central factor that autophagy appears in prompting induced Hcla cell is the nucleic acid of virus.
Six, induce it that situation of apoptosis takes place behind detection T virus transfection to the Hela cell
1) the T viral RNA, is collected respectively and is carried out AnnexinV/PI dyeing behind the Hela cell of different time points (24h, 48h) and utilize flow cytometer to detect apoptosis rate to the Hela cell through the Lipofectamine2000 transfection.According to AnnexinV/PI staining kit description, operating procedure is following: the about 1-5 of A. collecting cell * 10
5Individual/ml, centrifugal (500-1000rpm 5min), abandons culture fluid; B.3ml the PBS washing is 2 times; C. prepare 1 * annexin-binding buffer (with four times of 5 * annexin-binding buffer dilutions in the test kit); It is D. centrifugal that (500-1000rpm 5min), removes PBS, adds 1 * annexin-binding buffer that 500 μ l prepare, re-suspended cell; E. add 5 μ l AnnexinV-FITC and 10 μ l PI dye liquors, incubated at room 5min; F. flow cytometer detects.
2) shown in figure 11, A is the normal control group; B for the Hela cell that singly adds Lipofectamine2000 (lipofectine2000, L); C-D is respectively the Hela cell of 24h, 48h behind Lipofectamine2000 transfection T viral RNA.Result's demonstration, with the prolongation of transfection time, but T virus induced Hcla cell generation obvious apoptosis.
Above experimental result detects through the transfection of the T of liposome viral RNA to malignant cell (Hela) from nucleic acid, protein level respectively; In the Hela cell, duplicate and assemble synthetic progeny virion; Further high expressed autophagy gene beclin-1 in tumor cell; Inducing tumor cell generation autophagy finally causes tumor cell generation apoptosis, has suppressed the malignant proliferation of tumor cell.Utilize this characteristic, the T virus packets is dressed up liposomal pharmaceutical prepn be transported in the solid tumor finally inducing tumor cell generation autophagy and apoptosis, performance suppresses the effect of growth of tumour cell, stops the pernicious process of tumor.
Claims (5)
1. the application of plant virus in the medicine of preparation treatment malignant tumor; Said plant virus is a tobacco mosaic virus (TMV).
2. application according to claim 1 is characterized in that: the malignant tumor of said malignant tumor for being caused by viral infection.
3. application according to claim 2 is characterized in that: the cervical cancer of said malignant tumor for being caused by the human papillomavirus.
4. application according to claim 1 and 2 is characterized in that: said medicine is promoted the input of plant virus with carrier format.
5. application according to claim 4 is characterized in that: said medicine is a liposomal pharmaceutical prepn.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100633751A CN101653462B (en) | 2009-07-28 | 2009-07-28 | Application of plant virus in preparing medicine for treating malignant tumours |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100633751A CN101653462B (en) | 2009-07-28 | 2009-07-28 | Application of plant virus in preparing medicine for treating malignant tumours |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101653462A CN101653462A (en) | 2010-02-24 |
CN101653462B true CN101653462B (en) | 2012-05-09 |
Family
ID=41708062
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100633751A Expired - Fee Related CN101653462B (en) | 2009-07-28 | 2009-07-28 | Application of plant virus in preparing medicine for treating malignant tumours |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101653462B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105176934B (en) * | 2015-10-16 | 2018-09-18 | 西南大学柑桔研究所 | The long-term in-vitro conservation method of Citrus Yellowing vein clearing virus |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101104846A (en) * | 2006-05-26 | 2008-01-16 | 上海大学 | Physical deactivation method for recombined plant virus |
-
2009
- 2009-07-28 CN CN2009100633751A patent/CN101653462B/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101104846A (en) * | 2006-05-26 | 2008-01-16 | 上海大学 | Physical deactivation method for recombined plant virus |
Also Published As
Publication number | Publication date |
---|---|
CN101653462A (en) | 2010-02-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Churchill et al. | Agent of Marek's disease in tissue culture | |
CN104099301A (en) | Coxsackie virus A16 virus strain, uses of strain, vaccine and preparation method of vaccine | |
CN106367393B (en) | Prostate Carcinoma of Mice circulating tumor cell system and the separation of prostate cancer circulating tumor cell and cultural method | |
CN109893541A (en) | Application of the excretion body of menses source of human stem cell in the drug of preparation treatment Asherman's syndrom | |
CN107715117A (en) | The medicine-carried system and pharmaceutical applications of a kind of tetrahedral structure | |
CN101653462B (en) | Application of plant virus in preparing medicine for treating malignant tumours | |
CN107281172A (en) | Application of the melbine in the medicine for preparing cervical carcinoma | |
CN107708727A (en) | It is a kind of to be used to treat tumor vaccine of liver cancer and preparation method thereof | |
CN110024623A (en) | L-PROLINE is improving the application in aweto blastopore quantity and hypha biomass | |
CN102680272B (en) | Extraction, purification and identification method for sea urchin polysaccharides | |
CN107708728A (en) | It is a kind of to be used to treat tumor vaccine of stomach cancer and preparation method thereof | |
CN101732709B (en) | Method for preparing haemorrhagic fever vaccine by culturing primary cells in multilayer culture flask | |
Sharma et al. | Etiologic relationship of skin tumors (skin leukosis) of chickens to Marek's disease | |
CN104726408A (en) | Fast extracting method of vascular endothelial cell | |
CN105147722A (en) | Novel application of sulfated bletilla striata polysaccharide and preparation for treating ocular surface damage | |
CN101235364B (en) | Newcastle disease virus D90 strain and application thereof | |
CN101955914B (en) | Human hepatocellular carcinoma cell line with portal vein transfer potential | |
CN105936888A (en) | Isolation culture and identification method of human tonsil epithelial cells | |
CN107119125A (en) | The application of lncRNA D63785 and its chaff interference and apply its product | |
CN103961357A (en) | Application of 12-acetoxycoccinic acid to preparation of drug for preventing and controlling HCV (hepatitis C virus) | |
CN109234242A (en) | A kind of virus-like particle and its preparation method and application comprising CASP8 apoptotic proteins | |
CN108103023A (en) | People's carcinoma of the rectum primary cell and its application | |
CN108546675A (en) | Stem cell is promoted to be divided into the preparation method of the extracellular matrix of liver cell | |
CN101496815B (en) | Medicament for treating hepatic failure and preparation method thereof | |
CN107456471B (en) | Application of pomegranate bark in preparation of medicine for promoting migration of mesenchymal stem cells, medicine and preparation method of medicine |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
C17 | Cessation of patent right | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120509 Termination date: 20120728 |