CN101643737A - Chemically synthesized HSV1 virus gD glycoprotein extracellular region gene fragment and expression and application thereof - Google Patents
Chemically synthesized HSV1 virus gD glycoprotein extracellular region gene fragment and expression and application thereof Download PDFInfo
- Publication number
- CN101643737A CN101643737A CN200910184631A CN200910184631A CN101643737A CN 101643737 A CN101643737 A CN 101643737A CN 200910184631 A CN200910184631 A CN 200910184631A CN 200910184631 A CN200910184631 A CN 200910184631A CN 101643737 A CN101643737 A CN 101643737A
- Authority
- CN
- China
- Prior art keywords
- pro
- cct
- ctg
- leu
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a chemically synthesized HSV1 virus gD glycoprotein extracellular region gene fragment and expression and an application thereof, and relates to the fields of genetic engineering technology, vaccine and diagnostic reagent. By computer analysis, the invention screens out the HSV1 virus gD glycoprotein extracellular region fragment containing strong antigen epitope, totally 284 amino acids, namely from the 1st to the 284th; codons which are preferred by both eukaryon and pronucleus organism are selected; and a brand new gene sequence of the antigen epitope is chemically synthesized; the genetic engineering technology is utilized to express the gene fragment and prepare the strong antigen epitope fragment and antiserum of the HSV1 virus gD glycoprotein. The expressed HSV1 virus gD glycoprotein can be applicable to the detection of vaccine, HSV1 virus antibody or antigen and immune preparation of HSV1 virus monoclonal antibody and polyclonal antibody and the like.
Description
Technical field
The present invention is the brand-new gene fragment of the HSV1 virus gD glycoprotein extracellular region of chemosynthesis, utilizes genetic engineering technique, preparation reorganization HSV1 virus gD glycoprotein.By Computer Analysis, filter out the gD glucoprotein extracellular region fragment of the HSV1 virus that contains the strong antigen epi-position, the codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new, utilize genetic engineering technique to express, expressed proteins can be used for vaccine and HSV1 antiviral antibody or detection of antigens etc., the present invention relates to genetic engineering technique, vaccine and diagnostic reagent field.
Background technology
(Herpes simplex virus HSV) is the nerpes vinrus hominis who finds the earliest to hsv, causes recurrent infection and latent infection easily, and is serious to human body harm, is divided into two serotypes of HSV-1 and HSV-2.Herpes simplex types 1 virus mainly causes the infection of actinal surface portion, ocular infection and herpes simplex encephalitis etc.; And 2 types mainly cause genital infection, and closely related with the generation of women's cervical cancer.In recent years the infection of HSV1 significantly increases, and accounts for 10%～40% of this disease.Pharmacological agent HSV infects and occurs corresponding resistance often at present, is practicable effective ways so develop vaccine, and it can make body in anti-HSV infection immunity, and performance humoral immunization and cellular immune function are eliminated HSV and infected.So far developed multiple HSV vaccine; existing two kinds of HSV glucoprotein vaccines enter the III clinical trial phase; it is the vaccine that the reorganization gD2 glycoprotein developed of the vaccine that forms of reorganization gD2/gB2 glycoprotein and the MF59 adjuvant compatibility of Chiron company development and Glaxo Smith Kline (GSK) company and another adjuvant (3-de-O-acidylate monophosphoryl lipid A and alum) compatibility form; these two kinds of vaccines all have the certain protection effect, but clinical effectiveness is limited.Domestic at present to the research of HSV vaccine, mainly concentrate on the exploratory development aspect of DNA nucleic acid vaccine.
Think that at present the HSV genome has 34 genes, 70 multiple proteins of encoding, wherein the definite designation of after birth glycoprotein has 12 kinds, and they are with form different effect of performance in the infection of HSV replication cycle and virus is caused a disease of uniqueness or complex body.Wherein gD is the main component of viral after birth by the US6 genes encoding of HSV, combines significantly with cytotostatic for virus, promotes viral after birth and intercellular dissolving, the intercellular diffusion of mediation virus, release.Simultaneously gD albumen also be one of main target of host cell immunity and humoral immune reaction, so HSV1gD glycoprotein is structure HSV gene vaccine ideal goal gene the duplicating and stimulate in the generation of neutralizing antibody and play an important role of virus.
HSV1 virus gD glycoprotein full length gene 1185bp, the extracellular region of 312 aminoacid sequences of coding, the intracellular region of striding film district, 28 aminoacid sequences of 54 aminoacid sequences.Studies show that,, can remove its partial function encoding sequence, the host is had under the situation of toxicity or immunosuppressive action at complete antigen protein especially, antigen protein is carried out shorten expression just be even more important for strengthening the proteic immunogenicity of coding for antigens.And the gene constructed vaccine of the gD after the brachymemma, with virus attack has identical provide protection to HSV1 with the gene constructed vaccine of complete gD.So this research is by Computer Analysis, we filter out the gD glucoprotein extracellular region fragment of the HSV1 virus that contains the strong antigen epi-position, the codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new, utilize genetic engineering technique to express, expression product has antigenicity and immunogenicity preferably, and expressed proteins can be used for vaccine and HSV1 antiviral antibody or detection of antigens and is used for the anti-HSV1 virus monoclonal antibody of immunity preparation and how anti-etc.
Summary of the invention
The present invention is the brand-new gene fragment of the HSV1 virus gD glycoprotein extracellular region of chemosynthesis, utilizes genetic engineering technique, preparation reorganization HSV1 virus gD glycoprotein extracellular region fragment.By Computer Analysis, filter out the HSV1 virus gD glycoprotein extracellular region fragment that contains the strong antigen epi-position, 284 amino acid of the 1st amino acid to the, totally 284 amino acid, the codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new utilizes genetic engineering technique to express this gene.Expressed proteins can be used for vaccine, HSV1 antiviral antibody or detection of antigens and is used for the anti-HSV1 virus monoclonal antibody of immunity preparation and how anti-etc.
The HSV1 virus gD glycoprotein extracellular region gene fragment of chemosynthesis and expression thereof, application take following steps to implement:
1.HSV1 the screening of virus gD glycoprotein extracellular region epitope and the chemosynthesis of gene fragment thereof:
Utilize softwares such as ANTHEWIN,, find that the N end (the 1st amino acid to the 284 amino acid) of gD glycoprotein contains stronger antigenic determinant by the aminoacid sequence of Computer Analysis HSV1 virus gD glycoprotein.The codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new, and increased Hind III restriction enzyme site (following setting-out part) at 5 ' end, transcription regulating nucleotide sequence (GCCGCCACC), initiator codon (ATG), human IgG κ light chain signal peptide (wavy line part), 8 * His label and TEV proteolytic enzyme restriction enzyme site (gaaaacctgtacttccagggt), terminator codon (TAA) and BamH I restriction enzyme site (following setting-out part) have been increased at 3 ' end, make this gene fragment be easy to be cloned in plasmid pCEP4 interior the Hind III and BamH I restriction enzyme site, and make gD albumen be easier to express and purifying.
Epitope aminoacid sequence (284 amino acid of the 1st amino acid to the) in the HSV1 virus gD glycoprotein of screening:
Lys?Tyr?Ala?Leu?Ala?Asp?Ala?Ser?Leu?Lys?Met?Ala?Asp?Pro?Asn?Arg?Phe?Arg?Gly?Lys?Asp
Leu?Pro?Val?Leu?Asp?Pro?Leu?Thr?Asp?Pro?Pro?Gly?Val?Arg?Arg?Val?Tyr?His?Ile?Gln?Ala
Gly?Leu?Pro?Asp?Pro?Phe?Gln?Pro?Pro?Ser?Leu?Pro?Ile?Thr?Val?Tyr?Tyr?Ala?Val?Leu?Glu
Arg?Ala?Cys?Arg?Ser?Val?Leu?Leu?Asn?Ala?Pro?Ser?Glu?Ala?Pro?Gln?Ile?Val?Arg?Gly?Ala
Ser?Glu?Asp?Val?Arg?Lys?Gln?Pro?Tyr?Asn?Leu?Thr?Ile?Ala?Trp?Phe?Arg?Met?Gly?Gly?Asn
Cys?Ala?Ile?Pro?Ile?Thr?Val?Met?Glu?Tyr?Thr?Glu?Cys?Ser?Tyr?Asn?Lys?Ser?Leu?Gly?Ala
Cys?Pro?Ile?Arg?Thr?Gln?Pro?Arg?Trp?Asn?Tyr?Tyr?Asp?Ser?Phe?Ser?Ala?Val?Ser?Glu?Asp
Asn?Leu?Gly?Phe?Leu?Met?His?Ala?Pro?Ala?Phe?Glu?Thr?Ala?Gly?Thr?Tyr?Leu?Arg?Leu?Val
Lys?Ile?Asn?Asp?Trp?Thr?Glu?Ile?Thr?Gln?Phe?Ile?Leu?Glu?His?Arg?Ala?Lys?Gly?Ser?Cys
Lys?Tyr?Ala?Leu?Pro?Leu?Arg?Ile?Pro?Pro?Ser?Ala?Cys?Leu?Ser?Pro?Gln?Ala?Tyr?Gln?Gln
Gly?Val?Thr?Val?Asp?Ser?Ile?Gly?Met?Leu?Pro?Arg?Phe?Ile?Pro?Glu?Asn?Gln?Arg?Thr?Val
Ala?Val?Tyr?Ser?Leu?Lys?Ile?Ala?Gly?Trp?His?Gly?Pro?Lys?Ala?Pro?Tyr?Thr?Ser?Thr?Leu
Leu?Pro?Pro?Glu?Leu?Ser?Glu?Thr?Pro?Asn?Ala?Thr?Gln?Pro?Glu?Leu?Ala?Pro?Glu?Asp?Pro
Glu?Asp?Ser?Ala?Leu?Leu?Glu?Asp?Pro?Val?Gly
The dna sequence dna that contains HSV1 virus gD glycoprotein extracellular region antigen epitope genes (981bp) of chemosynthesis:
AAGCTT?GCC?GCC?ACC?ATG
GCT?CTG?GCC?GAT?GCT?AGC?CTG?AAG?ATG?GCT?GAT?CCT?AAC?CGC?TTC?AGA?GGT?AAG?GAC?CTG?CCT
GTG?CTG?GAC?CAG?CTG?ACC?GAC?CCT?CCT?GGC?GTG?CGC?AGA?GTG?TAC?CAC?ATT?CAG?GCT?GGT?CTG
CCT?GAC?CCT?TTC?CAG?CCT?CCT?AGC?CTG?CCT?ATC?ACC?GTG?TAC?TAC?GCC?GTG?CTG?GAG?AGA?GCC
TGT?CGC?AGC?GTG?CTG?CTG?AAC?GCT?CCT?AGC?GAG?GCT?CCT?CAG?ATC?GTG?AGA?GGT?GCT?AGC?GAA
GAC?GTG?AGG?AAG?CAG?CCT?TAC?AAC?CTG?ACC?ATC?GCC?TGG?TTC?AGG?ATG?GGT?GGT?AAC?TGT?GCT
ATC?CCT?ATC?ACC?GTG?ATG?GAG?TAC?ACC?GAG?TGT?TCT?TAC?AAC?AAG?AGC?CTG?GGC?GCT?TGT?CCT
ATC?CGC?ACC?CAG?CCT?AGG?TGG?AAC?TAC?TAC?GAC?AGC?TTC?AGC?GCT?GTG?AGC?GAG?GAC?AAC?CTG
GGC?TTC?CTG?ATG?CAC?GCT?CCT?GCC?TTC?GAG?ACC?GCT?GGC?ACC?TAC?CTG?AGG?CTG?GTG?AAG?ATC
AAC?GAC?TGG?ACC?GAG?ATC?ACC?CAG?TTC?ATC?CTG?GAG?CAC?AGA?GCC?AAG?GGT?AGC?TGT?AAG?TAC
GCT?CTG?CCT?CTG?AGA?ATC?CCT?CCT?AGC?GCT?TGT?CTG?AGC?CCT?CAG?GCC?TAC?CAG?CAA?GGC?GTG
ACC?GTG?GAC?AGC?ATC?GGT?ATG?CTG?CCT?CGC?TTC?ATC?CCT?GAG?AAC?CAG?AGG?ACC?GTG?GCT?GTG
TAC?AGC?CTG?AAG?ATC?GCT?GGC?TGG?CAC?GGT?CCT?AAG?GCT?CCT?TAC?ACC?AGC?ACT?CTG?CTG?CCT
CCT?GAG?CTG?AGC?GAG?ACC?CCT?AAC?GCC?ACT?CAG?CCT?GAG?CTG?GCT?CCT?GAG?GAC?CCT?GAG?GAC
AGC?GCT?CTG?CTG?GAG?GAC?CCT?GTG?GGT?TAA?
GGATCC
2. express HSV1 virus gD glycoprotein extracellular region fragment construction of recombinant plasmid:
Extract plasmid pCEP4,, reclaim the big fragment of plasmid that enzyme is cut behind the electrophoresis, be dissolved in the deionized water with Hind III and BamH I double digestion.Same HSV1 virus gD glycoprotein gene fragment with Hind III and the chemosynthesis of BamH I double digestion, electrophoresis is dissolved in the deionized water after reclaiming.
Above-mentioned two kinds of enzymes of volumetric molar concentration such as get and cut the back dna fragmentation, in same centrifuge tube, connect with the T4 dna ligase, HSV1 virus gD glycoprotein gene fragment is inserted between eucaryon plasmid pCEP4 interior the Hind III and BamH I site, constitutes recombinant eukaryon expression vector pCEP4-gD1.
3. the screening of recombinant plasmid and evaluation:
With the recombinant plasmid transformed bacillus coli DH 5 alpha, coating contains penbritin (100ug/ml) LB flat board, puts 37 ℃ and spends the night.Next day, picking transformed bacterium colony and 1 contrast bacterium (plasmid pCEP4 transformed bacteria) at random, extract plasmid respectively, plasmid with extraction is a template, pcr amplification HSV1 virus gD glycoprotein extracellular region gene fragment, contain the positive recombinant plasmid of HSV1 virus gD glycoprotein extracellular region gene fragment, should amplify the gene fragment that is about 981bp.The plasmid that will contain foreign gene carries out dna sequence analysis, and sequential analysis confirms that recombinant plasmid contains synthetic HSV1 virus gD glycoprotein gene fragment, and sequence is entirely true:
AAGCTT?GCC?GCC?ACC?ATG?GAA?ACC?CCA?GCG?CAG?CTT?CTC?TTC?CTC?CTG?CTA?CTC?TGG?CTC?CCA
GAT?ACC?ACC?GGA?CAT?CAT?CAC?CAT?CAC?CAT?CAC?CAT?GAA?AAC?CTG?TAC?TTC?CAG?GGT?AAG?TAC
GCT?CTG?GCC?GAT?GCT?AGC?CTG?AAG?ATG?GCT?GAT?CCT?AAC?CGC?TTC?AGA?GGT?AAG?GAC?CTG?CCT
GTG?CTG?GAC?CAG?CTG?ACC?GAC?CCT?CCT?GGC?GTG?CGC?AGA?GTG?TAC?CAC?ATT?CAG?GCT?GGT?CTG
CCT?GAC?CCT?TTC?CAG?CCT?CCT?AGC?CTG?CCT?ATC?ACC?GTG?TAC?TAC?GCC?GTG?CTG?GAG?AGA?GCC
TGT?CGC?AGC?GTG?CTG?CTG?AAC?GCT?CCT?AGC?GAG?GCT?CCT?CAG?ATC?GTG?AGA?GGT?GCT?AGC?GAA
GAC?GTG?AGG?AAG?CAG?CCT?TAC?AAC?CTG?ACC?ATC?GCC?TGG?TTC?AGG?ATG?GGT?GGT?AAC?TGT?GCT
ATC?CCT?ATC?ACC?GTG?ATG?GAG?TAC?ACC?GAG?TGT?TCT?TAC?AAC?AAG?AGC?CTG?GGC?GCT?TGT?CCT
ATC?CGC?ACC?CAG?CCT?AGG?TGG?AAC?TAC?TAC?GAC?AGC?TTC?AGC?GCT?GTG?AGC?GAG?GAC?AAC?CTG
GGC?TTC?CTG?ATG?CAC?GCT?CCT?GCC?TTC?GAG?ACC?GCT?GGC?ACC?TAC?CTG?AGG?CTG?GTG?AAG?ATC
AAC?GAC?TGG?ACC?GAG?ATC?ACC?CAG?TTC?ATC?CTG?GAG?CAC?AGA?GCC?AAG?GGT?AGC?TGT?AAG?TAC
GCT?CTG?CCT?CTG?AGA?ATC?CCT?CCT?AGC?GCT?TGT?CTG?AGC?CCT?CAG?GCC?TAC?CAG?CAA?GGC?GTG
ACC?GTG?GAC?AGC?ATC?GGT?ATG?CTG?CCT?CGC?TTC?ATC?CCT?GAG?AAC?CAG?AGG?ACC?GTG?GCT?GTG
TAC?AGC?CTG?AAG?ATC?GCT?GGC?TGG?CAC?GGT?CCT?AAG?GCT?CCT?TAC?ACC?AGC?ACT?CTG?CTG?CCT
CCT?GAG?CTG?AGC?GAG?ACC?CCT?AAC?GCC?ACT?CAG?CCT?GAG?CTG?GCT?CCT?GAG?GAC?CCT?GAG?GAC
AGC?GCT?CTG?CTG?GAG?GAC?CCT?GTG?GGT?TAA?
GGATCC
The virus gD glycoprotein extracellular region fragment (284 amino acid) of the expression of recombinant plasmid HSV1 that makes up, 8 * His label (8 amino acid) and TEV proteolytic enzyme restriction enzyme site (7 amino acid) have been added at its N end, 299 amino acid of total length, its aminoacid sequence is as follows:
His?His?His?His?His?His?His?His?Glu?Asn?Leu?Tyr?Phe?Gln?Gly?Lys?Tyr?Ala?Leu?Ala?Asp
Ala?Ser?Leu?Lys?Met?Ala?Asp?Pro?Asn?Arg?Phe?Arg?Gly?Lys?Asp?Leu?Pro?Val?Leu?Asp?Pro
Leu?Thr?Asp?Pro?Pro?Gly?Val?Arg?Arg?Val?Tyr?His?Ile?Gln?Ala?Gly?Leu?Pro?Asp?Pro?Phe
Gln?Pro?Pro?Ser?Leu?Pro?Ile?Thr?Val?Tyr?Tyr?Ala?Val?Leu?Glu?Arg?Ala?Cys?Arg?Ser?Val
Leu?Leu?Asn?Ala?Pro?Ser?Glu?Ala?Pro?Gln?Ile?Val?Arg?Gly?Ala?Ser?Glu?Asp?Val?Arg?Lys
Gln?Pro?Tyr?Asn?Leu?Thr?Ile?Ala?Trp?Phe?Arg?Met?Gly?Gly?Asn?Cys?Ala?Ile?Pro?Ile?Thr
Val?Met?Glu?Tyr?Thr?Glu?Cys?Ser?Tyr?Asn?Lys?Ser?Leu?Gly?Ala?Cys?Pro?Ile?Arg?Thr?Gln
Pro?Arg?Trp?Asn?Tyr?Tyr?Asp?Ser?Phe?Ser?Ala?Val?Ser?Glu?Asp?Asn?Leu?Gly?Phe?Leu?Met
His?Ala?Pro?Ala?Phe?Glu?Thr?Ala?Gly?Thr?Tyr?Leu?Arg?Leu?Val?Lys?Ile?Asn?Asp?Trp?Thr
Glu?Ile?Thr?Gln?Phe?Ile?Leu?Glu?His?Arg?Ala?Lys?Gly?Ser?Cys?Lys?Tyr?Ala?Leu?Pro?Leu
Arg?Ile?Pro?Pro?Ser?Ala?Cys?Leu?Ser?Pro?Gln?Ala?Tyr?Gln?Gln?Gly?Val?Thr?Val?Asp?Ser
Ile?Gly?Met?Leu?Pro?Arg?Phe?Ile?Pro?Glu?Asn?Gln?Arg?Thr?Val?Ala?Val?Tyr?Ser?Leu?Lys
Ile?Ala?Gly?Trp?His?Gly?Pro?Lys?Ala?Pro?Tyr?Thr?Ser?Thr?Leu?Leu?Pro?Pro?Glu?Leu?Ser
Glu?Thr?Pro?Asn?Ala?Thr?Gln?Pro?Glu?Leu?Ala?Pro?Glu?Asp?Pro?Glu?Asp?Ser?Ala?Leu?Leu
Glu?Asp?Pro?Val?Gly
4. the Protein Detection of the eucaryon transfection of recombinant plasmid and cell expressing supernatant:
Extract positive recombinant plasmid pCEP4-gD1, the HEK293 cell is carried out transfection with the liposome transfection method, 37 ℃, 5%CO
2Incubator was cultivated after 48 hours, the collecting cell supernatant carries out the SDS-PAGE electrophoresis detection, anti-His antibody with dilution in 1: 10000 carries out Western Blot detection to the proteic expression that has the His label simultaneously, transfectional cell is expressed the HSV1 virus gD recombinant glycoprotein that relative molecular weight is about 46kDa, and negative control plasmid pCEP4 does not have this protein band.
5. the purifying of the HSV1 virus gD glycoprotein of Biao Daing:
Ni-Sepharose 6Fast Flow affinity column is connected to the normal pressure chromatographic system, washes balance with balance liquid earlier, cell conditioned medium liquid adds the combination of Ni-Sepharose 6Fast Flow gel room temperature, collects behind the upper prop and penetrates liquid.Wash pillar with level pad, then with the elution buffer wash-out target protein, SDS-PAGE electrophoresis and the Western Blot testing goal albumen that contain the 500mM imidazoles.
6.ELISA detect the antigenicity of the HSV1 virus gD glycoprotein of purifying:
With the recombinant protein of purifying PBS doubling dilution, and with negative control with same concentration dilution after the bag by elisa plate, goat-anti HSV1+HSV2 is how anti-, and the anti-goat IgG-HRP of rabbit is anti-as two as one anti-, and the indirect enzyme-linked immunosorbent method detects antigenicity and the specificity of purifying protein gD1.The result shows that the recombinant protein that (table 1) expresses has antigenicity and specificity preferably.
7.ELISA detect the immunogenicity of the HSV1 virus gD glycoprotein of purifying:
1) the sero-fast preparation of HSV1 virus gD glycoprotein
The recombinant protein of purifying is mixed the back respectively at the 1st, 3 with freund adjuvant, 5 all abdominal injection immune mouses (negative control group injection PBS), and in the 3rd, 5,7 all eye socket blood samplings.4 ℃ are spent the night behind 37 ℃ of placements of blood 1h, and centrifugal 20 minutes of 2000rpm gets supernatant, and 4 ℃, centrifugal 20 minutes of 12000rpm gets the antiserum(antisera) that supernatant promptly gets the HSV1 virus gD glycoprotein.
2) HSV1 virus gD glycoprotein antiserum titre detects:
The recombinant protein of purifying is wrapped by elisa plate by 1: 100 dilution back with PBS, anti-as one behind the antiserum(antisera) gradient dilution, two is anti-with goat anti-mouse igg-HRP, and the indirect enzyme-linked immunosorbent method is surveyed antiserum titre, positive serum can react with the HSV1 virus gD glycoprotein, and negative serum then can not.The indirect ELISA result shows that the recombinant protein that (table 2) expresses has better immunogenicity.
8. with the HSV1 virus gD glycoprotein fragment of expressing, be used for vaccine, HSV1 antiviral antibody or detection of antigens and be used for the anti-HSV1 virus monoclonal antibody of immunity preparation and how anti-etc.
9. synthetic HSV1 virus gD glycoprotein gene fragment is connected with other gene fragments, expresses, prepare with the form of fusion rotein.
The application of the HSV1 virus gD glycoprotein extracellular region gene fragment of method for preparing in preparation HSV1 viral sub-units vaccine.
The HSV1 virus gD glycoprotein extracellular region gene fragment of chemosynthesis can utilize bacterium, yeast cell, insect cell, mammalian cell and genetically modified animals and plants to carry out recombinant expressed, preparation.
The application of HSV1 virus gD glycoprotein extracellular region gene fragment in preparation HSV1 virus vaccines and detection reagent of the chemosynthesis of described method preparation.
The advantage that the present invention compared with prior art has
1. the HSV1 virus gD glycoprotein extracellular region fragment expressed of the present invention is as antigen, the enzyme-linked immunologic detecting kit of preparation HSV1 antiviral antibody, have that production is safer, cost is low, with advantages such as other viral cross reactions are few.
2.HSV1 the gD glycoprotein of virus is the main component of viral after birth, duplicating and stimulating in the generation of neutralizing antibody and play an important role in virus, also be one of main target of host cell immunity and humoral immune reaction, so the HSV1 virus gD glycoprotein is to make up HSV vaccine ideal goal gene.The present invention has selected its strong antigen epi-position, utilizes genetic engineering technique to express preparation, for the development recombinant vaccine lays the foundation.Recombinant vaccine safety, cost are low.
3. the eukaryotic cell expression system is adopted in this research; protein translation post-treatment processes such as that the expressed proteins product can correctly be finished is folding, phosphorylation, glycosylation, disulfide linkage formation, acylations, proteolytic enzyme processing, the recombinant protein that obtains has higher biologic activity.
4. the present invention is according to the gD glucoprotein extracellular region fragment aminoacid sequence of the HSV1 virus that filters out, the codon of selecting for use eucaryon and prokaryotic cell prokaryocyte all to have a preference for, the gene order that chemosynthesis is brand-new, and at N end interpolation human IgG κ light chain signal peptide, high expression level in mammalian cell suits.
5. the engineering cell of the gD glycoprotein of the HSV1 virus of the expression that makes up of the present invention, the expressing quantity height, solubility is good, is easy to purifying, and has antigenicity and immunogenicity preferably.
Description of drawings
The invention will be further described below with reference to accompanying drawing:
Fig. 1 is the construction of recombinant plasmid schema of expressing the gD glycoprotein of HSV1 virus.
Fig. 2 is the pcr amplification product of 8 recons of Agarose gel detection of 1%.Lane 1: the dna sequence dna that contains HSV1 virus gD glycoprotein extracellular region antigen epitope genes with chemosynthesis is the template pcr amplification product, positive control; Lane 2: with empty plasmid pCEP4 is the template pcr amplification product, negative control; Lane 3-10:1-8 transformant pcr amplification product, wherein 2,4,5, No. 7 transformants amplify the target gene fragment of 981bp, i.e. the position that arrow indicates in the figure; Lane M:DL2000Marker (TaKaRa).
Fig. 3 is that the pcr amplification product and the enzyme of 1% Agarose gel detection positive recombinant cut the evaluation product.Lane 1:4 positive recombinant pcr amplification product; Lane 2:4 positive recombinant enzyme is cut the evaluation product; Lane M:DL2000Marker (TaKaRa).
Fig. 4 is that the cell conditioned medium Western Blot of express recombinant HSV1 virus gD glycoprotein detects.Lane M: standard molecular weight albumen Marker; Lane 1:Multiple-tag, positive control; Lane 2: empty plasmid pCEP4 cells transfected supernatant, negative control; Lane 3: the cell conditioned medium of transfection recombinant plasmid pCEP4-gD1.
Fig. 5 is that the reorganization HSV1 virus gD glycoprotein Western Blot of purifying detects.Lane 1: the reorganization HSV1 virus gD glycoprotein behind the purifying; Lane 2: empty plasmid pCEP4 cells transfected supernatant, negative control; Lane 3: standard molecular weight albumen Marker; Lane 4:25ng Multiple-tag, positive control.
Embodiment
The detailed description of embodiment of the present invention:
The analysis of the gD glycoprotein antigen epi-position of HSV1 virus, the synthetic vector construction that reaches of gene
Whole aminoacid sequences of the gD glycoprotein by Computer Analysis HSV1 virus, filter out the strong antigen epi-position in the HSV1 virus gD glycoprotein, the codon of selecting for use protokaryon and eucaryon all to have a preference for, the gD glycoprotein of chemosynthesis HSV1 virus contains the brand-new gene fragment of strong antigen epi-position.With the Hind III/BamH I site of gene fragment clone to the plasmid pCEP4, make up recombinant eukaryon expression vector pCEP4-gD1.
Materials and methods
1. bacterial classification and plasmid:
2. reagent and instrument:
PrimerSTAR HS DNA Polymerase, dNTP, Hind III, BamH I, the T4 dna ligase, it is TaKaRa company product that plasmid extraction kit, PCR product purification test kit, sepharose DNA reclaim test kit.TAE electrophoretic buffer, SDS-PAGE protein electrophoresis reagent etc. are by this chamber preparation (prescription is with reference to " fine works molecular biology experiment guide ").The pcr amplification instrument; High speed freezing centrifuge (U.S. Beckman company); The agarose gel electrophoresis device; Protein electrophoresis device (Bio-Rad company); Decolorization swinging table (Jiangsu Xinghua City analytical instrument factory).
3. gene fragment is synthetic:
Help synthetic by company.
4. express HSV1 virus gD glycoprotein extracellular region fragment construction of recombinant plasmid:
Extract plasmid pCEP4,, reclaim the big fragment of plasmid that enzyme is cut behind the electrophoresis, be dissolved in the deionized water with Hind III and BamH I double digestion.Same HSV1 virus gD glycoprotein gene fragment with Hind III and the chemosynthesis of BamH I double digestion, electrophoresis is dissolved in the deionized water after reclaiming.Above-mentioned two kinds of enzymes of volumetric molar concentration such as get and cut the back dna fragmentation, in same centrifuge tube, connect with the T4 dna ligase, HSV1 virus gD glycoprotein gene fragment is inserted between eucaryon plasmid pCEP4 interior the Hind III and BamH I site, constitutes recombinant eukaryon expression vector pCEP4-gD1.
5. the screening of recombinant plasmid and evaluation:
The recombinant plasmid transformed that the last step was connected arrives bacillus coli DH 5 alpha, and the converted product coating is contained on the solid LB substratum of penbritin (100ug/ml), puts 37 ℃ of overnight incubation.8 transformant bacterium colonies of random choose next day (being labeled as respectively 1-8 number) and 1 contrast bacterium (plasmid pCEP4 transformed bacteria), be inoculated into respectively and contain 3ml liquid LB substratum (containing penbritin 100ug/ml) in vitro, put 37 ℃ of shaking culture 5 hours, and got bacterium liquid 1ml, centrifugal receipts bacterium.Use 50ul deionized water suspension thalline respectively, boiling water boiled 5 minutes, 4 ℃, centrifugal 5 minutes of 12000rpm, get supernatant (in plasmid is arranged) 2ul as pcr template, pcr amplification inserts and carries intravital HSV1 virus gD glycoprotein extracellular region clipped form gene fragment, and the PCR reaction density is: the positive strand primer P1 (GC of plasmid template 2ul, HSV1 virus gD glycoprotein extracellular region gene fragment
AAGCTTGCCGCCACCATGGAA) and each 1ul of minus strand primer P2 (GCGGATCCTTAACCCACAGGGTC), 10 * pyrobest buffer 2.0ul, 2.5mmol/L dNTP 2.0ul, PrimerSTAR HS archaeal dna polymerase 0.5ul (1.25U), deionized water 11.5ul, cumulative volume 20ul.Amplification condition is: 98 ℃ of pre-sex change 1 minute, 98 ℃ 10 seconds, 55 ℃ 10 seconds, 72 ℃ 1 minute, 30 circulations, last 72C extended 7 minutes.Get pcr amplification product 5ul, the Agarose gel detection with 1.0%, positive transformant should be able to amplify the purpose fragment of 981bp, and the empty plasmid transformed bacteria does not have this band.With Hind III and BamH I enzyme double digestion, the recombinant plasmid enzyme is cut product should band occur at 975bp, 10200bp place.
6.DNA sequential analysis:
With QIAGEN company plasmid purification test kit plasmid purification, with the full-automatic sequenator order-checking of DNA.
The result
1.HSV1 screening of the gD glycoprotein antigen epi-position of virus and gene fragment is synthetic:
Utilize softwares such as ANTHEWIN, whole aminoacid sequence (GeneBank of the gD glycoprotein by Computer Analysis HSV1 virus, accession number: EF157320), filter out the interior strong antigen epi-position of gD glycoprotein of HSV1 virus, promptly from 284 amino acid of the 1st amino acid to the, its aminoacid sequence is as follows:
Lys?Tyr?Ala?Leu?Ala?Asp?Ala?Ser?Leu?Lys?Met?Ala?Asp?Pro?Asn?Arg?Phe?Arg?Gly?Lys?Asp
Leu?Pro?Val?Leu?Asp?Pro?Leu?Thr?Asp?Pro?Pro?Gly?Val?Arg?Arg?Val?Tyr?His?Ile?Gln?Ala
Gly?Leu?Pro?Asp?Pro?Phe?Gln?Pro?Pro?Ser?Leu?Pro?Ile?Thr?Val?Tyr?Tyr?Ala?Val?Leu?Glu
Arg?Ala?Cys?Arg?Ser?Val?Leu?Leu?Asn?Ala?Pro?Ser?Glu?Ala?Pro?Gln?Ile?Val?Arg?Gly?Ala
Ser?Glu?Asp?Val?Arg?Lys?Gln?Pro?Tyr?Asn?Leu?Thr?Ile?Ala?Trp?Phe?Arg?Met?Gly?Gly?Asn
Cys?Ala?Ile?Pro?Ile?Thr?Val?Met?Glu?Tyr?Thr?Glu?Cys?Ser?Tyr?Asn?Lys?Ser?Leu?Gly?Ala
Cys?Pro?Ile?Arg?Thr?Gln?Pro?Arg?Trp?Asn?Tyr?Tyr?Asp?Ser?Phe?Ser?Ala?Val?Ser?Glu?Asp
Asn?Leu?Gly?Phe?Leu?Met?His?Ala?Pro?Ala?Phe?Glu?Thr?Ala?Gly?Thr?Tyr?Leu?Arg?Leu?Val
Lys?Ile?Asn?Asp?Trp?Thr?Glu?Ile?Thr?Gln?Phe?Ile?Leu?Glu?His?Arg?Ala?Lys?Gly?Ser?Cys
Lys?Tyr?Ala?Leu?Pro?Leu?Arg?Ile?Pro?Pro?Ser?Ala?Cys?Leu?Ser?Pro?Gln?Ala?Tyr?Gln?Gln
Gly?Val?Thr?Val?Asp?Ser?Ile?Gly?Met?Leu?Pro?Arg?Phe?Ile?Pro?Glu?Asn?Gln?Arg?Thr?Val
Ala?Val?Tyr?Ser?Leu?Lys?Ile?Ala?Gly?Trp?His?Gly?Pro?Lys?Ala?Pro?Tyr?Thr?Ser?Thr?Leu
Leu?Pro?Pro?Glu?Leu?Ser?Glu?Thr?Pro?Asn?Ala?Thr?Gln?Pro?Glu?Leu?Ala?Pro?Glu?Asp?Pro
Glu?Asp?Ser?Ala?Leu?Leu?Glu?Asp?Pro?Val?Gly
According to the epitope aminoacid sequence in the HSV1 virus gD glycoprotein of screening, the codon of selecting eucaryon and prokaryotic organism all to have a preference for, the gene order that chemosynthesis is brand-new, and increased Hind III restriction enzyme site (following setting-out part) at 5 ' end, transcription regulating nucleotide sequence (GCCGCCACC), initiator codon (ATG), human IgG κ light chain signal peptide (wavy line part), 8 * His label and TEV proteolytic enzyme restriction enzyme site (gaaaacctgtacttccagggt), terminator codon (TAA) and BamH I restriction enzyme site (following setting-out part) have been increased at 3 ' end, make this gene fragment be easy to be cloned in plasmid pCEP4 interior the Hind III and BamHI restriction enzyme site, and make gD albumen be easier to express and purifying.The dna sequence dna that contains HSV1 virus gD glycoprotein antigen epitope genes (981bp) of chemosynthesis is as follows:
AAGCTT?GCC?GCC?ACC?ATG
GCT?CTG?GCC?GAT?GCT?AGC?CTG?AAG?ATG?GCT?GAT?CCT?AAC?CGC?TTC?AGA?GGT?AAG?GAC?CTG?CCT
GTG?CTG?GAC?CAG?CTG?ACC?GAC?CCT?CCT?GGC?GTG?CGC?AGA?GTG?TAC?CAC?ATT?CAG?GCT?GGT?CTG
CCT?GAC?CCT?TTC?CAG?CCT?CCT?AGC?CTG?CCT?ATC?ACC?GTG?TAC?TAC?GCC?GTG?CTG?GAG?AGA?GCC
TGT?CGC?AGC?GTG?CTG?CTG?AAC?GCT?CCT?AGC?GAG?GCT?CCT?CAG?ATC?GTG?AGA?GGT?GCT?AGC?GAA
GAC?GTG?AGG?AAG?CAG?CCT?TAC?AAC?CTG?ACC?ATC?GCC?TGG?TTC?AGG?ATG?GGT?GGT?AAC?TGT?GCT
ATC?CCT?ATC?ACC?GTG?ATG?GAG?TAC?ACC?GAG?TGT?TCT?TAC?AAC?AAG?AGC?CTG?GGC?GCT?TGT?CCT
ATC?CGC?ACC?CAG?CCT?AGG?TGG?AAC?TAC?TAC?GAC?AGC?TTC?AGC?GCT?GTG?AGC?GAG?GAC?AAC?CTG
GGC?TTC?CTG?ATG?CAC?GCT?CCT?GCC?TTC?GAG?ACC?GCT?GGC?ACC?TAC?CTG?AGG?CTG?GTG?AAG?ATC
AAC?GAC?TGG?ACC?GAG?ATC?ACC?CAG?TTC?ATC?CTG?GAG?CAC?AGA?GCC?AAG?GGT?AGC?TGT?AAG?TAC
GCT?CTG?CCT?CTG?AGA?ATC?CCT?CCT?AGC?GCT?TGT?CTG?AGC?CCT?CAG?GCC?TAC?CAG?CAA?GGC?GTG
ACC?GTG?GAC?AGC?ATC?GGT?ATG?CTG?CCT?CGC?TTC?ATC?CCT?GAG?AAC?CAG?AGG?ACC?GTG?GCT?GTG
TAC?AGC?CTG?AAG?ATC?GCT?GGC?TGG?CAC?GGT?CCT?AAG?GCT?CCT?TAC?ACC?AGC?ACT?CTG?CTG?CCT
CCT?GAG?CTG?AGC?GAG?ACC?CCT?AAC?GCC?ACT?CAG?CCT?GAG?CTG?GCT?CCT?GAG?GAC?CCT?GAG?GAC
AGC?GCT?CTG?CTG?GAG?GAC?CCT?GTG?GGT?TAA?
GGATCC
2. express HSV1 virus gD glycoprotein extracellular region fragment construction of recombinant plasmid:
Goal gene is cloned between the Hind III and BamH I restriction enzyme site of pCEP4 carrier, constitutes recombinant eukaryon expression vector pCEP4-gD1.(make up flow process and see Fig. 1).
3. the screening of recombinant plasmid and evaluation:
2nd, 4,5, No. 74 transformants amplify the target gene fragment of 981bp, and the contrast bacterium that contains plasmid pCEP4 does not amplify this gene fragment (see figure 2).Extract the plasmid of No. 4 recons, with Hind III and BamH I enzyme double digestion, enzyme is cut product and band occurred at about 975bp, 10200bp place, and (see figure 3) conforms to the expection size.Extract the plasmid of No. 4 recons, measure the HSV1 virus gD glycoprotein gene order in the plasmid, dna sequence analysis confirms that recombinant plasmid contains synthetic HSV1 virus gD glycoprotein gene fragment, and sequence is entirely true:
AAGCTT?GCC?GCC?ACC?ATG?GAA?ACC?CCA?GCG?CAG?CTT?CTC?TTC?CTC?CTG?CTACTC?TGG?CTC?CCA
GAT?ACC?ACC?GGA?CAT?CAT?CAC?CAT?CAC?CAT?CAC?CAT?GAA?AAC?CTG?TAC?TTC?CAG?GGT?AAG?TAC
GCT?CTG?GCC?GAT?GCT?AGC?CTG?AAG?ATG?GCT?GAT?CCT?AAC?CGC?TTC?AGA?GGT?AAG?GAC?CTG?CCT
GTG?CTG?GAC?CAG?CTG?ACC?GAC?CCT?CCT?GGC?GTG?CGC?AGA?GTG?TAC?CAC?ATT?CAG?GCT?GGT?CTG
CCT?GAC?CCT?TTC?CAG?CCT?CCT?AGC?CTG?CCT?ATC?ACC?GTG?TAC?TAC?GCC?GTG?CTG?GAG?AGA?GCC
TGT?CGC?AGC?GTG?CTG?CTG?AAC?GCT?CCT?AGC?GAG?GCT?CCT?CAG?ATC?GTG?AGA?GGT?GCT?AGC?GAA
GAC?GTG?AGG?AAG?CAG?CCT?TAC?AAC?CTG?ACC?ATC?GCC?TGG?TTC?AGG?ATG?GGT?GGT?AAC?TGT?GCT
ATC?CCT?ATC?ACC?GTG?ATG?GAG?TAC?ACC?GAG?TGT?TCT?TAC?AAC?AAG?AGC?CTG?GGC?GCT?TGT?CCT
ATC?CGC?ACC?CAG?CCT?AGG?TGG?AAC?TAC?TAC?GAC?AGC?TTC?AGC?GCT?GTG?AGC?GAG?GAC?AAC?CTG
GGC?TTC?CTG?ATG?CAC?GCT?CCT?GCC?TTC?GAG?ACC?GCT?GGC?ACC?TAC?CTG?AGG?CTG?GTG?AAG?ATC
AAC?GAC?TGG?ACC?GAG?ATC?ACC?CAG?TTC?ATC?CTG?GAG?CAC?AGA?GCC?AAG?GGT?AGC?TGT?AAG?TAC
GCT?CTG?CCT?CTG?AGA?ATC?CCT?CCT?AGC?GCT?TGT?CTG?AGC?CCT?CAG?GCC?TAC?CAG?CAA?GGC?GTG
ACC?GTG?GAC?AGC?ATC?GGT?ATG?CTG?CCT?CGC?TTC?ATC?CCT?GAG?AAC?CAG?AGG?ACC?GTG?GCT?GTG
TAC?AGC?CTG?AAG?ATC?GCT?GGC?TGG?CAC?GGT?CCT?AAG?GCT?CCT?TAC?ACC?AGC?ACT?CTG?CTG?CCT
CCT?GAG?CTG?AGC?GAG?ACC?CCT?AAC?GCC?ACT?CAG?CCT?GAG?CTG?GCT?CCT?GAG?GAC?CCT?GAG?GAC
AGC?GCT?CTG?CTG?GAG?GAC?CCT?GTG?GGT?TAA?
GGATCC
The virus gD glycoprotein fragment (284 amino acid) of the expression of recombinant plasmid HSV1 that makes up has been added 8 * His label (8 amino acid) and TEV proteolytic enzyme restriction enzyme site (7 amino acid) at its N end, 299 amino acid of total length, and its aminoacid sequence is as follows:
His?His?His?His?His?His?His?His?Glu?Asn?Leu?Tyr?Phe?Gln?Gly?Lys?Tyr?Ala?Leu?Ala?Asp
Ala?Ser?Leu?Lys?Met?Ala?Asp?Pro?Asn?Arg?Phe?Arg?Gly?Lys?Asp?Leu?Pro?Val?Leu?Asp?Pro
Leu?Thr?Asp?Pro?Pro?Gly?Val?Arg?Arg?Val?Tyr?His?Ile?Gln?Ala?Gly?Leu?Pro?Asp?Pro?Phe
Gln?Pro?Pro?Ser?Leu?Pro?Ile?Thr?Val?Tyr?Tyr?Ala?Val?Leu?Glu?Arg?Ala?Cys?Arg?Ser?Val
Leu?Leu?Asn?Ala?Pro?Ser?Glu?Ala?Pro?Gln?Ile?Val?Arg?Gly?Ala?Ser?Glu?Asp?Val?Arg?Lys
Gln?Pro?Tyr?Asn?Leu?Thr?Ile?Ala?Trp?Phe?Arg?Met?Gly?Gly?Asn?Cys?Ala?Ile?Pro?Ile?Thr
Val?Met?Glu?Tyr?Thr?Glu?Cys?Ser?Tyr?Asn?Lys?Ser?Leu?Gly?Ala?Cys?Pro?Ile?Arg?Thr?Gln
Pro?Arg?Trp?Asn?Tyr?Tyr?Asp?Ser?Phe?Ser?Ala?Val?Ser?Glu?Asp?Asn?Leu?Gly?Phe?Leu?Met
His?Ala?Pro?Ala?Phe?Glu?Thr?Ala?Gly?Thr?Tyr?Leu?Arg?Leu?Val?Lys?Ile?Asn?Asp?Trp?Thr
Glu?Ile?Thr?Gln?Phe?Ile?Leu?Glu?His?Arg?Ala?Lys?Gly?Ser?Cys?Lys?Tyr?Ala?Leu?Pro?Leu
Arg?Ile?Pro?Pro?Ser?Ala?Cys?Leu?Ser?Pro?Gln?Ala?Tyr?Gln?Gln?Gly?Val?Thr?Val?Asp?Ser
Ile?Gly?Met?Leu?Pro?Arg?Phe?Ile?Pro?Glu?Asn?Gln?Arg?Thr?Val?Ala?Val?Tyr?Ser?Leu?Lys
Ile?Ala?Gly?Trp?His?Gly?Pro?Lys?Ala?Pro?Tyr?Thr?Ser?Thr?Leu?Leu?Pro?Pro?Glu?Leu?Ser
Glu?Thr?Pro?Asn?Ala?Thr?Gln?Pro?Glu?Leu?Ala?Pro?Glu?Asp?Pro?Glu?Asp?Ser?Ala?Leu?Leu
Glu?Asp?Pro?Val?Gly
The eucaryon transfection of recombinant plasmid, the Protein Detection and the purifying of cell expressing supernatant
Extract positive recombinant plasmid pCEP4-gD1, the HEK293 cell is carried out transfection with the liposome transfection method.The collecting cell supernatant according to the aminoacid sequence of expressing the HSV1 virus gD glycoprotein, is analyzed its physicochemical property, determines suitable purification process.Our expressed HSV1 virus gD glycoprotein has added 8 * His label at the N end, can easily separate with the nickel sepharose, so we determines to adopt affinity chromatography, carries out purifying with Ni Sepharose 6Fast Flow gel.Concrete steps are as follows:
Material and method
1. main agents:
2. recombinant plasmid pCEP4-gD1 eucaryon transfection:
Transfection the day before yesterday is with 0.5-2 * 10
5Density inoculation HEK293 cell to 24 orifice plate in/hole, 37 ℃, 5%CO
2The incubator overnight incubation is carried out transfection when making it reach hole floorage 90-95%.Get recombinant plasmid pCEP4-gD1 5ul (200ng/ul) and be diluted in the 50ul serum-free DMEM substratum (establishing contrast empty plasmid pCEP4), gentle mixing.Get Lipofectamine 2000 2ul and be diluted in the 50ul serum-free DMEM substratum, gentle mixing, room temperature left standstill 5 minutes.With the recombinant plasmid and the gentle mixing of liposome of dilution, room temperature leaves standstill and joins in 24 orifice plates that contain the HEK293 cell 100ul/ hole, gentle mixing, 37 ℃, 5%CO after 20 minutes
2Incubator was cultivated after 48 hours, and the collecting cell supernatant detects.
3.Western Blot detects the cell conditioned medium of express recombinant HSV1 virus gD glycoprotein:
Collect the transfectional cell supernatant and carry out the SDS-PAGE electrophoresis, pvdf membrane is wet to be changeed, 100V, 1 hour, 4 ℃ of sealings spend the night (5%milk-PBST).PBST washes film 3 times, each 10 minutes, mouse anti His monoclonal antibody (1mg/ml) is diluted in the confining liquid at 1: 10000, incubated at room 2 hours was washed film 3 * 10 minutes, and goat anti-mouse igg-HRP is diluted in the confining liquid at 1: 10000, incubated at room 1 hour, washed film 3 * 10 minutes, and added luminous substrate reaction 3 minutes, compressing tablet exposure in the darkroom.
4. the purifying of reorganization HSV1 virus gD glycoprotein:
Supernatant solution adds equilibrated Ni Sepharose 6Fast Flow gel 3ml, and 4 ℃ of combinations are spent the night behind the mixing, and last sample is collected and penetrated liquid.Balance liquid (1 * PBS with ten times of column volumes, 0.5mol/L NaCl+, 20mmol/L imidazole, pH7.4) washing pillar is then with 1ml elutriant (1 * PBS, 0.5mol/L NaCl, 500mmol/L imidazole, pH7.4) add in the colloid, leave standstill wash-out target protein after 20 minutes, be the HSV1 virus gD glycoprotein extracellular region fragment of purifying.
5.Western Blot detects the reorganization HSV1 virus gD glycoprotein of purifying:
Reorganization HSV1 virus gD glycoprotein to purifying carries out the 12%SDS-PAGE gel electrophoresis, 19mA, 80 minutes.Pvdf membrane is wet to be changeed, 100V, 1 hour, 4 ℃ of sealings spend the night (5%milk-PBST).PBST washes film 3 times, each 10 minutes, mouse anti His monoclonal antibody (1mg/ml) is diluted in the confining liquid at 1: 10000, incubated at room 2 hours, washed film 3 * 10 minutes, goat anti-mouse igg-HRP1: 10000 are diluted in the confining liquid, incubated at room 1 hour, washed film 3 * 10 minutes, and added luminous substrate reaction 3 minutes, compressing tablet exposure in the darkroom.
The result
1.Western Blot detects the cell conditioned medium of express recombinant HSV1 virus gD glycoprotein:
Obviously give expression to reorganization HSV1 virus gD glycoprotein through the HEK293 of recombinant plasmid transfection cell, expression product is present in the cell conditioned medium with soluble form, and the about 46kDa of molecular weight conforms to the expection size.The result shows that reorganization HSV1 virus gD glycoprotein is expressed successful (see figure 4).
2.Western Blot detects the reorganization HSV1 virus gD glycoprotein of purifying:
To carry out Western Blot from the albumen of wash-out on the Ni Sepharose 6Fast Flow gel column and analyze, the about 46kDa of protein band molecular weight conforms to the expection size.The result shows, reorganization HSV1 virus gD glycoprotein purifying success (see figure 5).
The gD identification of glycoproteins and the application of purifying HSV1 virus
With the reorganization HSV1 virus gD glycoprotein antigen of purifying, detect by the indirect ELISA test method, to identify the antigenicity and the specificity of the HSV1 virus gD glycoprotein of expressing.Use the reorganization HSV1 virus gD glycoprotein antigen immune mouse of purifying again, detect antibody concentration in the mice serum, to identify the immunogenicity of the HSV1 virus gD glycoprotein of expressing by the indirect ELISA test method.
Material and method
1. main agents and material:
The many anti-Abcam company products that are of the anti-HSV1+HSV2 of goat, the anti-goat IgG-HRP of rabbit is doctor's moral company product, freund adjuvant and incomplete freund adjuvant are SIGMA company product fully.Other reagent is homemade or the import analytical reagent.Laboratory animal male mouse of kunming in 4 age in week, the SPF level is available from Beijing military medicine research institute Experimental Animal Center.
2. the evaluation of reorganization HSV1 virus gD glycoprotein:
Adopt indirect ELISA to detect the antigenicity of reorganization HSV1 virus gD glycoprotein.Basic step is: press 1 with 1 * PBS (pH7.4): 25-1: the reorganization HSV1 virus gD glycoprotein of 400 doubling dilution purifying, wrap by elisa plate (negative control is got normal HEK293 cell conditioned medium), and every hole 100ul, 4 ℃ are spent the night.Inferior daily confining liquid (1 * PBS, 1% calf serum) sealing, every hole 130ul, room temperature 2 hours.The anti-HSV1+HSV2 of goat is how anti-, with sample diluent (1 * PBS, 0.1% calf serum) after the dilution in 1: 500, add to respectively in the enzyme linked plate holes after the sealing, every hole 100ul, 37 ℃ were reacted 1 hour, with PBST liquid (1 * PBS, 0.5% tween 20) wash 5 times after, anti-goat IgG-the HRP of rabbit that adds dilution in 1: 40000, every hole 100ul, 37 ℃ were reacted 30 minutes, PBST washes 5 times, add substrate TMB solution, every hole 100ul, 37 ℃ of lucifuges developed the color 10 minutes, every hole adds 50ul 1N hydrochloric acid termination reaction, measures the A450 value with enzyme connection instrument.
3.HSV1 the sero-fast preparation of virus gD glycoprotein:
The reorganization HSV1 virus gD glycoprotein of purifying is mixed the back respectively at the 1st with the freund adjuvant equal-volume, 3,5 weeks, (the 1st week was used complete freund adjuvant, the 3rd, full freund adjuvant tood many or too much for use in 5 weeks) the abdominal injection immune mouse, 1.25ug//time (negative control group injection equal-volume PBS), and in the 3rd, 5,7 all eye socket blood samplings.37 ℃ of blood are placed after 1 hour 4 ℃ and are spent the night, and centrifugal 20 minutes of 2000rpm gets supernatant, and 4 ℃, centrifugal 20 minutes of 12000rpm gets the antiserum(antisera) that supernatant promptly gets the HSV1 virus gD glycoprotein.
4.HSV1 the virus gD glycoprotein antiserum titre detects:
Adopt indirect ELISA to detect the immunogenicity of reorganization HSV1 virus gD glycoprotein.Basic step is: with the reorganization HSV1 virus gD glycoprotein of 1 * PBS, wraps by elisa plate by 1: 100 dilution purifying, and every hole 100ul, 4 ℃ are spent the night.Inferior daily confining liquid sealase yoke plate, every hole 130ul, room temperature 2 hours.Antiserum(antisera) was pressed 1: 50 with the sample diluent, 1: 500, after the dilution in 1: 5000, add in the enzyme linked plate holes after the sealing every hole 100ul, 37 ℃ of reactions 1 hour respectively, after washing 5 times with PBST, add the goat anti-mouse igg-HRP of dilution in 1: 10000, every hole 100ul, 37 ℃ were reacted 30 minutes, PBST washes 5 times, adds the every hole 100ul of substrate TMB solution, and 37 ℃ of lucifuges developed the color 10 minutes, add 50ul 1N hydrochloric acid termination reaction, measure the A450 value with enzyme connection instrument.Positive serum should be able to react with the HSV1 virus gD glycoprotein, and negative serum then can not.
The result
1. reorganization HSV1 virus gD glycoprotein antigenicity is identified:
Detect the antigenicity of the recombinant protein of purifying with indirect elisa method, the result shows between (table 1) protein concentration and its OD value good linear relationship, illustrates that the reorganization HSV1 virus gD glycoprotein of expression has antigenicity and specificity preferably.
2. reorganization HSV1 virus gD glycoprotein immunogenicity is identified:
Detect the immunogenicity of the recombinant protein of purifying with indirect elisa method, the result shows (table 2), and immunity back antibody horizontal is lower for the first time, immunity back antibody horizontal obviously rises for the second time, immunity back antibody horizontal is with fair for the second time for the third time, illustrate that the reorganization HSV1 virus gD glycoprotein of expressing has good immunogenicity, for development lay a good foundation.
The ELISA experimental result that table 1 expressing protein antigenicity detects
The ELISA experimental result that table 2 expressing protein immunogenicity detects
The HSV1 virus gD glycoprotein extracellular region gene fragment sequence table of chemosynthesis
＜110〉Li Yuexi
＜120〉the HSV1 virus gD glycoprotein extracellular region gene fragment of chemosynthesis and expression thereof, application
<160>2
<210>1
<211>852
<212>DNA
＜213〉artificial sequence
<220>
<221>CDS
<222>(1)…(852)
＜223〉the brand-new gene fragment of synthetic, coding contains 284 ammonia of HSV1 virus gD glycoprotein extracellular region of strong antigen epi-position
The base acid fragment.
<400>1
AAG?TAC?GCT?CTG?GCC?GAT?GCT?AGC?CTG?AAG?ATG?GCT?GAT?CCT?AAC?CGC?TTC?AGA?GGT?AAG 60
GAC?CTG?CCT?GTG?CTG?GAC?CAG?CTG?ACC?GAC?CCT?CCT?GGC?GTG?CGC?AGA?GTG?TAC?CAC?ATT 120
CAG?GCT?GGT?CTG?CCT?GAC?CCT?TTC?CAG?CCT?CCT?AGC?CTG?CCT?ATC?ACC?GTG?TAC?TAC?GCC 180
GTG?CTG?GAG?AGA?GCC?TGT?CGC?AGC?GTG?CTG?CTG?AAC?GCT?CCT?AGC?GAG?GCT?CCT?CAG?ATC 240
GTG?AGA?GGT?GCT?AGC?GAA?GAC?GTG?AGG?AAG?CAG?CCT?TAC?AAC?CTG?ACC?ATC?GCC?TGG?TTC 300
AGG?ATG?GGT?GGT?AAC?TGT?GCT?ATC?CCT?ATC?ACC?GTG?ATG?GAG?TAC?ACC?GAG?TGT?TCT?TAC 360
AAC?AAG?AGC?CTG?GGC?GCT?TGT?CCT?ATC?CGC?ACC?CAG?CCT?AGG?TGG?AAC?TAC?TAC?GAC?AGC 420
TTC?AGC?GCT?GTG?AGC?GAG?GAC?AAC?CTG?GGC?TTC?CTG?ATG?CAC?GCT?CCT?GCC?TTC?GAG?ACC 480
GT?GGC?ACC?TAC?CTG?AGG?CTG?GTG?AAG?ATC?AAC?GAC?TGG?ACC?GAG?ATC?ACC?CAG?TTC?ATC 540
CTG?GAG?CAC?AGA?GCC?AAG?GGT?AGC?TGT?AAG?TAC?GCT?CTG?CCT?CTG?AGA?ATC?CCT?CCT?AGC 600
GCT?TGT?CTG?AGC?CCT?CAG?GCC?TAC?CAG?CAA?GGC?GTG?ACC?GTG?GAC?AGC?ATC?GGT?ATG?CTG 660
CCT?CGC?TTC?ATC?CCT?GAG?AAC?CAG?AGG?ACC?GTG?GCT?GTG?TAC?AGC?CTG?AAG?ATC?GCT?GGC 720
TGG?CAC?GGT?CCT?AAG?GCT?CCT?TAC?ACC?AGC?ACT?CTG?CTG?CCT?CCT?GAG?CTG?AGC?GAG?ACC 780
CCT?AAC?GCC?ACT?CAG?CCT?GAG?CTG?GCT?CCT?GAG?GAC?CCT?GAG?GAC?AGC?GCT?CTG?CTG?GAG 840
GAC?CCT?GTG?GGT
<210>2
<211>284
<212>PRT
＜213〉HSV1 virus gD protein extracellular fragment
<220>
＜223〉contain the HSV1 virus gD glycoprotein extracellular region fragment of strong antigen epi-position, 284 amino acid of the 1st amino acid-Di,
Totally 284 amino acid.
<400>2
Lys?Tyr?Ala?Leu?Ala?Asp?Ala?Ser?Leu?Lys?Met?Ala?Asp?Pro?Asn?Arg?Phe?Arg?Gly?Lys
1 5 10 15 20
Asp?Leu?Pro?Val?Leu?Asp?Pro?Leu?Thr?Asp?Pro?Pro?Gly?Val?Arg?Arg?Val?Tyr?His?Ile
21 25 30 35 40
Gln?Ala?Gly?Leu?Pro?Asp?Pro?Phe?Gln?Pro?Pro?Ser?Leu?Pro?Ile?Thr?Val?Tyr?Tyr?Ala
41 45 50 55 60
Val?Leu?Glu?Arg?Ala?Cys?Arg?Ser?Val?Leu?Leu?Asn?Ala?Pro?Ser?Glu?Ala?Pro?Gln?Ile
61 65 70 75 80
Val?Arg?Gly?Ala?Ser?Glu?Asp?Val?Arg?Lys?Gln?Pro?Tyr?Asn?Leu?Thr?Ile?Ala?Trp?Phe
81 85 90 95 100
Arg?Met?Gly?Gly?Asn?Cys?Ala?Ile?Pro?Ile?Thr?Val?Met?Glu?Tyr?Thr?Glu?Cys?Ser?Tyr
101 105 110 115 120
Asn?Lys?Ser?Leu?Gly?Ala?Cys?Pro?Ile?Arg?Thr?Gln?Pro?Arg?Trp?Asn?Tyr?Tyr?Asp?Ser
121 125 130 135 140
Phe?Ser?Ala?Val?Ser?Glu?Asp?Asn?Leu?Gly?Phe?Leu?Met?His?Ala?Pro?Ala?Phe?Glu?Thr
141 145 150 155 160
Ala?Gly?Thr?Tyr?Leu?Arg?Leu?Val?Lys?Ile?Asn?Asp?Trp?Thr?Glu?Ile?Thr?Gln?Phe?Ile
161 165 170 175 180
Leu?Glu?His?Arg?Ala?Lys?Gly?Ser?Cys?Lys?Tyr?Ala?Leu?Pro?Leu?Arg?Ile?Pro?Pro?Ser
181 185 190 195 200
Ala?Cys?Leu?Ser?Pro?Gln?Ala?Tyr?Gln?Gln?Gly?Val?Thr?Val?Asp?Ser?Ile?Gly?Met?Leu
201 205 210 215 220
Pro?Arg?Phe?Ile?Pro?Glu?Asn?Gln?Arg?Thr?Val?Ala?Val?Tyr?Ser?Leu?Lys?Ile?Ala?Gly
221 225 230 235 240
Trp?His?Gly?Pro?Lys?Ala?Pro?Tyr?Thr?Ser?Thr?Leu?Leu?Pro?Pro?Glu?Leu?Ser?Glu?Thr
241 245 250 255 260
Pro?Asn?Ala?Thr?Gln?Pro?Glu?Leu?Ala?Pro?Glu?Asp?Pro?Glu?Asp?Ser?Ala?Leu?Leu?Glu
261 265 270 275 280
Asp?Pro?Val?Gly
281
Claims (3)
1. the HSV1 virus gD glycoprotein extracellular region gene fragment of a chemosynthesis, this gene fragment coding contains the gD glucoprotein extracellular region fragment of the HSV1 virus of strong antigen epi-position, i.e. 284 amino acid of the 1st amino acid to the, totally 284 amino acid, the gene order total length 852bp of chemosynthesis, sequence is as follows:
AAG?TAC?GCT?CTG?GCC?GAT?GCT?AGC?CTG?AAG?ATG?GCT?GAT?CCT?AAC?CGC?TTC?AGA
GGT?AAG?GAC?CTG?CCT?GTG?CTG?GAC?CAG?CTG?ACC?GAC?CCT?CCT?GGC?GTG?CGC?AGA
GTG?TAC?CAC?ATT?CAG?GCT?GGT?CTG?CCT?GAC?CCT?TTC?CAG?CCT?CCT?AGC?CTG?CCT
ATC?ACC?GTG?TAC?TAC?GCC?GTG?CTG?GAG?AGA?GCC?TGT?CGC?AGC?GTG?CTG?CTG?AAC
GCT?CCT?AGC?GAG?GCT?CCT?CAG?ATC?GTG?AGA?GGT?GCT?AGC?GAA?GAC?GTG?AGG?AAG
CAG?CCT?TAC?AAC?CTG?ACC?ATC?GCC?TGG?TTC?AGG?ATG?GGT?GGT?AAC?TGT?GCT?ATC
CCT?ATC?ACC?GTG?ATG?GAG?TAC?ACC?GAG?TGT?TCT?TAC?AAC?AAG?AGC?CTG?GGC?GCT
TGT?CCT?ATC?CGC?ACC?CAG?CCT?AGG?TGG?AAC?TAC?TAC?GAC?AGC?TTC?AGC?GCT?GTG
AGC?GAG?GAC?AAC?CTG?GGC?TTC?CTG?ATG?CAC?GCT?CCT?GCC?TTC?GAG?ACC?GCT?GGC
ACC?TAC?CTG?AGG?CTG?GTG?AAG?ATC?AAC?GAC?TGG?ACC?GAG?ATC?ACC?CAG?TTC?ATC
CTG?GAG?CAC?AGA?GCC?AAG?GGT?AGC?TGT?AAG?TAC?GCT?CTG?CCT?CTG?AGA?ATC?CCT
CCT?AGC?GCT?TGT?CTG?AGC?CCT?CAG?GCC?TAC?CAG?CAA?GGC?GTG?ACC?GTG?GAC?AGC
ATC?GGT?ATG?CTG?CCT?CGC?TTC?ATC?CCT?GAG?AAC?CAG?AGG?ACC?GTG?GCT?GTG?TAC
AGC?CTG?AAG?ATC?GCT?GGC?TGG?CAC?GGT?CCT?AAG?GCT?CCT?TAC?ACC?AGC?ACT?CTG
CTG?CCT?CCT?GAG?CTG?AGC?GAG?ACC?CCT?AAC?GCC?ACT?CAG?CCT?GAG?CTG?GCT?CCT
GAG?GAC?CCT?GAG?GAC?AGC?GCT?CTG?CTG?GAG?GAC?CCT?GTG?GGT
2. the HSV1 virus gD glycoprotein extracellular region gene fragment of the described chemosynthesis of claim 1, it is recombinant expressed to utilize bacterium, yeast cell, insect cell, mammalian cell and genetically modified animals and plants to carry out, 284 amino acid protein fragments of gD glucoprotein extracellular region of preparation HSV1 virus, sequence is as follows:
Lys?Tyr?Ala?Leu?Ala?Asp?Ala?Ser?Leu?Lys?Met?Ala?Asp?Pro?Asn?Arg?Phe?Arg
Gly?Lys?Asp?Leu?Pro?Val?Leu?Asp?Pro?Leu?Thr?Asp?Pro?Pro?Gly?Val?Arg?Arg
Val?Tyr?His?Ile?Gln?Ala?Gly?Leu?Pro?Asp?Pro?Phe?Gln?Pro?Pro?Ser?Leu?Pro
Ile?Thr?Val?Tyr?Tyr?Ala?Val?Leu?Glu?Arg?Ala?Cys?Arg?Ser?Val?Leu?Leu?Asn
Ala?Pro?Ser?Glu?Ala?Pro?Gln?Ile?Val?Arg?Gly?Ala?Ser?Glu?Asp?Mal?Arg?Lys
Gln?Pro?Tyr?Asn?Leu?Thr?Ile?Ala?Trp?Phe?Arg?Met?Gly?Gly?Asn?Cys?Ala?Ile
Pro?Ile?Thr?Val?Met?Glu?Tyr?Thr?Glu?Cys?Ser?Tyr?Asn?Lys?Ser?Leu?Gly?Ala
Cys?Pro?Ile?Arg?Thr?Gln?Pro?Arg?Trp?Asn?Tyr?Tyr?Asp?Ser?Phe?Ser?Ala?Val
Ser?Glu?Asp?Asn?Leu?Gly?Phe?Leu?Met?His?Ala?Pro?Ala?Phe?Glu?Thr?Ala?Gly
Thr?Tyr?Leu?Arg?Leu?Val?Lys?Ile?Asn?Asp?Trp?Thr?Glu?Ile?Thr?Gln?Phe?Ile
Leu?Glu?His?Arg?Ala?Lys?Gly?Ser?Cys?Lys?Tyr?Ala?Leu?Pro?Leu?Arg?Ile?Pro
Pro?Ser?Ala?Cys?Leu?Ser?Pro?Gln?Ala?Tyr?Gln?Gln?Gly?Val?Thr?Val?Asp?Ser
Ile?Gly?Met?Leu?Pro?Arg?Phe?Ile?Pro?Glu?Asn?Gln?Arg?Thr?Val?Ala?Val?Tyr
Ser?Leu?Lys?Ile?Ala?Gly?Trp?His?Gly?Pro?Lys?Ala?Pro?Tyr?Thr?Ser?Thr?Leu
Leu?Pro?Pro?Glu?Leu?Ser?Glu?Thr?Pro?Asn?Ala?Thr?Gln?Pro?Glu?Leu?Ala?Pro
Glu?Asp?Pro?Glu?Asp?Ser?Ala?Leu?Leu?Glu?Asp?Pro?Val?Gly
3. the application of HSV1 virus gD glycoprotein extracellular region gene fragment in preparation HSV1 virus vaccines and detection reagent of the chemosynthesis of the described method preparation of claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910184631A CN101643737A (en) | 2009-08-27 | 2009-08-27 | Chemically synthesized HSV1 virus gD glycoprotein extracellular region gene fragment and expression and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910184631A CN101643737A (en) | 2009-08-27 | 2009-08-27 | Chemically synthesized HSV1 virus gD glycoprotein extracellular region gene fragment and expression and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101643737A true CN101643737A (en) | 2010-02-10 |
Family
ID=41655798
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910184631A Pending CN101643737A (en) | 2009-08-27 | 2009-08-27 | Chemically synthesized HSV1 virus gD glycoprotein extracellular region gene fragment and expression and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101643737A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773770A (en) * | 2012-10-18 | 2014-05-07 | 高峰 | Green fluorescent protein capable of being secreted out of cells and application thereof in screening of recombinant protein high-yield expression cell strain |
| CN110551745A (en) * | 2018-05-31 | 2019-12-10 | 康码（上海）生物科技有限公司 | Multiple histidine sequence tag and application thereof in protein expression and purification |
-
2009
- 2009-08-27 CN CN200910184631A patent/CN101643737A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103773770A (en) * | 2012-10-18 | 2014-05-07 | 高峰 | Green fluorescent protein capable of being secreted out of cells and application thereof in screening of recombinant protein high-yield expression cell strain |
| CN110551745A (en) * | 2018-05-31 | 2019-12-10 | 康码（上海）生物科技有限公司 | Multiple histidine sequence tag and application thereof in protein expression and purification |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110760006B (en) | African swine fever immune system targeting genetic engineering vaccine | |
| CN101525614A (en) | Human oophoroma tumor marker HE4 enzymoimmunoassay kit | |
| CN110041411B (en) | Stable atypical swine fever virus subunit protein, vaccine, preparation method and application thereof | |
| Stewart et al. | Characterization of murine gammaherpesvirus 68 glycoprotein B (gB) homolog: similarity to Epstein-Barr virus gB (gp110) | |
| CN106279378B (en) | Varicellazoster virus gE antigens and its purposes in varicella zoster virus antibody is detected | |
| CN105884902A (en) | Fusion protein of mycoplasma pneumonia protein epitope and preparation and application thereof | |
| CN116603060A (en) | Monkey poxvirus subunit vaccine and preparation method and application thereof | |
| CN105906717A (en) | Preparation method and application of Brucella multi-epitope fusion protein vaccine | |
| CN102813918B (en) | Porcine circovirus 2 type recombinant subunit vaccine and preparation method thereof | |
| Zezulak et al. | Characterization of a herpes simplex virus type 2 75,000-molecular-weight glycoprotein antigenically related to herpes simplex virus type 1 glycoprotein C | |
| CN105348391A (en) | Enteric cytopathogenic human orphan virus 6-type VP1 protein specific epitope, fusion protein of enteric cytopathogenic human orphan virus 6-type VP1 protein specific epitope and preparation method and use of fusion protein | |
| WO2015010347A1 (en) | Fine epitope peptide capable of inducing cross-reactive antibodies among homologous proteins in human papilloma virus e6 protein | |
| CN108314710A (en) | Mycoplasma pneumoniae recombination antigen and its application | |
| CN101173290B (en) | Chemically synthesized HSV1 virus gB glucoprotein extracellular region gene fragment, representation and application of the same | |
| CN107936123B (en) | Swine transmissible gastroenteritis virus fusion protein and preparation method and application thereof | |
| CN101643737A (en) | Chemically synthesized HSV1 virus gD glycoprotein extracellular region gene fragment and expression and application thereof | |
| CN104928302A (en) | Expressed rabies virus glycoprotein optimized through gene modification and monoclonal antibody and application thereof | |
| EP0957936B1 (en) | Formulations of recombinant papillomavirus vaccines | |
| CN102174091B (en) | Truncated and expressed duck plague virus (DPV) recombinant envelope gI protein and preparation method and application thereof | |
| CN101993478B (en) | Multi-epitope recombinant protein of epstein-barr (EB) virus latent membrane protein 2 and application thereof | |
| CN101787371A (en) | Chemosynthetic HSV2 virus gD glycoprotein extracellular region gene segment as well as expression and application thereof | |
| CN108059685A (en) | Swine foot-and-mouth disease virus A type Fc polypeptide vaccines and its preparation method and application | |
| CN109679970A (en) | The preparation method that feline herpesvirus I type virus quickly detects | |
| CN101440372B (en) | 18 type human papilloma virus major capsid protein L1 gene | |
| CN103740736B (en) | The HSV2 virus gE glucoprotein extracellular region gene fragment of chemosynthesis and expression, application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100210 |