CN101638665A - Construction and usage of lactobacillus single-plasmid Nisin inducible expression vector - Google Patents

Abstract

The invention provides construction and usage of lactobacillus single-plasmid Nisin inducible expression vector, which belongs to the field of biotechnology. The construction comprises: a, acquisitionand identification, the preparation of chromosome DNA producing Nisin lactococcus lactis, the design and synthesis of primer, the PCR amplification, recovery, pGEM-T connection and transformation ofa nisRK gene, and the identification of the nisRK gene; and b, the construction of pW425N, the recovery, connection and identification of the nisRK gene and a basic vector pW425et, the acquisition andidentification of inducible promoter nisA gene, and the construction of pW425N. The usage comprises: a, the acquisition and identification of a green fluorescent protein gfp gene; b, the constructionand identification of a recombinant expression vector; c, the determination of the inducible expression function of a Nisin inducible expression vector for green fluorescent protein; and d, the detection of lactobacillus stability. The invention has the advantages of avoiding the troublesome operation of integrating chromosomes of host bacteria in the prior system and simplifying the constructionof recombinant genetic-engineering lactic acid bacteria.

Description

The structure and the using method of milk-acid bacteria simple substance grain Nisin inducible expression carrier

Technical field:

The invention belongs to biological technical field.

Background technology

The definition of 1 milk-acid bacteria, distribution

Milk-acid bacteria (Lactic acid bacteria, but LAB) be the bacterium general name that a group fermentable carbohydrates produces a large amount of lactic acid.The glucose that such bacterium is Gram-positive, be spherical or shaft-like, catalase is negative, consume is used to produce lactic acid more than 50%; Do not form gemma, do not move or motoricity a little less than; But decomposing protein, but do not produce spoilage product; To the steatolysis ability a little less than.

Milk-acid bacteria is distributed more widely at occurring in nature, the Digestive tract, respiratory system, urogenital system, oral system, integumentary system and the movement that comprise humans and animals, milk and milk-product, the fruit of plant, rhizome and branches and leaves, septic plant materials, the animal food and the beverage of fermentation, compost, soil and mud, sewage, and some kinds of clinical samples etc. ^[2]

The benefit of 2 milk-acid bacterias is given birth to function

2.1 promote decomposition, the absorption of nutritive ingredient

The tropina of milk-acid bacteria can increase protein content, can be with the macro-molecular protein in the food, and part is degraded to small-molecular peptides and total free aminoacids, is beneficial to the gastro-intestinal digestion suctionization; Milk-acid bacteria can reduce lactose becomes glucose and semi-lactosi, and then further is decomposed into micromolecular compound, helps children's brain and neural growth; Milk-acid bacteria consumes the part VITAMIN in metabolic process, help increasing vitamins stability in the intestines; Milk-acid bacteria also can produce organic acid makes elements such as calcium, phosphorus, iron be in the ionic condition of easy absorption, improves its utilization ratio.

2.2 it is antibacterial disease-resistant

The antibacterial of milk-acid bacteria will be owing to its meta-bolites, and these meta-bolitess comprise acidic substance (lactic acid, acetate etc.), lactobacillin (lantibiotics, peptide class lactobacillin, protein lactobacillin and compound lactobacillin), carbonic acid gas (CO ₂) and hydrogen peroxide (H ₂O ₂) etc.Its middle acid substance can consume a large amount of cellular energies of bacterium and influence cell membrane stability; Lactobacillin can act on bacterial cell membrane, causes the leakage of matter and energy in the film.But the milk-acid bacteria zymohexose of heterofermentation produces CO ₂With mould fungus inhibition and some Gram-negative bacterias, but then invalid to some yeast and Bacterium lacticum.

2.3 regulate the digestive tube microecological balance

Milk-acid bacteria can be colonizated between surfaces such as humans and animals mucous membrane, skin or the cell in an orderly manner; occupy the gastral field planting of host site, form biological barrier, reduce the infecting of pathogenic micro-organism, field planting; play a part occupy-place, contention nutrition, antagonism, the protection body is not invaded by pathogenic bacteria.

2.4 effectively reduce cholesterol in serum content

Gililand equals to point out that in containing the hypercholesterolemia substratum of an amount of cholate, Lactobacterium acidophilum can reduce the substratum content of cholesterol by assimilating cholesterol in the cytolemma of self in 1985; Rasic etc. has also confirmed the effect that removes to cholesterol of Lactobacterium acidophilum and bifidumbacterium bifidum subsequently.

2.5 effectively alleviate hypertension

Milk-acid bacteria by extracellular protease, peptase (carboxypeptidase, aminopeptidase) is degraded into the milk-protein in the food that ACE is had inhibiting little peptide and oligopeptides.Cell wall constituent and exocellular polysaccharide as Lb.casei YIP 9018 show hypotensive activity in hyperpietic's body, some lactobacillus promotes to have the absorption of the mineral substance of blood pressure regulation effect in enteron aisle.

2.6 enhancing Intestinal Mucosal Immunity

But the mucosa-immune of milk-acid bacteria enhancing body, in health and disease individuality, milk-acid bacteria is finally induced body enhancing immunity response intensity by activating phagocytic cell, improve cytokine levels, increase natural killer cell activity (NK cell) and improving immunoglobulin level.

Milk-acid bacteria is acknowledged as microorganism (the Generallyregarded as safe of " safe class " as the probiotic bacterium in human and animal's enteron aisle, GRAS), can express the sight that the healthy and helpful functional protein of human and animal has been attracted numerous Chinese scholars with it as recipient bacterium.Be accompanied by deepening continuously of molecular biology research field, since the eighties in 20th century, milk-acid bacteria DNA recombinant technology is becoming better and approaching perfection day by day, and the genetic tool of a series of suitable milk-acid bacterias (as: expression vector) arises at the historic moment.This makes with the launch vehicle of plasmid vector as gene, functioning gene is assembled to give expression to the protein that meets people's demand in the milk-acid bacteria and become possibility.Can therefore, constructing efficiently, lactic acid bacteria expression vectors once becoming the bottleneck factor that this field of restriction is developed.

The present Research of 3 lactic acid bacteria expression vectors

Through the effort of more than ten years, also made up the expression vector of some suitable milk-acid bacterias, these carriers can be divided into constitutive expression carrier and inducible expression vector according to the type of promotor.

3.1 constitutive expression carrier

The milk-acid bacteria constitutive expression carrier has been developed the research method of three kinds of comparative maturities.(1) is based on the research of screening vector, makes plasmid and transposon carry the reporter gene of some non-promotors, for example: chloramphenicol resistance gene (cat-86), or beta-galactosidase gene (lacZ), or beta-glucosidase gene (gusA); (2) in the house-keeping gene of different bacterium, use the constitutive gene that screening of means such as pcr amplification, dna probe and purifying have strongly expressed, be used for the structure of recombinant vectors; (3) in L.lactis, filter out the strong promoter of composing type, this kind method is at present relevant for one of focus of studying in this respect, Jensen PR etc. study report, L.lactis composing type strong promoter can be carried out expression by regulating when genetic expression, and according to this promoter sequence recombinant expression vector, its activity can be up to more than 1000 times.

Yet, though the constitutive expression system has realized efficiently expressing of target protein matter, but this continue to efficiently express can cause proteinic degraded in the accumulating of intracellular protein, gathering or the tenuigenin, thereby increased the metabolism load of host bacterium, and causing the damage of host cell, this is its unfavorable factor.Given this, scientists has been explored inducible expression vector again, and by the promotor of induction type, the expression of goal gene can be subjected to the control of inductor according to people's wish.

3.2 inducible expression vector

Along with people to the deepening continuously of milk-acid bacteria genetics research, about the metabolic mechanism of milk-acid bacteria and controlling element have been studied clearly, make a series of inducible expression vectors that are suitable for milk-acid bacteria arise at the historic moment.Mainly comprise: lactose-induced expression vector, pH value inducible expression carrier, phage induction expression vector, temperature control inducible expression carrier and nisin inducible expression carrier.

However, after De Ruyter research, adopt identical method also to make up some and meet the inducible expression carrier of the type, and successfully in milk-acid bacteria, expressed tropina, materials such as enzyme, membranin, bacteriocin and some Antigens.But the main drawback that exists is that the host chromosome integration efficiency of nisRK gene is low, and host bacterium of every selection all needs it is carried out same processing, and genetic manipulation is loaded down with trivial details, and the carrier host range is narrow, thereby restricts its application.

Summary of the invention

The objective of the invention is:

A kind of structure and using method of milk-acid bacteria simple substance grain Nisin inducible expression carrier are provided, it is template that the present invention produces Nisin Lactococcus lactis chromosomal DNA with a strain, adopt round pcr amplification two-pack controlling element nisRK gene and inducible promoter nisA, with intestinal bacteria-lactic acid bacteria shuttle plasmid pW425et is carrier is carrier, integrate nisRK and replace promotor, be intended to make up milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N because of the back.And adopt green fluorescent protein gfp gene as reporter gene, and be used to detect the function of inducible expression carrier, determine the using method of inducible expression carrier.

Technical scheme of the present invention is:

The structure of milk-acid bacteria simple substance grain Nisin inducible expression carrier is:

The acquisition and the evaluation of two-pack controlling element nisRK gene

1 produces the preparation of Nisin Lactococcus lactis chromosomal DNA

-70 ℃ of frozen product Nisin Lactococcus lactis are inoculated in the fresh MRS liquid nutrient medium recover, on the recovery back bacterium liquid coating MRS culture plate, the single colony inoculation of picking is cultivated in fresh MRS liquid nutrient medium after 37 ℃ of constant temperature anaerobism overnight incubation, treats thalline OD ₆₀₀Value is 0.6～0.8 o'clock, collects thalline, extracts chromosomal DNA, and-20 ℃ of preservations are standby.

2 primer design are with synthetic

NisRK gene order (GI:473019) according to the GenBank login, adopt Primer 5.0 molecular biology softwares to carry out design of primers, the upstream and downstream primer adds Xba I and Kpn I restriction enzyme site respectively, and every primer total length 27bp is synthetic by precious biotechnology (Dalian) company limited.Primer sequence is as follows:

Upstream primer (P1): GGG TCTAGAGGA GGT AAA GTG GTG TAT;

Downstream primer (P2): GCG GGTACCTTA CTT TTT TAT TTT TAG;

The 3nisRK gene PCR increases, reclaims, is connected with pGEM-T and transforms

To produce Nisin Lactococcus lactis chromosomal DNA is template, and PCR obtains goal gene; Adopting gel to reclaim test kit reclaims the PCR product; Reclaiming product is connected by the T4DNA ligase enzyme with cloning vector pGEM-T; Connect in the product Transformed E .coli JM109 competent cell screening positive clone in the substratum that contains penbritin (200 μ g/mL).

The evaluation of 4nisRK gene

The positive bacterium colony of picking is inoculated in the LB substratum that contains penbritin (200 μ g/mL) 37 ℃ of shaking table overnight incubation.Collect thalline next day, in a small amount preparation reorganization positive plasmid pGEM-T::nisRK; And it is carried out PCR identifies and the evaluation of Xba I/Kpn I double digestion; Being sent to precious biotechnology (Dalian) company limited through the recombinant plasmid of above-mentioned evaluation, to carry out the sequence of goal gene fixed.The result shows, has successfully obtained two-pack controlling element nisRK gene, with the known array homology up to 99.9%.

(2) structure of milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N

The recovery of 1nisRK gene and carrier is carrier pW425et, be connected and evaluation

After pGEM-T::nisRK and basic plasmid pW425et used Xba I/Kpn I double digestion respectively, reclaim the purpose fragment, adopt the T4DNA ligase enzyme to connect; Connect in the product Transformed E .coli X13 competent cell, the screening sun is given birth to clone's in the LB substratum that contains erythromycin (200 μ g/mL); After preparing recombinant plasmid in a small amount, carry out PCR evaluation and Xba I/Kpn I double digestion and identify.The result shows, has successfully set up recombinant plasmid pW425et::nisRK.

The structure of acquisition, evaluation and the pW425N of 2 inducible promoter nisA genes

According to the nisA sequence of GenBank login, adopt Primer 5.0 molecular biology softwares to carry out design of primers, the upstream and downstream primer adds EcoR I and Sac I restriction enzyme site respectively, and every primer total length 24bp is synthetic by precious biotechnology (Dalian) company limited.Primer sequence is as follows:

Upstream primer (P1): GGG GAA TTCATT AAA TTC TGA AGT

Downstream primer (P2): GGG GAG CTCTTA TTT GCT TAC GTG

To produce Nisin Lactococcus lactis chromosomal DNA is template, and PCR obtains goal gene; Adopting gel to reclaim test kit reclaims the PCR product; Reclaim product and pW425et::nisRK and carry out double digestion with EcoR I/Sac I respectively, to reclaim the purpose product adopts the T4DNA ligase enzyme to connect, in the Transformed E .coli X13 competent cell, the screening sun is given birth to clone's in the LB substratum that contains erythromycin (200 μ g/mL) again; Prepare recombinant plasmid in a small amount, it is carried out PCR evaluation and the evaluation of EcoR I/Sac I double digestion; For accurately judging whether constitutive promoter P32 is replaced with inducible promoter nisA, recombinant plasmid is sent to precious biotechnology (Dalian) company limited carries out the part order-checking.The result shows, the inducible promoter nisA of acquisition and known array homology be up to 100%, and successfully replaced former constitutive promoter P32 with it, made up milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N.

The using method of milk-acid bacteria simple substance grain Nisin inducible expression carrier is:

The Function detection of milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N

The acquisition and the evaluation of 1 green fluorescent protein gfp gene

Green fluorescent protein gfp gene open reading frame sequence (GI:1674491) according to the GenBank login, adopt Primer 5.0 molecular biology softwares to carry out design of primers, the upstream and downstream primer adds Sac II and Cla I restriction enzyme site respectively, every primer total length 24bp, synthetic by precious biotechnology (Dalian) company limited.Primer sequence is as follows:

Upstream primer (p1) is: GTT CCG CGGATG ACC ATG ATT ACG

Downstream primer (P2) is: GGG ATC GATTTA TTT GTA GAG CTC

With the plasmid that contains green fluorescent protein gfp gene is template, and PCR obtains goal gene; Adopting gel to reclaim test kit reclaims the PCR product; Reclaim product and be connected in the Transformed E .coli JM109 competent cell of back screening positive clone in the LB substratum that contains penbritin (200 μ g/mL) with cloning vector pMD18-T; Prepare recombinant plasmid pMD18-T::gfp in a small amount, and it is carried out PCR evaluation, the evaluation of SacII/Cla I double digestion and order-checking identify.The result shows, has successfully obtained green fluorescent protein gfp gene, with the known array homology up to 100%.

The structure of 2 recombinant expression vector pW425N::gfp and evaluation

PMD18-T::gfp and expression vector pW425N are carried out double digestion with Sac II/Cla I respectively, reclaim the purpose fragment, adopt the T4DNA ligase enzyme to connect, connect the product electricity and transform separation in the lactobacillus competent cell in chitling road, screening positive clone in the MRS substratum that contains erythromycin (400 μ g/mL); Prepare recombinant expression vector pW425N::gfp in a small amount and it is carried out PCR evaluation and the evaluation of Sac II/Cla I double digestion.

The 3Nisin inducible expression carrier is to the mensuration of green fluorescent protein abduction delivering function

(1) determines that pig source lactobacillus tolerates concentration (RC) and minimal inhibitory concentration (MIC) to Nisin

Lactobacillus single colony inoculation in picking pig source is in the fresh MRS substratum that contains erythromycin (400 μ g/mL), and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, gets bacterium liquid and is inoculated in respectively in the MRS substratum that contains different concns Nisin (10ng/mL, 20ng/mL, 30ng/mL, 40ng/mL, 50ng/mL, 60ng/mL) in 1: 100 ratio.37 ℃ of constant temperature anaerobism are measured bacterium liquid OD after cultivating 24h ₆₀₀Value is to determine tolerance concentration and the minimal inhibitory concentration of recombination lactic acid bacillus to Nisin.

(2) determine to add Nisin to the gene induced expression time-histories of gfp

The positive bacterium of recombinating is inoculated in the MRS substratum of 50mL, and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, adds 10ng/mL Nisin and carries out abduction delivering.Bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, is designated as and induces 0h, behind the interpolation Nisin, gets bacterium liquid 2mL every 1h, connects and gets 7h; At last the bacterium liquid of above-mentioned collection is transferred OD with MRS ₆₀₀Value is 0.6～0.8,4 ℃, 4000r/min, and centrifugal 10min, precipitation is cleaned three times with stroke-physiological saline solution, is resuspended at last in the 3mL physiological saline.Adopt the relative intensity of fluorescence of spectrophotofluorometer under working sample 509nm wavelength under the exciting light 460nm wavelength, determine that the suitableeest abduction delivering time is 3h.

(3) determine the optimum concn of the required Nisin of the gene induced expression of gfp

The positive bacterium of recombinating is inoculated in the MRS substratum of 50mL, and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, adds Nisin in substratum, makes final concentration be respectively 10ng/mL, 15ng/mL, 20ng/mL, 25ng/mL, 30ng/mL, 35ng/mL, 40ng/mL, 45ng/mL, 50ng/mL, 55ng/mL, 60ng/mL; Behind the abduction delivering, get not sample 3mL on the same group respectively, the bacterium liquid of collecting is transferred OD with MRS ₆₀₀Value is 0.6～0.8,4 ℃, 4000r/min, and centrifugal 10min, precipitation is cleaned three times with stroke-physiological saline solution, is resuspended at last in the 3mL physiological saline.Adopt the relative intensity of fluorescence of spectrophotofluorometer under working sample 509nm wavelength under the exciting light 460nm wavelength, determine that the required Nisin concentration of best abduction delivering is 30ng/mL.

(4) SDS-PAGE electrophoretic analysis

Positive recombination lactic acid bacillus is inoculated in the MRS substratum of 50mL, 37 ℃ are cultured to bacterium liquid OD ₆₀₀Value is that 0.6～0.8 o'clock interpolation Nisin induces destination gene expression.Bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, is designated as and induces 0h, behind the interpolation Nisin, gets bacterium liquid 1.5mL every 1h, connects and gets 6h; At last the bacterium liquid of above-mentioned collection is transferred OD ₆₀₀Value is 0.6～0.8,4 ℃, and 12 000r/min abandon supernatant behind the centrifugal 5min, adds 50 μ L one and heats up in a steamer water, 45 μ L sample-loading buffers, 5 μ L dithiothreitol (DTT), and last sample carried out the SDS-PAGE electrophoresis after boiling water boiled 10min; After electrophoresis finishes, adopt Xylene Brilliant Cyanine G to dye, after imager is observed, successfully obtained the green fluorescent protein of 27kDa, conform to the expection size.

4 recombination lactic acid bacillus Detection of Stability

The recombination lactic acid bacillus was reached for 50 generations in the MRS substratum that contains erythromycin (400 μ g/mL), extract recombinant plasmid pW425N::gfp, it is carried out enzyme cut evaluation and PCR evaluation; Simultaneously, get bacterium liquid 100 μ L, make gramstaining and fluorescence microscope respectively after 10 times of dilutions.The result shows that constructed carrier still can stably exist and expressing green fluorescent protein in milk-acid bacteria after reaching for 50 generations.

The invention has the beneficial effects as follows:

The milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N that 1 the present invention is constructed, two-pack controlling element nisRK gene and inducible promoter nisA are bonded in one, effectively avoid this system in the past the host bacterium has been carried out the troublesome operation of chromosomal integration, simplified the structure of recombination engineering milk-acid bacteria greatly.

2 carry out Function detection as reporter gene to inducible expression carrier pW425N with green fluorescent protein gfp gene, the result shows, the controlled strictness of this carrier is not expressed under the non-inductive condition, has solved the problem that causes the damage of host bacterium because of constitutive expression carrier continuous expression protein; The Nisin working concentration that pW425N carries out the heterologous gene abduction delivering is 30ng/mL, and best induction time is 3h, compares with other inducible expression carriers, and required inductor dosage is little, and induction time is short.

3 with the launch vehicle of milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N as gene; can be with to the useful homology of human and animal or the gene of the relevant enzymes (as food flavor enzyme, phytase etc.) in allos goal gene (as the protective antigen of some hormone, nutritive substance, vaccine, the medicine gene that keeps healthy and cure the disease) or related food and the fodder industry; be assembled in the milk-acid bacteria, obtain recombination engineering milk-acid bacteria.Utilize technology such as high density fermentation, purifying to obtain a large amount of purpose products, in order to preparation functional living being engineering product; Or directly recombination engineering milk-acid bacteria is made oral preparations, and make it become in human and animal's body " job shop " that makes biologically active substance, remove required loaded down with trivial details, the complicated back purifying technique of general genetic engineering bacterium (as intestinal bacteria etc.) from.Recombination engineering milk-acid bacteria has the dual-use function of genetic expression and prebiotic effect concurrently as oral preparations, is used for industrial circles such as food, feed, medicine, health care, has broad application prospects and important social and economic benefit.

Description of drawings

Fig. 1 .L.lactis chromosomal DNA extracts, M: λ DNA/Hind III marker; 1:L.lactis chromosomal DNA.

The pcr amplification C of Fig. 2 .nisRK gene: negative control (water is template); M:DL 2000marker; The 1:PCR amplified production.

Fig. 3 .nisRK purpose fragment reclaims purifying M:DL 2000marker after adding A; 1:nisRK reclaims after adding A; The 2:nisRKPCR product reclaims.

Fig. 4. recombinant plasmid pGEM-T::nisRK prepares M in a small amount: λ DNA/Hind III marker; The preparation of 1-24:24 strain reorganization E.coliJM109 plasmid.

Fig. 5. recombinant plasmid pGEM-T::nisRK PCR identification of M: DL 2000marker; 1:No.1 recombinant chou PCR product; 2:No.10 recombinant chou PCR product; 3:No.20 recombinant chou PCR product; 4:No.7 recombinant chou PCR product; 5: negative control.

Fig. 6 .pGEM-T::nisRK plasmid enzyme restriction identification of M 1:DL 2000marker; M2: λ DNA/Hind III marker; 1:No.1 plasmid Kpn I/Xba I enzyme is cut; 2:No.10 plasmid Kpn I/Xba I enzyme is cut; 3:No.20 plasmid Kpn I/Xba I enzyme is cut.

Fig. 7 .nisRK gene and template sequence homology comparison sequencing result and original template sequence homology are 99.9%.

Fig. 8 .nisRK gene and pW425et reclaim purifying M1: λ DNA/Hind III marker; 1:pW425et; The 2:nisRK gene; M2:DL 2000marker.

Fig. 9. recombinant vectors pW425et::nisRK prepares M in a small amount: λ DNA/Hind III marker; 1,2: prepare plasmid in a small amount.

Figure 10 .pW425et::nisRK PCR identification of M: DL 2000marker; 1:No.1 be template PCR result; 2:No.2 be template PCR result; C: negative control.

Figure 11. recombinant plasmid pW425et::nisRK enzyme is cut identification of M 1: λ DNA/Hind III marker; 1: the little upgrading grain of recombinant vectors; 2:Kpn I single endonuclease digestion recombinant vectors; 3:Kpn I/Xba I double digestion recombinant vectors; M2:DL 2000marker.

Figure 12. inducible promoter nisA pcr amplification M:DL 2000marker; 1, the 2:nisA pcr amplification product; C: negative control (water is template).

The recovery purifying M1:DL 2000marker of Figure 13 .nisA and pW425et::nisRK; 1:nisA reclaims product; 2:pW425et::nisRK reclaims product; M2: λ DNA/Hind III marker.

Figure 14. contain the preparation M of nisA recombinant vectors: λ DNA/HindIII marker; 1-4: plasmid preparation.

Figure 15. contain nisA recombinant vectors PCR identification of M: DL 2000marker; C: negative control (water is template); 1: carrier is a template PCR product before replacing; 2: replacing the back plasmid is template PCR product.

Figure 16. the enzyme that contains the nisA recombinant vectors is cut identification of M 1: λ DNA/Hind III marker; 1: recombinant vectors EcoR I/Sac I enzyme is cut evaluation; M2:DL 2000marker.

Figure 17 .Nisin inducible expression carrier pW425N collection of illustrative plates carrier is carrier pW425et is intestinal bacteria-lactic acid bacteria shuttle carrier, and size is 4.8kb, contains erythromycin resistance gene and thymidylate synthase gene (a); For realizing the nisin abduction delivering, integrated (b) behind the two-pack controlling element nisRK gene, constitutive promoter P32 on the original vector being replaced with inducible promoter nisA, made up nisin inducible expression carrier pW425N (c). Figure 20 .P-GFP plasmid prepares M: λ DNA/Hind III marker; 1, the 2:P-GFP plasmid.

The pcr amplification M:DL 2000marker of Figure 18 .gfp gene; 1, the 2:gfpPCR product.

Figure 19 .gfp gene reclaims purifying M:DL 2000marker; 1,2:gfp reclaims purified product.

Figure 20. recombinant plasmid pMD18-T::gfp prepares 1 in a small amount: λ DNA/Hind III marker; The 1-4:pMD18-T::gfp recombinant plasmid.

Figure 21. recombinant plasmid pMD18-T::gfp enzyme is cut identification of M 1: λ DNA/HindIII marker; 1,2: the recombinant plasmid enzyme is cut product; M2:DL 2000marker.

Figure 22. the recovery purifying M1:DL 2000marker of carrier and gfp gene; The 1:gfp gene; 2: carrier pW425N; M2: λ DNA/Hind III marker.

Figure 23. the preparation M of recombinant expression vector pW425N::gfp: λ DNAHindIII marker; 1,2,3: recombinant expression vector pW425N::gfp.

Figure 24. recombinant vectors pW425N::gfpPCR identification of M: DL 2000marker; 1,2: with No.3 and No.4 is template PCR product, C: negative control (water is template).

Figure 25. recombinant vectors pW425N::gfp enzyme is cut identification of M 1: λ DNA/Hind III marker; 1,2:Sac II and Cla I double digestion pW425N::gfp; M2:DL 2000marker.

Figure 26. the recombination lactic acid bacillus is to the sensitive concentration of nisin.

Figure 27. the recombination lactic acid bacillus is expressed the relative intensity of fluorescence of GFP and the analysis of induction time.

Figure 28. relative intensity of fluorescence and nisin that the recombination lactic acid bacillus is expressed GFP add the analysis of concentration.

Figure 29 .SDS electrophoresis detection gfp gene expression product C: empty carrier pW425N is expression product in the lactobacillus of pig source; M: low molecular weight protein (LMWP) marker; 1:pW425N::gfp 0h abduction delivering product; 2～7:pW425N::gfp, 1～6h expression product.

Figure 30. recombination lactic acid bacillus gramstaining is observed.

Figure 31. the fluorescence microscope of recombination lactic acid bacillus.

Figure 32. add the relative intensity of fluorescence of different induction time green fluorescent proteins under the 10ng/mLNisin condition.

Figure 33. different concns Nisin induces the relative intensity of fluorescence of green fluorescent protein behind the 3h.

Embodiment

Embodiment 1

(1) acquisition and the evaluation of two-pack controlling element nisRK gene

1 main test materials and molecular biology reagent

(1) bacterial strain and plasmid vector

Produce the Nisin Lactococcus lactis, E.coli JM109 competent cell; The pGEM-T plasmid vector.

(2) toolenzyme and main agents

The Pfu archaeal dna polymerase, T4 dna ligase, Xba I and Kpn I restriction enzyme, Ex Taq archaeal dna polymerase, dNTP, the RNA enzyme, DNA A-Tailing test kit, dna gel reclaims test kit, karyomit(e) extracts test kit, and plasmid extracts reagent, penbritin etc.

(3) substratum

The special-purpose MRS substratum of milk-acid bacteria, LB intestinal bacteria substratum contains the LB substratum of penbritin.

2 produce the preparation of Nisin Lactococcus lactis chromosomal DNA

Adopt karyomit(e) to extract test kit, the Lactococcus lactis chromosomal DNA is extracted in the by specification operation, gets 2 μ L and carries out the detection of 0.8% agarose gel electrophoresis.The result has successfully obtained the Lactococcus lactis chromosomal DNA, as shown in Figure 1.

3 primer design are with synthetic

NisRK gene order (GI:473019) according to the GenBank login, adopt Primer 5.0 molecular biology softwares to carry out design of primers, the upstream and downstream primer adds Xba I and Kpn I restriction enzyme site respectively, and every primer total length 27bp is synthetic by precious biotechnology (Dalian) company limited.Primer sequence is as follows:

Upstream primer (P1): GGG TCT AGAGGA GGT AAA GTG GTG TAT;

Downstream primer (P2): GCG GGT ACCTTA CTT TTT TAT TTT TAG;

The 4nisRK gene PCR increases, reclaims, is connected with pGEM-T and transforms

(1) pcr amplification of nisRK gene

(2) PCR reaction system: upstream primer (P1,10 μ mol/L) 1.0 μ L

Downstream primer (P2,10 μ mol/L) 1.0 μ L

dNTP(2.5mmol/L) 4.0μL

10×Pfu?Buffer 5.0μL

PfuDNA polysaccharase (5U/ μ L) 0.25 μ L

Template DNA 1.0 μ L

ddH ₂O 37.75μL

Whiteruss 50.0 μ L

Total?V 100.0μL

Reaction conditions: 94 ℃ of pre-sex change 8min; 94 ℃ of sex change 1min, 55 ℃ of annealing 1.5min, 72 ℃ of extension 2min move 30 circulations altogether; Last 72 ℃ of total elongation 10min.After reaction finishes, get 2 μ L and carry out the detection of 0.8% agarose gel electrophoresis, the result purpose band occurs at the 2035bp place, conforms to the expection size, as shown in Figure 2.

(2) recovery of nisRK gene

Adopt Axygen company dna gel to reclaim test kit, operation is reclaimed goal gene to specifications; Be connected with pGEM-T for ease of the purpose fragment, add A at recovery fragment end and handle.

End adds the A reaction system:

10×A-Tailing?Buffer 5.0μL

dNTP(2.5mmol/L) 4.0μL

The nisRK gene reclaims fragment 8.0 μ L

A-Tailing?Enzyme(5U/μL) 0.5μL

ddH ₂O 32.5μL

Total?V 50.0μL

Reaction conditions: 72 ℃ of water-bath 30min, ice bath 2min; Reclaim the purpose fragment, get 2 μ L and carry out the detection of 0.8% agarose gel electrophoresis, the result as shown in Figure 3.

(3) the nisRK gene is connected with pGEM-T

Linked system:

2×Ligase?Buffer 5.0μL

End adds A fragment 3.5 μ L

pGEM-T 0.5μL

T4DNA ligase enzyme (3U/ μ L) 1.0 μ L

Total?V 10.0μL

Reaction conditions: 21 ℃ connect 2h, and 4 ℃ of connections are spent the night; Next day Transformed E .coli JM109 competent cell.

(4) recombinant plasmid pGEM-T::nisRK transforms

Get 10 μ L connection mixture and add in the 200 μ L E.coli JM109 competent cells ice bath 30min behind the mixing; 42 ℃ of heat shock 90s, ice bath 5min immediately; Add 800 μ L fresh liquid LB substratum, 37 ℃, the 150r/min shaking table is cultivated 2～3h; Get 50 μ L, 100 μ L, 150 μ L respectively, 200 μ L bacterium liquid are coated ready containing on penbritin (200 μ g/mL) the LB agar plate, cultivate 8～16h for 37 ℃, screening recombinant clone.

The evaluation of 5nisRK gene

(1) reorganization positive plasmid pGEM-T::nisRKPCR identifies

Get 1 μ L behind the test kit extraction plasmid and carry out the detection of 0.8% agarose gel electrophoresis, as shown in Figure 4.In 24 samples, choose 4 (No.1, No.7, No.10, No.20) and carry out the PCR evaluation.

The PCR reaction system:

Upstream primer (P1,10 μ mol/L) 1.0 μ L

Downstream primer (P2,10 μ mol/L) 1.0 μ L

dNTP(2.5mmol/L) 2.0μL

10×Ex?Taq?Buffer 2.5μL

Ex TaqDNA polysaccharase (5U/ μ L) 0.2 μ L

Template plasmid 1.0 μ L

ddH ₂O 17.3μL

Whiteruss 25.0 μ L

Total?V 50.0μL

Reaction conditions: 94 ℃ of pre-sex change 90s; 94 ℃ of sex change 60s, 55 ℃ of annealing 45s, 72 ℃ of extension 50s move 30 circulations altogether; Last 72 ℃ of total elongation 2min.After reaction finishes, get 2 μ L and carry out the detection of 0.8% agarose gel electrophoresis, the result is that No.1, No.10, No.20 all the purpose band occurs at about 2035bp place, and with No.7 plasmid and ddH ₂O is that template does not then have any band, but the positive recombinant plasmid of preliminary judgement former three, as shown in Figure 5.

(2) reorganization positive plasmid pGEM-T::nisRK enzyme is cut evaluation

No.1, No.10, the doubtful reorganization positive plasmid of No.20 are carried out Kpn I/XbaI double digestion identify that enzyme is cut system:

10×Multi-Core?Buffer 1.0μL

BSA(1mg/mL) 1.0μL

pGEM-T::nisRK 1.0μL

Xba?I(12U/μL) 0.25μL

KpnI(12U/μL) 0.25μL

ddH ₂O 6.5μL

Total?V 10.0μL

Reaction conditions: 37 ℃ of water-bath 3h.After the end, get 2 μ L and carry out the detection of 0.8% agarose gel electrophoresis.The result is that three recombinant plasmids all are cut to the carrier band of 3000bp and the purpose band of 2035bp, as shown in Figure 6.

(3) order-checking of nisRK gene is identified

For determining to obtain the accuracy of nisRK gene, respectively No.1, No.10, No.20 reorganization E.coli JM109 are sent to precious biotechnology (Dalian) company limited and carry out the order-checking of goal gene, sequencing result adopts DNAStar molecular biology software to carry out sequential analysis and homology compares.The result is that No.10, No.20 occur base respectively and lose phenomenon (owing to the unlisted gene order of length reason), has only No.1 sequencing result conform to the nisRK gene size of (GI:473019) login among the GenBank (2035bp); And only there are two place's bases to undergo mutation, compare homology up to 99.9% with template sequence

(2) structure of milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N

1 main test materials and molecular biology reagent

(1) bacterial strain and plasmid vector

E.coli X13 competent cell; Intestinal bacteria-lactic acid bacteria shuttle plasmid pW425et; PGEM-T::nisRK.

(2) toolenzyme and main agents

The PfuDNA polysaccharase, the T4DNA ligase enzyme, EcoR I and Sac I restriction enzyme, Ex Taq archaeal dna polymerase, dNTP, the RNA enzyme, dna gel reclaims test kit, plasmid extraction kit, erythromycin, thymidylic acid etc.

(3) substratum

Common LB substratum; The LB substratum that contains erythromycin; The LB substratum that contains thymidylic acid.

The recovery of 2nisRK gene and carrier is carrier pW425et, be connected and evaluation

(1) endonuclease bamhi of nisRK gene and carrier is carrier pW425et reclaims

Adopt Xba I and Kpn I restriction enzyme respectively recombinant plasmid pGEM-T::nisRK and pW425et to be carried out double digestion, to obtain nisRK gene and the big fragment of pW425et; The double digestion system is as follows:

10×Multi-Core?Buffer 2.0μL

BSA(1mg/mL) 2.0μL

Recombinant plasmid (or carrier) 2.0 μ L

Xba?I(12U/μL) 0.5μL

Kpn?I(12U/μL) 0.5μL

ddH ₂O 13.0μL

Total?V 20.0μL

Reaction conditions: 37 ℃ of water-bath 3h.After the end, adopt Axygen company dna gel to reclaim test kit, operation is reclaimed it to specifications, gets 2 μ L and carries out the detection of 0.8% agarose gel electrophoresis, and the result as shown in Figure 7.

(2) nisRK is connected because of reclaiming fragment with pW425et

Adopting the T4DNA ligase enzyme that the nisRK gene is cut back to close fragment with the pW425et enzyme is connected.Linked system is as follows:

10×Ligation?Buffer 1.0μL

The nisRK gene reclaims product 6.0 μ L

PW425et reclaims product 2.0 μ L

T4DNA ligase enzyme (3U/ μ L) 1.0 μ L

Total?V 10.0μL

Reaction conditions: 21 ℃ connect 5h, and 4 ℃ are spent the night; Next day Transformed E .coli X13 competent cell.

(3) recombinant plasmid pW425et::nisRK transforms

Get 10 μ L connection mixture and add in the 200 μ L E.coli X13 competent cells ice bath 30min behind the mixing; 42 ℃ of heat shock 90s, ice bath 5min immediately; Add 800 μ L fresh liquid LB substratum, 37 ℃, the 150r/min shaking table is cultivated 2～3h; Get 50 μ L, 100 μ L, 150 μ L respectively, 200 μ L bacterium liquid are coated ready containing on erythromycin (200 μ g/mL) the LB agar plate, cultivate 8～16h for 37 ℃, screening recombinant clone.

(4) recombinant plasmid pW425et::nisRK PCR identifies

Get 1 μ L behind the test kit extraction recombinant plasmid and carry out the detection of 0.8% agarose gel electrophoresis, as shown in Figure 8.It is carried out PCR identifies that the PCR reaction system is as follows:

Upstream primer (P1,10 μ mol/L) 1.0 μ L

Downstream primer (P2,10 μ mol/L) 1.0 μ L

dNTP(2.5mmol/L) 2.0μL

10×Ex?Taq?Buffer 2.5μL

Ex Taq archaeal dna polymerase (5U/ μ L) 0.2 μ L

Template plasmid 1.0 μ L

ddH ₂O 17.3μL

Whiteruss 25.0 μ L

TotalV 50.0μL

Reaction conditions: 94 ℃ of pre-sex change 90s; 94 ℃ of sex change 60s, 55 ℃ of annealing 45s, 72 ℃ of extension 50s move 30 circulations altogether; Last 72 ℃ of total elongation 2min.After reaction finishes, getting 2 μ L and carry out 0.8% agarose gel electrophoresis and detect, is template with the No.1 recombinant plasmid in two samples that the result detects, and band occurs at about 2035bp place; With No.2 recombinant plasmid and ddH ₂O is a template, does not then have the purpose band, the positive recombinant chou of No.1 recombinant plasmid possibility is described, as shown in Figure 9.

(5) recombinant plasmid pW425et::nisRK enzyme is cut evaluation

Adopt Xba I and Kpn I restriction enzyme that the No.1 recombinant plasmid is carried out double digestion and identify, it is as follows that enzyme is cut system:

10×Multi-Core?Buffer 1.0μL

BSA(1mg/mL) 1.0μL

pW425et::nisRK 2.0μL

XbaI(12U/μL) 0.25μL

Kpn?I(12U/μL) 0.25μL

ddH ₂O 5.5μL

Total?V 10.0μL

Reaction conditions: 37 ℃ of water-bath 3h.After the end, get 2 μ L and carry out the detection of 0.8% agarose gel electrophoresis.The result occurs tangible band respectively at about 4800bp and 2035bp place, confirms that further the nisRK gene correctly is connected with carrier, as shown in figure 10.

The structure of acquisition, evaluation and the pW425N of 3 inducible promoter nisA genes

(1) design of primers

According to the nisA sequence of GenBank login, adopt Primer 5.0 molecular biology softwares to carry out design of primers, the upstream and downstream primer adds EcoR I and Sac I restriction enzyme site respectively, and every primer total length 24bp is synthetic by precious biotechnology (Dalian) company limited.Primer sequence is as follows:

Upstream primer (P1): GGG GAA TTCATT AAA TTC TGA AGT

Downstream primer (P2): GGG GAG CTCTTA TTT GCT TAC GTG

(2) inducible promoter nisA pcr amplification

To produce Nisin Lactococcus lactis chromosomal DNA is template, and PCR obtains goal gene; The PCR reaction system is as follows:

Upstream primer (P1,10 μ mol/L) 1.0 μ L

Downstream primer (P2,10 μ mol/L) 1.0 μ L

dNTP(2.5mmol/L) 4.0μL

10×PfuBuffer 5.0μL

Pfu archaeal dna polymerase (5U/ μ L) 0.25 μ L

Template DNA 1.0 μ L

ddH ₂O 37.75μL

Whiteruss 50.0 μ L

TotalV 100.0μL

PCR reaction conditions: 94 ℃ of pre-sex change 2min; 94 ℃ of sex change 60s, 56 ℃ of annealing 45s, 72 ℃ of extension 50s move 30 circulations altogether; Last 72 ℃ of total elongation 2min.After reaction finishes, get 2 μ L and carry out the detection of 0.8% agarose gel electrophoresis, the result successfully amplifies the inducible promoter nisA of 251bp, conforms to the expection size, as shown in figure 11.

(3) replacement of promotor

NisA PCR product and pW425et::nisRK are carried out double digestion digestion, and the double digestion system is as follows:

10×MBuffer 2.0μL

Purpose fragment (or carrier) 3.0 μ L

EcoRI(12U/μL) 1.5μL

Sac?I(12U/μL) 1.5μL

ddH ₂O 12.0μL

Total?V 20.0μL

Reaction conditions: 37 ℃ of water-bath 4h.After the end, get 1 μ L and carry out the detection of 0.8% agarose gel electrophoresis, as shown in figure 12.Adopt Axygen company dna gel to reclaim test kit, operation is to specifications cut the back goal gene to enzyme and is reclaimed purifying, and purified product adopts the T4DNA ligase enzyme to connect, and linked system is as follows:

2×Ligase?Buffer 5.0μL

NisA reclaims product 3.0 μ L

Carrier recovery product 1.0 μ L

T4DNA ligase enzyme (3U/ μ L) 1.0 μ L

Total?V 10.0μL

Reaction conditions: 21 ℃ connect 3h, and 4 ℃ of connections are spent the night; Behind the next day Transformed E .coliX13, little upgrading grain is identified.

(4) containing promotor nisA recombinant vectors PCR identifies

Test kit extraction recombinant plasmid is got 1 μ L and is carried out the detection of 0.8% agarose gel electrophoresis, as shown in figure 13.With improved carrier (No.3) is template, nisA is carried out PCR identify; And do negative control with carrier before replacing and water respectively, the PCR reaction system is as follows:

Upstream primer (10 μ mol/L)) 1.0 μ L

Downstream primer (10 μ mol/L)) 1.0 μ L

dNTP(2.5mmol/L) 2.0μL

10×Ex?Taq?Polymerase?Buffer 2.5μL

ExTaq?DNA?polymerase(5U/μL) 0.2μL

Template 1.0 μ L

ddH ₂O 17.3μL

Whiteruss 25.0 μ L

TotalV 50.0μL

PCR reaction conditions: 94 ℃ of pre-sex change 90s; 94 ℃ of sex change 50s, 56 ℃ of annealing 45s, 72 ℃ of extension 50s move 30 circulations altogether; Last 72 ℃ of total elongation 90s.After reaction finishes, get 2 μ L and carry out the detection of 0.8% agarose gel electrophoresis, the result is that the PCR product of template the purpose band occurs at about 251bp place with the No.3 plasmid, conform to the expection size, and control group does not have any band, and preliminary explanation is incorporated into desired location with nisA, as shown in figure 14.

(5) contain promotor nisA recombinant vectors enzyme and cut evaluation

The above-mentioned recombinant vectors of identifying through PCR is carried out EcoR I and the evaluation of Sac I double digestion, and the double digestion system is as follows:

10×MBuffer 1.0μL

Recombinant vectors 2.0 μ L

EcoRI(12U/μL) 1.0μL

SacI(12U/μL) 1.0μL

ddH ₂O 5.0μL

TotalV 10.0μL

Reaction conditions: 37 ℃ of water-bath 4h.After the end, get 1 μ L and carry out the detection of 0.8% agarose gel electrophoresis.The result occurs tangible band respectively at about 6.7kb and 251bp place, has confirmed that further constitutive promoter P32 is by wholly replace, as shown in figure 15.

(6) inducible promoter nisA order-checking is identified

Recombinant vectors is sent to precious biotechnology (Dalian) company limited carries out part order-checking, sequencing result and known array are compared, and the result shows that the inducible promoter nisA of replacement does not have base and loses, and compare homology with known array and reach 100%.Therefore, successfully obtained simple substance grain Nisin inducible expression carrier pW425N, the carrier collection of illustrative plates as shown in figure 16.

Sbjct?1006?ATTAAATTCTGAAGTTTGTTAGATACAATGATTTCGTTCGAAGGAACTACAAAATAAATT 1065

Query?1 ------------------------------------------------------------ 60

Sbjct?1066?ATAAGGAGGCACTCAAAATGAGTACAAAAGATTTTAACTTGGATTTGGTATCTGTTTCGA 1125

Query?61 ------------------------------------------------------------ 120

Sbjct?1126?AGAAAGATTCAGGTGCATCACCACGCATTACAAGTATTTCGCTATGTACACCCGGTTGTA 1185

Query?121 ------------------------------------------------------------ 180

Sbjct?1186?AAACAGGAGCTATGATGGGTTGTAACATGAAAACAGCAACTTGTCATTGTAGTATTCACG 1245

Query?181 ------------------------------------------------------------ 240

Sbjct?1246?TAAGCAAATAA?1256

Query?241 -----------?251

(3) Function detection of milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N

1 main test materials and molecular biology reagent

(1) bacterial strain and plasmid vector

Pig source lactobacillus; The plasmid P-GFP that contains green fluorescence protein gene; Nisin inducible expression carrier pW425N.

(2) toolenzyme and main agents

Ex Taq archaeal dna polymerase, T4DNA ligase enzyme, SacII and Cla I restriction enzyme, dNTP, the RNA enzyme, dna gel reclaims test kit, plasmid extraction kit, DNA cleaning agents box, glycine, Xylene Brilliant Cyanine G, tetrabromophenol sulfonphthalein, ammonium persulphate, TEMED solution; Nisin (Nisin), dithiothreitol (DTT) (DTT); Penbritin, erythromycin, thymidylic acid etc.

(3) substratum

The special-purpose MRS substratum of milk-acid bacteria, contain 2% glycine the MRS substratum, contain the MRS substratum of erythromycin (400 μ g/mL) and thymidylic acid (100 μ g/mL); Intestinal bacteria LB substratum, contain penbritin (200 μ g/mL) LB substratum.

2 green fluorescent protein gfp genes obtain and identify

(1) design of primers

Green fluorescent protein gfp gene open reading frame sequence (GI:1674491) according to the GenBank login, adopt Primer 5.0 molecular biology softwares to carry out design of primers, the upstream and downstream primer adds SacII and Cla I restriction enzyme site respectively, every primer total length 24bp, synthetic by precious biotechnology (Dalian) company limited.Primer sequence is as follows:

Upstream primer (P1) is: GTT CCG CGG ATG ACC ATG ATT ACG

Downstream primer (P2) is: GGG ATC GAT TTA TTT GTA GAG CTC

(2) gfp gene PCR amplification

Preparation contains the plasmid P-GFP of gfp gene in a small amount, gets 1 μ L and carries out the detection of 0.8% agarose gel electrophoresis, as shown in figure 17.And be template with it, PCR obtains goal gene; The PCR reaction system is as follows:

Upstream primer (P1,10 μ mol/L) 1.0 μ L

Downstream primer (P2,10 μ mol/L) 1.0 μ L

dNTP(2.5μmol/L) 4.0μL

10×Ex?Taq?Buffer 5.0μL

Ex Taq archaeal dna polymerase (5U/ μ l) 0.25 μ L

Template plasmid 1.0 μ L

ddH ₂O 37.75μL

Whiteruss 50.0 μ L

TotalV 100.0μL

PCR reaction conditions: 94 ℃ of pre-sex change 90s; 94 ℃ of sex change 60s, 57 ℃ of annealing 45s, 72 ℃ are extended 50s, move 30 circulations altogether; Last 72 ℃ of total elongation 2min get 1 μ L and carry out the detection of 0.8% agarose gel electrophoresis after reaction finishes.The result purpose band occurs at about 792bp place, as shown in figure 18, conforms to the expection size.

(3) the gfp gene reclaims, is connected with pMD18-T and transforms

Adopt Axygen company dna gel to reclaim test kit, the gfp gene is reclaimed in operation to specifications, gets 1 μ L and carries out the detection of 0.8% agarose gel electrophoresis, as shown in figure 19.Reclaim product and be connected with pMD18-T, linked system is as follows:

pMD18-T 0.8μL

Gfp reclaims product 3.2 μ L

ddH ₂O 1.0μL

Solution?I 5.0μL

Total 10.0μL

Reaction conditions: 16 ℃ connect 4h, 4 ℃ of connections of spending the night; Next day Transformed E .coli JM109 competent cell.

(4) recombinant plasmid pMD18-T::gfp enzyme is cut evaluation

Test kit extracts recombinant plasmid, gets 1 μ L and carries out the detection of 0.8% agarose gel electrophoresis, as shown in figure 20.Adopt restriction enzyme SacII and Cla I respectively No.1 and No.2 recombinant plasmid to be carried out enzyme and cut evaluation.Because restriction enzyme SacII and Cla I do not have shared reaction buffer, cut so at first carry out the SacII enzyme, reclaim and carry out Cla I enzyme again behind the linear plasmid and cut, it is as follows that enzyme is cut system:

10×TBuffer 2.0μL

BSA(1mg/mL) 2.0μL

pMD18-T::gfp 2.0μL

SacII(12U/μL) 1.0μL

ddH ₂O 13.0μL

TotalV 20.0μL

Reaction conditions: 37 ℃ of water-bath 2h.After the end, adopt DNA cleaning agents box to remove remaining enzyme and ion, carry out Cla I enzyme then and cut, it is as follows that enzyme is cut system:

10×MBuffer 1.0μL

Linear pMD18-T::gfp 2.0 μ L

ClaI(12U/μL) 1.0μL

ddH ₂O 6.0μL

TotalV 10.0μL

Reaction conditions: 37 ℃ of water-bath 2h, get 1 μ L after reaction finishes and carry out the detection of 0.8% agarose gel electrophoresis, the result occurs the purpose band respectively at about 2692bp and 792bp place, the gfp gene (792bp) that further confirms amplification correctly is connected with cloning vector pMD18-T (2692bp), as shown in figure 21.

(5) sequencing of gfp gene:

For further determining the accuracy of clone's gained gfp gene order, No.1, No.2 reorganization E.coli JM109 is sent to precious biotechnology (Dalian) company limited carries out the order-checking of goal gene, sequencing result adopts DNAStar molecular biology software to carry out sequential analysis and homology compares.The result shows, successfully clones the gfp gene, and sequence (GI:1674491) homology of landing with GenBank reaches 100%,

Sbjct?217?ATGACCATGATTACGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCGGGTA 276

Query?1 ------------------------------------------------------------ 60

Sbjct?277?CCGGTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTG 336

Query?61 ------------------------------------------------------------ 120

Sbjct?337?GTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGC 396

Query?121?------------------------------------------------------------ 180

Sbjct?397?GATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTG 456

Query?181?------------------------------------------------------------ 240

Sbjct?457?CCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCC 516

Query?241?------------------------------------------------------------ 300

Sbjct?517?GACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAG 576

Query?301?------------------------------------------------------------ 360

Sbjct?577?CGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAG 636

Query?361?------------------------------------------------------------ 420

Sbjct?637?GGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAAC 696

Query?421?------------------------------------------------------------ 480

Sbjct?697?ATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGAC 756

Query?481?------------------------------------------------------------ 540

Sbjct?757?AAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGC 816

Query?541?------------------------------------------------------------ 600

Sbjct?817?GTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTG 876

Query?601?------------------------------------------------------------ 660

Sbjct?877?CCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGC 936

Query?661?------------------------------------------------------------ 720

Sbjct?937?GATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAG 996

Query?721?------------------------------------------------------------ 780

Sbjct?997?CTGTACAAGTAA 1008

Query?781?------------ 792

The structure of 3 recombinant expression vector pW425N::gfp and evaluation

(1) the gfp gene cuts back to close, is connected and transform with the pW425N enzyme

Adopt restriction enzyme SacII and Cla I,, get 1 μ L and carry out the detection of 0.8% agarose gel electrophoresis, as shown in figure 22 according to above-mentioned two-step approach difference digested vector pW425N and gfp gene.Reclaim the purpose fragment of purifying, adopt the T4DNA ligase enzyme to connect, reaction system is as follows:

10×Ligation?Buffer 2.0μL

The gfp gene reclaims product 10.0 μ L

PW425N reclaims product 6.0 μ L

T4DNA ligase enzyme (3U/ μ L) 2.0 μ L

Total?V 20.0μL

Reaction conditions: 21 ℃ connect 3h, and 4 ℃ of connections are spent the night; Next day, electricity transformed lactobacillus.

(2) preparation of lactobacillus competent cell and conversion

-70 ℃ of frozen lactobacilluss of very low temperature are hatched to thawing for 37 ℃, coat MRS flat board (containing thymidylic acid 100 μ g/mL), 37 ℃ of static overnight incubation of anaerobism.Next day, picking colony is inoculated in the fresh 10mL MRS liquid nutrient medium and (contains 1%Gly, 100 μ g/mL thymidylic acids), 37 ℃ of static thalline OD that are cultured to of anaerobism ₆₀₀Value is 0.6～0.8.Get above-mentioned nutrient solution, (contain 1%Gly, 100 μ g/mL thymidylic acids) by 1%～2% dose inoculation in fresh MRS liquid nutrient medium, thalline OD is treated in 37 ℃ of static cultivations of anaerobism ₆₀₀Value is 0.2～0.3 o'clock, collects standby.

With the yeast culture thing ice bath 10min of above collection, 4 ℃, 6000r/min, centrifugal 5min.Precipitation is cleaned twice with ice-cold cleaning buffer solution; 4 ℃, 6000r/min, centrifugal 5min collecting precipitation is heavily entreated in the electric shock damping fluid ice bath 5min at last.

Get the lactobacillus competence 200 μ L of above-mentioned processing, add 20 μ L recombinant expression plasmid pW425N::gfp, mix gently in the ice-cold pole cup of back transposition (Φ 20mm), the laggard horizontal high voltage electricity of ice bath 5min transforms, and condition is voltage 2.5kv, time 3.0ms.

Behind the high-voltage electric shock, with pole cup ice bath 5min, in the liquid MRS substratum that the 800 μ L of content transposition in the cup are fresh, 37 ℃ of static recovery 4～5h of anaerobism, coating contains the MRS flat board of erythromycin (400 μ g/mL), 37 ℃ of static cultivation 16～20h of anaerobism, screening positive clone.

(3) recombinant expression vector pW425N::gfp PCR identifies

Get 1 μ L behind the test kit extraction plasmid and carry out the detection of 0.8% agarose gel electrophoresis, as shown in figure 23.With No.2 and 10 times of dilutions of No.3 plasmid is template, it is carried out PCR identify, and make negative control, and the PCR reaction system is as follows:

Upstream primer (P1,10 μ mol/L) 1.0 μ L

Downstream primer (P2,10 μ mol/L) 1.0 μ L

dNTP(2.5mmol/L) 2.0μL

10×Ex?Taq?Buffer 2.5μL

Ex Taq archaeal dna polymerase (5U/ μ L) 0.2 μ L

Template plasmid 1.0 μ L

ddH ₂O 17.3μL

Whiteruss 25.0 μ L

Total?V 50.0μL

PCR reaction conditions: 94 ℃ of pre-sex change 90s; 94 ℃ of sex change 55s, 57 ℃ of annealing 45s, 72 ℃ are extended 50s, move 30 circulations altogether; Last 72 ℃ of total elongation 60s get 1 μ L and carry out the detection of 0.8% agarose gel electrophoresis after reaction finishes.The two all the purpose band occurs at about 792bp place as a result, conforms to the expection size, as shown in figure 24.

(4) recombinant expression vector pW425N::gfp enzyme is cut evaluation

No.2 and No.3 plasmid are carried out enzyme according to above-mentioned two-step approach cut evaluation, the result occurs the purpose band respectively at about 6.9kb and 792bp place, conforms to expected results, shows successfully to have made up recombinant expression vector pW425N::gpf, as shown in figure 25.

The 4Nisin inducible expression carrier is to the mensuration of green fluorescent protein abduction delivering function

(1) determines that pig source lactobacillus tolerates concentration (RC) and minimal inhibitory concentration (MIC) to Nisin

Lactobacillus single colony inoculation in picking pig source is in the fresh MRS substratum that contains erythromycin (400 μ g/mL), and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, gets bacterium liquid and is inoculated in respectively in the MRS substratum that contains different concns Nisin (10ng/mL, 20ng/mL, 30ng/mL, 40ng/mL, 50ng/mL, 60ng/mL) in 1: 100 ratio.37 ℃ of constant temperature anaerobism are measured bacterium liquid OD after cultivating 24h ₆₀₀Value is to determine tolerance concentration and the minimal inhibitory concentration of recombination lactic acid bacillus to Nisin.The result as shown in figure 26, tolerance concentration and minimal inhibitory concentration are respectively 40ng/mL and 60ng/mL; In addition, when adding 10ng/mL Nisin, recipient bacterium is well-grown still, therefore, is that standard is measured the gene induced expression time-histories of gfp with this concentration.

(2) determine to add Nisin to the gene induced expression time-histories of gfp

The positive bacterium of recombinating is inoculated in the MRS substratum of 50mL, and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, adds 10ng/mL Nisin and carries out abduction delivering.Bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, is designated as and induces 0h, behind the interpolation Nisin, gets bacterium liquid 2mL every 1h, connects and gets 7h; At last the bacterium liquid of above-mentioned collection is transferred OD with MRS ₆₀₀Value is 0.6～0.8,4 ℃, 4000r/min, and centrifugal 10min, precipitation is cleaned three times with stroke-physiological saline solution, is resuspended at last in the 3mL physiological saline.Adopt the relative intensity of fluorescence of spectrophotofluorometer under working sample 509nm wavelength under the exciting light 460nm wavelength, each induction time relative intensity of fluorescence such as Figure 32 and shown in Figure 27, the result shows that best induction time is 3h.

(3) determine the optimum concn of the required Nisin of the gene induced expression of gfp

The positive bacterium of recombinating is inoculated in the MRS substratum of 50mL, and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, adds Nisin in substratum, makes final concentration be respectively 10ng/mL, 15ng/mL, 20ng/mL, 25ng/mL, 30ng/mL, 35ng/mL, 40ng/mL, 45ng/mL, 50ng/mL, 55ng/mL, 60ng/mL; Behind the abduction delivering, get not sample 3mL on the same group respectively, the bacterium liquid of collecting is transferred OD with MRS ₆₀₀Value is 0.6～0.8,4 ℃, 4000r/min, and centrifugal 10min, precipitation is cleaned three times with stroke-physiological saline solution, is resuspended at last in the 3mL physiological saline.Adopt the relative intensity of fluorescence of spectrophotofluorometer under working sample 509nm wavelength under the exciting light 460nm wavelength, relative intensity of fluorescence such as Figure 33 and shown in Figure 28 under each induced concentration, the result shows that inducing best Nisin concentration is 30ng/mL

(4) SDS-PAGE electrophoretic analysis

Positive recombination lactic acid bacillus is inoculated in the MRS substratum of 50mL, 37 ℃ are cultured to bacterium liquid OD ₆₀₀Value is that 0.6～0.8 o'clock interpolation Nisin induces destination gene expression.Bacterium liquid OD ₆₀₀Value is 0.6～0.8 o'clock, is designated as and induces 0h, behind the interpolation Nisin, gets bacterium liquid 1.5mL every 1h, connects and gets 6h; At last the bacterium liquid of above-mentioned collection is transferred OD ₆₀₀Value is 0.6～0.8,4 ℃, and 12000r/min abandons supernatant behind the centrifugal 5min, adds 50 μ L one and heats up in a steamer water, 45 μ L sample-loading buffers, 5 μ L dithiothreitol (DTT), and last sample carried out the SDS-PAGE electrophoresis after boiling water boiled 10min; After electrophoresis finishes, adopt Xylene Brilliant Cyanine G to dye, after imager was observed, the result showed and induces 0h to detect less than expression product, and the controlled strictness of carrier is described; Tangible band all appears in other induction times at about 27kDa place, conform to the expection size, as shown in figure 29.

5 recombination lactic acid bacillus Detection of Stability

The recombination lactic acid bacillus was reached for 50 generations in the MRS substratum that contains erythromycin (400 μ g/mL), extract recombinant plasmid pW425N::gfp, it is carried out enzyme cut evaluation and PCR evaluation; Simultaneously, get bacterium liquid 100 μ L, make gramstaining and fluorescence microscope respectively after 10 times of dilutions.The result shows that constructed carrier still can stably exist and expressing green fluorescent protein, shown in Figure 30,31 in milk-acid bacteria after reaching for 50 generations.

Claims (2)

1, a kind of structure of milk-acid bacteria simple substance grain Nisin inducible expression carrier is characterized in that:

The acquisition and the evaluation of a, two-pack controlling element nisRK gene

(1) preparation of product Nisin Lactococcus lactis chromosomal DNA

-70 ℃ of frozen product Nisin Lactococcus lactis are inoculated in the fresh MRS liquid nutrient medium recover, on the recovery back bacterium liquid coating MRS culture plate, the single colony inoculation of picking is cultivated in fresh MRS liquid nutrient medium after 37 ℃ of constant temperature anaerobism overnight incubation, treats thalline OD ₆₀₀Value is 0.6～0.8 o'clock, collects thalline, extracts chromosomal DNA, and-20 ℃ of preservations are standby;

(2) primer design is with synthetic

NisRK gene order (GI:473019) according to the GenBank login, adopt Primer 5.0 molecular biology softwares to carry out design of primers, the upstream and downstream primer adds Xba I and Kpn I restriction enzyme site respectively, and every primer total length 27bp is synthetic by precious biotechnology (Dalian) company limited; Primer sequence is as follows:

Upstream primer (P1): GGG TCT AGAGGA GGT AAA GTG GTG TAT;

Downstream primer (P2): GCG GGT ACCTTA CTT TTT TAT TTT TAG;

(3) the nisRK gene PCR increases, reclaims, is connected with pGEM-T and transforms

To produce Nisin Lactococcus lactis chromosomal DNA is template, and PCR obtains goal gene; Adopting gel to reclaim test kit reclaims the PCR product; Reclaiming product is connected by the T4DNA ligase enzyme with cloning vector pGEM-T; Connect in the product Transformed E .coli JM109 competent cell screening positive clone in the substratum that contains penbritin (200 μ g/mL);

(4) evaluation of nisRK gene

The positive bacterium colony of picking is inoculated in the LB substratum that contains penbritin (200 μ g/mL) 37 ℃ of shaking table overnight incubation; Collect thalline next day, in a small amount preparation reorganization positive plasmid pGEM-T::nisRK; And it is carried out PCR identifies and the evaluation of Xba I/Kpn I double digestion;

The structure of b, milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N

(1) recovery of nisRK gene and carrier is carrier pW425et, is connected and evaluation

After pGEM-T::nisRK and basic plasmid pW425et used Xba I/Kpn I double digestion respectively, reclaim the purpose fragment, adopt the T4DNA ligase enzyme to connect; Connect in the product Transformed E .coli X13 competent cell screening positive clone in the LB substratum that contains erythromycin (200 μ g/mL); After preparing recombinant plasmid in a small amount, carry out PCR evaluation and Xba I/Kpn I double digestion and identify; The result shows, has successfully set up recombinant plasmid pW425et::nisRK;

(2) structure of the acquisition of inducible promoter nisA gene, evaluation and pW425N

According to the nisA sequence of GenBank login, adopt Primer 5.0 molecular biology softwares to carry out design of primers, the upstream and downstream primer adds EcoRI and Sac I restriction enzyme site respectively, and every primer total length 24bp is synthetic by precious biotechnology (Dalian) company limited.Primer sequence is as follows:

Upstream primer (P1): GGG GAA TTCATT AAA TTC TGA AGT

Downstream primer (P2): GGG GAG CTCTTA TTT GCT TAC GTG

To produce Nisin Lactococcus lactis chromosomal DNA is template, and PCR obtains goal gene; Adopting gel to reclaim test kit reclaims the PCR product; Reclaim product and pW425et::nisRK and carry out double digestion with EcoR I/Sac I respectively, to reclaim the purpose product adopts the T4DNA ligase enzyme to connect, again in the Transformed E .coli X13 competent cell, screening positive clone in the LB substratum that contains erythromycin (200 μ g/mL); Prepare recombinant plasmid in a small amount, it is carried out PCR evaluation and the evaluation of EcoRI/SacI double digestion; The result shows, the inducible promoter nisA of acquisition and known array homology be up to 100%, and successfully replaced former constitutive promoter P32 with it, made up milk-acid bacteria simple substance grain Nisin inducible expression carrier pW425N.

2, the using method of a kind of milk-acid bacteria simple substance grain Nisin inducible expression carrier according to claim 1, its method is:

The acquisition and the evaluation of a, green fluorescent protein gfp gene

Green fluorescent protein gfp gene open reading frame sequence (GI:1674491) according to the GenBank login, adopt Primer5.0 molecular biology software to carry out design of primers, the upstream and downstream primer adds SacII and Cla I restriction enzyme site respectively, every primer total length 24bp, synthetic by precious biotechnology (Dalian) company limited; Primer sequence is as follows:

Upstream primer (P1) is: GTT CCG CGGATG ACC ATG ATT ACG

Downstream primer (P2) is: GGG ATC GATTTA TTT GTA GAG CTC

With the plasmid that contains green fluorescent protein gfp gene is template, and PCR obtains goal gene; Adopting gel to reclaim test kit reclaims the PCR product; Reclaim product and be connected in the Transformed E .coli JM109 competent cell of back screening positive clone in the LB substratum that contains penbritin (200 μ g/mL) with cloning vector pMD18-T; Prepare recombinant plasmid pMD18-T::gfp in a small amount, and it is carried out PCR evaluation, the evaluation of SacII/Cla I double digestion and order-checking identify; The result shows, has successfully obtained green fluorescent protein gfp gene, with the known array homology up to 100%;

The structure of b, recombinant expression vector pW425N::gfp and evaluation

PMD18-T::gfp and expression vector pW425N are carried out double digestion with Sac II/Cla I respectively, reclaim the purpose fragment, adopt the T4DNA ligase enzyme to connect, connect the product electricity and transform separation in the lactobacillus competent cell in chitling road, screening positive clone in the MRS substratum that contains erythromycin (400 μ g/mL); Prepare recombinant expression vector pW425N::gfp in a small amount and it is carried out PCR evaluation and the evaluation of SacII/Cla I double digestion;

C, Nisin inducible expression carrier are to the mensuration of green fluorescent protein abduction delivering function

(1) determines that pig source lactobacillus tolerates concentration (RC) and minimal inhibitory concentration (MIC) to Nisin

Lactobacillus single colony inoculation in picking pig source is in the fresh MRS substratum that contains erythromycin (400 μ g/mL), and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6 ~ 0.8 o'clock, gets bacterium liquid and is inoculated in respectively in the MRS substratum that contains different concns Nisin (10ng/mL, 20ng/mL, 30ng/mL, 40ng/mL, 50ng/mL, 60ng/mL) in 1: 100 ratio; 37 ℃ of constant temperature anaerobism are measured bacterium liquid OD after cultivating 24h ₆₀₀Value is to determine tolerance concentration and the minimal inhibitory concentration of recombination lactic acid bacillus to Nisin;

(2) determine to add Nisin to the gene induced expression time-histories of gfp

The positive bacterium of recombinating is inoculated in the MRS substratum of 50mL, and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6 ~ 0.8 o'clock, adds 10ng/mL Nisin and carries out abduction delivering.Bacterium liquid OD ₆₀₀Value is 0.6 ~ 0.8 o'clock, is designated as and induces 0h, behind the interpolation Nisin, gets bacterium liquid 2mL every 1h, connects and gets 7h; At last the bacterium liquid of above-mentioned collection is transferred OD with MRS ₆₀₀Value is 0.6 ~ 0.8,4 ℃, 4000r/min, and centrifugal 10min, precipitation is cleaned three times with stroke-physiological saline solution, is resuspended at last in the 3mL physiological saline; Adopt the relative intensity of fluorescence of spectrophotofluorometer under working sample 509nm wavelength under the exciting light 460nm wavelength, determine that the suitableeest abduction delivering time is 3h;

(3) determine the optimum concn of the required Nisin of the gene induced expression of gfp

The positive bacterium of recombinating is inoculated in the MRS substratum of 50mL, and 37 ℃ of constant temperature anaerobism are cultured to bacterium liquid OD ₆₀₀Value is 0.6 ~ 0.8 o'clock, adds Nisin in substratum, makes final concentration be respectively 10ng/mL, 15ng/mL, 20ng/mL, 25ng/mL, 30ng/mL, 35ng/mL, 40ng/mL, 45ng/mL, 50ng/mL, 55ng/mL, 60ng/mL; Behind the abduction delivering, get not sample 3mL on the same group respectively, the bacterium liquid of collecting is transferred OD with MRS ₆₀₀Value is 0.6 ~ 0.8,4 ℃, 4000r/min, and centrifugal 10min, precipitation is cleaned three times with stroke-physiological saline solution, is resuspended at last in the 3mL physiological saline.Adopt the relative intensity of fluorescence of spectrophotofluorometer under working sample 509nm wavelength under the exciting light 460nm wavelength, determine that the required Nisin concentration of best abduction delivering is 30ng/mL;

(4) SDS-PAGE electrophoretic analysis

Positive recombination lactic acid bacillus is inoculated in the MRS substratum of 50mL, 37 ℃ are cultured to bacterium liquid OD ₆₀₀Value is that 0.6 ~ 0.8 o'clock interpolation Nisin induces destination gene expression.Bacterium liquid OD ₆₀₀Value is 0.6 ~ 0.8 o'clock, is designated as and induces 0h, behind the interpolation Nisin, gets bacterium liquid 1.5mL every 1h, connects and gets 6h; At last the bacterium liquid of above-mentioned collection is transferred OD ₆₀₀Value is 0.6 ~ 0.8,4 ℃, and 12000r/min abandons supernatant behind the centrifugal 5min, adds 50 μ L one and heats up in a steamer water, 45 μ L sample-loading buffers, 5 μ L dithiothreitol (DTT), and last sample carried out the SDS-PAGE electrophoresis after boiling water boiled 10min; After electrophoresis finishes, adopt Xylene Brilliant Cyanine G to dye, after imager is observed, successfully obtained the green fluorescent protein of 27kDa, conform to the expection size;

D, recombination lactic acid bacillus Detection of Stability

The recombination lactic acid bacillus was reached for 50 generations in the MRS substratum that contains erythromycin (400 μ g/mL), extract recombinant plasmid pW425N::gfp, it is carried out enzyme cut evaluation and PCR evaluation; Simultaneously, get bacterium liquid 100 μ L, make gramstaining and fluorescence microscope respectively after 10 times of dilutions.The result shows that constructed carrier still can stably exist and expressing green fluorescent protein in milk-acid bacteria after reaching for 50 generations.

Images