CN101613750B

CN101613750B - Molecular biology method for identifying gender of chub fry

Info

Publication number: CN101613750B
Application number: CN2009100642854A
Authority: CN
Inventors: 常重杰; 陈建军; 杜启艳; 夏晓华; 王友利
Original assignee: Henan Normal University
Current assignee: Henan Normal University
Priority date: 2009-02-27
Filing date: 2009-02-27
Publication date: 2011-08-24
Anticipated expiration: 2029-02-27
Also published as: CN101613750A

Abstract

The invention discloses a molecular biology method for identifying gender of a chub fry, belonging to the field of molecular biology, and aiming at providing a specific segment of chub fry DNA gender, a specific primer of male and the method for identifying gender of the chub fry. The technical proposal is that the sequence of the specific segment is Hmmf1 and Hmmf2. The molecular biology method for identifying gender of the chub fry is to use the designed specific primer and a contrast housekeeping gene GAPDH primer to carry out PCR amplification with chub individual gene group DNA as a template, the reaction system is 25 mu l, PCR amplification is carried out on a PCR instrument according to 30 circulating parameters, a gel imaging system is used for observing and shooting for record, 100bp DNA ladder is used as a molecular marker, the appeared chub fry with a band of 800bp mesh is male individual, the chub fry without band is female individual. The invention is used for identification of gender of the chub fry.

Description

A kind of molecular biology method of identifying gender of chub fry

Technical field:

The present invention relates to a kind of molecular biology, particularly a kind of molecular biology method of identifying gender of chub fry.

Background technology:

There is abundant fish stock in China, and wherein many fish exist gender difference on growth velocity, and therefore, control has very high theory directive significance for fish sex to carry out the research of these fish sexs decision genes involveds and sex specific mark.Silver carp (Hypophthalmichthys molitrix) cries silver carp, water silver carp again, jumps silver carp, Hypophthalmichthys molitrix, belongs to Cypriniformes, and Cyprinidae is one of four famous large Chinese carps.Famous special product economic fish is cultured with a long historyly, at China pond, lake, reservoir breed is arranged all, and cultured output occupies always first of China's freshwater aquiculture.Silver carp is female to grow soon, and growth rapidly.Artificial gynogenesis is the main direction of silver carp breeding with the cultured population that the hormonal counter-rotating combines the creation gynoecy at present.But, can't judge its sex character by mode of appearance period, so how from seedling colony, simply identify the prerequisite that genetic sex becomes restriction silver carp success seed selection fast seedling because silver carp sexual maturity for the first time needs 3～4 years at all.

The RAPD technology occurred in recent years, can seek a kind of effective ways of molecule marker fast.In the genome of some animal, seek the sex mark with it and have successfully report.As in the rainbow trout genome, having found two male special molecule markers, can be used as the probe of identification male and female.Kovacs etc. 2000 scan female, the male gene pool of African catfish (Clarias gariepinus) with RAPD, find the relevant RAPD mark of two male sexs.

Summary of the invention:

The purpose of this invention is to provide male specific primer sequence of a pair of silver carp and a pair of contrast house keeper gene primer sequence.

Another object of the present invention provides a kind of method that can differentiate gender of chub fry fast.

Technical scheme of the present invention is that the silver carp dna molecular is identified the specific fragment of sex, it is characterized in that: this pulsating especially sequence called after Hmmf.The male special primer that the chub fry dna molecular is differentiated, it is characterized in that: this primer is by Hmmf sequences Design synthetic, this primer sequence called after Hmmf1 and Hmmf2, contrast house keeper gene primer is by the silver carp house-keeping gene GAPDH design synthetic that arrives at the NCBI web search, its primer sequence called after Gapdh1 and Gapdh2.A kind of molecular biology method of identifying gender of chub fry, it is characterized in that: the special primer Hmmf1 and the Hmmf2 that utilize design, and primer Gapdh1 and the Gapdh2 of contrast house-keeping gene GAPDH, with silver carp genes of individuals group DNA is that template is carried out pcr amplification, reaction system is 25 μ l, reaction consists of the Taq archaeal dna polymerase of 1U, the dNTP of 2 μ l, 100～200ng genomic dna, wherein contain each 0.1 μ mol/L of male special upstream and downstream primer and house-keeping gene upstream and downstream primer, carrying out pcr amplification by following loop parameter on the PCR instrument: behind 95 ℃ of pre-sex change 5min, 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 60sec totally 30 circulations, last 72 ℃ are extended 10min, amplified production separates with 1.5% agarose gel electrophoresis, ethidium bromide staining, under gel imaging system, observe and Taking Pictures recording, 100bp DNA ladder makes molecular weight marker, the amplified band of contrast house-keeping gene GAPDH equal stable existence in the male and female individuality in this method, the appearance size is a male for 800bp purpose band, does not have the female individuals that is of band.The present invention has compared with the prior art and can carry out sex identification and differentiate the high remarkable advantage of accuracy rate chub fry.

Description of drawings:

Fig. 1 utilizes the checking result of specific PCR method to the sex specific fragment.In 10 individualities of male and female, contrast house-keeping gene band is high-visible in all individualities, proves that the pcr amplification program is no problem.1,2,3,4,5 swimming lanes size all occurred for the amplified band of 800bp, are male; And 6,7,8,9,10 do not amplify any band except that house-keeping gene, is female individuals.M is the dna molecular amount standard of 100bp gradient.Arrow 1 indication is that size is the male specific band of 800bp; Arrow 2 indications are the crt gene band.

Fig. 2 is the gender of chub fry qualification result that utilizes male special primer and house-keeping gene primer.13 chub fry individualities of picked at random carry out sex identification.Wherein 1,2,3,4,5,9, the band of a 800bp size is arranged on the electrophoresis band of 10,11 eight individualities, be male; 6,7,8,11,12 5 individualities do not have band on the 800bp position, be female individuals.But the house-keeping gene band all occurs in the male and female individuality.M is the dna molecular amount standard of 100bp gradient.Arrow 1 indication is that size is the male specific band of 800bp; Arrow 2 indications are the house-keeping gene band.

Embodiment:

The acquisition of male special primer and the checking of sex-specific

After sexual gland is dissected and is identified sex, extract male and female genes of individuals group DNA, utilize 220 random primers to carry out the RAPD-PCR amplification, when using random primer S2107, in male, amplify stable bands of a spectrum, this band line does not exist in female individuals, obtained the male specific fragment of one section about 800bp by clone and order-checking, called after Hmmf (its dna sequence dna such as table 1), this fragment belongs to non-coding sequence, this sequence is carried out the sequence contrast on Genebank, do not find homologous sequence with it.This band is the male specific band of silver carp, order-checking back a pair of male special primer Hmmf1 of design and Hmmf2, by the GAPDH house-keeping gene of NCBI search silver carp, design a pair of can be as the primer Gapdh1 and the Gapdh2 (its dna sequence dna such as table 2) of PCR internal contrast.Special primer that utilization designs and crt gene primer carry out the specific PCR amplification in the individuality of 10 known sexes, the result as shown in Figure 1, in 10 individualities of male and female, contrast house-keeping gene band is high-visible in all individualities, proves that the pcr amplification program is no problem, 1,2,3,4,5 are male, and swimming lane size all occurred and has been the amplified band of 800bp; And 6,7,8,9,10 be female individuals, do not amplify any band except that house-keeping gene, and this shows the evaluation that primer that the present invention designs and method can be used in the silver carp sex.

The discriminating of gender of chub fry

To test the fish docking and get blood a little (being no more than 0.5ml), and add the antithrombotics ACD of twice at least, the centrifugal 10min of 4000rpm removes supernatant; Add 5ml lysate and 20 μ g RNA enzymes, 37 ℃ of incubation 3h; Add Proteinase K to final concentration 100 μ g/ μ l, 50 ℃ are spent the night.Through phenol → phenol chloroform isoamyl alcohol → chloroform isoamyl alcohol extracting successively, dehydrated alcohol precipitation, 70% washing with alcohol.After the drying, the silver carp genomic dna is dissolved in TE or the aseptic double-distilled water, respectively numbering.Utilize the male special primer and the house-keeping gene primer of design that 13 unknown sex chub fry individualities are carried out pcr amplification, reaction system is 25 μ l, 1U Taq enzyme, 2 μ l dNTP, 100～200ng genomic dna, each 0.1 μ mol/L of male special upstream and downstream primer and house-keeping gene upstream and downstream primer.After loop parameter is 95 ℃ of pre-sex change 5min, 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 60sec totally 30 circulations, and last 72 ℃ are extended 10min.Amplified production separates with 1.5% agarose gel electrophoresis, and ethidium bromide staining is observed and Taking Pictures recording under gel imaging system.The amplified band of finding crt gene GAPDH as Fig. 2 equal stable existence in the male and female individuality, 8 occur size for 800bp purpose band be male, other 5 female individuals that are that do not have band.

Below all show the discriminating that special primer that the present invention designs and method can be used in chub fry male and female sex.

The male specific fragment Hmmf of table 1. silver carp sequence

Male specific primer sequence of table 2. silver carp and house-keeping gene primer sequence

Claims

1. the silver carp dna molecular is identified the nucleotide sequence of sex, and it is characterized in that: this nucleotides sequence is classified as:

TGCAGGTCGACGATTTCCCAGCAGAGGTTATAAAAAAAAAAAAAAAAAAATGTTCACATGTTCTAATTATGTGTTTATTAGAGGTTGAATTCAAATCAAA TACTGCCAAACTGTCCATACTACTTCTGAATAGGATGTCTACCTCATAAAATGTATGAAAATATGGAAATGTATGGTTCAGATTACTCAAATAAATGG A G GCGCCCTTAAAGGGTCAGATATGGAGCTTGGGTGTCATCTAGTGAAAAAGTTTGGTACCTAAACAAAATCTTACTGAAAGGTAATTTTTGAAATAT TT CA AGCTAAAACTTGGAATGTTGAGATTTTTGGCTTTTATTTTCTTGCAGTTTAAGAGTAACACATGCTTTGTAATATATTATTATAAAATATAAAC AAT TAT ATTTGCACATTTTCATAACTTTTTTTTAAATTTCACTCTCATAATTTATTTCACTTCTACAATAATTTGACAAGTGGCTTCTTTAAAACATG ACCA ACCT TAGGTCTATATTCCAAAGCATTCTTGAATTACAACCATTTATGTTTGGATAGTGCATTTTCATGTCTACACAGTAAAATCGGCAGTGTTA ATTAG GCAGT GTTACTCTACATTTACTCTTAAGGAGTTAACTTAACAACAAATAGTGAAAGATACCCTCTAGTGTTGGTGAAAATTATCAGAGTTAAT TCTGCC TCGTTA ACTTTACTCTGTTAAGCTCCGCCCCTCAAGCTAACGACAAGGATCTGAACAGAAGTTTCTTGTCGTCGTTGCAACCGCCATTTTCT

2. the male special primer differentiated of chub fry dna molecular, it is characterized in that: this male special primer is that the nucleotides sequence of this male special primer is classified as by the described nucleotide sequence design of claim 1 synthetic:

5 ' TGCAGGTCGACGATTTCCCAGC3 ' and

5’CCATTTTCTTTCACCTCGCACC?3’。

3. molecular biology method of identifying gender of chub fry is characterized in that: the male special primer nucleotide sequence that utilizes design:

5 ' TGCAGGTCGACGATTTCCCAGC3 ' and

5’CCATTTTCTTTCACCTCGCACC?3’，

And the primer nucleotide sequence of contrast house-keeping gene GAPDH:

5 ' GCCTCCTGCACCACCAACTG3 ' and

5 ' CGGAAGGCCATGCCGGTCAG3 ', with silver carp genes of individuals group DNA is that template is carried out pcr amplification, reaction system is 25 μ l, reaction consists of the Taq archaeal dna polymerase of 1U, the dNTP of 2 μ l, 100～200ng genomic dna, wherein contain each 0.1 μ mol/L of male special upstream and downstream primer and house-keeping gene upstream and downstream primer, carrying out pcr amplification by following loop parameter on the PCR instrument: behind 95 ℃ of pre-sex change 5min, 94 ℃ of sex change 30sec, 60 ℃ of annealing 30sec, 72 ℃ are extended 60sec totally 30 circulations, and last 72 ℃ are extended 10min, and amplified production separates with 1.5% agarose gel electrophoresis, ethidium bromide staining, observe and Taking Pictures recording under gel imaging system, 100bp DNA ladder makes molecular weight marker, the amplified band of contrast house-keeping gene GAPDH equal stable existence in the male and female individuality in this method, the appearance size is a male for 800bp purpose band, does not have the female individuals that is of 800bp order band.