CN101613675A - Bortezomib drug resistant myeloma cell strain and construction process thereof and application - Google Patents
Bortezomib drug resistant myeloma cell strain and construction process thereof and application Download PDFInfo
- Publication number
- CN101613675A CN101613675A CN200910044965A CN200910044965A CN101613675A CN 101613675 A CN101613675 A CN 101613675A CN 200910044965 A CN200910044965 A CN 200910044965A CN 200910044965 A CN200910044965 A CN 200910044965A CN 101613675 A CN101613675 A CN 101613675A
- Authority
- CN
- China
- Prior art keywords
- cell strain
- myeloma cell
- drug resistant
- velcade
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the biological medicine technology field.The proteasome inhibitor Velcade has remarkable effect to multiple hematological system tumor, has been approved for multiple myeloma and lymphadenomatous clinical treatment.Clinical study finds that part MM patient has produced the resistance reaction or treated the recurrence that occurs resistance and disease among the effective MM patient in the early stage Velcade.The purpose of this invention is to provide bortezomib drug resistant myeloma cell strain and construction process thereof and application.The present invention is by making up bortezomib drug resistant myeloma cell strain, detections such as the gene chip that this cell strain is carried out, protein electrophoresis, real-time quantitative PCR confirm to have a plurality of gene expression differences and protein expression difference between drug-resistant cell strain and the parent's myeloma cell strain; These differential genes and albumen can be used for studying the resistance mechanism of Velcade in myelomatosis.The present invention can be used for screening anti-bortezomib drug resistant medicine.
Description
Technical field
The present invention relates to the biological medicine technology field, be specifically related to a kind of proteasome inhibitor bortezomib drug resistant myeloma cell strain, and construction process, the application in the anti-bortezomib drug resistant medicine of screening.
Background technology
Proteasome inhibitor is the research focus of PTS in recent years, and preclinical phase research formally proteasome inhibitor Velcade has remarkable effect to multiple hematological system tumor, has been approved for multiple myeloma and lymphadenomatous clinical treatment.Velcade is the active reversible inhibitor of 26S proteasome Chymotrypsin sample in the mammalian cell, and chemistry is by name: [(1R)-the 3-methyl isophthalic acid-[[(2S)-and 1-oxygen-3-phenyl-2-[(pyrazinecarboxamide) amino] propyl group] amino] butyl] boric acid, molecular formula C
19H
25BN
4O
4, relative molecular weight 384.24.It is that a specificity is potent, efficient protein enzyme body inhibitor.Reports such as Mateos, (the total reaction rate is 89% for Multiple Myeloma, MM) patient to adopt Velcade associating MP (VMP scheme) treatment 60 examples 65 years old and above old first visit multiple myeloma, it is that 32%, 16 month no incident survival rate (EFS) is 93% that CR leads; And the MP scheme total reaction rate of historical control is 42%, 16 month EFS is 51%.(National Comprehensive CancerNetwork NCCN) also recommends in the myelomatosis practice guidelines Velcade+dexamethasone (being called for short the VD scheme), Velcade+dexamethasone+Zorubicin (being called for short the PAD scheme), melphalan+prednisone+Velcade (being called for short MPV) are used for the first MM patient who sends out and transplant the candidate the comprehensive cancer network of American National in 2008.MM patient for refractory/recurrence recommended Velcade list medicine and Velcade associating liposomal doxorubicin in the NCCN guide in 2008 as the I class, Velcade+dexamethasone scheme is recommended as the 2A class.Yet, along with the expansion of its clinical application range and the passing of time, clinical study has both at home and abroad found that part MM patient has produced the resistance reaction or treated recurrence (the Richardson PG that occurs resistance and disease among the effective MM patient in the early stage Velcade, Barlogie B, Berenson J, et al.A phase 2 study of bortezomibin relapsed, refractory myeloma.N Engl J Med, 2003; 348:2609-2617.).
At present, the resistance mechanism research about Velcade both at home and abroad is still few, and its resistance mechanism is still indeterminate.Research state outer analysis is arranged expression and the Velcade of multiple medicines thing drug-resistant protein (MRP) in the MM cell induce dependency between the MM apoptosis, the expression that studies show that MRP3 and MRP5 is not enough to contain that Velcade induces the apoptotic effect of generation, thereby the prompting Velcade may not be the substrate for the multidrug resistance translocator.This is prompting just, and the resistance of Velcade is different from classical multidrug resistance in the existing oncotherapy.
In addition, employing biochip technologies such as Selga have been analyzed Rheumatrex (Methotrexate, MTX) responsive and drug-fast people HT29 colon-cancer cell strain, in conjunction with real-time quantitative PCR, Caveolin-1 and E-cadherin down-regulated expression in the drug-fast HT29 cell of MTX are found in technical study such as gene transfection and little RNA interference, may be relevant with resistance, point out it to treat target spot (Selga E for potential, Morales C, No é V, Peinado MA, Ciudad CJ.Role of Caveolin 1, E-Cadherin, Enolase 2 andPKCalpha on resistance to methotrexate in human HT29 colon cancer cells.BMCMed Genomics, 2008; 1:35.).Shen etc. have adopted two dimensional electrophoresis technical Analysis Zorubicin (Adriamycin, ADM) the responsive and drug-fast K562 leukemia cell line of Zorubicin, identify the albumen of having found 9 differential expressions altogether, wherein CRKL expresses in ADM resistance K562 cell obviously and raises, and can reduce this proteic expression by transfection recombinant slow virus psc-2 LVshCRKL.In addition, adopt RNA perturbation technique silence after the CRKL expression of gene resistance of ADM can be reversed, CRKL is relevant with many resistances in prompting, this albumen is expected as the action target spot of antisense therapy technology (Shen SH, Gu LJ, Liu PQ, Ye X, Chang WS, Li BS.Comparative proteomic analysis ofdifferentially expressed proteins between K562 and K562/ADM cells.Chin Med J (Engl), 2008; 121 (5): 463-8.).These documents all provide by drug-resistant cell strain and find the enlightenment of screening medicine-resistant medicine behind the differential protein.
Therefore,, can further investigate the possible resistance mechanism of Velcade,, monitor and avoid the drug-fast experimental basis that provides in the treatment for clinical application proteasome inhibitor treatment multiple myeloma if can set up the myeloma cell strain of bortezomib drug resistant; Simultaneously, for the screening of overriding resistance medicine provides cell model, in the hope of reaching the purpose that reversing drug resistance improves curative effect.
The report that bortezomib drug resistant myeloma cell strain is not arranged at present as yet.
Summary of the invention
The purpose of this invention is to provide a kind of bortezomib drug resistant myeloma cell strain, and construction process and application.
The invention provides a kind of bortezomib drug resistant myeloma cell strain.
The present invention also provides the construction process of above-mentioned bortezomib drug resistant myeloma cell strain.
Concrete technical scheme of the present invention is: a kind of bortezomib drug resistant myeloma cell strain makes up in accordance with the following methods:
A, get the myeloma cell strain NCI-H929 in vegetative period, adopting concentration is that the Velcade of 1-10nmol/L is induced;
B, progressively increase Velcade concentration, obtain bortezomib drug resistant myeloma cell strain to 200nmol/L.
The present invention also can be other myeloma cell strains, because NCI-H929 is a strain myeloma cell strain of generally acknowledging in the world at present, it is comparatively clear and definite that biology and genetics shape have been studied, be one of myeloma cell strain comparatively commonly used in the experiment both at home and abroad, so the present invention select this cell strain for use.
Above-mentioned bortezomib drug resistant myeloma cell strain preferably, makes up in accordance with the following methods:
Get the myeloma cell strain NCI-H929 in vegetative period, employing concentration is that the Velcade of 10nmol/L is induced; Half amount was changed liquid once in 2-3 days, and every 1-2 week left and right sides concentration improves 10nmol/L, reaches 200nmol/L until final concentration, and drug withdrawal laggard line correlation in January detects then, and incubation time is 8 months, obtains bortezomib drug resistant myeloma cell strain.
The present invention also provides the application of above-mentioned bortezomib drug resistant myeloma cell strain in the anti-bortezomib drug resistant medicine of screening.
The present invention makes up after the bortezomib drug resistant myeloma cell strain, utilizes this cell strain to carry out the research of aspects such as genomics, protein science.By research, further understand the possible mechanism of Velcade resistance in myelomatosis, and can reverse drug-fast gene and albumen provides the laboratory foundation for screening.
The observation of the biological characteristics of bortezomib drug resistant myeloma cell strain and the research of resistance mechanism specifically comprise:
1. get parent H929 cell and the resistance H929 cell of exponential phase of growth, carry out the flow cytometry cell cycle analysis;
2. get parent H929 cell and the resistance H929 cell of exponential phase of growth, extract the capable expression profiles of gene chip of RNA and analyze;
3. adopt analysis software in conjunction with the gene pathway related web site, the analyzing gene chip results is tentatively determined differential gene and the possible signal path relevant with resistance;
4. carrying out that real-time quantitative PCR detects may the differential gene relevant with resistance, further verifies the gene chip result;
5. get parent H929 cell and the resistance H929 cell of exponential phase of growth, extract albumen and carry out the two-phase two dimensional electrophoresis, the connexus spectrum analysis is determined differential gene.
Detections such as the gene chip of the present invention by bortezomib drug resistant myeloma cell strain is carried out, protein electrophoresis, real-time quantitative PCR confirm to have a plurality of gene expression differences and protein expression difference between drug-resistant cell strain and the parent's myeloma cell strain.These differential genes and albumen is as the research resistance mechanism of Velcade in myelomatosis, and improves experimental basis for screening overriding resistance medicine.Thereby reach the research purpose that reversing drug resistance improves curative effect.
Description of drawings
Fig. 1 is bortezomib drug resistant myeloma cell strain of the present invention and parent's a fluidic cell periodogram.
A parent fluidic cell periodogram
B bortezomib drug resistant myeloma cell strain fluidic cell of the present invention periodogram
Fig. 2 is bortezomib drug resistant myeloma cell strain gene chip data analysis figure of the present invention.
Fig. 3 is for adopting real-time quantitative PCR method checking gene chip difference expression gene figure.
Fig. 4 carries out qualification result figure for adopting the two dimensional electrophoresis method to the differential protein that exists between parent and bortezomib drug resistant myeloma cell strain.
Embodiment:
Below in conjunction with drawings and Examples the present invention is further described.
Embodiment 1: the foundation of bortezomib drug resistant myeloma cell strain
Get NCI-H929 myeloma cell strain (available from American Type Culture Collecti (ATCC), available long-term liquid nitrogen is preserved, and the use the recovery back during experiment) 1x10 of exponential phase of growth
9/ L is inoculated in 6 orifice plates, and adding and containing Velcade (providing former medicine by Xi'an Yang Sen company) final concentration is RPMI1640 nutrient solution (available from Gibico company)+10% foetal calf serum of 10nmol/L, places 37 ℃, contains 5%CO
2, saturated humidity incubator in cultivate, 2-3 days half amount is changed liquid to cell growth recovery normal (being approximately 1-2 week), adds the Velcade that final concentration is 10nmol/L once more, the final concentration of Velcade increases to 20nmol/L after three times repeatedly.So progressively increase concentration to 200nmol/L, cultivated 8 months, obtain bortezomib drug resistant myeloma cell strain (to call NCI-H929B in the following text).
Embodiment 2: adopt mtt assay to measure the IC50 of parent and resistance myeloma cell strain
Mtt assay reference book: Xue Qingshan, the philosophy and technique of vitro culture, Science Press, 2001; 343.
Velcade relative molecular weight 384.24, and record NCI-H929 according to the applicant and be about 20.7nmol/L, be respectively 1nmol/L, 10nmol/L, 50nmol/L, 100nmol/L, 500nmol/L and six concentration of 1000nmol/L as the reference design experimental concentration for the IC50 of Velcade.Get above NCI-H929B cell of at least 2 week of drug withdrawal, get the cell suspension of exponential phase of growth, concentration is adjusted into 1x10
5/ L is inoculated in 96 orifice plates respectively, and every hole contains 90ul, places 37 ℃, contains 5%CO
2, saturated humidity incubator in cultivate 24h after, add the Velcade of six concentration respectively, every hole 10ul, each concentration is all established 3 multiple holes.Cultivate after 20 hours, add 10ul MTT liquid, 4 hours every holes of co-cultivation add acidifying Virahol 100ul, and it is dissolved fully, adopt wavelength 570nm, carry out microplate reader and detect, and measure the half inhibiting rate.According to measurement result, NCI-H929B IC50 is 487.4nmol/L, resistance multiple=mdr cell IC50/ parental cell IC50=487.4/20.7=23.5.
Embodiment 3: the flow cytometry cell cycle
Get NCI-H929, the NCI-H929B cell suspension of exponential phase of growth, counting is got 1x10 respectively
6/ L, centrifugal, remove supernatant, add 70% ice ethanol and beat even fixingly, 0-4 ℃ is spent the night.Next day, recentrifuge removes supernatant, PBS washing 2 times, and RNA enzyme effect 15 minutes adds iodate third ingot, spermine effect 15 minutes, and the adjustment cell concn is 1x10
6/ L, the upflowing cell instrument is done the cell cycle analysis.
The result as shown in Figure 1, ordinate Y represents the absolute number of tested cell among the figure, abscissa x is fluorescence or the scattered intensity of being surveyed, with " road number " expression:
1) Figure 1A is a parent NCI-H929 fluidic cell periodogram: S phase ratio is 54.28%, and the G1 phase is 36.83%, and the G2 phase is 8.89%, G2/G1:1.85
2) Figure 1B is NCI-H929B cell streaming cell cycle figure: S phase ratio is 51.88%, and the G1 phase is 32.36%, and the G2 phase is 15.76%, G2/G1:1.85.
The extraction of embodiment 4:NCI-H929, NCI-H929B cell total rna
1) collects 1x10
7/ NCI-H929, NCI-H929B cell were washed 5 minutes with PBS 2000rpm, and every pipe adds TRIZOL reagent (Gibico, Invitrogen, USA) 1ml (with Rnase-free rifle head, the vibration of limit edged), fully mixing.-80 ℃ of preservations.
2) the chloroform 0.2ml of Jia Xinkai (1: 5 volume), thermal agitation, room temperature leaves standstill 5-10min.
3) 12000rpm, 15min is 4 ℃, centrifugal.Get supernatant then to EP pipe (DEPC handled).
4) add the Virahol (1: 1 volume) that 0.5ml newly opens, jog (preventing the RNA fracture), room temperature leaves standstill 10min.
5) 12000rpm, 15min is 4 ℃, centrifugal.Abandon supernatant.
6) total RNA is the pipe white precipitate at the end, add 75% ethanol 1ml washing (newly preparing) with DEPC water after, 10000rpm, 10min, 4 ℃.Centrifugal.
7) remove supernatant, gas was done precipitation 5-10 minute, and is translucent to precipitating, and adds sigma-water 20-30ul,
8) the OD value is surveyed in 96 orifice plates dilution.
9) the RNA+loading buffer 10ul of absorption 500ng ices immediately behind 65 ℃ of heating 8min and puts (purpose: open secondary structure)
11) electrophoresis.
12) RNA-80 that will take out ℃ of preservation (multigelation must not above 3 times).
Embodiment 5:NCI-H929, the analysis of NCI-H929B cell expressing spectrum gene chip
Two kinds of mRNA difference sex change of NCI-H929, NCI-H929B and reverse transcription are to cDNA, respectively behind mark fluorescent dyestuff Cy3 and the Cy5, with the cDNA chip that is loaded with 12673 clones (providing) airbath hybridization, 65 ℃ of 15h by cma gene group National Key Laboratory of Shanghai City hemopathy institute.
Chip results is analyzed, the result as shown in Figure 2:
1) carries out gene function analysis according to the resistance group that filters out and myeloma cell's differential gene of normal group, determine the rule of this group gene in the GO classification, find the gene in the significance GO classification, the key gene with target that differential expression promptly causes differences between samples is reduced in going up of these genes;
2) Pathway that simultaneously the differential gene product is mainly distributed carries out significance analysis, and finding out with experiment purpose has the Pathway that significantly gets in touch;
3) get key gene common factor among the Pathway of key gene and significance in the significance GO classification, as the target spot gene group of primary study.
4) employing finds that from network perspective the activation between the significance Pathway concerns to have center ability of regulation and control Pathway thereby determine based on the Path-Net technology of KEGG Pathway database.
Embodiment 6: real-time quantitative PCR detects the gene of differential expression
1, design of primers
Known array according to following six genes among the GenBank goes out order in conjunction with the primer5.0 programdesign
The gene primer sequence:
FADD?P：5’CACGACCTGCTGCGGCGCG?3’(SEQ?ID?NO：1)
FADD?M：5’CCCGCACACGCTCTGTCAGG?3’(SEQ?ID?NO：2)
TRAF2P：5’CCGAATGTCCCGCGTGCAAAG?3’(SEQ?ID?NO：3)
TRAF2M：5’CCTGAAACTTCTCCCGGGGG?3’(SEQ?ID?NO：4)
Casp8P：5’GATGAATTTTCAAATGGGGAGGAG?3’(SEQ?ID?NO：5)
Casp8M：5’CATTCCTGTCCCTAATGCTGTG?3’(SEQ?ID?NO：6)
CASP7P：5’TGTGCCAAGATGCAAGATCTGC?3’(SEQ?ID?NO：7)
CASP7M：5’TCGGCAAGCCTGAATGAAGAAG?3’(SEQ?ID?NO：8)
HSP86P：5’GTTAACTGGTACCAAGAAAAGGC?3’(SEQ?ID?NO：9)
HSP86M：5’CAGGCATCAGTAGCCTAAGCAA?3’(SEQ?ID?NO：10)
MAP3K5P：5’TTCCTGATGACAAGAAAGGTATAC?3’(SEQ?ID?NO：11)
MAP3K5M：5’TGCTTCTCCCCTTCTCTTCGG?3’(SEQ?ID?NO：12)
The customized six pairs of primers of handsome biotech firm to Shanghai.
2, extract total RNA
Get NCI-H929 exponential phase of growth, NCI-H929B suspension cell 5x10
6, centrifugal 5 minutes of 2000rpm, supernatant discarded, add the 1mlTRIzol cracking, add the 200ul chloroform, firmly put upside down mixing, room temperature left standstill 10 minutes, 4 ℃, 13000rpm centrifugal 30 minutes, draws supernatant to another 1.5mlEP pipe from every pipe, add the equal-volume Virahol ,-20 ℃ precipitate 1 hour behind the mixing.4 ℃, 13000rpm, centrifugal 20 minutes, abandoning supernatant added 500ul75% ethanol, washing precipitation.4 ℃, 13000rpm, centrifugal 10 minutes, supernatant discarded added 10ulDEPC water to dissolving fully, carries out electrophoretic analysis and measures.
Reverse transcription reaction
Get total RNA1ug and add in the 0.2mlPCR pipe, add 0ligodT 1ul and replenish volume to 12ul with DEPC water, 70 ℃ of ice baths are 5 minutes behind the mixing, add the 5x reaction buffer successively, Riblolck
TMRNA enzyme inhibitors 1ul, 10mM dNTP mixture 2ul, 37 ℃ were reacted 5 minutes behind the mixing, added RevertAid
TMM-MulV reversed transcriptive enzyme 1ul, final volume is 20ul, and 42 ℃ were reacted 60 minutes behind the mixing, and 70 ℃ were reacted 10 minutes then.
3, real-time quantitative PCR reaction
With GAPDH is internal control gene, adopts above-mentioned six pairs of primers.Get reverse transcription product 1ul, add SYBY Premix Ex Taq enzyme 10ul successively, primer and distilled water.The reaction cycle system is set as follows:
Cycle?1： (1X)
Step 1:95.0 ℃ 1 minute
Cycle?2： (40X)
Step 1:95.0 ℃ 15 seconds
Step 2:57.0 ℃ 15 seconds
Step 3:72.0 ℃ 45 seconds
Data?collection?and?real-time?analysis?enabled.
Cycle?3： (1X)
Step 1:95.0 ℃ 1 minute
Cycle?4： (1X)
Step 1:65.0 ℃ 1 minute
Cycle?5： (62X)
Step 1:65.0 ℃ 10 seconds
4. calculate the relative expression quantity of goal gene
(document sees reference: Livak KJ to calculate the relative expression quantity of six genes in the sample according to following formula, Schmittgen TD.Analysis of relative gene expression data usingreal-time quantitative PCR and the 2 (Delta Delta C (T)) Method.Methods, 2001; 25 (4): 402-8.), adopt the CT value to represent the result of real-time quantitative PCR, GAPDH is as the confidential reference items contrast of tissue, Δ Ct (goal gene)=goal gene Ct-confidential reference items crt gene Ct; Δ Δ Ct=Δ Ct (mdr cell)-Δ Ct (parental cell); Can calculate genetic expression in genetic expression/parental cell=2 in the persister according to formula
-Δ Δ CtWith reference to the chip of expression spectrum analysis, when candidate gene in persister, express/when expressing 〉=1.5 in the parental cell, think that then this gene be to express, if≤0.5 judge that this gene is for hanging down expression.
The result is shown in Fig. 3 and table 1:
1) be depicted as the real-time fluorescence amplification curve diagram by experiment, X-coordinate is a cycle number; Ordinate zou is a PCR baseline deduction value, (wherein the CF value is meant that the fluorescent signal of sample hose reaches the PCR reaction cycle number of a certain fixed threshold, and RFU represents relative fluorescence unit [relativefluorescence units, RFU]);
2) it is as shown in table 1 to calculate the result according to formula, and results suggest is FADD, Casp8 in the NCI-H929B cell strain, MAP3K5 down-regulated expression, and Hsp86 up-regulated.
Expression of Related Genes in table 1 real-time quantitative PCR parent and the bortezomib drug resistant myeloma cell strain
Embodiment 7: two dimensional electrophoresis analysis and differential protein are identified
1, cell protein extracts:
1) gets NCI-H929 and the NCI-H929B cell suspension of exponential phase of growth, add up to 1x10
8/ L, the centrifugal 10min collecting cell of 1000rpm; If the then direct centrifugal collection of suspension cell.
2) the freezing PBS washed cell of adding～5ml in the centrifuge tube, piping and druming for several times, 1000g, 4 ℃ of centrifugal 5min abandon supernatant; Repeat 3 times (soft, as to avoid cell rupture).
3) blow and beat cell gently with sorbyl alcohol (250mM) washing lotion 1ml, the centrifugal 10min of 1000rpm repeats once.
4) complete drying afterwards.
5) lysate of adding proper volume (guarantee that final concentration of protein can not be too high or too low, 3 bottles of cells add the 150ul lysate).
6) vortex vibration centrifuge tube 10～30s, re-suspended cell.Place more than the 30min on ice.Ultrasonication cell 20～30s (pipe is positioned on ice).
7) place 30min on ice.
8) 14000rpm, 4 ℃ of centrifugal 30min.
9) 54000rpm, 4 ℃ of centrifugal again 30min.
10) get supernatant, packing ,-80 ℃ of preservations.
2, first to etc. point focusing:
(1) from refrigerator, takes out the prefabricated adhesive tape of IPG, use the swelling damping fluid adhesive tape swelling 12 hours.
Swelling damping fluid: 8M urea, 2M thiocarbamide, 0.5%CHAPS, 0.52% amphotericeledrolyte, 0.02% tetrabromophenol sulfonphthalein, 1%DTT
(2) the focusing groove is put in the adhesive tape taking-up, added mineral oil to the sample cup of not going up, applied sample amount is 0.45mg, and is diluted to 170ul with swelling buffer.
(3) to good positive and negative electrode, cover lid.The isoelectrofocusing program is set:
(4) focus on the adhesive tape that finishes.Carry out balance, second immediately to the SDS-PAGE electrophoresis.
3, second to SDS-PAGE electrophoresis (see supplementary material three, recommend use 12.5% gel):
(1) the preparation acrylamide gel is 2.
(2) treat that gel solidifies after, the adhesive tape of taking out from-20 ℃ of refrigerators was placed 10 minutes prior to room temperature, made its dissolving.
(3) preparation adhesive tape level pad I, level pad II.
Level pad I:50mM Tris-HCl 6.8,6M urea, 30% glycerine, 2%SDS, 2%DTT, 0.02% tetrabromophenol sulfonphthalein.
Level pad II:50mM Tris-HCl 6.8,6M urea, 30% glycerine, 2%SDS, 2.5%IAA, 0.02% tetrabromophenol sulfonphthalein.
(4) balance adhesive tape: earlier adhesive tape is put into level pad I level vibration 15min, again adhesive tape is changed over to level pad II level vibration 15min.
(5) after balance finishes for the second time, the IPG adhesive tape is shifted out from sample aquation dish, be put into the SDS-PAGE gel upper end that has prepared, and, with 0.5% agarose adhesive tape and marker obturaged again the end that marker is put into gel.And offset plate is fixed in the electrophoresis chamber.
(6) after electrophoresis chamber adds electrophoretic buffer, connect power supply, treat can stop electrophoresis when the tetrabromophenol sulfonphthalein indicator reaches bottom margin.
(7) after electrophoresis finishes, pry open layer glass gently, take out gel, dye.
4, dyeing
1. dye: R350: (acetate: methyl alcohol=120: 80) dissolve, spend the night, filter paper filtering by stirring with 200ul dye liquor mother liquor for every tablet of tablet; Adding 1800ul dye liquor diluent (water: acetate: methyl alcohol=7: 2: 1), mixing.
2. decolouring: will collect staining fluid, gel is dipped in the destainer, horizontal shaking table vibration.Change MQ at last into and wash 30min again
Destainer: 3% glacial acetic acid solution.
5, differential protein analysis
The file of the above-mentioned tiff form that obtains is imported to Melanie Viewer software, generate the file of mel form.Concrete steps are as follows:
1) Spot detection: all analyzed gels all use same parameter to detect, and each parameter of adjusting spotdetection makes that the spot on the gel is apparent under the coomassie brilliant blue staining level.Confirm after detecting that deleting obviously is the point of impurity, or the unclear point of profile.
2) Backgbround substraction: adopt the background correction method of lowest on boundary to carry out
3) Reference gel: select collection of illustrative plates the most well-behaved, the gel that spot number is maximum relatively is set to reference gel, follow-up differential protein comparison in, remaining gel is all compared with reference glue.
4) Matching: at first on each glue, select resolving power, focus on better, be sure of it is that the spot of same protein spots is as landmark, landmark choose will be on glue uniform distribution, choose 6-8 spots as the road sign that carries out matching between the glue.
5) Normalization: purpose is the volumn value of spot on every glue of stdn, so that the accurate comparison and the analysis of expressing quantity between the glue.We adopt (volumn of each spot on a gel)/(total volumn of total spots on the same gel) * 10000 as the volumn value after the stdn, this value is used for the differential expression analysis (distribution free t check) of back, like this with regard to having avoided because the false picture of the differential expression that the difference of applied sample amount causes.
6) Differential protein analysis: all glue are through after mating with reference gel, with reference to each point on the glue all corresponding the corresponding point on each glue, such point is classified as a Group, utilizes each spot to carry out the differential expression analysis through the volumn value behind the nomalization.At first software is analyzed automatically, confirms Visualization confirmation then, can think differentially expressed protein.
7) matching result, we utilize Two-dimensional Electrophoresis Analysis software that two-way collection of illustrative plates (coomassie brilliant blue staining) is analyzed.
In the drug-resistant cell strain group, can detect 763 apparent spot; In control group, detect 691 spot.Through finding after the above-mentioned analysis: the albumen that raises in drug-resistant cell strain group group has 11, and the albumen that raises in control group has 6.
6, differential protein enzymolysis
Enzymolysis step:
1) 200ul rifle head (yellow) top is cut, then the target protein point on the gel is downcut, perhaps the protein band on the one dimension electrophoresis is downcut with scalper, pack in the 0.5ml centrifuge tube, with Milli-Q washing three times, each 10～15min 2) the blob of viscose decolouring: with destainer (50%ACN/25mMNH
4HCO
3) adding 400ul at every turn, shaking table 250rpm shakes.Decolouring washing three times is till blob of viscose is transparent.
3) blob of viscose adds 50ul 100%ACN, and effect 5min repeats once preferably to vibrate.Treat that blob of viscose bleaches and dwindle back sucking-off CAN, and allow residual ACN seasoning.
4) (1ug trypsin is dissolved in 100ul 25mMNH to each blob of viscose adding 10ul Trypsin solution
4HCO
3Among the pH8.0, Sigma), the about 100ng trypsin of each blob of viscose like this.Imbibition 30min under the 40C adds the 25mM NH of 10ul then
4HCO
3PH8.0,37 ℃ are spent the night.Decide according to the size of protein molecular weight the action time of Trypsin, and molecular weight is more little, and the time of effect should suitably shorten; Molecular weight is big more, the digestion time proper extension.
5) for the MALDI-TOF-MS Identification of Fusion Protein, blob of viscose proteopepsis liquid need not can directly get 1～2ul (can repeat point sample when protein content is few) point sample on the MALDI plate through desalting treatment.
The result according to identifying 17 differential proteins altogether after differential protein enzymolysis and the mass spectrum evaluation, sees the following form shown in Fig. 4 and table 2.
The albumen of differential expression tabulation in table 2 two dimensional electrophoresis
SEQUENCE?LISTING
＜110〉Second Military Medical University, PLA
＜120〉bortezomib drug resistant myeloma cell strain and construction process thereof and application
＜130〉specification sheets
<140>200910044965.X
<141>2009-01-07
<160>12
<170>PatentIn?version?3.1
<210>1
<211>19
<212>DNA
＜213〉artificial sequence
<400>1
cacgacctgc?tgcggcgcg 19
<210>2
<211>20
<212>DNA
＜213〉artificial sequence
<400>2
cccgcacacg?ctctgtcagg 20
<210>3
<211>21
<212>DNA
＜213〉artificial sequence
<400>3
ccgaatgtcc?cgcgtgcaaa?g 21
<210>4
<211>20
<212>DNA
＜213〉artificial sequence
<400>4
cctgaaactt?ctcccggggg 20
<210>5
<211>24
<212>DNA
＜213〉artificial sequence
<400>5
gatgaatttt?caaatgggga?ggag 24
<210>6
<211>22
<212>DNA
＜213〉artificial sequence
<400>6
cattcctgtc?cctaatgctg?tg 22
<210>7
<211>22
<212>DNA
＜213〉artificial sequence
<400>7
tgtgccaaga?tgcaagatct?gc 22
<210>8
<211>22
<212>DNA
＜213〉artificial sequence
<400>8
tcggcaagcc?tgaatgaaga?ag 22
<210>9
<211>23
<212>DNA
＜213〉artificial sequence
<400>9
gttaactggt?accaagaaaa?ggc 23
<210>10
<211>22
<212>DNA
＜213〉artificial sequence
<400>10
caggcatcag?tagcctaagc?aa 22
<210>11
<211>24
<212>DNA
＜213〉artificial sequence
<400>11
ttcctgatga?caagaaaggt?atac 24
<210>12
<211>21
<212>DNA
＜213〉artificial sequence
<400>12
tgcttctccc?cttctcttcg?g 21
Claims (6)
1, a kind of bortezomib drug resistant myeloma cell strain is characterized in that making up in accordance with the following methods:
A, get the myeloma cell strain NCI-H929 in vegetative period, adopting concentration is that the Velcade of 1-10nmol/L is induced;
B, progressively increase Velcade concentration, obtain bortezomib drug resistant myeloma cell strain to 200nmol/L.
2, a kind of bortezomib drug resistant myeloma cell strain according to claim 1 is characterized in that making up in accordance with the following methods:
Get the myeloma cell strain NCI-H929 in vegetative period, employing concentration is that the Velcade of 10nmol/L is induced; Half amount was changed liquid once in 2-3 days, and every 1-2 week concentration improves 10nmol/L, reaches 200nmol/L until final concentration, and incubation time is 8 months, obtains bortezomib drug resistant myeloma cell strain.
3, the construction process of bortezomib drug resistant myeloma cell strain as claimed in claim 1 is characterized in that this method may further comprise the steps:
A, get the myeloma cell strain NCI-H929 in vegetative period, adopting concentration is that the Velcade of 1-10nmol/L is induced;
B, progressively increase Velcade concentration, obtain bortezomib drug resistant myeloma cell strain to 200nmol/L.
4, the construction process of bortezomib drug resistant myeloma cell strain according to claim 3 is characterized in that this method may further comprise the steps:
Get the myeloma cell strain NCI-H929 in vegetative period, employing concentration is that the Velcade of 10nmol/L is induced; Half amount was changed liquid once in 2-3 days, and every 1-2 week concentration improves 10nmol/L, reaches 200nmol/L until final concentration, and incubation time is 8 months, obtains bortezomib drug resistant myeloma cell strain.
5, the construction process of bortezomib drug resistant myeloma cell strain according to claim 4 is characterized in that this method is:
Get the NCI-H929 myeloma cell strain 1x10 of exponential phase of growth
9/ L is inoculated in 6 orifice plates, adds and contains the RPMI1640 nutrient solution that the Velcade final concentration is 10nmol/L+10% foetal calf serum, places 37 ℃, contains 5%CO
2, saturated humidity incubator in cultivate, it is normal to the cell growth recovery that 2-3 days half amount is changed liquid, add the Velcade that final concentration is 10nmol/L once more, the final concentration of Velcade increases to 20nmol/L after three times repeatedly, progressively increase concentration to 200nmol/L, cultivated 8 months, and obtained bortezomib drug resistant myeloma cell strain.
6, the application of bortezomib drug resistant myeloma cell strain as claimed in claim 1 or 2 in the anti-bortezomib drug resistant medicine of screening.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910044965A CN101613675A (en) | 2009-01-07 | 2009-01-07 | Bortezomib drug resistant myeloma cell strain and construction process thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910044965A CN101613675A (en) | 2009-01-07 | 2009-01-07 | Bortezomib drug resistant myeloma cell strain and construction process thereof and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101613675A true CN101613675A (en) | 2009-12-30 |
Family
ID=41493566
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910044965A Pending CN101613675A (en) | 2009-01-07 | 2009-01-07 | Bortezomib drug resistant myeloma cell strain and construction process thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101613675A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104502610A (en) * | 2014-12-25 | 2015-04-08 | 中山大学 | Method for screening antibiotics binding proteins |
| CN113262223A (en) * | 2020-02-17 | 2021-08-17 | 上海交通大学医学院 | Application of nilotinib and pharmaceutically acceptable salt thereof in preparation of medicines for treating multiple myeloma |
| CN114869897A (en) * | 2022-05-18 | 2022-08-09 | 苏州大学 | Application of small molecular compound and bortezomib in preparation of multiple myeloma treatment drugs |
-
2009
- 2009-01-07 CN CN200910044965A patent/CN101613675A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104502610A (en) * | 2014-12-25 | 2015-04-08 | 中山大学 | Method for screening antibiotics binding proteins |
| CN113262223A (en) * | 2020-02-17 | 2021-08-17 | 上海交通大学医学院 | Application of nilotinib and pharmaceutically acceptable salt thereof in preparation of medicines for treating multiple myeloma |
| CN114869897A (en) * | 2022-05-18 | 2022-08-09 | 苏州大学 | Application of small molecular compound and bortezomib in preparation of multiple myeloma treatment drugs |
| CN114869897B (en) * | 2022-05-18 | 2024-04-05 | 苏州大学 | Application of small molecular compound and bortezomib in preparation of medicines for treating multiple myeloma |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wells et al. | Key parameters of tumor epitope immunogenicity revealed through a consortium approach improve neoantigen prediction | |
| Todinova et al. | Microcalorimetry of blood serum proteome: a modified interaction network in the multiple myeloma case | |
| Chiasson et al. | Soybean SAT1 (Symbiotic Ammonium Transporter 1) encodes a bHLH transcription factor involved in nodule growth and NH4+ transport | |
| CN103109187B (en) | Diagnosis and treatment of breast cancer | |
| CN102203290B (en) | Molecular marker for cancer stem cell | |
| Wang et al. | RING finger proteins are involved in the progression of barrett esophagus to esophageal adenocarcinoma: a preliminary study | |
| CN102399772B (en) | Preparation method for probes related to breast cancer molecular markers and application of same | |
| Boissard et al. | Nurse-like cells promote CLL survival through LFA-3/CD2 interactions | |
| KR20190112027A (en) | Immune Biomarkers for Predicting Clinical Effects of Cancer Immunotherapy | |
| Zhou et al. | Posttranslational regulation of the exon skipping machinery controls aberrant splicing in leukemia | |
| Asadzadeh et al. | Rapid and accurate identification of Candida albicans and Candida dubliniensis by real-time PCR and melting curve analysis | |
| CN103076453B (en) | P16 immune cell chemical reagent kit and polypeptide sequence in preparing same | |
| Cheng et al. | Discovery of a transferrin receptor 1-binding aptamer and its application in cancer cell depletion for adoptive T-cell therapy manufacturing | |
| CN106957908A (en) | MiRNA and/or target molecules with aptamer detection method and detection probe | |
| CN101613675A (en) | Bortezomib drug resistant myeloma cell strain and construction process thereof and application | |
| CN115427585A (en) | Method for identifying functional disease-specific regulatory T cells | |
| Liu et al. | A novel FRET-based dendritic hybridization chain reaction for tumour-related mRNA imaging | |
| CN109593861A (en) | The detection method and detection kit of different loci leukaemia MEF2D-BCL9 fusion oligonucleotides | |
| Zhao et al. | Terminal deoxynucleotidyl transferase-initiated molecule beacons arrayed aptamer probe for sensitive detection of metastatic colorectal cancer cells | |
| Zhao et al. | Cascaded electrochemiluminescence signal amplifier for the detection of telomerase activity from tumor cells and tissues | |
| Chen et al. | Ubiquitination-related miRNA–mRNA interaction is a potential mechanism in the progression of retinoblastoma | |
| Rossi et al. | RNA flow cytometry for the study of T cell metabolism | |
| WO2020247220A1 (en) | Compositions and methods for predicting susceptibility of cancers to synthetic-lethal therapies | |
| CN101768214A (en) | Human tumor marker-Tim17 polypeptide and application thereof | |
| CN107312778B (en) | A kind of cancer diagnosing kit and treatment pharmaceutical composition |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20091230 |