CN101586115B - Gene coexpression recombinant plasmid and DNA vaccine prepared from same - Google Patents
Gene coexpression recombinant plasmid and DNA vaccine prepared from same Download PDFInfo
- Publication number
- CN101586115B CN101586115B CN 200810220642 CN200810220642A CN101586115B CN 101586115 B CN101586115 B CN 101586115B CN 200810220642 CN200810220642 CN 200810220642 CN 200810220642 A CN200810220642 A CN 200810220642A CN 101586115 B CN101586115 B CN 101586115B
- Authority
- CN
- China
- Prior art keywords
- gene
- chicken
- recombinant plasmid
- gal
- alexin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a gene coexpression recombinant plasmid and a DNA vaccine prepared from the same, which are characterized in that a preparation method orderly comprises processes of PCR amplification of genetic fragments of chicken defensin-1, construction of a recombinant plasmid pcDNA3.1(+)-Ga1-1, PCR amplification of a VP2 gene of bursal disease virus, construction of a coexpression recombinant plasmid pcDNA3.1(+)-Ga1-1/VP2 of the VP2 gene of the infectious bursal disease virus and a gene of the chicken defensin-1, and culture and extraction of the coexpression recombinant plasmid pcDNA3.1(+)-Ga1-1/VP2 of the VP2 gene of the infectious bursal disease virus and the gene of the chicken defensin-1. Compared with the prior art, the gene coexpression recombinant plasmid and the DNA vaccine have the advantages that the gene coexpression recombinant plasmid and the DNA vaccine have the immunologic enhancement special for defensin, are suitable for chickens, and can be used for preventing infectious bursal disease.
Description
Technical field
The present invention relates to animal medical bioengineering field, is a kind of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene coexpression DNA bacterin pcDNA3.1 (+)-Gal-1/VP2.
Background technology
(infectious burasl disease is by infectious bursal disease virus (infectious burasl disease virus, a kind of height contagious infection disease that IBDV) causes IBD) to infectious bursal disease.The fabricius bursa of main infringement chick and young chicken destroys the bone-marrow-derived lymphocyte in the fabricius bursa, causes immunosuppression.Make the immunne response ability drop of chicken, to disease-susceptible humans to other vaccines.Since 20th century, imported China the seventies into, IBD had formed popular several times outburst in the whole nation, caused heavy strike for the poultry husbandry of China.
Up to now, still do not have effective methods of treatment for infectious bursal disease, the resistibility that improves chicken by immunization remains the optimal selection of preventing system IBD.The IBD vaccine of being developed at present mainly divides inactivated vaccine, living vaccine (being divided into weak malicious type, mesogenic type and strong malicious type), gene engineering vaccine and connection seedling etc.Now widespread usage remains living vaccine and deactivation vaccine.People adopt mesogenic or virulent strain to develop vaccine for the IBDV of anti-system highly pathogenicity usually.The living vaccine virulence all can influence last immune effect too by force or too.Inactivated vaccine needs using dosage big, and preparation needs immunological adjuvant, can not induce body to produce cellular immunization.In addition, the unreasonable fabricius bursa tissue that also is easy to damage chicken of the abuse of vaccine, immune programme for children causes immunity function to descend, and immunosuppression makes the susceptibility raising of chicken to other diseases, reaches the immunne response ability drop to other vaccines.Along with the development of cell engineering and genetic engineering technique, the focus of research has turned to the development of recombinant vaccine at present.Develop a kind of new generation vaccine safely and effectively particularly recombinant vaccine become the focus of current research.With respect to traditional vaccine, the production of recombinant vaccine is carried out external fully, need not be that carrier obtains virus preparation living vaccine or deactivation vaccine with the susceptible animal; Vaccine does not contain can cause the sick composition of chicken mass-sending, the danger of the poison that do not loose.A lot of scholars are devoted to the research of the recombinant vaccine of IBD always.Focus mainly still is dna vaccination and subunit vaccine.Dna vaccination is that the plasmid DNA that will contain the coding for antigens gene directly imports in the body, and antigen gene is expressed in vivo, induces body to produce immunne response, comprises neutralizing antibody, cellulotoxic lymphocyte and helper cell (Hassett et al, 1996).This vaccine expressed proteins can be with the natural antigen form by immune system recognition, Heat stability is good, and immunizing power is lasting.
IBDV belongs to birnavirus section Avibirnavirus.Be divided into two serotypes of I type and II type.Have only some strain of I type IBDV that chicken is had virulence.IBDV has five kinds of maturation proteins, VP1, VP2, VP3, VP4 and VP5.Wherein VP2 and VP3 are main structural protein.VP2 is positioned at the N end of polyprotein, and molecular weight is about 40kD, is made up of 451 amino-acid residues, and it contains the antigenic determinant that can induce neutralizing antibody of serotype specificity, is the main host protective immunity former (Hudson et al, 1986) of virus.Antigenic determinant on the VP2 is a conformation dependent, and its inductive neutralizing antibody can protect the host to avoid infection (Azad et al, 1987 of IBDV passively; Becht et al, 1988).VP2 still is a kind of antiapoptotic factors simultaneously, can induce apoptosis of many kinds (Lv Yingzi, 1999).Therefore, in the molecular biology research of IBDV, the proteic research of VP2 has important status.Step CHIGO etc. (2000) inserts in eukaryon expression plasmid immune SPF chicken with the VP2 gene of D78 strain.The result shows that the immunity of VP2 gene DNA can induce the SPF chicken to produce neutralizing antibody, and the attack of IBDV highly virulent strain is had provide protection.Pitcovski et al(2003) the VP2 gene is expressed in Pichia pastoris expression system, the amplification back is carried out immunity with it to the chicken group, obtains good effect.Hulse et al(2002) with the VP2 gene clone of IBDV standard virulent strain STC in carrier for expression of eukaryon, plasmid DNA purification potruncus intramuscular injection immunity chick in 2 age in week.The result all can find the VP2 gene in chest muscle, thymus gland, spleen and the fabricius bursa, but does not then have in cecal tonsil.Behind the chest muscle of proof plasmid DNA direct injection chicken, transcribe and the translation purpose gene at the injection part potential energy, and can be distributed in the firsts and seconds Lymphoid tissue.Ginger equality (1998) shows that with the chick of VP2, immune 14 ages in days of VP3 recombinant plasmid dna, result the VP2 gene recombination plasmid produces the higher ELISA antibody except inducing, and also can obviously reduce M ﹠ M.Though single antigen VP2 dna vaccination prevention infectious bursal disease effect is pretty good, have also that immunoreactivity is strong inadequately, immunogenicity is weak, the high relatively inadequately defective of protection.How better improving the dna vaccination immune effect, enhance immunity is replied level, is the key issue of current dna vaccine research.
Along with deepening continuously of pair cell factor research, many cytokines find to have tangible molecular immune adjuvant effect, immunogenicity and reactionogenicity that can enhancement antigen.Alexin is exactly the class non-specific immunity factor that body produces for antagonism external source pathogenic micro-organism.Recently studies show that to alexinic it all has extremely important effect (Menendez A ﹠amp aspect raising of organism adaptation immunizing power and innate immunity power; Finlay B B, 2007), be an important component part of living organism immunity defence system.People's beta-alexin (hBD-1 and hBD-2) plays an important role in endogenous immunity and the acquired immune response, as prematurity dendritic cells and memory T-cell are had chemotaxis (Yang et al, 1999; Yang et al, 2000).Biragyn et al(2001) to the research of the plain polypeptide-2,3 of mouse beta-alexin 1 also find they can with the combining of the exciting acceptor of mouse CCR6 chemistry, be similar to inflammation chemistry agonist MIP3-α, immature cell that can the chemical attraction derived from bone marrow.When inducing enhancing body acquired immunity power Mechanism Study, the element that is on the defensive finds that Lillard et al(1999) human alpha-defensin (HNPs) can significantly increase the level of antigen-specific IgG and IgM in the serum; Enhancement antigen specific C D4
+The secretion of the increment of T cell and IFN-γ, IL-5, IL-6, IL-10; CD4 is found in vitro study
+T improves spleen and Peyer ' the s knot CD4 that CD3 ε stimulates
+The increment of T cell and the secretion of the t helper cell factor; Regulate the expression of spleen and Peyer ' the s knot B or the T cell mass costimulatory molecules of LPS or CD3 ε stimulation.Tani et al(2000) external personnel selection α-alexin stimulates the mouse spleen cell can promote its increment and production of cytokines; Feed in the body and can improve IgG to mouse
1, IgG
2a, IgG
2bAntibody horizontal.These results of study have shown that all alexin has vital role in endogenous immunizing power and acquired immunity power.
Summary of the invention
Goal of the invention of the present invention be to provide a kind of have the peculiar immuno-potentiation of alexin, be fit to that chicken is used, can be used for preventing the gene co-expressing recombinant plasmid of infectious bursal disease and the dna vaccination of making by this plasmid.
The present invention realizes like this, the pcr amplification process that comprises chicken alexin-1 gene fragment successively, the building process of recombinant plasmid pcDNA3.1 (+)-Gal-1, the pcr amplification process of chicken bursal disease virus VP 2 gene, the building process of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2, chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 culturing process leaching process
The pcr amplification process of chicken alexin-1 gene fragment is successively:
1, respectively through multiple comparisons after designs primer according to chicken phylaxin gene-1 gene order of in GenBank, having logined both at home and abroad, according to the restriction enzyme site on the carrier for expression of eukaryon pcDNA3.1 (+), the design of chicken phylaxin gene-1 upstream primer begins from having removed leading peptide, adds initiator codon word ATG and Hind III restriction enzyme site; The downstream primer design has been removed terminator codon TGA, and has been added BamH I restriction enzyme site at the gene end, and chicken phylaxin gene-1 upstream and downstream primer sequence is:
Chicken phylaxin gene-1 upstream primer:
5’-CGAAGCTTAAACCATGGGAAGGAAGTCAGATTG-3’?（Hind?III）
Chicken phylaxin gene-1 downstream primer:
5 '-TTGGATCCGCCCCATATTCTTTTGC-3 ' (BamH I restriction enzyme site)
；
2, with recombinant plasmid pGEM-T-Gal-1 is template, add the ExTaq archaeal dna polymerase, chicken phylaxin gene-1 upstream and downstream primer, dNTPs carries out amplified reaction, the reaction system of PCR is: 10 * PCR Buffer(comprises 0.5mmol/L MgCl2,50mmol/L KCl, 10mmol/L TrisHCl, 0.001% gelatin) 5 μ L, 4 * dNTPs(comprises dATP, dTTP, dCTP, each 2.5mmol/L of dGTP) 4 μ L, concentration is on the chicken phylaxin gene-1 of 20 μ mol/L, each 1 μ L of downstream primer, pGEM-T-gal-1 plasmid 1 μ L, ddH2O(distilled water) 37.5 μ L, concentration is the ExTaq archaeal dna polymerase 0.5 μ L of 5 μ mol/L, and reaction process is followed successively by: a, handle 3min for 95 ℃; B, successively 94 ℃ handle 45s, 55 ℃ and handle 45s, 72 ℃ and handle 1min; Reaction process is carried out 30 circulations; C, 72 ℃ of extension 10min; Promptly obtain the PCR product of chicken alexin-1 gene fragment, the PCR product of chicken alexin-1 gene fragment is observed at 1% agarose gel electrophoresis, and as seen the amplified band of about 130bp is big or small consistent with expected result,
Chicken alexin-1 gene fragment order:
atgggaaggaagtcagattgttttcgaaagagtggcttctgtgcatttctgaagtgcccttccctcactctcatcagtgggaaatgctcaagattttacc
，
The building process of recombinant plasmid pcDNA3.1 (+)-Gal-1: with the PCR product of chicken alexin-1 gene fragment phenol chloroform extracting and purifying, ethanol sedimentation, dissolve with TE dry back, and the PCR product of chicken alexin-1 gene fragment is used
BamH I,
HindIII carries out double digestion to be handled, glue reclaims the band of 130bp, with same method pcDNA3.1 (+) plasmid being carried out double digestion handles, glue reclaims the dna fragmentation about 5.4kb, get pcDNA3.1 (+) plasmid that glue reclaims behind glue reclaims behind the 5 μ L double digestions chicken alexin-1 gene fragment and the 3 μ L double digestions, add 1 μ L, 10 * T4 DNA connection Buffer(and comprise 0.5mol/L TrisHCl, 0.1mol/L MgCl2,50mmol/L DTT, 5mmol/L ATP, 0.25mg/mL BSA), the T4 dna ligase of 1 μ L, 16 ℃ connect 18 hours, to connect product and transform DH5 α competent cell, contain 37 ℃ of cultivations on the LB flat board of penbritin, promptly finishing the structure of recombinant plasmid pcDNA3.1 (+)-Gal-1
The pcr amplification process of chicken bursal disease virus VP 2 gene comprises successively:
1, respectively through multiple comparisons after designs primer according to the chicken bursal disease virus VP 2 gene sequence of in GenBank, having logined both at home and abroad, according to the restriction enzyme site on the carrier for expression of eukaryon pcDNA3.1 (+), chicken bursal disease virus VP 2 gene upstream primer adds EcoR I restriction enzyme site and adds 1 base T and is used for ORF(Openg reading frame) correctly the reading over of frame, the downstream primer design is at the gene end, add terminator codon TGA and add Xho I restriction enzyme site
2, with recombinant plasmid pGEM-T-VP2 is template, add the ExTaq archaeal dna polymerase, chicken bursal disease virus VP 2 gene upstream and downstream primer, dNTPs carries out amplified reaction, the reaction system of PCR is: 10 * PCR Buffer(comprises 0.5mmol/L MgCl2,50mmol/L KCl, 10mmol/L TrisHCl, 0.001% gelatin) 5 μ L, 4 * dNTPs(comprises dATP, dTTP, dCTP, each 2.5mmol/L of dGTP) 4 μ L, concentration is on the chicken bursal disease virus VP 2 gene of 20 μ mol/L, each 1 μ L of downstream primer, pGEM-T-VP2 plasmid 1 μ L, ddH2O(distilled water) 37.5 μ L, concentration is 5 μ mol/L ExTaq archaeal dna polymerases, 0.5 μ L, and reaction process is followed successively by: a, handle 3min for 95 ℃; B, successively 94 ℃ handle 40s, 56 ℃ and handle 45s, 72 ℃ and handle 90s; The b process is carried out 30 circulations; C, 72 ℃ extend 10min, can obtain the PCR product of chicken bursal disease virus VP 2 gene, and the PCR product of chicken bursal disease virus VP 2 gene is observed at 1% agarose gel electrophoresis, and the amplified band about as seen about 1400bp is big or small consistent with expected result,
Chicken bursal disease virus VP 2 gene sequence:
ACGAACCTGCAAGATCAAACCCAACAGATTGTTCCGTTCATACGGAGCCTTCTGATGCCAACAACCGGACCGGCGTCCATTCCGGACGACACCCTAGAGA AGCACACTCTCAGGTCAGAGACCTCGACCTACAATTTGACTGTGGGGGACACAGGGTCAGGGCTAATTGTCTTTTTCCCTGGTTTCCCTGGCTCAATT G T GGGTGCTCACTACACACTGCAGAGCAATGGGAGCTACAAGTTCGATCAGATGCTCCTGACTGCCCAGAACCTACCGGCCAGCTACAATTACTGCAG GC TA GTGAGTCGGAGTCTCACAGTGAGGTCAAGCACACTCCCTGGTGGCGTTTATGCACTAAATGGCACCATAAACGCCGTGACCTTCCAAGGAAGCC TGA GTG AACTGACAGATGTTAGCTACAATGGGTTGATGTCTGCAACAGCCAACATCAACGACAAGATCGGGAACGTCCTAGTAGGGGAAGGGGTAACT GTCC TCAG CTTACCCACATCATATGATCTTGGGTATGTGAGACTCGGTGACCCCATTCCCGCTATAGGGCTCGACCCAAAAATGGTAGCAACATGTGA CAGCA GTGAC AGGCCCAGAGTCTACACCATAACTGCAGCCGATGATTACCAATTCTCATCACAGTACCAAGCAGGTGGAGTAACAATCACACTGTTCT CAGCTA ATATCG ATGCCATCACAAGCCTCAGTATCGGGGGAGAACTCGTGTTTCAAACAAGCGTCCAAGGCCTTATACTGGGTGCTACCATCTACCTT ATAGGCT TTGATGG GACTGCGGTAATCACCCGAGCTGTGGCCGCAGACAATGGGCTAACGGCCGGCACTGACAACCTTATGCCATTCAATATTGTGAT TCCAACCA GCGAGATA ACCCAGCCAATCACATCCATCAAACTGGAGATAGTGACCTCCAAAAGTGGTGGTCAGGCGGGGGATCTGATGTCATGGTCAG CAAGTGGGA GCCTAGCAG TGACGATCCACGGTGGCAACTATCCAGGGGCCCTCCGTCCCGTCACACTAGTAGCCTACGAAAGAGTGGCAACAGGATCT GTCGTTACGG TCGCTGGGGT GAGCAACTTCGAGCTGATCCCAAATCCTGAACTAACAAAGAACCTGGTCACAGAATACGGCCGATTTGACCCAGGAGC CATGAACTACA CAAAATTGATA CTGAGTGAGAGGGACCGTCTTGGCATCAAGACCGTATGGCCAACAAGGGAGTACACTGACTTTCGCGAGTACTTCA
，
The building process of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2: with the PCR product of chicken bursal disease virus VP 2 gene phenol chloroform extracting and purifying, ethanol sedimentation, dissolve with TE dry back, the PCR product of chicken bursal disease virus VP 2 gene is handled with EcoR I and Xho I double digestion, glue reclaims the band of about 1400bp size, with same method recombinant plasmid pcDNA3.1 (+)-Gal-1 being carried out double digestion handles, glue reclaims the dna fragmentation about 5.5kB, get pcDNA3.1 (+)-Gal-1 plasmid fragment that glue reclaims behind glue reclaims behind the 5 μ L double digestions chicken bursal disease virus VP 2 gene fragment and the 3 μ L double digestions, 10 * T4 the DNA that adds 1 μ L connects Buffer(and comprises 0.5mol/L TrisHCl, 0.1mol/L MgCl2,50mmol/L DTT, 5mmol/L ATP, 0.25mg/mL BSA), the T4 dna ligase of 1 μ L, 16 ℃ connect 18 hours, to connect product and transform DH5 α competent cell, containing 37 ℃ of cultivations on the LB flat board of penbritin, promptly finish the structure of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2
Chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 culturing process leaching process: the single bacterium colony of picking from the LB solid medium, be inoculated in the triangular flask that fills the 10ml liquid nutrient medium 37 ℃ of concussion incubated overnight.The fermention medium that in the triangular flask of 1000ml, adds 100ml, the bacterial classification of access 5ml, 37 ℃, under the 200rpm/min rotating speed, shake, cultivate 20h.Extract the alkaline lysis method of plasmid with routine and carry out a large amount of extractings of plasmid, carry out purifying with the diatomite adsorption method and can obtain chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2;
Carrier for expression of eukaryon pcDNA3.1 (+) is the product of Invitrogen company, the recombinant plasmid pGEM-T-Gal-1 of chicken alexin-1 gene and contain chicken bursal disease virus VP 2 recombinant plasmid pGEM-T-VP2 and make up, preserve and provide for animal science institute of Agricultural University Of South China poultry research department, restriction enzyme EcoR I, the Xho I of use, T4DNA ligase enzyme, ExTaq archaeal dna polymerase etc. are all available from precious Tyke, Guangzhou bio tech ltd.
Of the present invention is to realize like this by chicken infectivity bursa of Fabricius virus VP 2 gene and dna vaccination that chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-the Gal-1/VP2 plasmid is made, with the PBS damping fluid chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 plasmid are diluted to 1mg/ml, are a kind of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken Gal-1 gene coexpression DNA bacterin pcDNA3.1 (+)-Gal-1/VP2.This molecular dna vaccine carries out preventive vaccination with the method for intramuscular injection.
The present invention compared with the prior art, be a kind of chicken alexin-1 gene and chicken bursal disease virus VP 2 gene coexpression DNA bacterin, have the peculiar immuno-potentiation of chicken alexin-1, be suitable for chicken and use, the advantage that can be used to prevent infectious bursal disease again simultaneously.
Embodiment:
Now in conjunction with the embodiments the present invention is described in further detail:
The present invention comprises the pcr amplification process of chicken alexin-1 gene fragment successively, the building process of recombinant plasmid pcDNA3.1 (+)-Gal-1, the pcr amplification process of chicken bursal disease virus VP 2 gene, the building process of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2, chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 culturing process leaching process
The pcr amplification process of chicken alexin-1 gene fragment is successively:
1, respectively through multiple comparisons after designs primer according to chicken phylaxin gene-1 gene order of in GenBank, having logined both at home and abroad, according to the restriction enzyme site on the carrier for expression of eukaryon pcDNA3.1 (+), the design of chicken phylaxin gene-1 upstream primer begins from having removed leading peptide, adds initiator codon ATG and Hind III restriction enzyme site; The downstream primer design has been removed terminator codon TGA, and has been added BamH I restriction enzyme site at the gene end, and chicken phylaxin gene-1 upstream and downstream primer sequence is:
Chicken phylaxin gene-1 upstream primer:
5 '-CGAAGCTTAAACCATGGGAAGGAAGTCAGATTG-3 ' (Hind III restriction enzyme site)
Chicken phylaxin gene-1 downstream primer:
5 '-TTGGATCCGCCCCATATTCTTTTGC-3 ' (BamH I restriction enzyme site)
；
2, with recombinant plasmid pGEM-T-Gal-1 is template, add the ExTaq archaeal dna polymerase, chicken phylaxin gene-1 upstream and downstream primer, dNTPs carries out amplified reaction, the reaction system of PCR is: 10 * PCR Buffer(comprises 0.5mmol/L MgCl2,50mmol/L KCl, 10mmol/L TrisHCl, 0.001% gelatin) 5 μ L, 4 * dNTPs(comprises dATP, dTTP, dCTP, each 2.5mmol/L of dGTP) 4 μ L, concentration is on the chicken phylaxin gene-1 of 20 μ mol/L, each 1 μ L of downstream primer, pGEM-T-gal-1 plasmid 1 μ L, ddH2O(distilled water) 37.5 μ L, concentration is the ExTaq archaeal dna polymerase 0.5 μ L of 5 μ mol/L, and reaction process is followed successively by: a, handle 3min for 95 ℃; B, successively 94 ℃ handle 45s, 55 ℃ and handle 45s, 72 ℃ and handle 1min; Reaction process is carried out 30 circulations; C, 72 ℃ of extension 10min; Promptly obtain the PCR product of chicken alexin-1 gene fragment, the PCR product of chicken alexin-1 gene fragment is observed at 1% agarose gel electrophoresis, and as seen the amplified band of about 130bp is big or small consistent with expected result,
Chicken alexin-1 gene fragment order:
atgggaaggaagtcagattgttttcgaaagagtggcttctgtgcatttctgaagtgcccttccctcactctcatcagtgggaaatgctcaagattttacctctgctgcaaaagaatatggggc
，
The building process of recombinant plasmid pcDNA3.1 (+)-Gal-1: with the PCR product of chicken alexin-1 gene fragment phenol chloroform extracting and purifying, ethanol sedimentation, dissolve with TE dry back, and the PCR product of chicken alexin-1 gene fragment is used
BamH I,
HindIII carries out double digestion to be handled, glue reclaims the band of 130bp, with same method pcDNA3.1 (+) plasmid being carried out double digestion handles, glue reclaims the dna fragmentation about 5.4kb, get pcDNA3.1 (+) plasmid that glue reclaims behind glue reclaims behind the 5 μ L double digestions chicken alexin-1 gene fragment and the 3 μ L double digestions, add 1 μ L, 10 * T4 DNA connection Buffer(and comprise 0.5mol/L TrisHCl, 0.1mol/L MgCl2,50mmol/L DTT, 5mmol/L ATP, 0.25mg/mL BSA), the T4 dna ligase of 1 μ L, 16 ℃ connect 18 hours, will connect product and transform DH5 α competent cell, are containing 37 ℃ of cultivations on the LB flat board of penbritin.
The double digestion of recombinant plasmid pcDNA3.1 (+)-Gal-1 is identified: containing the single white colony of picking on the LB flat board of penbritin, being inoculated in 3ml contains in the LB liquid medium of penbritin, 37 ℃ of vibrations were cultivated after 18 hours, get and cultivate bacterium liquid, the extracting plasmid DNA is carried out the double digestion evaluation, will contain chicken alexin-1 gene fragment recombinant plasmid pcDNA3.1 (+)-Gal-1 and use respectively
BamH I,
HindIII carries out double digestion, enzyme is cut product and is observed at 1% agarose gel electrophoresis, produce two bands about about 5.4kb and 130bp behind recombinant plasmid pcDNA3.1 (+)-Gal-1 double digestion, prove successfully to have made up recombinant plasmid pcDNA3.1 (+)-Gal-1 that contains chicken alexin-1 gene fragment.
The PCR of recombinant plasmid pcDNA3.1 (+)-Gal-1 identifies: containing the single white colony of picking on the LB flat board of penbritin, being inoculated in 3ml contains in the LB liquid medium of penbritin, 37 ℃ of vibrations were cultivated after 18 hours, get and cultivate bacterium liquid, the extracting plasmid DNA is carried out PCR and is identified, with recombinant plasmid pcDNA3.1 (+)-Gal-1 is template, and adding ExTaq archaeal dna polymerase, upstream and downstream primer, dNTPs carry out amplified reaction.The reaction system of PCR is: 10 * PCR Buffer, 5 μ L, 4 * dNTPs(2.5mmol/L) 4 μ L, each 1 μ L of chicken phylaxin gene-1 upstream and downstream primer (20 μ mol/L), pcDNA3.1 (+)-Gal-1 recombinant plasmid 1 μ L, ddH2O 37.5 μ L, ExTaq archaeal dna polymerase (5u/L) 0.5 μ L.Reaction parameter is: handle 3min for 95 ℃, 94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 1min 30 respectively circulate totally then, and 72 ℃ are extended 10min.The PCR product is observed at 1% agarose gel electrophoresis, and as seen the amplified band of about 130bp proves successfully to have made up recombinant plasmid pcDNA3.1 (+)-Gal-1 that contains chicken alexin-1 gene fragment.
The amplification procedure of chicken bursal disease virus VP 2 gene comprises successively:
1, respectively through multiple comparisons after designs primer according to the chicken bursal disease virus VP 2 gene sequence of in GenBank, having logined both at home and abroad, according to the restriction enzyme site on the carrier for expression of eukaryon pcDNA3.1 (+), chicken bursal disease virus VP 2 gene upstream primer adds EcoR I restriction enzyme site and adds 1 base T and is used for ORF(Openg reading frame) correctly the reading over of frame, the downstream primer design is at the gene end, add terminator codon TGA and add Xho I restriction enzyme site
2, with recombinant plasmid pGEM-T-VP2 is template, add the ExTaq archaeal dna polymerase, chicken bursal disease virus VP 2 gene upstream and downstream primer, dNTPs carries out amplified reaction, the reaction system of PCR is: 10 * PCR Buffer(comprises 0.5mmol/L MgCl2,50mmol/L KCl, 10mmol/L TrisHCl, 0.001% gelatin) 5 μ L, 4 * dNTPs(comprises dATP, dTTP, dCTP, each 2.5mmol/L of dGTP) 4 μ L, concentration is on the chicken bursal disease virus VP 2 gene of 20 μ mol/L, each 1 μ L of downstream primer, pGEM-T-VP2 plasmid 1 μ L, the ddH2O(distilled water) 37.5 μ L, concentration is 5 μ mol/L ExTaq archaeal dna polymerases, 0.5 μ L.Reaction process is followed successively by: a, 95 ℃ of processing 3min; B, successively 94 ℃ handle 40s, 56 ℃ and handle 45s, 72 ℃ and handle 90s; The b process is carried out 30 circulations; C, 72 ℃ extend 10min, can obtain the PCR product of chicken bursal disease virus VP 2 gene, and the PCR product of chicken bursal disease virus VP 2 gene is observed at 1% agarose gel electrophoresis, and the amplified band about as seen about 1400bp is big or small consistent with expected result,
Chicken bursal disease virus VP 2 gene sequence:
ACGAACCTGCAAGATCAAACCCAACAGATTGTTCCGTTCATACGGAGCCTTCTGATGCCAACAACCGGACCGGCGTCCATTCCGGACGACACCCTAGAGAAGCACACTCTCAGGTCAGAGACCTCGACCTACAATTTGACTGTGGGGGACACAGGGTCAGGGCTAATTGTCTTTTTCCCTGGTTTCCCTGGCTCAATTGTGGGTGCTCACTACACACTGCAGAGCAATGGGAGCTACAAGTTCGATCAGATGCTCCTGACTGCCCAGAACCTACCGGCCAGCTACAATTACTGCAGGCTAGTGAGTCGGAGTCTCACAGTGAGGTCAAGCACACTCCCTGGTGGCGTTTATGCACTAAATGGCACCATAAACGCCGTGACCTTCCAAGGAAGCCTGAGTGAACTGACAGATGTTAGCTACAATGGGTTGATGTCTGCAACAGCCAACATCAACGACAAGATCGGGAACGTCCTAGTAGGGGAAGGGGTAACTGTCCTCAGCTTACCCACATCATATGATCTTGGGTATGTGAGACTCGGTGACCCCATTCCCGCTATAGGGCTCGACCCAAAAATGGTAGCAACATGTGACAGCAGTGACAGGCCCAGAGTCTACACCATAACTGCAGCCGATGATTACCAATTCTCATCACAGTACCAAGCAGGTGGAGTAACAATCACACTGTTCTCAGCTAATATCGATGCCATCACAAGCCTCAGTATCGGGGGAGAACTCGTGTTTCAAACAAGCGTCCAAGGCCTTATACTGGGTGCTACCATCTACCTTATAGGCTTTGATGGGACTGCGGTAATCACCCGAGCTGTGGCCGCAGACAATGGGCTAACGGCCGGCACTGACAACCTTATGCCATTCAATATTGTGATTCCAACCAGCGAGATAACCCAGCCAATCACATCCATCAAACTGGAGATAGTGACCTCCAAAAGTGGTGGTCAGGCGGGGGATCTGATGTCATGGTCAGCAAGTGGGAGCCTAGCAGTGACGATCCACGGTGGCAACTATCCAGGGGCCCTCCGTCCCGTCACACTAGTAGCCTACGAAAGAGTGGCAACAGGATCTGTCGTTACGGTCGCTGGGGTGAGCAACTTCGAGCTGATCCCAAATCCTGAACTAACAAAGAACCTGGTCACAGAATACGGCCGATTTGACCCAGGAGCCATGAACTACACAAAATTGATACTGAGTGAGAGGGACCGTCTTGGCATCAAGACCGTATGGCCAACAAGGGAGTACACTGACTTTCGCGAGTACTTCATGGAGGTGGCCGACCTCAACTCCCCCCTGAAGATTGCAGGAGCATTTGGCTTCAAAGACATAATTCGGGCACTAAGGTGATGA
，
The building process of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2: with the PCR product of chicken bursal disease virus VP 2 gene phenol chloroform extracting and purifying, ethanol sedimentation, dissolve with TE dry back, the PCR product of chicken bursal disease virus VP 2 gene is handled with EcoR I and Xho I double digestion, glue reclaims the band of about 1400bp size, with same method recombinant plasmid pcDNA3.1 (+)-Gal-1 being carried out double digestion handles, glue reclaims the dna fragmentation about 5.5kB, get pcDNA3.1 (+)-Gal-1 plasmid fragment that glue reclaims behind glue reclaims behind the 5 μ L double digestions chicken bursal disease virus VP 2 gene fragment and the 3 μ L double digestions, 10 * T4 the DNA that adds 1 μ L connects Buffer(and comprises 0.5mol/L TrisHCl, 0.1mol/L MgCl2,50mmol/L DTT, 5mmol/L ATP, 0.25mg/mL BSA), the T4 dna ligase of 1 μ L, 16 ℃ connect 18 hours, to connect product and transform DH5 α competent cell, contain 37 ℃ of cultivations on the LB flat board of penbritin.
The double digestion of coexpression recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 is identified, is containing the single bacterium colony of picking on the LB flat board of penbritin, and the extracting plasmid DNA is carried out double digestion and identified.Coexpression recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 is carried out double digestion with Hind III, Xho I respectively, enzyme is cut product and is observed at 1% agarose gel electrophoresis, produce two bands about about 5.5kb and 1400bp behind coexpression recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 double digestion, prove successfully to have made up coexpression recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2.
The PCR of coexpression recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 identifies, containing the single white colony of picking on the LB flat board of penbritin, being inoculated in 3ml contains in the LB liquid medium of penbritin, 37 ℃ of vibrations were cultivated after 18 hours, get and cultivate bacterium liquid, the extracting plasmid DNA is carried out PCR and is identified.With plasmid pcDNA3.1 (+)-Gal-1/VP2 is template, and adding ExTaq archaeal dna polymerase, chicken bursal disease virus VP 2 gene upstream and downstream primer, dNTPs carry out amplified reaction.The reaction system of PCR is: 10 * PCR Buffer, 5 μ L, 4 * dNTPs(2.5mmol/L) 4 μ L, each 1 μ L of chicken bursal disease virus VP 2 gene upstream and downstream primer (20 μ mol/L), recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 1 μ L, ddH2O 37.5 μ L, ExTaq archaeal dna polymerase (5u/L) 0.5 μ L.Reaction parameter is: handle 3min for 95 ℃, 94 ℃ of 40s, 56 ℃ of 45s, 72 ℃ of 90s 30 respectively circulate totally then, and 72 ℃ are extended 10min.The PCR product is observed at 1% agarose gel electrophoresis, and as seen the amplified band of about 1400bp proves successfully to have made up coexpression recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2.
Chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 culturing process leaching process: the single white colony of picking from the LB flat board that contains penbritin, be inoculated in and fill in the triangular flask of LB liquid medium that 10ml contains penbritin 37 ℃ of concussion incubated overnight.The fermention medium that in the triangular flask of 1000ml, adds 100ml, the bacterial classification of access 5ml, 37 ℃, under the 200rpm/min rotating speed, shake, cultivate 20h.Extract the alkaline lysis method of plasmid with routine and carry out a large amount of extractings of plasmid, carry out purifying with the diatomite adsorption method and can obtain chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2;
Carrier for expression of eukaryon pcDNA3.1 (+) is the product of Invitrogen company, the recombinant plasmid pGEM-T-Gal-1 of chicken alexin-1 gene and contain chicken bursal disease virus VP 2 recombinant plasmid pGEM-T-VP2 and make up, preserve and provide for animal science institute of Agricultural University Of South China poultry research department, restriction enzyme EcoR I, the Xho I of use, T4DNA ligase enzyme, ExTaq archaeal dna polymerase etc. are all available from precious Tyke, Guangzhou bio tech ltd.
Of the present invention is to realize like this by chicken infectivity bursa of Fabricius virus VP 2 gene and dna vaccination that chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-the Gal-1/VP2 plasmid is made, with the PBS damping fluid chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 plasmid are diluted to 1mg/ml, are a kind of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken Gal-1 gene coexpression DNA bacterin pcDNA3.1 (+)-Gal-1/VP2.This molecular dna vaccine carries out preventive vaccination with the method for intramuscular injection.
With coexpression DNA bacterin pcDNA3.1 (+)-negative chicken (as test group) of Gal-1/VP2 immunity IBD VP2 serum antibody, with pcDNA3.1 (+)-VP2 dna vaccination is control group, detects the immuno-potentiation behind Gal-1 gene and the VP2 gene co-expressing by detection serological specificity IgG antibody value, CD3+, CD4+, CD8+ percentage composition.Measurement result is found, immunity back the 7th day, 14 days, pcDNA3.1 (+)-Gal-1/VP2 group chicken serum specific antibody value, CD3+, CD4+, CD8+ percentage composition just are higher than the single expression group of VP2 (being pcDNA3.1 (+)-VP2 group) always, but difference is not remarkable.Back 21 days of immunity, pcDNA3.1 (+)-Gal-1/VP2 group are respectively measured numerical value and all are significantly higher than pcDNA3.1 (+)-VP2 and organize (P＜0.05).Attack malicious experimental result and also show, pcDNA3.1 (+)-Gal-1/VP2 group chicken M ﹠ M all is better than pcDNA3.1 (+)-VP2 group.The result has shown the immuno-potentiation to the VP2 gene of Gal-1 gene among co-expression gene engineering DNA vaccine pcDNA A3.1 (+)-Gal-1/VP2.
Claims (2)
1. gene co-expressing recombinant plasmid, it is characterized in that its construction process comprises the pcr amplification process of chicken alexin-1 gene fragment successively, the building process of recombinant plasmid pcDNA3.1 (+)-Gal-1, the pcr amplification process of chicken bursal disease virus VP 2 gene, the building process of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2, chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 culturing process leaching process
The pcr amplification process of chicken alexin-1 gene fragment is successively:
The gene order of chicken alexin-1 gene that a, basis have been logined in GenBank both at home and abroad designs primer respectively behind multiple comparisons, according to the restriction enzyme site on the carrier for expression of eukaryon pcDNA3.1 (+), the upstream primer design of chicken alexin-1 gene begins from having removed leading peptide, adds initiator codon ATG and Hind III restriction enzyme site; The downstream primer design has been removed terminator codon TGA, and has been added BamH I restriction enzyme site at the gene end, and the upstream and downstream primer sequence of chicken alexin-1 gene is:
The upstream primer of chicken alexin-1 gene:
5’-CGAAGCTTAAACCATGGGAAGGAAGTCAGATTG-3’
The downstream primer of chicken alexin-1 gene:
5’-TTGGATCCGCCCCATATTCTTTTGC-3’
；
B, be template with recombinant plasmid pGEM-T-Gal-1, adding ExTaq archaeal dna polymerase, the upstream and downstream primer of chicken alexin-1 gene, dNTPs carry out amplified reaction, the reaction system of PCR is: 10 * PCR Buffer5 μ L, 4 * dNTPs4 μ L, concentration is each 1 μ L of upstream and downstream primer of chicken alexin-1 gene of 20 μ mol/L, pGEM-T-gal-1 plasmid 1 μ L, ddH
2O 37.5 μ L, concentration is the ExTaq archaeal dna polymerase 0.5 μ L of 5 μ mol/L, reaction process is followed successively by: a, 95 ℃ of processing 3min; B, successively 94 ℃ handle 45s, 55 ℃ and handle 45s, 72 ℃ and handle 1min; Reaction process is carried out 30 circulations; C, 72 ℃ of extension 10min; Promptly obtain the PCR product of chicken alexin-1 gene fragment,
Chicken alexin-1 gene fragment order:
atgggaaggaagtcagattgttttcgaaagagtggcttctgtgcatttctgaagtgcccttccctcactctcatcagtgggaaatgctcaagattttacctctgctgcaaaagaatatggggc
，
The building process of recombinant plasmid pcDNA3.1 (+)-Gal-1: with the PCR product of chicken alexin-1 gene fragment phenol chloroform extracting and purifying, ethanol sedimentation, dissolve with TE dry back, and the PCR product of chicken alexin-1 gene fragment is used
BamH I,
HindIII carries out double digestion to be handled, glue reclaims the band of 130bp, with same method pcDNA3.1 (+) plasmid being carried out double digestion handles, glue reclaims the dna fragmentation of 5.4kb, get pcDNA3.1 (+) plasmid that glue reclaims behind glue reclaims behind the 5 μ L double digestions chicken alexin-1 gene fragment and the 3 μ L double digestions, add 1 μ L, 10 * T4 DNA and connect Buffer, the T4 dna ligase of 1 μ L, 16 ℃ connect 18 hours, to connect product and transform DH5 α competent cell, contain 37 ℃ of cultivations on the LB flat board of penbritin, promptly finishing the structure of recombinant plasmid pcDNA3.1 (+)-Gal-1
The pcr amplification process of chicken bursal disease virus VP 2 gene comprises successively:
The chicken bursal disease virus VP 2 gene sequence that a, basis have been logined in GenBank both at home and abroad designs primer respectively behind multiple comparisons, according to the restriction enzyme site on the carrier for expression of eukaryon pcDNA3.1 (+), chicken bursal disease virus VP 2 gene upstream primer adds EcoR I restriction enzyme site and adds 1 base T and is used for correctly reading over of ORF frame, the downstream primer design is at the gene end, add terminator codon TGA and add Xho I restriction enzyme site
B, be template with recombinant plasmid pGEM-T-VP2, adding ExTaq archaeal dna polymerase, chicken bursal disease virus VP 2 gene upstream and downstream primer, dNTPs carry out amplified reaction, the reaction system of PCR is: 10 * PCR Buffer, 5 μ L, 4 * dNTPs4 μ L, concentration is each 1 μ L of chicken bursal disease virus VP 2 gene upstream and downstream primer of 20 μ mol/L, pGEM-T-VP2 plasmid 1 μ L, ddH
2O 37.5 μ L, concentration is 5 μ mol/L ExTaq archaeal dna polymerases, 0.5 μ L, reaction process is followed successively by: a, 95 ℃ of processing 3min; B, successively 94 ℃ handle 40s, 56 ℃ and handle 45s, 72 ℃ and handle 90s; The b process is carried out 30 circulations; C, 72 ℃ extend 10min, can obtain the PCR product of chicken bursal disease virus VP 2 gene,
Chicken bursal disease virus VP 2 gene sequence:
ACGAACCTGCAAGATCAAACCCAACAGATTGTTCCGTTCATACGGAGCCTTCTGATGCCAACAACCGGACCGGCGTCCATTCCGGACGACACCCTAGAGAAGCACACTCTCAGGTCAGAGACCTCGACCTACAATTTGACTGTGGGGGACACAGGGTCAGGGCTAATTGTCTTTTTCCCTGGTTTCCCTGGCTCAATTGTGGGTGCTCACTACACACTGCAGAGCAATGGGAGCTACAAGTTCGATCAGATGCTCCTGACTGCCCAGAACCTACCGGCCAGCTACAATTACTGCAGGCTAGTGAGTCGGAGTCTCACAGTGAGGTCAAGCACACTCCCTGGTGGCGTTTATGCACTAAATGGCACCATAAACGCCGTGACCTTCCAAGGAAGCCTGAGTGAACTGACAGATGTTAGCTACAATGGGTTGATGTCTGCAACAGCCAACATCAACGACAAGATCGGGAACGTCCTAGTAGGGGAAGGGGTAACTGTCCTCAGCTTACCCACATCATATGATCTTGGGTATGTGAGACTCGGTGACCCCATTCCCGCTATAGGGCTCGACCCAAAAATGGTAGCAACATGTGACAGCAGTGACAGGCCCAGAGTCTACACCATAACTGCAGCCGATGATTACCAATTCTCATCACAGTACCAAGCAGGTGGAGTAACAATCACACTGTTCTCAGCTAATATCGATGCCATCACAAGCCTCAGTATCGGGGGAGAACTCGTGTTTCAAACAAGCGTCCAAGGCCTTATACTGGGTGCTACCATCTACCTTATAGGCTTTGATGGGACTGCGGTAATCACCCGAGCTGTGGCCGCAGACAATGGGCTAACGGCCGGCACTGACAACCTTATGCCATTCAATATTGTGATTCCAACCAGCGAGATAACCCAGCCAATCACATCCATCAAACTGGAGATAGTGACCTCCAAAAGTGGTGGTCAGGCGGGGGATCTGATGTCATGGTCAGCAAGTGGGAGCCTAGCAGTGACGATCCACGGTGGCAACTATCCAGGGGCCCTCCGTCCCGTCACACTAGTAGCCTACGAAAGAGTGGCAACAGGATCTGTCGTTACGGTCGCTGGGGTGAGCAACTTCGAGCTGATCCCAAATCCTGAACTAACAAAGAACCTGGTCACAGAATACGGCCGATTTGACCCAGGAGCCATGAACTACACAAAATTGATACTGAGTGAGAGGGACCGTCTTGGCATCAAGACCGTATGGCCAACAAGGGAGTACACTGACTTTCGCGAGTACTTCATGGAGGTGGCCGACCTCAACTCCCCCCTGAAGATTGCAGGAGCATTTGGCTTCAAAGACATAATTCGGGCACTAAGGTGATGA
，
The building process of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2: with the PCR product of chicken bursal disease virus VP 2 gene phenol chloroform extracting and purifying, ethanol sedimentation, dissolve with TE dry back, the PCR product of chicken bursal disease virus VP 2 gene is handled with EcoR I and Xho I double digestion, glue reclaims the band of 1400bp size, with same method recombinant plasmid pcDNA3.1 (+)-Gal-1 being carried out double digestion handles, glue reclaims the dna fragmentation of 5.5kB, get pcDNA3.1 (+)-Gal-1 plasmid fragment that glue reclaims behind glue reclaims behind the 5 μ L double digestions chicken bursal disease virus VP 2 gene fragment and the 3 μ L double digestions, 10 * T4 the DNA that adds 1 μ L connects Buffer, the T4 dna ligase of 1 μ L, 16 ℃ connect 18 hours, to connect product and transform DH5 α competent cell, containing 37 ℃ of cultivations on the LB flat board of penbritin, promptly finish the structure of chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2
Chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 culturing process leaching process: the single white colony of picking from the LB solid medium, be inoculated in and fill in the triangular flask of LB liquid medium that 10ml contains penbritin, 37 ℃ of concussion incubated overnight, the fermention medium that in the triangular flask of 1000ml, adds 100ml, insert the bacterial classification of 5ml, 37 ℃, under the 200rpm/min rotating speed, shake, cultivate 20h, extract the alkaline lysis method of plasmid with routine and carry out a large amount of extractings of plasmid, carry out purifying with the diatomite adsorption method and can obtain chicken infectivity bursa of Fabricius virus VP 2 gene and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2;
Carrier for expression of eukaryon pcDNA3.1 (+) is the product of Invitrogen company, the recombinant plasmid pGEM-T-Gal-1 of chicken alexin-1 gene and contain chicken bursal disease virus VP 2 recombinant plasmid pGEM-T-VP2 and make up, preserve and provide for animal science institute of Agricultural University Of South China poultry research department, restriction enzyme EcoR I, the Xho I of use, T4DNA ligase enzyme, ExTaq archaeal dna polymerase are all available from precious Tyke, Guangzhou bio tech ltd.
2. a dna vaccination of being made by the gene co-expressing recombinant plasmid is characterized in that with the PBS damping fluid chicken infectivity bursa of Fabricius virus VP 2 gene as claimed in claim 1 and chicken alexin-1 gene co-expressing recombinant plasmid pcDNA3.1 (+)-Gal-1/VP2 plasmid being diluted to 1mg/ml and forming.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810220642 CN101586115B (en) | 2008-12-25 | 2008-12-25 | Gene coexpression recombinant plasmid and DNA vaccine prepared from same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200810220642 CN101586115B (en) | 2008-12-25 | 2008-12-25 | Gene coexpression recombinant plasmid and DNA vaccine prepared from same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101586115A CN101586115A (en) | 2009-11-25 |
| CN101586115B true CN101586115B (en) | 2011-10-12 |
Family
ID=41370545
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200810220642 Expired - Fee Related CN101586115B (en) | 2008-12-25 | 2008-12-25 | Gene coexpression recombinant plasmid and DNA vaccine prepared from same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101586115B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106177993B (en) * | 2016-07-06 | 2020-01-14 | 华南农业大学 | Infectious bursal disease virus DNA vaccine and construction method thereof |
-
2008
- 2008-12-25 CN CN 200810220642 patent/CN101586115B/en not_active Expired - Fee Related
Non-Patent Citations (3)
| Title |
|---|
| Diane J. Hulse et al.Partial protection against infectious bursal disease virus through DNA-mediated vaccination with the VP2 capsid protein and chicken IL-2 genes.《Vaccine》.2004,第22卷1249–1259. * |
| 张辉华 等.鸡β-防御素-1基因(Gal-1)在大肠杆菌中的融合表达与纯化.《中国兽医杂志》.2006,第42卷(第9期),9-12. * |
| 祁小乐 等.鸡传染性法氏囊病病毒VP2 蛋白研究进展.《中国预防兽医学报》.2008,第30卷(第8期),656-660. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101586115A (en) | 2009-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105693827B (en) | Porcine pseudorabies virus subunit vaccine and preparation method and application thereof | |
| CN102675471B (en) | Pig foot-and-mouth disease virus O-type broad spectrum multi-epitope recombination antigen and application thereof | |
| CN107384944B (en) | Yeast-expressed Coxsackie virus A6 virus-like particle and application thereof | |
| CN102221618B (en) | Method for establishing hog cholera lapinized virus labeled vaccine strain and preparing vaccine | |
| CN105624124B (en) | Vaccine composition for resisting O-type foot-and-mouth disease and preparation method and application thereof | |
| CN101880647B (en) | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application | |
| CN108218965A (en) | A kind of preparation method and application of Salmonella abortus equi flagellin FliC | |
| CN102274496B (en) | O/Asia I type foot and mouth disease virus bivalent genetic engineering polypeptide vaccine, its preparation method and its purpose | |
| CN1814757B (en) | Novel CpGDNA adjuvant, its preparing method and vaccine containing same | |
| US9913896B2 (en) | Attenuated parvovirus vaccine for muscovy duck parvovirus and goose parvovirus (derzsy's disease) | |
| Dar et al. | DNA prime-protein boost strategy with replicase-based DNA vaccine against foot-and-mouth disease in bovine calves | |
| CN101586115B (en) | Gene coexpression recombinant plasmid and DNA vaccine prepared from same | |
| CN102127554A (en) | Japanese encephalitis particle vaccine and preparation method and application thereof | |
| CN104119443B (en) | Broad-spectrum multi-epitope recombinant vaccine for bovine foot-and-mouth disease virus type A strain epidemic abroad, and preparation method and application thereof | |
| JP6914370B2 (en) | Two-kind mixed vaccine composition for preventing and / or treating porcine circovirus infection, its preparation method and use | |
| JP6821818B2 (en) | Porcine Circovirus Type 3 virus strain, its vaccine composition, preparation method and use | |
| CN102657864B (en) | Immune adjuvant of foot-and-mouth disease vaccine and application of immune adjuvant | |
| CN105497885B (en) | A kind of subunit vaccine and its preparation method and application | |
| CN111840533B (en) | A-type foot-and-mouth disease virus-like particle antigen, vaccine composition thereof, preparation method and application | |
| KR101863335B1 (en) | DNA vaccine for prevention and treatment of fish viral hemorrhagic septicemia | |
| CN101629182B (en) | Eukaryotic expression plasmid of chicken defensin-1 gene and molecular adjuvants prepared by the gene and vaccine | |
| TWI386223B (en) | Duck hepatitis vaccine and its preparation method | |
| CN106085968B (en) | Mad dog inactivated vaccine of a kind of mink puppet and its preparation method and application | |
| Kattlun et al. | Immunogenic potential of a membrane protein encoded by the viral gene located at ORF 81 of Cyprinid Herpesvirus-3 | |
| CN101049508A (en) | Carrier bacterin of attenuated typhoid bacterium of carrying tubercle branch bacillus Ag85B |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20111012 Termination date: 20141225 |
|
| EXPY | Termination of patent right or utility model |