CN101585872A - Recombinant spider poison protein, preparation method and expression vector thereof and medicament for treating (erection disturbance) ED - Google Patents
Recombinant spider poison protein, preparation method and expression vector thereof and medicament for treating (erection disturbance) ED Download PDFInfo
- Publication number
- CN101585872A CN101585872A CNA2008100974041A CN200810097404A CN101585872A CN 101585872 A CN101585872 A CN 101585872A CN A2008100974041 A CNA2008100974041 A CN A2008100974041A CN 200810097404 A CN200810097404 A CN 200810097404A CN 101585872 A CN101585872 A CN 101585872A
- Authority
- CN
- China
- Prior art keywords
- recombinant spider
- spider poison
- substratum
- preparation
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a recombinant spider poison protein, a preparation method and an expression vector thereof and a medicament for treating (erection disturbance) ED so as to solve the problem of spider poison proteins in the nature. The recombinant spider poison protein consists of a polypeptide chain comprising the following sequence which consists of 48 amino acids: ATCAGQDQPC KETCDCCGER GECVCGGPCI CRQGYFWIAW YKLANCKK. The recombinant spider poison protein prepared by the invention can be used for treating the erection disturbance.
Description
Technical field
The present invention relates to biochemical field, in particular to a kind of recombinant spider poison protein, its preparation method and expression vector and the medicine that is used for the treatment of ED (male erectile dysfunction).
Background technology
Erection is that nerve-endocrine is regulated the haemodynamics change procedure of erection organ corpus cavernosum penis down.After being subjected to sexual stimulus, non-suprarenin non-cholinergic neurone is the synthetic nitrogen protoxide (NO) that discharges under the catalysis of nitricoxide synthase (NOS); Activation corpus cavernosum penis hole of phatidylcholine that the parasympathetic nerve tip discharges and the catalysis of vascular endothelial cell nitricoxide synthase promote that down NO is synthetic and discharge.NO is diffused in the corpus cavernosum penis smooth muscle cell, activates guanylate cyclase, makes GTP (guanosine triphosphate) be converted into cyclic guanosine monophosphate (cGMP).The increase of intracellular cGMP concentration makes calcium ion concn reduction in the endochylema, causes the cavernous body smooth muscle loosening, and the corpus cavernosum penis hole expands, and artery blood flow increases and the increase of penis sponge body bulk.Along with the corpus cavernosum penis volume increases, elongate around the passive extension of the tunica albuginea of corpus cavernosum penis, the vena emissaria pressurized is extended narrow down, the venous return resistance increases, and corpus cavernosum penis pressure strengthens and brings out erection.Along with Phosphodiesterase V type (PDE-5) degraded in the smoothed myocyte of cGMP, lose its active and ejaculation back sympathetic nerve recovery tonus, penis changes weak state over to.In this process, cGMP can be by the deactivation of phosphodiesterase (PDE-5) institute, thereby makes penis change weak state over to.
The spider venom of some kind in the Latin American, usually can be experienced the mandatory erection of several hrs to the early existing report of the influence of male reproductive system by the male patient of the blue Tula of tower spider bite.In a plurality of hospitals of Brazil, Argentina and Israel, the doctor has launched clinical application for many years, treats male erectile disorder with spider venom.Spider poison albumen kind is very many, and research proved already, and the active substance that this function is played a major role is a component in the agatoxin just.We have proved that with experimentation on animals recombinant spider poison protein also has activity for erection problem.
In realizing process of the present invention, the contriver finds that occurring in nature spider poison protein resource is limited, and separation difficulty, and its activity and stability all are difficult to be guaranteed.The albumen of this animal-origin uses at human body, can cause in various degree immunological rejection and potential pathogeny transmission danger.
Summary of the invention
The medicine that the present invention aims to provide a kind of recombinant spider poison protein, its preparation method and expression vector and is used for the treatment of ED is to solve the proteic problem of occurring in nature spider poison.
In an embodiment of the present invention, a kind of recombinant spider poison protein is provided, it is made of polypeptide chain, and polypeptide chain comprises by following 48 sequences that amino acid constitutes: ATCAGQDQPCKETCDCCGER GECVCGGPCI CRQGYFWIAW YKLANCKK (called after PnTx2-6-β in the present invention).
In above-mentioned recombinant spider poison protein PnTx2-6-β, polypeptide chain can be made of the sequence that 48 amino acid constitute.
In above-mentioned recombinant spider poison protein, polypeptide chain can further comprise the sequence that following 34 amino acid constitute: MKVAILFLSI LVLAVASESI EESRDDFAVEELGR, the sequence that these 34 amino acid constitute and the sequence that constitutes of 48 amino acid constitute the sequence that 82 amino acid constitute: MKVAILFLSI LVLAVASESIEESRDDFAVE ELGR ATCAGQDQPC KETCDCCGERGECVCGGPCI CRQGYFWIAW YKLANCKK (called after PnTx2-6-α in the present invention) jointly.
In above-mentioned recombinant spider poison protein PnTx2-6-α, polypeptide chain can be made of the sequence that 82 amino acid constitute.
In an embodiment of the present invention, also provide a kind of preparation method of recombinant spider poison protein, used intestinal bacteria to express the above-mentioned recombinant spider poison protein PnTx2-6-β of preparation, it may further comprise the steps:
Step I. the following dna fragmentation of synthetic,
1 gccacatgcg?ctggccaaga?ccagccctgc?aaagaaactt?gcgactgctg?tggagagaga
61 ggagaatgtg?tttgcggagg?accttgcatt?tgcaggcaag?gctacttttg?gatagcatgg
121?tataaacttg?ctaactgtaa?aaaatga
Step I i. is a masterplate with this dna fragmentation, amplifies to comprise
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, reclaim nucleotide sequence, be inserted in multiple clone site and obtain recombinant expression vector in the prokaryotic expression carrier;
After step I ii. prepares DH5 α competent cell with Calcium Chloride Method, transform DH5 α competent cell with aforementioned recombinant expression vector, picking list bacterium colony in resistant panel obtains plasmid through cultivating the back extracting;
Step I v. is transformed into competence Rosetta 2 intestinal bacteria with this plasmid, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, add IPTG to final concentration be 1mmol/L, continue to cultivate 4 hours, and with centrifugal 10 minutes of 4 ℃ of 2000g, collected the thalline that obtains then;
Step v. is with thalline and 100mMNaCl, 50mMTris pH8.0 mixes, adopt cell breaking technology that cell is carried out fragmentation, centrifugal with 12000rpm, collect supernatant, carry out chromatography purification through affinity column, ion exchange column and gel exclusion chromatography then, and through after the sterile filtration,-30 ℃ to 7 ℃ freeze-drying, obtain above-mentioned recombinant spider poison protein PnTx2-6-β.
In an embodiment of the present invention, also provide a kind of preparation method of recombinant spider poison protein, used intestinal bacteria to express the above-mentioned recombinant spider poison protein PnTx2-6-α of preparation, it may further comprise the steps:
Step I. the following dna fragmentation of synthetic,
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
Step I i. is a masterplate with this dna fragmentation, amplifies to comprise
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, reclaim nucleotide sequence, be inserted in multiple clone site and obtain recombinant expression vector in the prokaryotic expression carrier;
After step I ii. prepares DH5 α competent cell with Calcium Chloride Method, transform DH5 α competent cell with this recombinant expression vector, picking list bacterium colony in resistant panel obtains plasmid through cultivating the back extracting;
Step I v. is transformed into competence Rosetta 2 intestinal bacteria with plasmid, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, add IPTG to final concentration be 1mmol/L, continue to cultivate 4 hours, and with centrifugal 10 minutes of 4 ℃ of 2000g, collected the thalline that obtains then;
Step v. is with thalline and 100mMNaCl, 50mMTris pH8.0 mixes, adopt cell breaking technology that cell is carried out fragmentation, centrifugal with 12000rpm, collect supernatant, carry out chromatography purification through affinity column, ion exchange column and gel exclusion chromatography then, and through after the sterile filtration,-30 ℃ to 7 ℃ freeze-drying, obtain above-mentioned recombinant spider poison protein PnTx2-6-α.
In an embodiment of the present invention, also provide a kind of preparation method of recombinant spider poison protein, used pichia spp to express the above-mentioned recombinant spider poison protein PnTx2-6-β of preparation, it may further comprise the steps:
Step I. the following dna fragmentation of synthetic,
1 gccacatgcg?ctggccaaga?ccagccctgc?aaagaaactt?gcgactgctg?tggagagaga
61 ggagaatgtg?tttgcggagg?accttgcatt?tgcaggcaag?gctacttttg?gatagcatgg
121?tataaacttg?ctaactgtaa?aaaatga
Step I i. is a masterplate with this dna fragmentation, amplifies to comprise
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, reclaim nucleotide sequence, be inserted among the expression vector pPIC9K in multiple clone site;
After step I ii. prepares DH5 α competent cell with Calcium Chloride Method, transform DH5 α competent cell with this expression vector, picking list bacterium colony in resistant panel obtains plasmid through cultivating the back extracting;
Step I v. adds competence Pichia pastorisSMD1168 according to 5 μ g/80 μ L with plasmid and changes in the electric shock cup, and shock parameters is voltage 1300V, electric capacity 25 μ F, resistance is 200 Ω, evenly coating MD flat board was cultivated 3-4 days at 30 ℃, with the His that grows on the MD flat board
+Transformant is inoculated into successively with photolithography and contains 1.0,2.0,3.0, in the YPD substratum of 4.0mg/mL concentration gradient G418, progressively screens the G418 resistant strain, and inoculating strain is in the BMGY substratum, and 30 ℃, 250rpm cultivates 24 hours to OD
600Be 4, centrifugal 10 minutes of room temperature 1500g collects the thalline that obtains;
Step v. suspends thalline with the BMMY substratum, 29 ℃ of 250rpm abduction deliverings, in substratum, added methyl alcohol to final concentration 5mL/L substratum every 24 hours, cultivated 96 hours, 4 ℃ of nutrient solutions are centrifugal, collect supernatant liquor, carry out chromatography purification through affinity column, ion exchange column and gel exclusion chromatography, and,, obtain above-mentioned recombinant spider poison protein PnTx2-6-β-30 ℃ to 7 ℃ freeze-drying through after the sterile filtration.
In an embodiment of the present invention, also provide a kind of preparation method of recombinant spider poison protein, used pichia spp to express the above-mentioned recombinant spider poison protein PnTx2-6-α of preparation, it specifically may further comprise the steps:
Step I. the following dna fragmentation of synthetic,
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
Step I i. is a masterplate with this dna fragmentation, amplifies to comprise
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, reclaim nucleotide sequence, be inserted among the expression vector pPIC9K in multiple clone site;
After step I ii. prepares DH5 α competent cell with Calcium Chloride Method, transform DH5 α competent cell with this expression vector, picking list bacterium colony in resistant panel obtains plasmid through cultivating the back extracting;
Step I v. adds competence Pichia pastorisSMD1168 according to 5 μ g/80 μ L with plasmid and changes in the electric shock cup, and shock parameters is voltage 1300V, electric capacity 25 μ F, resistance is 200 Ω, evenly coating MD flat board was cultivated 3-4 days at 30 ℃, with the His that grows on the MD flat board
+Transformant is inoculated into successively with photolithography and contains 1.0,2.0,3.0, in the YPD substratum of 4.0mg/mL concentration gradient G418, progressively screens the G418 resistant strain, and inoculating strain is in the BMGY substratum, and 30 ℃, 250rpm cultivates 24 hours to OD
600Be 4, centrifugal 10 minutes of room temperature 1500g collects the thalline that obtains;
Step v. suspends thalline with the BMMY substratum, 29 ℃ of 250rpm abduction deliverings, in substratum, added methyl alcohol to final concentration 5mL/L substratum every 24 hours, cultivated 96 hours, 4 ℃ of nutrient solutions are centrifugal, collect supernatant liquor, carry out chromatography purification through affinity column, ion exchange column and gel exclusion chromatography, and,, obtain above-mentioned recombinant spider poison protein PnTx2-6-α-30 ℃ to 7 ℃ freeze-drying through after the sterile filtration.
In an embodiment of the present invention, a kind of preparation method of recombinant spider poison protein also is provided, use intestinal bacteria, subtilis, bacillus pumilus, Erwinia herbicola, the bar-shaped bacterium of L-glutamic acid, yeast or insect cell to express the above-mentioned recombinant spider poison protein of preparation, or use chemical synthesis to prepare above-mentioned recombinant spider poison protein.
In an embodiment of the present invention, also provide a kind of medicine that is used for the treatment of male erectile dysfunction, its effective constituent comprises above-mentioned recombinant spider poison protein.
The invention provides the new recombinant spider poison protein with pharmaceutical use of a class, provide a kind of biological fermentation to prepare the method for recombinant spider poison protein, the recombinant spider poison protein of preparation can be used in the treatment male erectile dysfunction.
Description of drawings
Accompanying drawing described herein is used to provide further understanding of the present invention, constitutes the application's a part, and illustrative examples of the present invention and explanation thereof are used to explain the present invention, do not constitute improper qualification of the present invention.In the accompanying drawings:
Fig. 1 shows the amalgamation and expression example of PnTx2-6-α in intestinal bacteria according to the embodiment of the invention;
Fig. 2 shows the amalgamation and expression example of PnTx2-6-β in intestinal bacteria according to the embodiment of the invention;
Fig. 3 shows the amalgamation and expression example of PnTx2-6-α in intestinal bacteria according to the embodiment of the invention;
Fig. 4 shows the amalgamation and expression example of PnTx2-6-β in intestinal bacteria according to the embodiment of the invention;
Embodiment
Below with reference to the accompanying drawings and in conjunction with the embodiments, describe the present invention in detail.
The inventor has determined that through screening active ingredients the structure of spider poison protein is formed, and utilizes genetically engineered or chemical synthesis to produce this spider poison protein of reorganization.This recombinant spider poison protein is made of polypeptide chain, and polypeptide chain comprises by following 48 sequences that amino acid constitutes: ATCAGQDQPC KETCDCCGER GECVCGGPCI CRQGYFWIAWYKLANCKK (called after PnTx2-6-β in the present invention).
In above-mentioned recombinant spider poison protein, the sequence that polypeptide chain can only be made of 48 amino acid is constituted.
In above-mentioned recombinant spider poison protein, polypeptide chain can further comprise the sequence that following 34 amino acid constitute: MKVAILFLSI LVLAVASESI EESRDDFAVEELGR, the sequence that these 34 amino acid constitute and the sequence that constitutes of 48 amino acid constitute the sequence that 82 amino acid constitute: MKVAILFLSI LVLAVASESIEESRDDFAVE ELGR ATCAGQDQPC KETCDCCGERGECVCGGPCI CRQGYFWIAW YKLANCKK (called after PnTx2-6-α in the present invention) jointly.
In above-mentioned recombinant spider poison protein, the sequence that polypeptide chain can only be made of 82 amino acid is constituted.
In an embodiment of the present invention, the recombinant spider poison protein of said structure can prepare with conventional chemical synthesis process.Be that raw material adopts the method for Fmoc and tBoc to carry out for example with each seed amino acid.
Preferably, use biological fermentation process to prepare above-mentioned recombinant spider poison protein.
In an embodiment of the present invention, a kind of preparation method of recombinant spider poison protein is provided, has used intestinal bacteria, subtilis, bacillus pumilus, Erwinia herbicola, the bar-shaped bacterium of L-glutamic acid, yeast or insect cell to express the above-mentioned recombinant spider poison protein of preparation and prepare above-mentioned recombinant spider poison protein.
Preferably, comprise following step:
Step I. the following dna fragmentation of synthetic,
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
Ii. be masterplate with this dna fragmentation, PCR amplifies respectively and comprises
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
Taaacttgct aactgtaaaa aatga (sequence α is used to prepare PnTx2-6-α)
Perhaps comprise
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
Taaacttgct aactgtaaaa aatga (sequence β is used to prepare PnTx2-6-β)
Nucleotide sequence.
The PCR product is reclaimed, utilize Protocols in Molecular Biology, in multiple clone site sequence α and sequence β are inserted respectively among expression vector PSUMO-M, pPIC9K, the pPIC9, obtain expression vector PSUMO-M-PnTx2-6-α, PSUMO-M-PnTx2-6-β, the pPIC9K-PnTx2-6-α of PnTx2-6, pPIC9K-PnTx2-6-β, pPIC9-PnTx2-6-α, pPIC9-PnTx2-6-β.
Iii. after preparing DH5 α competent cell with Calcium Chloride Method, transform with expression vector PSUMO-M-PnTx2-6 α, picking list bacterium colony in resistant panel is through cultivating back extracting plasmid.Same step can be applied to PSUMO-M-PnTx2-6-β, pPIC9K-PnTx2-6-α, pPIC9K-PnTx2-6-β, pPIC9-PnTx2-6-α, pPIC9-PnTx2-6-β.
First. use escherichia coli expression:
Iv. expression plasmid PSUMO-M-PnTx2-6-α is transformed into competence Rosetta 2 intestinal bacteria, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, adding IPTG is 1mmol/L to final concentration, and continuation was cultivated 4 hours.Centrifugal 10 minutes of 4 ℃ of 2000g collect thalline.
V. with the thalline and the 100mMNaCl that collect, 50mMTris pH8.0 mixes, adopt cell breaking technology that cell is carried out fragmentation, centrifugal at 12000rpm, collect supernatant, then through affinity column, ion exchange column and gel exclusion chromatography etc. are carried out chromatography purification, and,, obtain recombinant spider poison protein PnTx2-6 (α type)-30 ℃ to 7 ℃ freeze-drying through after the sterile filtration.
Iv. expression plasmid PSUMO-M-PnTx2-6-β is transformed into competence Rosetta 2 intestinal bacteria, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, adding IPTG is 1mmol/L to final concentration, and continuation was cultivated 4 hours.Centrifugal 10 minutes of 4 ℃ of 2000g collect thalline.
V. with the thalline and the 100mMNaCl that collect, 50mMTris pH8.0 mixes, adopt cell breaking technology that cell is carried out fragmentation, centrifugal at 12000rpm, collect supernatant, then through affinity column, ion exchange column and gel exclusion chromatography etc. are carried out chromatography purification, and,, obtain recombinant spider poison protein PnTx2-6 (β type)-30 ℃ to 7 ℃ freeze-drying through after the sterile filtration.
Second. use Pichia anomala expression
Iv. getting 5 μ gpPIC9K-PnTx2-6-α adds 80 μ L competence Pichiapastoris SMD 1168 and changes in the electric shock cup.Shock parameters is voltage 1300V, electric capacity 25 μ F, and resistance is 200 Ω.Evenly coating MD (13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 10g/L glucose) flat board was cultivated 3-4 days at 30 ℃.
V. with the His that grows on the MD flat board
+Transformant be inoculated into successively with photolithography contain 1.0,2.0,3.0, YPD (the 10g/L yeast extract of 4.0mg/mL concentration gradient G418, the 20g/L peptone, 20g/L glucose) in the substratum, progressively screen the G418 resistant strain and promptly obtain the high copy of goal gene bacterial strain.Called after SMD 1168/pPIC9K-PnTx2-6.
Vi. inoculate SMD1168/pPIC9K-PnTx2-6 in BMGY (10g/L yeast extract, the 20g/L peptone, 13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 10mL/L glycerine, 100mmol/L potassium phosphate buffer, pH 6.0) in the substratum, 30 ℃, 250rpm cultivate 24 hours to OD600 be 4, room temperature 1500g collected thalline in centrifugal 10 minutes.
Vii. with cell BMMY (the 10g/L yeast extract of gathering in the crops, the 20g/L peptone, 13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 5mL/L methyl alcohol, the 100mmol/L potassium phosphate buffer, pH 6.0) the substratum suspension, 29 ℃ of 250rpm abduction deliverings added methyl alcohol to final concentration 5mL/L substratum every 24 hours in substratum.Cultivated 96 hours.
Viii. 4 ℃ of nutrient solutions are centrifugal, collect supernatant liquor, and through affinity column, ion exchange column and gel exclusion chromatography etc. carries out chromatography purification, and through after the sterile filtration ,-30 ℃ to 7 ℃ freeze-drying, obtain recombinant spider poison protein PnTx2-6 (α type).
Iv. getting 5 μ gpPIC9K-PnTx2-6-β adds 80 μ L competence Pichiapastoris SMD 1168 and changes in the electric shock cup.Shock parameters is voltage 1300V, electric capacity 25 μ F, and resistance is 200 Ω.Evenly coating MD flat board was cultivated 3-4 days at 30 ℃.
V. with the His that grows on the MD flat board
+Transformant is inoculated into successively with photolithography and contains 1.0,2.0,3.0, in the YPD substratum of 4.0mg/mL concentration gradient G418, progressively screens the G418 resistant strain and promptly obtain the high copy of goal gene bacterial strain.Called after SMD1168/pPIC9K-PnTx2-6.
Vi. inoculate SMD1168/pPIC9K-PnTx2-6 in the BMGY substratum, 30 ℃, 250rpm cultivate 24 hours to OD600 be 4, room temperature 1500g collected thalline in centrifugal 10 minutes.
Vii. the cell with results suspends with the BMMY substratum, and 29 ℃ of 250rpm abduction deliverings added methyl alcohol to final concentration 5mL/L substratum every 24 hours in substratum.Cultivated 96 hours.
Viii. 4 ℃ of nutrient solutions are centrifugal, collect supernatant liquor, and through affinity column, ion exchange column and gel exclusion chromatography etc. carries out chromatography purification, and through after the sterile filtration ,-30 ℃ to 7 ℃ freeze-drying, obtain recombinant spider poison protein PnTx2-6 (β type).
Specifically describe the preparation method of four embodiment below.
Artificial-synthetic DNA's fragment
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
With this dna fragmentation is masterplate, and PCR amplifies respectively and comprises
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence.
The PCR product is reclaimed, this sequence is inserted expression vector PSUMO-M, the expression vector of the PnTx2-6 that obtains recombinating in multiple clone site.Transform DH5 α competent cell with this expression vector, picking list bacterium colony in resistant panel is through cultivating back extracting plasmid.With extracting to plasmid be transformed into competence Rosetta 2 intestinal bacteria, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and the antibiotic TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, adding IPTG is 1mmol/L to final concentration, and continuation was cultivated 4 hours.Centrifugal 10 minutes of 4 ℃ of 2000g collect thalline.With thalline and the 100mMNaCl that collects, 50mMTris pH8.0 mixes, adopt the ultrasonic cell disintegration technology that cell is carried out fragmentation at 4 ℃, centrifugal at 12000rpm, collect supernatant, then through affinity column, ion exchange column and gel exclusion chromatography etc. are carried out chromatography purification, and,, obtain recombinant spider poison protein PnTx2-6-α-30 ℃ to 7 ℃ freeze-drying through after the sterile filtration.
Artificial-synthetic DNA's fragment
1 gccacatgcg?ctggccaaga?ccagccctgc?aaagaaactt?gcgactgctg?tggagagaga
61 ggagaatgtg?tttgcggagg?accttgcatt?tgcaggcaag?gctacttttg?gatagcatgg
121?tataaacttg?ctaactgtaa?aaaatga
With this dna fragmentation is masterplate, and PCR amplifies respectively and comprises
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence.
The PCR product is reclaimed, this sequence is inserted expression vector PSUMO-M, the expression vector of the PnTx2-6 that obtains recombinating in multiple clone site.Transform DH5 α competent cell with this expression vector, picking list bacterium colony in resistant panel is through cultivating back extracting plasmid.With extracting to plasmid be transformed into competence Rosetta 2 intestinal bacteria, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and the antibiotic TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, adding IPTG is 1mmol/L to final concentration, and continuation was cultivated 4 hours.Centrifugal 10 minutes of 4 ℃ of 2000g collect thalline.With thalline and the 100mMNaCl that collects, 50mMTris pH8.0 mixes, adopt the ultrasonic cell disintegration technology that cell is carried out fragmentation at 4 ℃, centrifugal at 12000rpm, collect supernatant, then through affinity column, ion exchange column and gel exclusion chromatography etc. are carried out chromatography purification, and,, obtain recombinant spider poison protein PnTx2-6-β-30 ℃ to 7 ℃ freeze-drying through after the sterile filtration.
Artificial-synthetic DNA's fragment
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa
With this dna fragmentation is masterplate, and PCR amplifies respectively and comprises
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence.
The PCR product is reclaimed, this sequence is inserted Yeast expression carrier pPIC9K, the expression vector of the PnTx2-6 that obtains recombinating in multiple clone site.Transform the JM109 competent cell with this expression vector, picking list bacterium colony in resistant panel is through cultivating back extracting plasmid.Get 5 μ extractings to plasmid add 80 μ L competence Pichia pastoris SMD1168 and change in the electric shock cup.Shock parameters is voltage 1300V, electric capacity 25 μ F, and resistance is 200 Ω.Evenly coating MD (13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 10g/L glucose) flat board was cultivated 3-4 days at 30 ℃.With the His that grows on the MD flat board
+Transformant be inoculated into successively with photolithography contain 1.0,2.0,3.0, YPD (the 10g/L yeast extract of 4.0mg/mL concentration gradient G418, the 20g/L peptone, 20g/L glucose) in the substratum, progressively screen the G418 resistant strain and promptly obtain the high copy of goal gene bacterial strain.Inoculate this bacterial strain in BMGY (10g/L yeast extract, the 20g/L peptone, 13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 10mL/L glycerine, 100mmol/L potassium phosphate buffer, pH 6.0) in the substratum, 30 ℃, 250rpm cultivate 24 hours to OD600 be 4, room temperature 1500g collected thalline in centrifugal 10 minutes.Cell BMMY (10g/L yeast extract with results, the 20g/L peptone, 13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 5mL/L methyl alcohol, the 100mmol/L potassium phosphate buffer, pH 6.0) the substratum suspension, 29 ℃ of 250rpm abduction deliverings added methyl alcohol to final concentration 5mL/L substratum every 24 hours in substratum.Cultivated 96 hours.4 ℃ of nutrient solutions are centrifugal, collect supernatant liquor, and through affinity column, ion exchange column and gel exclusion chromatography etc. carries out chromatography purification, and through after the sterile filtration ,-30 ℃ to 7 ℃ freeze-drying, obtain recombinant spider poison protein PnTx2-6-α.
Artificial-synthetic DNA's fragment
1 gccacatgcg?ctggccaaga?ccagccctgc?aaagaaactt?gcgactgctg?tggagagaga
61 ggagaatgtg?tttgcggagg?accttgcatt?tgcaggcaag?gctacttttg?gatagcatgg
121?tataaacttg?ctaactgtaa?aaaatga
With this dna fragmentation is masterplate, and PCR amplifies respectively and comprises
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence.
The PCR product is reclaimed, this sequence is inserted Yeast expression carrier pPIC9K, the expression vector of the PnTx2-6 that obtains recombinating in multiple clone site.Transform the JM109 competent cell with this expression vector, picking list bacterium colony in resistant panel is through cultivating back extracting plasmid.Get 5 μ extractings to plasmid add 80 μ L competence Pichia pastoris SMD1168 and change in the electric shock cup.Shock parameters is voltage 1300V, electric capacity 25 μ F, and resistance is 200 Ω.Evenly coating MD (13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 10g/L glucose) flat board was cultivated 3-4 days at 30 ℃.With the His that grows on the MD flat board
+Transformant be inoculated into successively with photolithography contain 1.0,2.0,3.0, YPD (the 10g/L yeast extract of 4.0mg/mL concentration gradient G418, the 20g/L peptone, 20g/L glucose) in the substratum, progressively screen the G418 resistant strain and promptly obtain the high copy of goal gene bacterial strain.Inoculate this bacterial strain in BMGY (10g/L yeast extract, the 20g/L peptone, 13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 10mL/L glycerine, 100mmol/L potassium phosphate buffer, pH 6.0) in the substratum, 30 ℃, 250rpm cultivate 24 hours to OD600 be 4, room temperature 1500g collected thalline in centrifugal 10 minutes.Cell BMMY (10g/L yeast extract with results, the 20g/L peptone, 13.4g/L yeast nitrogen, 0.4mg/L vitamin H, 5mL/L methyl alcohol, the 100mmol/L potassium phosphate buffer, pH 6.0) the substratum suspension, 29 ℃ of 250rpm abduction deliverings added methyl alcohol to final concentration 5mL/L substratum every 24 hours in substratum.Cultivated 96 hours.4 ℃ of nutrient solutions are centrifugal, collect supernatant liquor, and through affinity column, ion exchange column and gel exclusion chromatography etc. carries out chromatography purification, and through after the sterile filtration ,-30 ℃ to 7 ℃ freeze-drying, obtain recombinant spider poison protein PnTx2-6-β.
Further set forth embodiments of the invention below in conjunction with accompanying drawing.
Example one: the amalgamation and expression example of PnTx2-6-α in intestinal bacteria
Artificial-synthetic DNA's fragment:
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
With this dna fragmentation is masterplate, amplifies to comprise
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, be inserted among the prokaryotic expression carrier pET32a in Kpn I and Xho I site and carry out sequence verification, sequencing result is as follows:
1 GGTACCGACG?ACGACGACAA?GATGAAAGTG?GCGATTCTGTTTCTGAGCAT?TCTGGTGCTG
61 GCGGTGGCGA?GCGAAAGCAT?TGAAGAAAGC?CGCGATGATTTTGCGGTGGA?AGAACTGGGC
121?CGCGCGACCT?GCGCGGGCCA?GGATCAGCCG?TGCAAAGAAACCTGCGATTG?CTGCGGCGAA
181?CGCGGCGAAT?GCGTGTGCGG?CGGCCCGTGC?ATTTGCCGCCAGGGCTATTT?TTGGATTGCG
241?TGGTATAAAC?TGGCGAATTG?CAAAAAATAA?CTCGAG
With 5ng recombinant plasmid transformed e. coli host cell DE3, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, add IPTG to final concentration be 1mmol/L, continue to cultivate 4 hours, and with centrifugal 10 minutes of 4 ℃ of 2000g, collected the thalline that obtains then; Use the 15%SDS-PAGE analytical results as shown in Figure 1 behind the bacterial cell disruption, wherein,
Row 1: do not induce bacterial cell disruption liquid
Row M:Marker
Be listed as the 2:37 ℃ of bacterial cell disruption liquid after inducing
Be listed as the 3-5:25 ℃ of bacterial cell disruption liquid after inducing
Example two: the amalgamation and expression example of PnTx2-6-β in intestinal bacteria
Artificial-synthetic DNA's fragment:
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
With this dna fragmentation is masterplate, amplifies to comprise
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, be inserted among the prokaryotic expression carrier pET32a in Kpn I and Xho I site and carry out sequence verification, sequencing result is as follows:
1 GGTACCGACG?ACGACGACAA?GGCGACCTGC?GCGGGCCAGGATCAGCCGTG?CAAAGAAACC
61 TGCGATTGCT?GCGGCGAACG?CGGCGAATGC?GTGTGCGGCGGCCCGTGCAT?TTGCCGCCAG
121?GGCTATTTTT?GGATTGCGTG?GTATAAACTG?GCGAATTGCAAAAAATAACT?CGAG
With 5ng recombinant plasmid transformed e. coli host cell DE3, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, add IPTG to final concentration be 1mmol/L, continue to cultivate 4 hours, and with centrifugal 10 minutes of 4 ℃ of 2000g, collected the thalline that obtains then; Use the 15%SDS-PAGE analytical results as shown in Figure 2 behind the bacterial cell disruption, wherein,
Row 1: do not induce bacterial cell disruption liquid
Row M:Marker
Be listed as the 2:37 ℃ of bacterial cell disruption liquid after inducing
Be listed as the 3-5:25 ℃ of bacterial cell disruption liquid after inducing
Example three: the amalgamation and expression example of PnTx2-6-α in intestinal bacteria
Artificial-synthetic DNA's fragment:
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
With this dna fragmentation is masterplate, amplifies to comprise
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, be inserted among the prokaryotic expression carrier pSUMO-M in Stu I and Xho I site and carry out sequence verification, sequencing result is as follows:
1 TATGAAAGTG?GCGATTCTGT?TTCTGAGCAT?TCTGGTGCTGGCGGTGGCGA?GCGAAAGCAT
61 TGAAGAAAGC?CGCGATGATT?TTGCGGTGGA?AGAACTGGGCCGCGCGACCT?GCGCGGGCCA
121?GGATCAGCCG?TGCAAAGAAA?CCTGCGATTG?CTGCGGCGAACGCGGCGAAT?GCGTGTGCGG
181?CGGCCCGTGC?ATTTGCCGCC?AGGGCTATTT?TTGGATTGCGTGGTATAAAC?TGGCGAATTG
241?CAAAAAATAA?CTCGAG
With 5ng recombinant plasmid transformed e. coli host cell DE3, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, add IPTG to final concentration be 1mmol/L, continue to cultivate 4 hours, and with centrifugal 10 minutes of 4 ℃ of 2000g, collected the thalline that obtains then; Use the 15%SDS-PAGE analytical results as shown in Figure 3 behind the bacterial cell disruption, wherein,
Row 1: do not induce bacterial cell disruption liquid
Row M:Marker
Be listed as the 2:37 ℃ of bacterial cell disruption liquid after inducing
Be listed as the 3-5:25 ℃ of bacterial cell disruption liquid after inducing
Example four: the amalgamation and expression example of PnTx2-6-β in intestinal bacteria
Artificial-synthetic DNA's fragment:
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
With this dna fragmentation is masterplate, amplifies to comprise
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, be inserted among the prokaryotic expression carrier pSUMO-M in Stu I and Xho I site and carry out sequence verification, sequencing result is as follows:
1 TGCGACCTGC?GCGGGCCAGG?ATCAGCCGTG?CAAAGAAACCTGCGATTGCT?GCGGCGAACG
61 CGGCGAATGC?GTGTGCGGCG?GCCCGTGCAT?TTGCCGCCAGGGCTATTTTT?GGATTGCGTG
121?GTATAAACTG?GCGAATTGCA?AAAAATAACT?CGAG
With 5ng recombinant plasmid transformed e. coli host cell DE3, after transforming, contain picking list bacterium colony the resistant panel of correct expression plasmid, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, add IPTG to final concentration be 1mmol/L, continue to cultivate 4 hours, and with centrifugal 10 minutes of 4 ℃ of 2000g, collected the thalline that obtains then; Use the 15%SDS-PAGE analytical results as shown in Figure 4 behind the bacterial cell disruption, wherein,
Row 1: do not induce bacterial cell disruption liquid
Row M:Marker
Be listed as the 2:37 ℃ of bacterial cell disruption liquid after inducing
Be listed as the 3-5:25 ℃ of bacterial cell disruption liquid after inducing
In an embodiment of the present invention, also provide a kind of medicine that is used for the treatment of male erectile dysfunction, its effective constituent comprises above-mentioned recombinant spider poison protein.
In an embodiment of the present invention, use above-mentioned recombinant spider poison protein treatment male erectile dysfunction.
The foregoing description has determined that through screening active ingredients the structure of spider poison protein is formed, and utilizes genetically engineered or chemical synthesis to produce recombinant spider poison protein, and not only output is big, also can avoid rejection, is the method that has development prospect and magnetism.
In addition, the foregoing description utilizes this recombinant spider poison protein treatment male erectile dysfunction and makes the medicine for the treatment of male erectile dysfunction.
The above is the preferred embodiments of the present invention only, is not limited to the present invention, and for a person skilled in the art, the present invention can have various changes and variation.Within the spirit and principles in the present invention all, any modification of being done, be equal to replacement, improvement etc., all should be included within protection scope of the present invention.
Claims (10)
1. a recombinant spider poison protein is characterized in that it is made of polypeptide chain, and described polypeptide chain comprises by following 48 sequences that amino acid constitutes: ATCAGQDQPCKETCDCCGER GECVCGGPCI CRQGYFWIAWYKLANCKK.
2. recombinant spider poison protein according to claim 1 is characterized in that, described polypeptide chain is made of the sequence that described 48 amino acid constitute.
3. recombinant spider poison protein according to claim 1, it is characterized in that, described polypeptide chain further comprises the sequence that following 34 amino acid constitute: MKVAILFLSILVLAVASESI EESRDDFAVE ELGR, the sequence that 82 amino acid of the common formation of sequence that the sequence that these 34 amino acid constitute and described 48 amino acid constitute constitute: MKVAILFLSI LVLAVASESI EESRDDFAVE ELGRATCAGQDQPC KETCDCCGER GECVCGGPCICRQGYFWIAW YKLANCKK.
4. recombinant spider poison protein according to claim 3 is characterized in that, described polypeptide chain is made of the sequence that described 82 amino acid constitute.
5. the preparation method of a recombinant spider poison protein is characterized in that, uses intestinal bacteria to express preparation claim 1 or 2 described recombinant spider poison proteins, and it may further comprise the steps:
Step I. the following dna fragmentation of synthetic,
1 gccacatgcg?ctggccaaga?ccagccctgc?aaagaaactt?gcgactgctg?tggagagaga
61 ggagaatgtg?tttgcggagg?accttgcatt?tgcaggcaag?gctacttttg?gatagcatgg
121?tataaacttg?ctaactgtaa?aaaatga
Step I i. is a masterplate with this dna fragmentation, amplifies to comprise
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, reclaim described nucleotide sequence, be inserted in the prokaryotic expression carrier in multiple clone site;
Step I ii. transforms described DH5 α competent cell with the described expression vector that builds after preparing DH5 α competent cell with Calcium Chloride Method, and picking list bacterium colony in resistant panel is through cultivating the plasmid that the back extracting obtains;
Step I v. is transformed into competence Rosetta 2 intestinal bacteria with described plasmid, after transforming, contain picking list bacterium colony the resistant panel of the described plasmid of correct expression, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, add IPTG to final concentration be 1mmol/L, continue to cultivate 4 hours, and with centrifugal 10 minutes of 4 ℃ of 2000g, collected the thalline that obtains then;
Step v. is with described thalline and 100mMNaCl, 50mMTris pH8.0 mixes, adopt cell breaking technology that cell is carried out fragmentation, centrifugal with 12000rpm, collect supernatant, carry out chromatography purification through affinity column, ion exchange column and gel exclusion chromatography then, and through after the sterile filtration,-30 ℃ to 7 ℃ freeze-drying, obtain claim 1 or 2 described recombinant spider poison proteins.
6. the preparation method of a recombinant spider poison protein is characterized in that, uses intestinal bacteria to express preparation claim 3 or 4 described recombinant spider poison proteins, and it may further comprise the steps:
Step I. the following dna fragmentation of synthetic,
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
Step I i. is a masterplate with this dna fragmentation, amplifies to comprise
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, reclaim described nucleotide sequence, be inserted in the prokaryotic expression carrier in multiple clone site;
Step I ii. transforms described DH5 α competent cell with the described expression vector that builds after preparing DH5 α competent cell with Calcium Chloride Method, and picking list bacterium colony in resistant panel obtains plasmid through cultivating the back extracting;
Step I v. is transformed into competence Rosetta 2 intestinal bacteria with described plasmid, after transforming, contain picking list bacterium colony the resistant panel of the described plasmid of correct expression, be inoculated in and contain in glucose and antibiotic LB or the TB substratum, in gas bath or water-bath, be cultured to OD600=1.2 at the rotating speed with 100-300rpm under 20-37 ℃ the condition, add IPTG to final concentration be 1mmol/L, continue to cultivate 4 hours, and with centrifugal 10 minutes of 4 ℃ of 2000g, collected the thalline that obtains then;
Step v. is with described thalline and 100mMNaCl, 50mMTris pH8.0 mixes, adopt cell breaking technology that cell is carried out fragmentation, centrifugal with 12000rpm, collect supernatant, carry out chromatography purification through affinity column, ion exchange column and gel exclusion chromatography then, and through after the sterile filtration,-30 ℃ to 7 ℃ freeze-drying, obtain claim 3 or 4 described recombinant spider poison proteins.
7. the preparation method of a recombinant spider poison protein is characterized in that, uses pichia spp to express preparation claim 1 or 2 described recombinant spider poison proteins, and it may further comprise the steps:
Step I. the following dna fragmentation of synthetic,
1 gccacatgcg?ctggccaaga?ccagccctgc?aaagaaactt?gcgactgctg?tggagagaga
61 ggagaatgtg?tttgcggagg?accttgcatt?tgcaggcaag?gctacttttg?gatagcatgg
121?tataaacttg?ctaactgtaa?aaaatga
Step I i. is a masterplate with this dna fragmentation, amplifies to comprise
gc?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, reclaim described nucleotide sequence, be inserted among the expression vector pPIC9K in multiple clone site;
Step I ii. transforms described DH5 α competent cell with described expression vector after preparing DH5 α competent cell with Calcium Chloride Method, and picking list bacterium colony in resistant panel obtains plasmid through cultivating the back extracting;
Step I v. adds competence Pichiapastoris SMD1168 according to 5 μ g/80 μ L with described plasmid and changes in the electric shock cup, and shock parameters is voltage 1300V, electric capacity 25 μ F, resistance is 200 Ω, evenly coating MD flat board was cultivated 3-4 days at 30 ℃, with the His that grows on the described MD flat board
+Transformant is inoculated into successively with photolithography and contains 1.0,2.0,3.0, in the YPD substratum of 4.0mg/mL concentration gradient G418, progressively screens the G418 resistant strain, inoculates described bacterial strain in the BMGY substratum, and 30 ℃, 250rpm cultivates 24 hours to OD
600Be 4, centrifugal 10 minutes of room temperature 1500g collects the thalline that obtains;
Step v. suspends described thalline with the BMMY substratum, 29 ℃ of 250rpm abduction deliverings, in substratum, added methyl alcohol to final concentration 5mL/L substratum every 24 hours, cultivated 96 hours, 4 ℃ of nutrient solutions are centrifugal, collect supernatant liquor, carry out chromatography purification through affinity column, ion exchange column and gel exclusion chromatography, and,, obtain claim 1 or 2 described recombinant spider poison proteins-30 ℃ to 7 ℃ freeze-drying through after the sterile filtration.
8. the preparation method of a recombinant spider poison protein is characterized in that, uses pichia spp to express preparation claim 3 or 4 described recombinant spider poison proteins, and it specifically may further comprise the steps:
Step I. the following dna fragmentation of synthetic,
1 tcggcacgag?atcagaatga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
61 tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
121?cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
181?agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
241?taaacttgct?aactgtaaaa?aatgatatgg?atttatgtat?accacgatat?aataaatata
301?ttgcatttga?aaaaaaaaaa?aaa；
Step I i. is a masterplate with this dna fragmentation, amplifies to comprise
tga?aagttgcaat?cctcttcctc?tctattttgg?tgcttgctgt
tgcaagtgaa?tccattgaag?aatcccgtga?tgattttgct?gtagaagaat?tggggagagc
cacatgcgct?ggccaagacc?agccctgcaa?agaaacttgc?gactgctgtg?gagagagagg
agaatgtgtt?tgcggaggac?cttgcatttg?caggcaaggc?tacttttgga?tagcatggta
taaacttgct?aactgtaaaa?aatga
Nucleotide sequence, reclaim described nucleotide sequence, be inserted among the expression vector pPIC9K in multiple clone site;
Step I ii. transforms described DH5 α competent cell with described expression vector after preparing DH5 α competent cell with Calcium Chloride Method, and picking list bacterium colony in resistant panel obtains plasmid through cultivating the back extracting;
Step I v. adds competence Pichiapastoris SMD1168 according to 5 μ g/80 μ L with described plasmid and changes in the electric shock cup, and shock parameters is voltage 1300V, electric capacity 25 μ F, resistance is 200 Ω, evenly coating MD flat board was cultivated 3-4 days at 30 ℃, with the His that grows on the described MD flat board
+Transformant is inoculated into successively with photolithography and contains 1.0,2.0,3.0, in the YPD substratum of 4.0mg/mL concentration gradient G418, progressively screens the G418 resistant strain, inoculates described bacterial strain in the BMGY substratum, and 30 ℃, 250rpm cultivates 24 hours to OD
600Be 4, centrifugal 10 minutes of room temperature 1500g collects the thalline that obtains;
Step v. suspends described thalline with the BMMY substratum, 29 ℃ of 250rpm abduction deliverings, in substratum, added methyl alcohol to final concentration 5mL/L substratum every 24 hours, cultivated 96 hours, 4 ℃ of nutrient solutions are centrifugal, collect supernatant liquor, carry out chromatography purification through affinity column, ion exchange column and gel exclusion chromatography, and,, obtain claim 3 or 4 described recombinant spider poison proteins-30 ℃ to 7 ℃ freeze-drying through after the sterile filtration.
9. the preparation method of a recombinant spider poison protein, it is characterized in that, use intestinal bacteria, subtilis, bacillus pumilus, Erwinia herbicola, the bar-shaped bacterium of L-glutamic acid, yeast or insect cell to express each described recombinant spider poison protein of preparation claim 1-4, or use chemical synthesis to prepare each described recombinant spider poison protein of claim 1-4.
10. a medicine that is used for the treatment of male erectile dysfunction is characterized in that, its effective constituent comprises each described recombinant spider poison protein of claim 1-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100974041A CN101585872A (en) | 2008-05-23 | 2008-05-23 | Recombinant spider poison protein, preparation method and expression vector thereof and medicament for treating (erection disturbance) ED |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100974041A CN101585872A (en) | 2008-05-23 | 2008-05-23 | Recombinant spider poison protein, preparation method and expression vector thereof and medicament for treating (erection disturbance) ED |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101585872A true CN101585872A (en) | 2009-11-25 |
Family
ID=41370320
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100974041A Pending CN101585872A (en) | 2008-05-23 | 2008-05-23 | Recombinant spider poison protein, preparation method and expression vector thereof and medicament for treating (erection disturbance) ED |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101585872A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3187167A1 (en) * | 2015-12-30 | 2017-07-05 | Nexgen Biotechnologies, Inc. | Sv82 polypeptide, and cosmetic composition for reducing skin wrinkles and maintaining skin elasticity comprising sv82 polypeptide as active ingredient |
| WO2020006617A1 (en) | 2018-07-05 | 2020-01-09 | Biozeus Desenvolvimento De Produtos Biofarmacêuticos | Synthetic peptides, prodrugs, pharmaceutical compositions and uses |
| WO2021036803A1 (en) * | 2019-08-29 | 2021-03-04 | 江苏中新医药有限公司 | Use of long-acting protein preparation for improving sexual dysfunction |
| CN114107353A (en) * | 2021-10-29 | 2022-03-01 | 苏州佩德生物医药有限公司 | Plasmid for efficiently expressing polypeptide toxin and preparation method and application thereof |
-
2008
- 2008-05-23 CN CNA2008100974041A patent/CN101585872A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3187167A1 (en) * | 2015-12-30 | 2017-07-05 | Nexgen Biotechnologies, Inc. | Sv82 polypeptide, and cosmetic composition for reducing skin wrinkles and maintaining skin elasticity comprising sv82 polypeptide as active ingredient |
| JP2017118863A (en) * | 2015-12-30 | 2017-07-06 | ネクスゼン バイオテクノロジーズ インコーポレイテッド | Sv82 polypeptide, gene thereof, recombinant vector, transformed e. coli, production method thereof, and cosmetic composition comprising it as effective ingredient for improving skin wrinkles and maintaining elasticity |
| CN107033231A (en) * | 2015-12-30 | 2017-08-11 | 纳丝真生命工学株式会社 | SV82 polypeptides and contain its as active ingredient be used for improve wrinkle of skin and keep skin elasticity cosmetic composition |
| US9879060B2 (en) | 2015-12-30 | 2018-01-30 | Nexgen Biotechnologies, Inc. | SV82 polypeptide, and cosmetic composition for reducing skin wrinkles and maintaining skin elasticity comprising SV82 polypeptide as active ingredient |
| WO2020006617A1 (en) | 2018-07-05 | 2020-01-09 | Biozeus Desenvolvimento De Produtos Biofarmacêuticos | Synthetic peptides, prodrugs, pharmaceutical compositions and uses |
| WO2021036803A1 (en) * | 2019-08-29 | 2021-03-04 | 江苏中新医药有限公司 | Use of long-acting protein preparation for improving sexual dysfunction |
| CN112439053A (en) * | 2019-08-29 | 2021-03-05 | 江苏中新医药有限公司 | Use of long-acting protein preparation in improving sexual dysfunction |
| CN114107353A (en) * | 2021-10-29 | 2022-03-01 | 苏州佩德生物医药有限公司 | Plasmid for efficiently expressing polypeptide toxin and preparation method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101585872A (en) | Recombinant spider poison protein, preparation method and expression vector thereof and medicament for treating (erection disturbance) ED | |
| CN106794263A (en) | The vaccine of the IL-21 with antigen and as adjuvant | |
| CN102247603B (en) | Infusion protein with transdermal drug delivery property | |
| CN101451145B (en) | Tuberculosis gene vaccine based on T cell epitope as well as preparation method and use thereof | |
| CN107530450A (en) | Vaccine with the CD40L as adjuvant | |
| CN102796200B (en) | Hybrid peptide bursin adjuvant and preparation method and application thereof | |
| CN102532324A (en) | Preparation and application of brucella gene engineering subunit vaccines | |
| CN110669114B (en) | Lanthionine precursor peptide amyA6, and preparation method and application thereof | |
| CN104861050A (en) | Acinetobacter baumannii zinc dependent oligopeptide A1S-1610 recombinant protein and preparation method and application thereof | |
| Banchereau | The long arm of the immune system | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN110478480A (en) | Sore mouth virus F1L vaccine based on ferritin nano particle and preparation method thereof | |
| CN105018454A (en) | Recombination preparation method of arginine deiminase | |
| CN102516382B (en) | Antimicrobial peptide Hainanenin-5 of Amolops hainanensis, gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis, and application of gene of antimicrobial peptide Hainanenin-5 of Amolops hainanensis | |
| CN102094023A (en) | Plutella xylostella gloverin gene and encoded protein, corresponding expression system and application | |
| CN106818885A (en) | A kind of acid protease is preparing the application in suppressing cause of disease bacteria preparation | |
| CN103172721B (en) | Amolops hainanensis antimicrobial peptide Hainanenin-1, and gene, separation purification, chemical synthesis and application thereof | |
| CN105732792A (en) | Yeast expressed chicken Cathelicidin antibacterial peptide as well as preparation method and application thereof | |
| CN102190717B (en) | Narcissus tazetta lectin expressed in vitro and application thereof | |
| CN101899116B (en) | Non-invasive high-penetrability epidermal growth factor and application thereof | |
| CN105713908A (en) | Recombinant bombyx mori gloverin and preparation method and application thereof | |
| CN101875913B (en) | Recombinant mycobacterium smegmatis strain capable of expressing mycobacterium tuberculosis Ag 85B and ESAT-6 fusion protein and application thereof | |
| CN101225371B (en) | Preparation technology of recombinant human p43 protein | |
| CN104861048A (en) | Acinetobacter baumanniihy pothetical protein A1S-1462 protein and preparation method and application thereof | |
| CN110117328A (en) | A kind of recombinant spider silk protein and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20091125 |