CN101575643A - Method for detecting the chimerism rate of recipients after allogeneic hematopoietic stem cell transplantation - Google Patents

Method for detecting the chimerism rate of recipients after allogeneic hematopoietic stem cell transplantation Download PDF

Info

Publication number
CN101575643A
CN101575643A CNA2009100522602A CN200910052260A CN101575643A CN 101575643 A CN101575643 A CN 101575643A CN A2009100522602 A CNA2009100522602 A CN A2009100522602A CN 200910052260 A CN200910052260 A CN 200910052260A CN 101575643 A CN101575643 A CN 101575643A
Authority
CN
China
Prior art keywords
donor
pcr
recipient
stem cell
hematopoietic stem
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CNA2009100522602A
Other languages
Chinese (zh)
Inventor
王健民
邵宇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Second Military Medical University SMMU
Original Assignee
Second Military Medical University SMMU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Second Military Medical University SMMU filed Critical Second Military Medical University SMMU
Priority to CNA2009100522602A priority Critical patent/CN101575643A/en
Publication of CN101575643A publication Critical patent/CN101575643A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention adopts the real-time quantitative PCR (RQ-PCR) technology combining with single nucleotide polymorphism (SNP) to detect the chimerism rate of recipients after allogeneic hematopoietic stem cell transplantation, and establishes a standard curve of a plasmid standard which contains target genes and internal reference and is subjected to multiple proportions dilution. A standard construction template is a qualitative PCR product for a patient with positive SNP loci, the standard construction template is cloned in a T carrier to construct a plasmid, and the standard curve is established after multiple proportions dilution. The new method facilitates early detection and exclusion as well as relapse prevention, improves the success rate of transplantation, has higher sensitivity and stability, does not need to consume a large number of valuable specimens before transplantation, and can be used for individual identification purposes. The invention can replace the present prevailing STP-PCR semi-quantitative detection method, can carry out quantitative detection of the chimerism rate by utilizing real-time quantitative PCR instruments purchased by most hospitals, and has accuracy, simplicity, speediness and low cost.

Description

A kind of detection after the recessive allele hematopoietic stem cell transplantation for the method that is subjected to chimeric rate
Technical field
The invention belongs to technical field of molecular biology, more particularly, relate to the method for the chimeric rate of donor-recipient after a kind of novel detection recessive allele hematopoietic stem cell transplantation.
Background technology
In recent years, children and adult's malignant hematologic disease incidence have ascendant trend year by year, and by treatment meanss such as conventional chemicotherapies, survival rate only had 40-60% in 3 years, and be difficult to cure fully, recessive allele hematopoietic stem cell transplantation (allo-HSCT) is unique method that can reach healing.At present, transplant routine number both at home and abroad and climb year by year and increase, the domestic hospital that has carried out hematopoietic stem cell transplantation reaches tens of families.But the rejection behind the allo-HSCT, recurrence have influenced the success ratio of transplanting greatly.The formation of donor-recipient's chimerism that the success or not of transplanting is stable with transplanting the back has substantial connection.Therefore, distinguishing the source of transplanting the back hemopoietic stem cell is the important symbol that success or not is transplanted in assessment, and to judging that the protopathy prognosis has important value.In 2004 the 22nd phases of " Clin Oncol " magazine " Increasing mixed chimerism is an importantprognostic factor for unfavorable outcome in children with acute lymphoblasticleukemia after allo-geneic stem-cell transplantation:possible role forpreemptive immunotherapy " literary composition, just point out, transplanting back dynamic monitoring donor-recipient's chimeric rate can find to repel early, prevention of recurrence is also in time intervened, and has very important significance.
" China's blood transfusion magazine " the 16th phase in 2003 " is implanted the present Research of evidence detection method " after the hematopoietic stem cell transplantation literary composition is pointed out, after the detection recessive allele hematopoietic stem cell transplantation there be the classical way of the chimeric rate of donor-recipient: (1) blood group; (2) red corpuscle isozyme; (3) sex chromosome karyotyping; (4) HLA antigen; (5) restricted length polymorphism; (6) variable number tandem repeat VNTR; (7) little satellite tumor-necrosis factor glycoproteins (STR) etc. all has its inherent defect.The method of the chimeric rate of detection of the current international practice is STR-PCR at present, it has the height distinguishability, susceptibility and relative advantage such as quick, but 1991 the 77th phases of " Blood " magazine " Evaluation of mixed chimerism by in vitro amplication of dinucleotide repeatsequences using the polymerase chain reaction " literary composition is pointed out, it is a kind of semiquantitative method, have PCR competition and plateau biased shortcoming, its PCR product need carry out further capillary electrophoresis, the possibility of product pollution is arranged, and sensitivity reaches about 5-10% only.These defectives make it be difficult to detect MRD, and PCR product electrophoresis and sequencing analysis cost are higher, and expensive hereditary sequenator is purposes utmost point limitation clinically, are sent to scientific research institution mostly and detect, domestic be difficult to popularize carry out.
SNP (single nucleotide polymorphism) mainly is meant on genomic level by the caused dna sequence polymorphism of the variation of single Nucleotide.It is modal a kind of in human heritable variation, accounts for more than 90% of all known polymorphisms.SNP extensively exists in human genome, is widely used in the research of population genetics and disease related gene, will replace the application of STR in legal medical expert's evaluation, individual recognition gradually, becomes the molecular genetics mark of a new generation.
Real-time quantitative PCR (RQ-PCR) is a kind of with the technology of conventional polymerase chain reaction (PCR) with specific probe hybridization technological incorporation, it has successfully solved conventional PCR can not be quantitative, the false positive that amplified production pollutes, need carry out problems such as PCR aftertreatment, have highly sensitive, specificity and reliability are stronger, can realize multiple reaction, the level of automation height, nonstaining property, characteristics such as tool real-time and accuracy, and the real-time quantitative PCR instrument can carry out leukemia fusion gene, methylate, point mutation and transplant patient cytomegalovirus, detection by quantitative such as fungi have high clinical value in hematology.
2002 the 99th phases of " Blood " magazine " Quantitative assessment of hematopoieticchimerism after bone marrow transplantation by real-time quantitative polymerasechain reaction " literary composition has reported that RQ-PCR associating SNP detects the method for transplanting the chimeric rate in back, improved the sensitivity that detects greatly than STR-PCR, accuracy, but the cell simulation that need utilize the donor-recipient is for being subjected to the chimeric doubling dilution that carries out to set up typical curve, the typical curve that this method is set up need utilize the valuable sample before a large amount of transplanting, complex operation, increased the detection cost in time between, and reduced the stability of experiment.The present invention utilizes plasmid standard to set up typical curve, carries out absolute quantitation, plasmid has stable in properties, be easy to preserve, quantitatively accurately, advantage that can endless amplification, do not waste blood sample, greatly improved result's accuracy and reliability.
Summary of the invention
The purpose of this invention is to provide after a kind of simple and easy to do, detection recessive allele hematopoietic stem cell transplantation of saving cost for the novel method that is subjected to chimeric rate.
For realizing this purpose, the present invention has adopted real-time quantitative PCR technology (RQ-PCR) associating single nucleotide polymorphism (SNP) to detect the chimeric rate of donor-recipient after the recessive allele hematopoietic stem cell transplantation, set up the typical curve of the plasmid standard doubling dilution that contains goal gene and confidential reference items, mainly may further comprise the steps: the preparation of (1) genomic dna; (2) selection of SNP site and primer and probe design; (3) PCR screening donor-recipient difference SNP site; (4) foundation of goal gene and confidential reference items GAPDH plasmid standard and typical curve; (5) real-time quantitative PCR detects; (6) calculating of the chimeric rate of donor (DC); (7) method accuracy and susceptibility checking.Standard substance of the present invention make up template SNP site male patient's qualitative PCR product for this reason, and it is cloned into the T carrier, makes up plasmid, set up typical curve behind the doubling dilution.
Another object of the present invention is a large amount of genetic information of utilizing 18 SNP sites to carry, native system is applied to legal medical expert identifies and individual recognition, replaces the application of STR in legal medical expert's evaluation, individual recognition gradually.
The present invention is beneficial to and finds transplant rejection, prevention of recurrence early, guiding clinical treatment, the success ratio of transplanting that improves, have higher sensitivity, stability and operability, the plasmid standard stable in properties is reliable, the source is simple, does not need the valuable sample before a large amount of uses are transplanted to make up typical curve; And 18 SNP sites of donor-recipient PCR result carries a large amount of genetic information, can be used as the individual recognition purposes.The alternative current at present STP-PCR semi-quantitative detection method of the present invention, the real-time quantitative PCR instrument that utilizes most hospital to purchase carries out chimeric rate detection by quantitative, and testing cost is comparatively cheap, has high potential applicability in clinical practice.
In the technique scheme, the related content specific explanations is as follows:
1. recessive allele hematopoietic stem cell transplantation (allo-PBSCT): be exactly before transplanting, the tumour cell maximum in the patient blood to be limited the quantity of to kill with the chemotherapy/radiotherapy of heavy dose, suppress patient's immunity and hemopoietic system simultaneously, then HLA is joined type mutually and the allogene donor hematopoietic stem cell by in the vein input patient body, reach the hematopoiesis of rebuilding patient and the purpose of immunologic function.
2. chimeric rate (donor chimerism DC): transplant the shared overall ratio of back donor's cells, judge with this whether donorcells is implanted or be ostracised, and with transplant back common complication graft versus host disease (GVH disease) (GVHD) close ties arranged, can instruct the consumption of clinical increase and decrease immunosuppressor or carry out donor lymphocyte infusion.
3. polymerase chain reaction (PCR): be a kind of method of amplification in vitro dna fragmentation, have special, responsive, productive rate is high, outstanding advantage such as quick; Can in vitro goal gene or a certain dna fragmentation that will study be expanded to 100,000 and even 1,000,000 times in a few hours at one, make naked eyes energy direct viewing and judgement; Can from a hair, bleed in addition cell amplify capacity DNA for analysis and research with detect and identify.
4. real-time quantitative PCR reaction (RQ-PCR): be meant in conventional PCR reaction system to add fluorophor, utilize the fluorescent signal accumulation whole PCR process of monitoring in real time, count typical curve that standard substance set up carries out quantitative analysis to unknown template method by known copy at last.It has added fluorescence dye or fluorescent probe on conventional PCR basis.Fluorescence dye can specificity mix the dna double chain, send fluorescent signal, and the dye molecule that does not mix in the two strands does not send fluorescent signal, thereby guarantees that the increase of fluorescent signal and PCR product increase fully synchronously.Need specific real-time quantitative PCR instrument to finish.The feasibility of quantitative PCR reaction is quantitatively generally carried out in the pcr amplification exponential phase.
5. plasmid standard: synthetic include plasmid aim sequence or confidential reference items sequence, the known copy number, plasmid is as carrier, has stable in properties, advantage such as quantitatively accurate, easy and simple to handle, copy number=(quality ÷ molecular weight) * 6.023 * 10 233-5 point of generally held standard product doubling dilution makes up a typical curve, in order to unknown sample is carried out absolute quantitation.
6. confidential reference items: confidential reference items are house-keeping gene such as β-actine, GAPDH normally, copy number is constant in expression amount or the genome in cell, influence affected by environment is little, and the quantitative result of confidential reference items has been represented total cell or genome content in the sample, can proofread and correct total cell count, application of sample equal error.The patient will carry out the reaction of purpose SNP locus gene and internal control gene twice PCR after every displacement was planted among the present invention, carried out final chimeric rate with goal gene copy number/internal control gene copy number and calculated.
Description of drawings
Below in conjunction with Figure of description, the present invention is described in more detail.
Fig. 1 is 18 SNP site titles, position, difference degree and primers thereof, probe sequence.
Fig. 2 is that this experimental result compares (CC: chimeric fully with STR-PCR, fluorescence in situ hybridization (FISH) and special leukemia fusion gene result; MC: part is chimeric).
Fig. 3 seeks the qualitative PCR result in difference site for the donor-recipient.Left and right sides swimming lane is respectively the PCR product of donor-recipient's same primers as before transplanting in twos, has only one of them male for can distinguish the SNP site, have only 3/4 road and 13/14 road donor-recipient that a positive is arranged as figure, be and can distinguish the SNP site, this primer and probe can be used as this patient and transplant purpose primer and the probe of the chimeric rate in back when detecting.
Fig. 4 seeks the quantitative PCR result in difference site for the donor-recipient.The donor-recipient transplants preceding donor-recipient and has only one can increase with the capable quantitative PCR reaction of primer in same SNP site before transplanting, and on the qualitative PCR result, verifies that further the primer in this site and probe can be used for next step chimeric rate detection by quantitative.
Fig. 5 is simulation chimeric measured value and theoretical value dependency comparative result, and dependency is up to R 2＞0.99.
Fig. 6 is the susceptibility of method.It is chimeric that doubling dilution is set up simulation, and it is 0.01% that this experiment can repeat susceptibility.This figure is the pcr amplification figure behind 2 times of confidential reference items standard substance or the 10 times of unlimited doubling dilutions, be respectively 100%, 25%, 12.5%, 3.25%, 1.6%, 0.8%, 0.4%, 0.2%, 0.1%, 0.01% from left to right, this time the threshold value of pcr amplification reaction is 22203.863795, the X-coordinate of amplification curve and threshold value point of interface i.e. the CT value of sample for this reason, according to the PCR2 principle that doubly increases, 2 times of every doubling dilutions, the CT value should reduce 1 (2 1=2), dilute 10 times, the CT value should reduce 3.33 (2 3.33=10), spacing should equate substantially that PCR susceptibility can reach 0.01% between the sample institute amplification curve of same ratio doubling dilution and the threshold value point of interface.
Fig. 7 transplants chimeric rate dynamic change figure in back and and the STR-PCR comparative result same period for certain patient.
Fig. 8 a is amplification curve behind the plasmid standard doubling dilution of S01a SNP site and the typical curve of being set up, Fig. 8 b is amplification curve behind the plasmid standard doubling dilution of confidential reference items GAPDH and the typical curve of being set up, both amplification efficiency basically identicals, 0.97259 vs 0.97173.Surplus SNP site typical curve repeats no more.
Embodiment
1. sample disposal and genomic dna preparation:
Split red liquid (NH 1.1 split the EDTA anticoagulation or the bone marrow prepare → adding 2-3ml of red collection 4Cl (1.5M) 80g, KHCO 3(100nM) 10g, Na 4EDTA (10nM) 3.7g, regulator solution pH value is to 7.2-7.4, add the deionized water constant volume to 1L, when preparation work liquid, use after 10 times of this storage liquid dilutions) → mixing → leave standstill 5min → centrifugal 1200rpm put upside down repeatedly, 5min → abandon supernatant adds once more to split red liquid and repeat once → adds PBS2-3ml and washs centrifugal back collection white corpuscle twice.
1.2 extracting genome DNA adopts the conventional salt analysis method of test kit to extract genomic dna (U-gene, Anhui), spectrophotometer measures DNA purity and concentration, and purity assurance OD value is advisable between 1.7-2.0, and-20 ℃ frozen standby.Employing Chelex-100 (Bio-Rad) method that cell count is extremely low (referring to " Wannan Medical College's journal " the 18th phase in 1999 " Chelex-100 single stage method rapid extraction peripheral blood DNA ") is extracted.Detailed step is as follows:
The white corpuscle that splits after red adds 200 μ L 10%Chelex-100, fully behind the mixing → 56 ℃ insulation 30min → fully concussion is boiled 8min for → 100 ℃, fully concussion → centrifugal, and 13000rpm promptly contains template DNA in 5min → supernatant liquor.
2.SNP site selection and primer and probe design: we have chosen on 9 coloured differently bodies totally 18 SNP site (see figure 1)s, such as S01a is 17q (No. 17 karyomit(e) is long-armed) in chromosomal position, difference degree in the crowd is 23.6%, be that this site has 23.6% probability can become mutual difference site in the crowd, reach the purposes of individual recognition.The nucleotide sequence in corresponding this site has designed upstream and downstream primer and probe (primer: GGTACCGGGTCTCCACATGA, a GGGAAAGTCACTCACCCAAGG; Probe: CTGGGCCAGAATCTTGGTCCTCACA); Shared same downstream primer of S01a and S01b and probe, S01b are also at No. 17 long-armed positions of karyomit(e), its primer sequence: GTACCGGGTCTCCACCAGG, GGGAAAGTCACTCACCCAAGG; Probe sequence: CTGGGCCAGAATCTTGGTCCTCACA; S02 is on Y chromosome, and the difference degree in the crowd is 36.4%, and promptly this site has 36.4% probability can become mutual difference site in the crowd, to reach the purposes of individual recognition.Similarly, the nucleotide sequence in corresponding this site has designed two primers of upstream and downstream and probe (primer: GCTTCTCTGGTTGGAGTCACG, a GCTTGCTGGCGGACCCT; Probe: CTGCACCACCAAATCATCCCCGTG).Site selection principle: 1. diallele sudden change; 2. have two continuous base mutations at least; 3. extensive heterogeneity is arranged in the general population.Article one, primer specificity is at sudden change SNP site, and another is at common sequence.
3. screen donor-recipient's difference SNP site: the regular-PCR (see figure 3): the common PCR reaction that the preceding donor-recipient of transplanting carries out 18 SNP sites respectively (is used same amplimer with quantitative PCR, see accompanying drawing 1), be reflected in the Bimetra T Gradient PCR instrument and carry out.All establish negative control at every turn.The PCR product sifts out the independent male of donor-recipient, can distinguish the SNP site after gel electrophoresis (2% agarose, electrophoresis 25min) is analyzed, the row quantitative PCR is further verified.
Reaction system:
Final concentration Volume (ul)
Template DNA 50-100ng 3.4
Primer (Forward+Reverse) 200nM 1.6
2 * Pre-MIX (comprising enzyme, Mg2+, dNTPs, Buffer) 1× 10
Distilled water (replenishing volume) 5
Cumulative volume 20
Reaction conditions:
Figure A20091005226000101
Quantitative PCR (see figure 4): add sequence-specific probe to the further checking of candidate SNP locus row quantitative PCR reaction, only have preceding donor of transplanting or receptor to increase, promptly determine to be that this is to donor-recipient's purpose SNP site as a certain SNP site.Total reaction volume 20ul is reflected in the ABI 7500 real-time quantitative PCR instrument and carries out.All establish negative control (do not add template DNA, distilled water replenishes) at every turn.
Reaction system:
Final concentration Volume (ul)
Template DNA 50-100ng 2.6
Primer (Forward+Reverse) 200nM 1.6
Probe 200nM 0.8
2 * quantitatively Pre-MIX (comprising enzyme, Mg2+, dNTPs, Buffer) 1× 10
Distilled water (replenishing volume) 5
Cumulative volume 20
Reaction conditions:
Figure A20091005226000111
4. the foundation of standard substance and typical curve: we make up 18 plasmids that contain the SNP locus gene that remains to be distinguished respectively:
At first the qualitative PCR product of in ncbi database, determining this SNP site positive patient of this SNP site PCR product size → utilize according to every pair of SNP site upstream and downstream primer location for the structure template of standard substance (as the S01a site, the S01a site-specific primer that the utilization of patient's first has designed can amplify positive fragment, promptly utilize this PCR product to make up template as S01a site plasmid standard) → capable 2% agarose electrophoresis of PCR product, purpose band glue reclaims and (reclaims product and promptly comprise S01a site target gene sequences under 30min → ultraviolet lamp, glue reclaims the test kit operation routinely) → by T4 ligase enzyme and (the commercialization purchase of T carrier, TAKARA, Dalian) connect (16 ℃ are spent the night), being inserted in the T carrier → connecting product further transforms through DH5A intestinal bacteria competence, blue hickie screening is chosen and is shaken the performing PCR reaction of bacterium amplification → at first behind the mono-clonal bacterium and verify that (primer is with Fig. 1 S01a site) → capable plasmid of male takes out (press the test kit ordinary method extracts) → finally sequence verification for a short time, and survey its concentration, calculate copy number according to molecular weight, doubling dilution becomes the order of magnitude 10 7～10 3, diluting 3 orders of magnitude at least and could set up typical curve, the many more curves of the dilution order of magnitude are set up reliable more.Every batch threshold level is located at increased logarithmic phase and is higher than non-specific amplification.
We have made up the plasmid standard in confidential reference items and each SNP site respectively, and its amplification efficiency basically identical (Fig. 8 a and Fig. 8 b) is found in fixed quantity PCR reaction back, so also can only utilize typical curve of confidential reference items GAPDH to calculate both copy numbers.
5. real-time quantitative PCR detects: the same table of reaction system and condition, use and express constant confidential reference items GAPDH correction error, if two-pack hole, (so the donor amplification before transplanting of SNP site is positive for confession/receptor before each reaction includes and transplants, receptor's feminine gender, when then surveying the chimeric rate of unknown sample, comprise transplant before donor), 5 gradient standard substance and negative controls.Reaction tubes arrangement design following (order can be different, can not establish secondary hole after the skilled operation):
Standard substance e 7(confidential reference items GAPDH) Standard substance e 7(confidential reference items GAPDH) Supply or receptor's (goal gene) before transplanting Supply or receptor's (goal gene) before transplanting
Standard substance e 6(confidential reference items GAPDH) Standard substance e 6(confidential reference items GAPDH) Supply or receptor (confidential reference items GAPDH) before transplanting Supply or receptor (confidential reference items GAPDH) before transplanting
Standard substance e 5(confidential reference items GAPDH) Standard substance e 5(confidential reference items GAPDH) Testing sample (goal gene) Testing sample (goal gene)
Standard substance e 4(confidential reference items GAPDH) Standard substance e 4(confidential reference items GAPDH) Testing sample (confidential reference items GAPDH) Testing sample (confidential reference items GAPDH)
Standard substance e 3(confidential reference items GAPDH) Standard substance e 3(confidential reference items GAPDH) Negative control (no template)
6. the calculating of the chimeric rate of donor (DC): utilizing the Ct value of sample and the copy number that typical curve calculates each sample SNP site and confidential reference items, averages in secondary hole.As confidential reference items copy number 〉=3 * 10 3, think that promptly this sample can use.Copy number＜500 samples all carry out the 2nd amplification.
Figure A20091005226000131
7. method accuracy and susceptibility checking: the donor-recipient in a pair of known difference SNP site is transplanted preceding sample counting, with the donor's cells receptor is diluted in proportion, make that donee's cells accounts for 100%, 80% respectively, 40%......0.01%, 0.001%, it is chimeric to set up simulation, utilization variance SNP site is carried out the quantitative PCR reaction and is recorded chimeric rate, compares checking (Fig. 5, Fig. 6) with theoretical value.
Fig. 7 be method by STR-PCR and the present invention to an allotransplantation after the patient for the result who is subjected to chimeric rate dynamic monitoring.
Utilize 17 typical curves of confidential reference items plasmid standard amplification, average gradient is-3.39 (3.22～-3.65), and mean intercept is 39.97 (37.33～43.19), and the facies relationship number average is greater than 0.995, and batch interpolation and difference between batch are all in controlled range.18 pairs of SNP primers that utilize Fig. 1 to provide, almost each all can find the site of mutual difference to donor-recipient before transplanting.The simulation chimeric cell is carried out chimeric rate detection by quantitative, and repeatedly result and theoretical value dependency are fine, R 2＞0.99 (Fig. 5), it is 0.01% (Fig. 6) that method can repeat susceptibility.Part patient has carried out the quantitative result of STR-PCR, XY-FISH and fusion gene simultaneously, dependency fine (comparative result is seen Fig. 2).Above result proves that all the method that the present invention set up is accurate, reliable, easy, easy row, is suitable for clinical expansion.
In addition, 18 SNP sites of donor-recipient PCR result that the 2nd, 3 steps of embodiment adopt carries a large amount of genetic information, can be used as the individual recognition purposes.In this research, transplant donor-recipients and can reach 96.1% (49/51) for 51 pairs, illustrate that above-mentioned 18 SNP sites are middle high information quantity site, be applicable to the medical jurisprudence individual recognition, can be used as the important supplement of current STR system by these 18 mutual recognition rates in SNP site.

Claims (5)

1, a kind of method that detects the chimeric rate of donor-recipient after the recessive allele hematopoietic stem cell transplantation, this method may further comprise the steps:
(1) genomic dna preparation;
(2) selection of SNP site and primer and probe design;
(3) screening donor-recipient difference SNP site;
(4) foundation of plasmid standard and typical curve;
(5) real-time quantitative PCR detects;
(6) calculating of the chimeric rate of donor.
2, the method for the chimeric rate of donor-recipient after the detection recessive allele hematopoietic stem cell transplantation according to claim 1 is characterized in that: described typical curve is to utilize the plasmid standard that contains for being distinguished SNP locus gene and confidential reference items to set up behind doubling dilution.
3, the method for the chimeric rate of donor-recipient after the detection recessive allele hematopoietic stem cell transplantation according to claim 1 is characterized in that: described typical curve is to utilize the plasmid standard that contains confidential reference items to set up behind doubling dilution.
4, according to the method for the chimeric rate of donor-recipient after claim 1 or the 2 or 3 described detection recessive allele hematopoietic stem cell transplantation, it is characterized in that: the described doubling dilution copy number order of magnitude is 10 7～10 3
5, according to the method for the chimeric rate of donor-recipient after the described detection recessive allele of claim 1 hematopoietic stem cell transplantation, the application of wherein said SNP site system in the medical jurisprudence individual recognition.
CNA2009100522602A 2009-05-31 2009-05-31 Method for detecting the chimerism rate of recipients after allogeneic hematopoietic stem cell transplantation Pending CN101575643A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CNA2009100522602A CN101575643A (en) 2009-05-31 2009-05-31 Method for detecting the chimerism rate of recipients after allogeneic hematopoietic stem cell transplantation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNA2009100522602A CN101575643A (en) 2009-05-31 2009-05-31 Method for detecting the chimerism rate of recipients after allogeneic hematopoietic stem cell transplantation

Publications (1)

Publication Number Publication Date
CN101575643A true CN101575643A (en) 2009-11-11

Family

ID=41270715

Family Applications (1)

Application Number Title Priority Date Filing Date
CNA2009100522602A Pending CN101575643A (en) 2009-05-31 2009-05-31 Method for detecting the chimerism rate of recipients after allogeneic hematopoietic stem cell transplantation

Country Status (1)

Country Link
CN (1) CN101575643A (en)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105861675A (en) * 2016-04-27 2016-08-17 上海荻硕贝肯生物科技有限公司 Primers, probe, kit and method for microchimerism detection and individual recognition
CN107960107A (en) * 2015-06-15 2018-04-24 默多克儿童研究所 The method for measuring chimerism
RU2667006C1 (en) * 2017-06-07 2018-09-13 Федеральное государственное бюджетное учреждение науки "Кировский научно-исследовательский институт гематологии и переливания крови Федерального медико-биологического агентства" Method for determining posttransplantation chimerism in analysis of point mutations of base substitution in genes f2, f5, f7, f13, fgb, itga2, itgb3, pai-1
RU2667127C1 (en) * 2017-06-28 2018-09-14 Федеральное государственное бюджетное учреждение науки "Кировский научно-исследовательский институт гематологии и переливания крови Федерального медико-биологического агентства" Method for determining hematopoietic chimerism in the study of single nucleotide polymorphisms of genes mther: 677, mther: 1298, mtr: 2756, mtrr: 66
RU2675597C1 (en) * 2017-06-23 2018-12-20 Федеральное государственное бюджетное учреждение Гематологический научный центр Министерства здравоохранения Российской Федерации (ФГБУ ГНЦ Минздрава России) Method of identification of immunogen dna discrepancies in donor - patient pairs when planning hematopoietic stem cell transplantation
CN112509638A (en) * 2020-12-04 2021-03-16 深圳荻硕贝肯精准医学有限公司 Analysis method and analysis processing device for human HLA chromosome region heterozygosity loss
CN118016160A (en) * 2024-04-08 2024-05-10 北京博富瑞基因诊断技术有限公司 HLA haploid matched hematopoietic stem cell transplantation survival rate prediction method, system, equipment and storage medium

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KHAN F ET AL: "Significance of chimerism in hematopoietic stem cell transp lantation: new variations on an old theme", 《BONEMARROW TRANSPLANT》 *
MEHDI ALIZADEH ET AL: "Quantitative assessment of hematopoietic chimerism after bone marrow transplantation by real-time quantitative polymerase chain reaction", 《TRANSPLANTATION》 *
MICHAEL KOLDEHOFF ET AL: "Quantitative Analysis of Chimerism after Allogeneic Stem Cell Transplantation by Real-Time Polymerase Chain Reaction with Single Nucleotide Polymorphisms, Standard Tandem Repeats,and Y-Chromosome-Specific Sequences", 《AMERICAN JOURNAL OF HEMATOLOGY》 *
唐晓文等: "嵌合体的定量检测在异基因造血干细胞移植术后过继免疫治疗中的应用", 《中华内科杂志》 *

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107960107A (en) * 2015-06-15 2018-04-24 默多克儿童研究所 The method for measuring chimerism
CN105861675A (en) * 2016-04-27 2016-08-17 上海荻硕贝肯生物科技有限公司 Primers, probe, kit and method for microchimerism detection and individual recognition
RU2667006C1 (en) * 2017-06-07 2018-09-13 Федеральное государственное бюджетное учреждение науки "Кировский научно-исследовательский институт гематологии и переливания крови Федерального медико-биологического агентства" Method for determining posttransplantation chimerism in analysis of point mutations of base substitution in genes f2, f5, f7, f13, fgb, itga2, itgb3, pai-1
RU2675597C1 (en) * 2017-06-23 2018-12-20 Федеральное государственное бюджетное учреждение Гематологический научный центр Министерства здравоохранения Российской Федерации (ФГБУ ГНЦ Минздрава России) Method of identification of immunogen dna discrepancies in donor - patient pairs when planning hematopoietic stem cell transplantation
RU2667127C1 (en) * 2017-06-28 2018-09-14 Федеральное государственное бюджетное учреждение науки "Кировский научно-исследовательский институт гематологии и переливания крови Федерального медико-биологического агентства" Method for determining hematopoietic chimerism in the study of single nucleotide polymorphisms of genes mther: 677, mther: 1298, mtr: 2756, mtrr: 66
CN112509638A (en) * 2020-12-04 2021-03-16 深圳荻硕贝肯精准医学有限公司 Analysis method and analysis processing device for human HLA chromosome region heterozygosity loss
CN118016160A (en) * 2024-04-08 2024-05-10 北京博富瑞基因诊断技术有限公司 HLA haploid matched hematopoietic stem cell transplantation survival rate prediction method, system, equipment and storage medium
CN118016160B (en) * 2024-04-08 2024-05-31 北京博富瑞基因诊断技术有限公司 HLA haploid matched hematopoietic stem cell transplantation survival rate prediction method, system, equipment and storage medium

Similar Documents

Publication Publication Date Title
US11155872B2 (en) Detection and quantification of donor cell-free DNA in the circulation of organ transplant recipients
CN101575643A (en) Method for detecting the chimerism rate of recipients after allogeneic hematopoietic stem cell transplantation
Hose et al. Proliferation is a central independent prognostic factor and target for personalized and risk-adapted treatment in multiple myeloma
Hernandez et al. Genomic and mutational profiling of ductal carcinomas in situ and matched adjacent invasive breast cancers reveals intra‐tumour genetic heterogeneity and clonal selection
Faham et al. Deep-sequencing approach for minimal residual disease detection in acute lymphoblastic leukemia
Decaux et al. Prediction of survival in multiple myeloma based on gene expression profiles reveals cell cycle and chromosomal instability signatures in high-risk patients and hyperdiploid signatures in low-risk patients: a study of the Intergroupe Francophone du Myelome
Shlush et al. Cell lineage analysis of acute leukemia relapse uncovers the role of replication-rate heterogeneity and microsatellite instability
Ponti et al. TCRγ-chain gene rearrangement by PCR-based GeneScan: diagnostic accuracy improvement and clonal heterogeneity analysis in multiple cutaneous T-cell lymphoma samples
CN101845520B (en) HPA allelic gene typing detection reagent kit
US20120101001A1 (en) Method to assess human allograft status from microrna expression levels
Ramsey et al. Cross‐species analysis of the canine and human bladder cancer transcriptome and exome
CN107488726A (en) A kind of kidney prognosis evaluation biomarker and its detection reagent and application
CN103740824B (en) A kind of two Nucleotide synthesize the method for Sequencing chromatogram Identifying micro-organisms population in real time
CN104561306A (en) Porcine UNC13B gene SNP (single nucleotide polymorphism) marker related to porcine eye muscle area character
CN108913757A (en) A kind of primer sets of chromosome aneuploid numerical abnormality and detection kit and its application
CN104830852A (en) Multiplex real-time fluorescent PCR (polymerase chain reaction) method for detecting HLA-B*15:02 alleles
CN103468790B (en) Primers used for detecting polymorphism of saccharum arundinaceum, and detection method and applications
CN102899413A (en) Application of single nucleotide polymorphisms of rs2735591 in detection of leprosy susceptibility genes
CN106939334A (en) A kind of detection method of fetal DNA in maternal plasma DNA content
CN107012232A (en) Primer and detection method for detecting the related SNP site of gastric cancer susceptibility
CN103290108A (en) Mitochondrial SNP fluorescence labeling composite amplification kit and application thereof
JP6164683B2 (en) Method for analyzing deletion site of spermatogenesis region on Y chromosome and Y chromosome
CN102443625A (en) Method for rapidly detecting human leucocyte antigen B27 (HLA-B27) and kit thereof
CN102899390A (en) Small cell lung cancer markers and their detection
CN106755530A (en) One kind detection HLA A*31:The MGB probe for real-time fluorescence PCR method and its primer combination of probe of 01 allele

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20091111