CN101570787A - Composite chip for rapid prenatal diagnosis of PKU and method - Google Patents
Composite chip for rapid prenatal diagnosis of PKU and method Download PDFInfo
- Publication number
- CN101570787A CN101570787A CNA2009100383578A CN200910038357A CN101570787A CN 101570787 A CN101570787 A CN 101570787A CN A2009100383578 A CNA2009100383578 A CN A2009100383578A CN 200910038357 A CN200910038357 A CN 200910038357A CN 101570787 A CN101570787 A CN 101570787A
- Authority
- CN
- China
- Prior art keywords
- chip
- pku
- dna
- sample
- diagnosis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a composite chip for rapid prenatal diagnosis of PKU and a method. The composite chip comprises a DNA chip and a micro-fluidic chip; the DNA chip is formed by fixing various point mutation PKU specific diagnostic gene probes on a glass chip; and the surface of the micro-fluidic chip provided with a passage is butted and automatically adsorbed firmly with the surface of the glass chip provided with the point mutation PKU specific diagnostic gene probes by taking a reaction area and a gene probe area as butting points. The method comprises the following steps: extracting DNA in plasma and leucocyte of a pregnant woman, performing amplification on exon genes of the DNA and performing reaction on a primer to obtain a sample; respectively adding the sample, washing fluid and a cleaning solution into a sample cell, a washing fluid cell and a cleaning solution cell of the composite chip; centrifuging the composite chip; and unveiling and discarding the micro-fluidic chip on the glass chip, and observing a result of the reaction of the sample and the reaction area. The composite chip and the method can realize the rapid prenatal diagnosis of the PKU.
Description
Technical field
The present invention relates to a kind of Apparatus and method for that is used for the antenatal quick diagnosis of genetic diseases, more particularly, relate to the compound chip and the method for the antenatal quick diagnosis of a kind of PKU of being used for.
Background technology
Classic phenylketonuria (Phenyketon uria letter PKU) is a kind of inborn error of metabolism that the hereditary defect by Phenylalanine hydroxylase (PAH) causes.The PKU infant is when birth just, because therefore the absorption of no phenylalanine does not have performance when participating in the cintest, but, occur the decline of carrying out property of intelligence continuously along with the moving back food of infant, skin pigment is shallow, the muscular tension height, faint from fear and take place, in sweat and the urine special odor is arranged, the patient can't take care of oneself, the intelligence serious hindrance, simultaneously, cause serious physical and mental burden and economic pressures for patient family.Therefore, this sick row antenatal diagnosis is very important.
PKU is a kind of autosomal recessive hereditary diseases, and the father and mother of infant are homozygote for carrier's infant of Disease-causing gene.Cause the PAH of the gene of PKU, this gene is positioned at the about 90kb of 12q22-24.2 total length, comprises 13 exons and 12 introns.Have been found that so far PKU has more than 440 kind of pathogenic mutation (http://www.mcgill.ca/pahdb), domestic only find 30 surplus kind sudden change.The little genetics that the sudden change major part of PAH gene is positioned at the coding region changes, and only influences one or more amino acid in the Phenylalanine hydroxylase gene, and its influence to enzymic activity depends on the form and the position of sudden change strongly.According to the Phenylalanine hydroxylase enzymic activity is had or not influence, sudden change can be divided into pathogenic mutation and silent mutation again.Pathogenic mutation is positioned at the cross-connecting area of exon or exon mostly, has a strong impact on Phenylalanine hydroxylase genetic transcription and translation and proteinic folding unusually, polymerization, and accelerated degradation, thereby influences the catalytic activity of Phenylalanine hydroxylase.Silent mutation is to the active nothing influence of Phenylalanine hydroxylase.
The gene mutation site and the form of Phenylalanine hydroxylase are varied, have the difference of obvious ethnic group and region.But major part is positioned at the exon district, the 63%th, and secondly missense mutation is splice site sudden change (accounting for 13%).European PKU patient's common mutations is positioned at exons 12 and introne 12, is respectively R408Q (31%) and IVS12nt G2＞A (11%); East PKU patient's common sudden change is positioned at exons 12 and 7, is respectively R413P (25%) and R243Q (18%).The gene diagnosis that the research in these Phenylalanine hydroxylase gene common mutations sites helps setting up PKU is so that realize early diagnosis and the antenatal diagnosis of PKU.
Antenatal diagnosis is meant directly or indirectly pregnancy period fetus situation is detected, and takes some required measure to prevent serious inherited disease in order to improve the health of the people, the birth of congenital abnormality and dysnoesia infant.At the beginning of the nineties, the expression level detection of carrying out with gene chip can detect thousands of expression of gene situations automatically and quickly.From normal people's genome, isolate DNA and the DNA chip hybridization just can draw standard diagram.From patient's genome, isolate DNA and the DNA chip hybridization just can draw the pathology collection of illustrative plates.By comparing, analyzing this two kinds of collection of illustrative plates, just can draw the DNA information of pathology.Characteristics such as this gene chip diagnosis technology is efficient with it, sensitivity, economy, high array, automatization, become a modernization diagnosis new technology, it has reduced false positive and false negative that the PCR mispairing is caused, has overcome the problem that round pcr can't disposable multidigit point amplification simultaneously.Although have so many advantage, the DNA hybridization time in this technology needs consuming time more than 12 hours, and quick diagnosis is restricted.The micro-fluidic chip technology (claims micro-total analysis system again, μ-TAS or chip lab lab on a chip) refer to integrated or be integrated into substantially on more than one square centimeters the chip basic operation units such as specimen preparation related in the fields such as biological and chemical, biological and chemical reaction, separation detection, in order to finishing different biological or chemical reaction process, and a kind of technology that its product is analyzed.Micro-fluidic chip has been acknowledged as one of of paramount importance cutting edge technology of 21 century, and still, the micro-fluidic chip technology is still waiting to improve and improve at present.
At present, the molecular cytobiology technology is done antenatal diagnosis has wound and does not have two kinds of wounds according to its mode branch of drawing materials.Taking to obtain method that fetal cell carries out antenatal diagnosis with umbilical vein puncture by amniocentesis, fine hair is called wound is arranged.These means have certain risk for fetus, and the possibility that causes miscarrying and take place is arranged.Thereby many scholars are devoted to the research that Noninvasive does not have the wound antenatal diagnosis, and have made encouraging progress.Noninvasive does not have the wound antenatal diagnosis and mainly contains following two kinds of methods:
1. maternal blood separation and concentration fetal cell: have fetal cell in the maternal blood, by separate, these cells of enrichment can be used for antenatal diagnosis.These cells comprise nurse cell, lymphocyte, granulosa cell and erythroblast.Present research thinks that erythroblast is the optimal cell that is used for antenatal diagnosis.But the number of fetal cell is few in the maternal blood.Carry out Non-invasive Prenatal Diagnosis, must at first fetal cell separation and purification from maternal blood be come out.The method that is usually used in enrichment, isolation of fetal cells comprises: (1) density gradient centrifugation; (2) flow cytometry method (flow cytometry); (3) magnetic field activating cells separating method (magnetic activated cell sorting, MACS); (4) micrurgy partition method; (5) selecting cell culture technique etc.At present, the fetal cell of separation and enrichment can be used for gene diagnosis or karyomit(e) diagnosis.But because the content difference of its fetal cell quantity rareness and different pregnancy phases, difficult point technology such as separation and purifying fetal cell are still unresolved, and the expense costliness, and susceptibility is low, makes it be difficult to become the non-invasive methods for prenatal diagnosis of clinical practice.
2. maternal blood isolating fetal DNA: in recent years, have the scholar that the free fetal dna in female blood plasma is greatly paid close attention to.This main enlightenment that has tumour to come source DNA to report according to discovery in tumour patient blood plasma and serum.There is the scholar to think and the bigger similarity of existence between placenta and malignant tumour placenta behavior partly is called " pseudo-pernicious ".Owing to do not need to have saved time and expense, for non-invasive prenatal diagnosis provides a kind of new way through loaded down with trivial details DNA extraction process.Though fetus dissociative DNA is abundant than fetus intact cell content in pregnant woman's blood, its absolute magnitude is pettiness extremely still, needs highstrung method could obtain reliable and stable detected result.Yet it no longer is the factor of restriction prenatal gene diagnosis that the development of round pcr makes the foetal DNA of trace.In recent years report is used for the round pcr of prenatal gene diagnosis, and sleeve type PCR method, primer extension increase in advance (PEP)-PCR method and real time fluorescent quantitative (QF)-PCR method or the like are arranged.Because maternal blood isolating fetal DNA method is without loaded down with trivial details nucleus DNA leaching process, therefore obviously shorten detection time, save testing cost and blood sampling volume and also reduce to 2ml, can obtain the template amount (each 4 μ l) of enough pcr amplifications, provide the good premise condition for the non-invasive prenatal gene diagnosis enters clinical application.But still there is the extraction of two main problem: 1.DNA in above-mentioned detection method and detects still to be needed further to simplify, and especially to the detection of women tire DNA, needs 3～5 sites at least with the STRs analysis, expends height, still need explore a kind of accurate cheap detecting method.2.PCR technology built-in problem.Owing to problems such as the pollution that may have DNA, allelotrope dropouts, so false positive or false negative can occur by pcr amplification.
Summary of the invention
A technical problem to be solved by this invention provides the compound chip of the antenatal quick diagnosis of a kind of PKU of being used for, adopts this compound chip, can realize the antenatal quick diagnosis of genetic diseases.
Another technical problem to be solved by this invention provides the method for the antenatal quick diagnosis of a kind of PKU of being used for.
In order to solve the problems of the technologies described above, the present invention has adopted following technical scheme:
A kind of compound chip that is used for the antenatal quick diagnosis of PKU comprises DNA chip, micro-fluidic chip; Described DNA chip is fixed on the glass-chip by some kinds of different point mutation PKU specific diagnosis gene probes and forms, described some kinds of different point mutation PKU specific diagnosis gene probes form the gene probe district, described micro-fluidic chip comprises flushing liquid pool, washing liquid pool, sample pool, reaction zone, waste liquid pool, and reaction zone is communicated with flushing liquid pool, washing liquid pool, sample pool, waste liquid pool by fluid passage respectively; Described point mutation PKU specific diagnosis gene probe all is fixed on the one side of glass-chip, and the one side that micro-fluidic chip has passage is that docking point dock and automatic absorption cement with reaction zone with the gene probe district with the one side that glass-chip has point mutation PKU specific diagnosis gene probe.
Described point mutation PKU specific diagnosis gene probe is five kinds of different point mutation PKU specific diagnosis gene probes.
A kind of method that is used for the antenatal quick diagnosis of PKU, it may further comprise the steps, step 1: the DNA in extracting pregnant woman blood plasma and the white corpuscle, increase and its primer reacted and obtain sample the exon genes of DNA;
Step 2: in the sample pool of compound chip, flushing liquid pool, washing liquid pool, add sample, washing fluid and washings respectively;
Step 3: the ready compound chip of step 2 is carried out taking out after centrifugal treating 1-2 minute;
Step 4: the micro-fluidic chip on the glass-chip opened discard, place glass-chip the situation of DNA chip scanner check sample and reaction zone and the result of observation sample and reaction zone reaction to get final product.
In step 1, adopt PCR method that the exon genes of DNA is increased and its primer is reacted.
In step 1, adopt PCR method that 3,6,7,11,12 5 exon genes of DNA are increased and its primer is reacted.
In step 3, the ready compound chip of step 2 is positioned on the whizzer and takes out after 1.5 minutes with default speed centrifugal treating.
The present invention is owing to adopted said structure and method, multiple common point mutation PKU specific diagnosis gene probe is fixed on the glass-chip, and the one side that micro-fluidic chip has passage is that docking point dock and automatic absorption cement with reaction zone with the gene probe district with the one side that glass-chip has point mutation PKU specific diagnosis gene probe.Adopt the DNA in extracting pregnant woman blood plasma and the white corpuscle to make test sample, utilize micro-fluidic chip reagent dosage pettiness and characteristics such as controlled, finish sample and reagent adding and the operation steps such as mixing on the DNA chip by action of centrifugal force simultaneously, so the utility model can foreshorten to hybridization time in 15 minutes, thereby can overcome the long and false-negative unfavorable factor of DNA array chip hybridization time, realize the antenatal quick diagnosis of PKU.
After the detailed description of reading embodiments of the present invention in conjunction with the accompanying drawings, it is clearer that characteristics of the present invention and advantage will become.
Description of drawings
Fig. 1 is the synoptic diagram of parts of compound chip of the antenatal quick diagnosis of a kind of PKU of being used for of the present invention.
Embodiment
The present invention is further detailed explanation with an embodiment below, but should illustrate that protection scope of the present invention is not limited only to this.
Consult Fig. 1.A kind of compound chip that is used for the antenatal quick diagnosis of PKU, comprise DNA chip, micro-fluidic chip, described DNA chip is fixed on the glass-chip 7 by some kinds of different point mutation PKU specific diagnosis gene probes (not shown) and forms, 5 kinds of common point mutation PKU specific diagnosis gene probes are for example arranged, and above-mentioned point mutation PKU specific diagnosis gene probe forms the gene probe district; Described micro-fluidic chip comprises flushing liquid pool 1, washing liquid pool 2, sample pool 3, reaction zone 5, waste liquid pool 6, and reaction zone 5 is communicated with flushing liquid pool 1, washing liquid pool 2, sample pool 3, waste liquid pool 6 by fluid passage 4 respectively; Described point mutation PKU specific diagnosis gene probe all is fixed on the one side of glass-chip 7, and the one side that micro-fluidic chip has passage is that docking point dock and automatic absorption cement with reaction zone with the gene probe district with the one side that glass-chip 7 has point mutation PKU specific diagnosis gene probe.
In the present embodiment, common point mutation site as shown in Table 1, wherein, 5 kinds of common point mutation PKU specific diagnosis gene probes are to make according to following point mutation site.
Table one:
| The mutational site | Outer exon | Emergent properties | Sequence capture probe |
| R11 1X | 3 | C→ T | CGAGATAAGAAGAAAGACACA |
| Y20 4C | 6 | A→ G | GACGTTTCTCAATTCCTGCAG |
| R24 3Q | 7 | G→ A | AGCCCATGTATACCCCCGAA |
| Y35 6X | 11 | G→ A | TACTGCTTATCAGAGAAGCCAAAG |
| R41 3P | 12 | G→ C | ATTTTGGCTGATTCCATTAAC |
A kind of method that is used for the antenatal quick diagnosis of PKU, it may further comprise the steps.Step 1: with phenol by classics
DNA in chloroform method extracting pregnant woman blood plasma and the white corpuscle, adopt PCR method to DNA 3,6,7,11,12 5 exon genes increase and its primer reacted and obtains sample; Step 2: in the sample pool of compound chip, flushing liquid pool, washing liquid pool, add sample, washing fluid and washings respectively; Step 3: the ready compound chip of step 2 is positioned on the whizzer and carries out taking out after centrifugal treating 1-2 minute, as centrifugal treating 1. minutes with default speed; Step 4: the micro-fluidic chip on the glass-chip opened discard, place glass-chip the situation of DNA chip scanner check sample and chip reaction zone and the result of observation sample and reaction zone reaction to get final product.
Though described embodiments of the present invention in conjunction with the accompanying drawings; but those skilled in the art can make various distortion or modification within the scope of the appended claims; as long as be no more than the described protection domain of claim of the present invention, all should be within protection scope of the present invention.
Claims (6)
1, a kind of compound chip that is used for the antenatal quick diagnosis of PKU comprises DNA chip, micro-fluidic chip; Described DNA chip is fixed on the glass-chip by some kinds of different point mutation PKU specific diagnosis gene probes and forms, described some kinds of different point mutation PKU specific diagnosis gene probes form the gene probe district, described micro-fluidic chip comprises flushing liquid pool, washing liquid pool, sample pool, reaction zone, waste liquid pool, and reaction zone is communicated with flushing liquid pool, washing liquid pool, sample pool, waste liquid pool by fluid passage respectively; It is characterized in that: described point mutation PKU specific diagnosis gene probe all is fixed on the one side of glass-chip, and the one side that micro-fluidic chip has passage is that docking point dock and automatic absorption cement with reaction zone with the gene probe district with the one side that glass-chip has point mutation PKU specific diagnosis gene probe.
2, the compound chip that is used for the antenatal quick diagnosis of PKU according to claim 1 is characterized in that: described point mutation PKU specific diagnosis gene probe is five kinds of different point mutation PKU specific diagnosis gene probes.
3, a kind of method that is used for the antenatal quick diagnosis of PKU is characterized in that, may further comprise the steps:
Step 1: the DNA in extracting pregnant woman blood plasma and the white corpuscle, increase and its primer reacted and obtain sample the exon genes of DNA;
Step 2: in the sample pool of the described compound chip of claim 1, flushing liquid pool, washing liquid pool, add sample, washing fluid and washings respectively;
Step 3: the ready compound chip of step 2 is carried out taking out after centrifugal treating 1-2 minute;
Step 4: open and discard being positioned at micro-fluidic chip on the described glass-chip of claim 1, place glass-chip the situation of DNA chip scanner check sample and the described reaction zone of claim 1 and the result of observation sample and reaction zone reaction to get final product.
4, the method that is used for the antenatal quick diagnosis of PKU according to claim 3 is characterized in that: in step 1, adopt PCR method that the exon genes of DNA is increased and its primer is reacted.
5, the method that is used for the antenatal quick diagnosis of PKU according to claim 4 is characterized in that: in step 1, adopt PCR method that 3,6,7,11,12 5 exon genes of DNA are increased and its primer is reacted.
6, the method that is used for the antenatal quick diagnosis of PKU according to claim 3 is characterized in that: in step 3, the ready compound chip of step 2 is positioned on the whizzer and takes out after 1.5 minutes with default speed centrifugal treating.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100383578A CN101570787A (en) | 2009-04-01 | 2009-04-01 | Composite chip for rapid prenatal diagnosis of PKU and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2009100383578A CN101570787A (en) | 2009-04-01 | 2009-04-01 | Composite chip for rapid prenatal diagnosis of PKU and method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101570787A true CN101570787A (en) | 2009-11-04 |
Family
ID=41230272
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2009100383578A Pending CN101570787A (en) | 2009-04-01 | 2009-04-01 | Composite chip for rapid prenatal diagnosis of PKU and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101570787A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102608329A (en) * | 2012-03-08 | 2012-07-25 | 郭健 | Maternal amniotic fluid phenylalanine detection method for phenylketonuria (PKU) antenatal diagnosis |
| CN102728420A (en) * | 2011-04-13 | 2012-10-17 | 白向阳 | Heterogeneous inverted flow chip and preparation method thereof |
| CN104822357A (en) * | 2012-09-18 | 2015-08-05 | 辛温尼奥生物系统公司 | Spin elute tube |
-
2009
- 2009-04-01 CN CNA2009100383578A patent/CN101570787A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102728420A (en) * | 2011-04-13 | 2012-10-17 | 白向阳 | Heterogeneous inverted flow chip and preparation method thereof |
| CN102728420B (en) * | 2011-04-13 | 2014-07-02 | 白向阳 | Heterogeneous inverted flow chip and preparation method thereof |
| CN102608329A (en) * | 2012-03-08 | 2012-07-25 | 郭健 | Maternal amniotic fluid phenylalanine detection method for phenylketonuria (PKU) antenatal diagnosis |
| CN104822357A (en) * | 2012-09-18 | 2015-08-05 | 辛温尼奥生物系统公司 | Spin elute tube |
| CN104822357B (en) * | 2012-09-18 | 2018-04-03 | 珠海丽珠圣美医疗诊断技术有限公司 | Rotation elution pipe |
| US10130951B2 (en) | 2012-09-18 | 2018-11-20 | Cynvenio Biosystems, Inc. | Open-ended conical tube for recovering cells from a microfludic chip |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105695567B (en) | A kind of kit for detecting foetal chromosome aneuploidy, primer and probe sequence and detection method | |
| JP2004533243A (en) | Prenatal diagnostic methods for fetal cells in isolated maternal blood | |
| CN103555835B (en) | Primer and probe for screening spinal muscular atrophy (SMA) genes and using method of primer and probe | |
| US20120264628A1 (en) | Methods for Enriching Microparticles or Nucleic Acids in a Complex Mixture Using Size Exclusion Filtration | |
| CN109112209A (en) | Reference material for noninvasive antenatal detection fetal aneuploidy chromosome | |
| Sekizawa et al. | Improvement of fetal cell recovery from maternal blood: suitable density gradient for FACS separation | |
| CN104531842A (en) | Noninvasive fetus 21, 18 and 13 trisomic syndrome antenatal detection positive quality control product and preparing method thereof | |
| CN101570787A (en) | Composite chip for rapid prenatal diagnosis of PKU and method | |
| CN101724691B (en) | Method for quantitatively detecting methylation level of CD11a and CD70 genes | |
| CN104846087A (en) | Kit for male azoospermia diagnosis and use method | |
| CN105349641B (en) | Acute myocardial infarction AMI related gene SERPINB13 and its application | |
| Hamada et al. | Mid‐trimester fetal sex determination from maternal peripheral blood by fluorescence in situ hybridization without enrichment of fetal cells | |
| CN108004309A (en) | Detect primer, method and the kit of MTHFR677, MTHFR1298 and MTRR66 | |
| Kanda et al. | Practicability of prenatal testing using lectin‐based enrichment of fetal erythroblasts | |
| Al-Mufti et al. | Detection of fetal messenger ribonucleic acid in maternal blood to determine fetal RhD status as a strategy for noninvasive prenatal diagnosis | |
| CN105132572B (en) | A kind of patau syndrome kit of noninvasive Prenatal Screening 21 | |
| CN109735612A (en) | The biomolecule marker and its kit of Kawasaki disease coronary aneurysm complication | |
| CN111944893B (en) | MiRNA molecular marker related to prenatal noninvasive diagnosis of cleft lip and palate and application thereof | |
| CN114703272A (en) | Screening or early diagnosis kit for pregnant women with high risk of gestational diabetes mellitus | |
| Nagy et al. | Use of routinely collected amniotic fluid for whole-genome expression analysis of polygenic disorders | |
| CN201376967Y (en) | Composite chip used for rapid prenatal diagnosis of PKU(phenylketonuria) | |
| CN108802354B (en) | Urine detection method | |
| CN112376115A (en) | Method for detecting different diseases by using single cell transcriptome sequencing technology | |
| Bianchi | Progress in the genetic analysis of fetal cells circulating in maternal blood | |
| JP6023916B2 (en) | Non-invasive prenatal diagnostic method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20091104 |