CN101560547A - Method for screening aminoglycoside-induced deafness and disability of individual - Google Patents
Method for screening aminoglycoside-induced deafness and disability of individual Download PDFInfo
- Publication number
- CN101560547A CN101560547A CNA2008100403187A CN200810040318A CN101560547A CN 101560547 A CN101560547 A CN 101560547A CN A2008100403187 A CNA2008100403187 A CN A2008100403187A CN 200810040318 A CN200810040318 A CN 200810040318A CN 101560547 A CN101560547 A CN 101560547A
- Authority
- CN
- China
- Prior art keywords
- pcr
- primer
- result
- sites
- reaction system
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for screening aminoglycoside-induced deafness and disability of an individual, which is characterized by comprising the following steps: using a sampling swab for scraping up and down for at least 40-60 times on the left cheek and the right cheek in the oral cavity of a measured person so as to collect enough cell samples; extracting genomic DNA; detecting the mutations of maternal mitochondrial deafness-related genes of A1555G, U1494A, T1095C and 961del T/insC; and evaluating the susceptibility of the individual to the aminoglycoside-induced deafness by simultaneously detecting and analyzing the gene carrying types at sites of 1555, 1494, 1095 and 961 SNP on an MT RNRI gene of the individual. The method has the advantage of being used for evaluating the susceptibility of the individual to the drug-induced deafness caused by aminoglycoside antibiotics.
Description
Technical field
The present invention relates to a kind of method that is used for screening aminoglycoside-induced deafness and disability of individual, by on the MTRNR1 gene of while check and analysis individuality the 1555th, 1494,1095,961SNP locus gene portable is assessed individual susceptibility to the aminoglycoside medicaments induced deafness, belongs to technical field of molecular biology.
Background technology
Drug induced deafness is meant the auditory dysesthesia that uses some drugs caused acoustic nerve system's toxic lesion and produce, dizzy even complete deafness.
People have the history of nearly half a century, but still do not have final conclusion at present aminoglycoside antibiotics ototoxicity Study on Mechanism.That relatively generally acknowledges in recent years has two kinds of viewpoints, inner ear metabolic disturbance and a mitochondrial gene mutation.
1. inner ear metabolic disturbance
Aminoglycoside medicaments can be directly and the permeability that has destroyed film after the mucopolysaccharide of cytolemma of hair cell and phospholipid in the ear combine, and particularly intracellular plastosome causes the disorder of carbohydrate metabolism and protein metabolism, causes cytopathy with dead.Aminoglycoside medicaments has lowered the plurality of enzymes activity simultaneously, as ATP enzyme, lysosomal enzyme and desaminase, causes the disorder of inner ear physiological function, and particle environment disorder in the cell causes the sensory cell damage.And the existence of blood one lost barrier causes the savings of medicine in interior ear fluid and inner ear tissue to make inner ear sensory cell poisoning sex change.Aminoglycoside antibiotics is a voltage-dependent to the blocking-up of ionic channel, is acute, reversible but just can irreversibly blocks intracellular signal transduction path (PIP2) after by metabolism, causes the death of external hair cell.
2. mitochondrial gene mutation
The aminoglycoside antibiotics ototoxicity is the modal reason of the acquired deafness day after tomorrow, and hearing loss has shown the characteristics of matrilinear inheritance.A large amount of different individualities that studies show that have very big difference to the reaction of this medicine ear toxic action, not only heavy dose of, long medication can cause the infringement of cochlea one vestibular, patient promptly suffers from AAID (aminoglycoside antibiotic induceddeafness behind this type of microbiotic of short-term use routine dose, AAID), in addition low dose of single medication also can cause deafness.Some scholars have also reported family's clustering phenomena of AAID, and this shows that some individuality has familial inheritance to the higher susceptibility of this class microbiotic, and there is genetic predisposition in prompting.
A large amount of evidences are provided to this genetic predisposition further investigation over nearly 40 years.Robinson in 1964 has reported that at first tuberculosis pregnant woman causes the deafness of fetus after the treatment of aminoglycoside antibiotics chain enzyme.The tool aminoglycoside ear poison that Konigsmark etc. found great majority in 1976 causes the data of deaf family and sums up, and thinks that the ototoxic genetic predisposition of aminoglycoside antibiotics may belong to the multifactor proterties of the autosomal dominant inheritance of matrilinear inheritance and companion's incomplete penetrance.1988, Wallen etc. reported the first human diseases that is caused by Mitochondrial DNA (mtDNA) sudden change, and clear and definite mtDNA sudden change can cause human diseases, proposes the mitochondriopathy notion first.After Higashi had looked back relevant document in 1989, proposing the most probable explanation of matrilinear inheritance was the Mitochondrial DNA defective.Prezant in 1993 etc. have reported three Chinese familys, and the toxicity deafness takes place after using aminoglycoside antibiotics several members, all confirm to present 1555 bases A → G sudden change of the chondriogen mtDNA12SrRNA of matrilinear inheritance in three familys.Subsequently, also there are the family report in Africa, Spain, Japan, Mongolia, South America, Israel.At China, Japan, the Mongolian report that also has some Sporadic cases, these Sporadic cases do not have family history, all toxic deafness and mtDNA A1555G sudden change.
Chinese scholar Zhao H has set up six people's cell strain (four individuality and four irrelevant lymphocyte series contrasts that have symptom to carry C1494T sudden change and two the asymptomatic C1494T of carrying sudden changes) from family of China.Cell strain is exposed in the paromycin or Xin Meisu of high density, observes the remarkable decline of oxygen-consumption speed in the clone of sudden change, therefore, the a-quadrant that data are supported in plastosome 12S rRNA is that aminoglycoside medicaments causes deaf important target spot.Show also simultaneously that the C1494T sudden change is relevant with the toxicity of aminoglycoside medicaments.
Zhao, L etc. have reported three hearing losss that caused by aminoglycoside and the case of non-syndromes hearing loss, and all there is the T-to-C sudden change in these three cases in 1095 base positions, do not have the T1095C sudden change in 364 hearing normal Chinese group control groups.And this sudden change also has checking in the family of the hearing nerve injury that Italy is caused by aminoglycoside.
Marianne etc. have shown to adopt the full genome chip of people mtDNA that the French family of 1350 asymptomatic phonosensitive nerve deafness is analyzed in " European human genetics magazine " 15 curly hair in 2007, and wherein 29 extended familys advance to have clear and definite and matrilinear inheritance characteristics.Analyze the AAID related data and show in the plastosome 12SrRNA gene that except that A1555G, C1494T and 961insC sudden change, delT961, T961G, A827G sudden change also can cause body to the ototoxic height susceptibility of aminoglycoside antibiotics.
The big family of matrilinear inheritance induced deafness be studies show that, mitochondrial DNA 12SrRNA gene A 1555G transgenation causes deaf relevant with familial, research at present thinks that plastosome 12SrRNA gene is to cause the hypersusceptible transgenation hotspot location of aminoglycoside antibiotics ototoxicity.The A1555G of 12SrRNA, C1494T, T1095C, 961insC sudden change drug induced deafness deaf with the non-syndrome type and that aminoglycoside antibiotics causes is closely related.
Summary of the invention
The purpose of this invention is to provide a kind of method that is used for screening aminoglycoside-induced deafness and disability of individual that can be used for assessing the individual drug induced deafness susceptibility that aminoglycoside antibiotics is caused.
For realizing above purpose, technical scheme of the present invention provides a kind of method that is used for screening aminoglycoside-induced deafness and disability of individual, it is characterized in that, its method is:
Assurance collects the cell sample of capacity;
The method for extracting of step 2. genomic dna:
Adopt the genomic dna of silica gel adsorption extraction steps 1 measured's mouth epithelial cells sample, the extracting time is 2-3 hour, be total to 2 samples of extracting, adopt the running gel imaging method that genomic dna concentration and purity are detected, macroscopic clear white ribbon can judge that the DNA of acquisition can enter next step detection;
Step 3. gene type
Each measured's sample is put into 2 reacting holes respectively, 1 reacting hole detects 961,1095 sites, another 1 reacting hole detects 1494,1555 sites, and the gene type employing fluorescent quantitative PCR technique that each reacting hole is surveyed 2 sites respectively increases, gel electrophoresis technology detects purity, sequencing technologies carries out genotype to these sites and determines:
3-1, the reaction system configuration
Adding reagent in each reacting hole is the quantitative fluorescent PCR reaction system, the primer concentration of standard reaction system is 10uM, the reaction system cumulative volume is 20ul, wherein QPCR MIX is PCR quantitative reagent 5ul, each 0.4ul of forward primer and reverse primer, the dna profiling 3 μ l of 20ng/ μ l, deionized water 11.2ul;
Detect the Mitochondrial DNA 611-1411 forward and the reverse primer in 961,1095 sites:
Forward primer: CTCCTCAAAGCAATACACTG
Reverse primer: TGCTAAATCCACCTTCGAGC
Detect the Mitochondrial DNA 1245-2007 forward and the reverse primer in 1494,1555 sites:
Forward primer: CGATCAACCTAACCACCTCT
Reverse primer: TGGACAACCAGCTATCACCA
3-2, the PCR reaction conditions
2 reacting holes are reacted on ABI9700 type pcr amplification instrument, and reaction conditions is 95 ℃ of preheatings 15 minutes; Carry out 95 ℃ of 35 round-robin, 45 seconds again; 60 ℃, 45 seconds; 72 ℃, 60 seconds; Be cooled to 4 ℃ after 72 ℃, 7 minutes;
3-3, carry out electrophoresis detection with 2 reacting holes at the reacted product of pcr amplification instrument:
A.1% sepharose is inserted small size hole comb;
B.2000bp DNA marker is dna marker thing: 6ul
C.PCR product: 4ul+ electrophoretic buffer r:1ul
D. electrophoretic voltage: 120v
E. electrophoresis time: 20min takes an electrophorogram; 30min takes an electrophorogram
7 sample PCR after products, the electrophoresis result figure of 25ng/ul is about purpose band 800bp;
The electrophoresis result figure of 7 sample PCR after products is:
3-4, purifying
Final concentration: PCR product purification reagent 0.2U SAP+PCR product purification reagent 2.5U EXON1/7ul; Add reaction system in each reacting hole, the reaction system cumulative volume is 7ul, deionized water ddH2O3.825ul, PCR product purification reagent SAP 0.05ul, PCR product purification reagent E XON10.125ul, PCR product 3ul; Reaction conditions is: 37 ℃, 60min; 80 ℃, 15min; 4 ℃ of constant temperature are preserved;
3-5 checks order each reacting hole behind the purifying, and primer concentration is 1uM, device A BI 3730 sequenators;
3-5-1 takes out PCR purified product, sequencing reagent MIX, order-checking damping fluid seq buffer, 1uM primer, sequencing primer: GCGTTTGGTCCTAGCCTTTC from-20 degree refrigerators;
3-5-2, PCR purified product name, the primer, reaction system, MIX consumption, the PCR reaction conditions of record date, the reaction of doing;
3-5-3 gets a deblocking reaction plate, table top plate name, primer name, date;
3-5-4, each sample need be done two PCR reactions, with two reacting holes, one of them adds first group of primer, detect the Mitochondrial DNA 611-1411 forward and the reverse primer in 961,1095 sites, another adds another group primer, detects the Mitochondrial DNA 1245-2007 forward and the reverse primer in 1494,1555 sites;
3-5-5, add reaction system in each reacting hole, reaction system is the PCR purified product, the deionized water ddH2O of 0.1ul of sequencing primer 1uM primer, 3ul of order-checking damping fluid sequence buffer, 2ul of sequencing reagent mix3.1, the 1.4ul of 0.5ul; After the system branch installed, last whizzer reached 900 rev/mins and promptly stops;
3-5-6 is placed on Sptting plate on the ABI9700 type pcr amplification instrument and reacts, and reaction conditions is 96 ℃ of preheatings 10 seconds; Carry out 96 ℃ of 25 round-robin, 10 seconds again; 50 ℃, 5 seconds; 60 ℃, 4 minutes; Being cooled to 4 ℃ of constant temperature after 60 ℃, 4 minutes preserves;
3-5-7 after amplification finishes, adds 1ul 125mM edta edta in every hole;
3-5-8 adds 100% ethanol 15ul again and precipitates in room temperature in every hole, must not be above 24 hours;
3-5-9 puts into refrigerated centrifuge with 96 orifice plates, and 3650 rev/mins, 4 ℃ centrifugal 30 minutes;
3-5-10 removes supernatant liquor gently, 96 orifice plates is caused centrifugal, and reaching 800 changes and promptly to stop, add 30ul70% ethanol in every hole again, 3650 rev/mins, 4 ℃ centrifugal 15 minutes, remove supernatant liquor gently, 96 orifice plates are caused centrifugal, reaching 800 changes and promptly to stop, and residual alcohol is air-dry, and room temperature was placed 20 minutes;
3-5-11, every hole adds 95% methane amide of 8ul, 5%ddH2O;
3-5-12 carries out the result and reads on ABI 3730, consult the order-checking detected result with online free download software Chromas: 4 positions of each measured have 4 results respectively;
By 5000-10000 measured's detection, summarize: the experiment of 961 positions has 3 kinds of results, and promptly normal result, T deletion mutantion result and C insert the sudden change result; The experiment of 1095 positions has 2 kinds of results, promptly normal result and sudden change result; The experiment of 1494 positions has 2 kinds of results, promptly normal result and sudden change result; The experiment of 1555 positions has 2 kinds of results, promptly normal result and sudden change result;
The result of 4 positions of each measured draws check and analysis:
1, do not detect sudden change:
Do not find to carry above site mutation in your detected result;
2. detect sudden change:
You ban use of aminoglycoside medicaments strong suggestion under physician guidance.
The present invention is to maternal chondriosome deafness genes involved A1555G, C1494T, T1095C, 961del T/insC sudden change detects, the design of corresponding site Auele Specific Primer and the experimental program, reagent and the report preparing system that are used for fluorescence quantitative PCR detection are by on the MTRNR1 gene of while check and analysis individuality the 1555th, 1494,1095,961SNP locus gene portable is assessed individual susceptibility to the aminoglycoside medicaments induced deafness.
The type of gathering sample is an oral mucosa epithelial cell, adopts this method, has and does not have wound, the advantage convenient, simple to operate of drawing materials.It is few that the genomic dna of employing silica gel adsorption extracting mouth epithelial cells has required sample size, extracting steady quality, extract product purity height, characteristics easy and simple to handle.
Utilize the present invention that the detected result that surpasses the above Chinese population sample of 100 examples is shown that 4 locus gene somatotypes detection recall rates such as MTRNR1 A1555G of carrying out according to aforesaid method can reach more than 99%, reproducibility of results reaches 100%.Simultaneously, detect data and conform to substantially, this detection method is described accurately and reliably with the Chinese population gene frequency of report.
Advantage of the present invention is to can be used for assessing the individual drug induced deafness susceptibility that aminoglycoside antibiotics is caused.
Description of drawings
Fig. 1 is the electrophoresis result figure of 7 sample PCR after products
Fig. 2 is that normal result schematic diagram is tested in 961 positions;
Fig. 3 is 961 a positions experiment T deletion mutantion result schematic diagram;
Fig. 4 is that 961 positions experiment C inserts the sudden change result schematic diagram;
Fig. 5 is that normal result schematic diagram is tested in 1095 positions;
Fig. 6 is 1095 a positions experiment sudden change result schematic diagram;
Fig. 7 is that normal result schematic diagram is tested in 1494 positions;
Fig. 8 is 1494 a positions experiment sudden change result schematic diagram;
Fig. 9 is that normal result schematic diagram is tested in 1555 positions;
Figure 10 is 1555 a positions experiment sudden change result schematic diagram;
Figure 11 is positioned at 961 positions experiment sudden change result schematic diagram for the embodiment measured;
Figure 12 is an embodiment measured examining report synoptic diagram.
Embodiment
The invention will be further described below in conjunction with drawings and Examples.
Embodiment
The person under inspection after doctor or genetic counseling personnel detect relevant information, fill in sign detect please be singly in relevant and detection inform book, as following table
Cellular elements genetics detects request slip
The connection odd numbers:
The doctor explains to detect to the person under inspection and informs book:
By with the exchanging of genetic counseling professional, I understand fully and approve of following content:
1. this detection will adopt order-checking to detect the genovariation situation relevant with test item with polymorphic typing method for I (my child).
2. if I have needs, the genetic counseling professional can continue as me relevant genetic counseling is provided after detection.
3. do not detect the genovariation that increases disease risks and can not get rid of the possibility that other undiscovered variations or environmental factors cause disease fully.
4. this detection just detects at the relevant genovariation situation of particular detection project, does not relate to the genovariation situation relevant with other diseases.
5. along with the continuous development of science, the genovariation situation relevant with test item may be upgraded.
6. in some family, detected result may be found some unrelated relations, as adopts relation etc.
7. the equipment that detect to adopt all is at present most advanced and reliable, still still can not get rid of fully not detect the minimising possibilities incident generation that result or result make mistakes.
8. inspection center will try one's best and provide detected result at the appointed time, but the not deferred liabilities to causing because of vis major.
9. the detected result of I (my child) will be given the genetic counseling professional and be explained the correlation detection result to me.
10. if the sample of I (my child) causes obtaining enough DNA because of a variety of causes, perhaps detect relevant information and do not fill in completely, the personnel of inspection center can get in touch with me by the contact method that I fill in.
11. inspection center will maintain secrecy to the personal information of I (my child) and the privacy that detection information is carried out strictness.Under situation without permission, except that specifying the genetic counseling professional, can not give any other entity and individual with these information leakage.
Through _ _ _ _ _ _ _ _ _ _ _ _ _ explanation of (genetic counseling professional name), I have read and have understood above-mentioned literal, do not have any misunderstanding and ambiguity.
Person under inspection's signature:
Date
A kind of method that is used for screening aminoglycoside-induced deafness and disability of individual is:
The method for extracting of step 2. genomic dna:
Adopt the genomic dna of silica gel adsorption extraction steps 1 measured's mouth epithelial cells sample, the extracting time is 2-3 hour, be total to 2 samples of extracting, adopt the running gel imaging method that genomic dna concentration and purity are detected, macroscopic clear white ribbon can judge that the DNA of acquisition can enter next step detection;
Step 3. gene type
Each measured's sample is put into 2 reacting holes respectively, 1 reacting hole detects 961,1095 sites, another 1 reacting hole detects 1494,1555 sites, and the gene type employing fluorescent quantitative PCR technique that each reacting hole is surveyed 2 sites respectively increases, gel electrophoresis technology detects purity, sequencing technologies carries out genotype to these sites and determines:
3-1, the reaction system configuration
Adding reagent in each reacting hole is the quantitative fluorescent PCR reaction system, the primer concentration of standard reaction system is 10uM, the reaction system cumulative volume is 20ul, wherein QPCR MIX is PCR quantitative reagent 5ul, each 0.4ul of forward primer and reverse primer, the dna profiling 3 μ l of 20ng/ μ l, deionized water 11.2ul;
Detect the Mitochondrial DNA 611-1411 forward and the reverse primer in 961,1095 sites:
Forward primer: CTCCTCAAAGCAATACACTG
Reverse primer: TGCTAAATCCACCTTCGAGC
Detect the Mitochondrial DNA 1245-2007 forward and the reverse primer in 1494,1555 sites:
Forward primer: CGATCAACCTAACCACCTCT
Reverse primer: TGGACAACCAGCTATCACCA
3-2, the PCR reaction conditions
2 reacting holes are reacted on ABI9700 type pcr amplification instrument, and reaction conditions is 95 ℃ of preheatings 15 minutes; Carry out 95 ℃ of 35 round-robin, 45 seconds again; 60 ℃, 45 seconds; 72 ℃, 60 seconds; Be cooled to 4 ℃ after 72 ℃, 7 minutes;
3-3, carry out electrophoresis detection with 2 reacting holes at the reacted product of pcr amplification instrument:
A.1% sepharose is inserted small size hole comb;
B.2000bp DNA marker is dna marker thing: 6ul
C.PCR product: 4ul+ electrophoretic buffer r:1ul
D. electrophoretic voltage: 120v
E. electrophoresis time: 20min takes an electrophorogram; 30min takes an electrophorogram
7 sample PCR after products, the electrophoresis result figure of 25ng/ul is about purpose band 800bp;
The electrophoresis result figure of 7 sample PCR after products is:
3-4, purifying
Final concentration: PCR product purification reagent 0.2U SAP+PCR product purification reagent 2.5U EXON1/7ul; Add reaction system in each reacting hole, the reaction system cumulative volume is 7ul, deionized water ddH2O3.825ul, PCR product purification reagent SAP 0.05ul, PCR product purification reagent E XON10.125ul, PCR product 3ul; Reaction conditions is: 37 ℃, 60min; 80 ℃, 15min; 4 ℃ of constant temperature are preserved;
3-5 checks order each reacting hole behind the purifying, and primer concentration is 1uM, device A BI 3730 sequenators;
3-5-1 takes out PCR purified product, sequencing reagent MIX, order-checking damping fluid seq buffer, 1uM primer, sequencing primer: GCGTTTGGTCCTAGCCTTTC from-20 degree refrigerators;
3-5-2, PCR purified product name, the primer, reaction system, MIX consumption, the PCR reaction conditions of record date, the reaction of doing;
3-5-3 gets a deblocking reaction plate, table top plate name, primer name, date;
3-5-4, each sample need be done two PCR reactions, with two reacting holes, one of them adds first group of primer, detect the Mitochondrial DNA 611-1411 forward and the reverse primer in 961,1095 sites, another adds another group primer, detects the Mitochondrial DNA 1245-2007 forward and the reverse primer in 1494,1555 sites;
3-5-5, add reaction system in each reacting hole, reaction system is the PCR purified product, the deionized water ddH2O of 0.1ul of sequencing primer 1uM primer, 3ul of order-checking damping fluid sequence buffer, 2ul of sequencing reagent mix3.1, the 1.4ul of 0.5ul; After the system branch installed, last whizzer reached 900 rev/mins and promptly stops;
3-5-6 is placed on Sptting plate on the ABI9700 type pcr amplification instrument and reacts, and reaction conditions is 96 ℃ of preheatings 10 seconds; Carry out 96 ℃ of 25 round-robin, 10 seconds again; 50 ℃, 5 seconds; 60 ℃, 4 minutes; Being cooled to 4 ℃ of constant temperature after 60 ℃, 4 minutes preserves;
3-5-7 after amplification finishes, adds 1ul 125mM edta edta in every hole;
3-5-8 adds 100% ethanol 15ul again and precipitates in room temperature in every hole, must not be above 24 hours;
3-5-9 puts into refrigerated centrifuge with 96 orifice plates, and 3650 rev/mins, 4 ℃ centrifugal 30 minutes;
3-5-10 removes supernatant liquor gently, 96 orifice plates is caused centrifugal, and reaching 800 changes and promptly to stop, add 30ul70% ethanol in every hole again, 3650 rev/mins, 4 ℃ centrifugal 15 minutes, remove supernatant liquor gently, 96 orifice plates are caused centrifugal, reaching 800 changes and promptly to stop, and residual alcohol is air-dry, and room temperature was placed 20 minutes;
3-5-11, every hole adds 95% methane amide of 8ul, 5%ddH2O;
3-5-12 carries out the result and reads on ABI 3730, consult order-checking measured's the result of 4 positions with online free download software Chromas, and Figure 11 is positioned at the 961 positions experiment result schematic diagram of suddenling change for the embodiment measured;
By 5000-10000 measured's detection, the detected result of 4 positions of summarizing is:
The experiment of 961 positions has 3 kinds of results, and normal result schematic diagram as shown in Figure 2, T deletion mutantion result schematic diagram as shown in Figure 3 and C as shown in Figure 4 insert the sudden change result schematic diagram; The experiment of 1095 positions has 2 kinds of results, normal result schematic diagram as shown in Figure 5 and sudden change result schematic diagram as shown in Figure 6; The experiment of 1494 positions has 2 kinds of results, normal result schematic diagram as shown in Figure 7 and sudden change result schematic diagram as shown in Figure 8; The experiment of 1555 positions has 2 kinds of results, normal result schematic diagram as shown in Figure 9 and sudden change result schematic diagram as shown in figure 10;
Your 961T disappearance/C inserts the site detected result and is Del T sudden change.You ban use of aminoglycoside medicaments strong suggestion under physician guidance.
It is a variety of to cause the deaf cause of disease to have, and wherein the caused deafness of drug intoxication accounts for more than 60%, and wherein aminoglycoside antibiotics causes the deaf medicine that accounts for and causes about 97% of deafness.Present scientific research finds that above detection site can explain that the aminoglycoside antibiotics of 20%-25% causes deaf phenomenon in the Chinese population.
Claims (1)
1. a method that is used for screening aminoglycoside-induced deafness and disability of individual is characterized in that, its method is:
Step 1, wipe away in a measured oral cavity with sampling about two cheeks need each to scrape 40-60 time up and down at least, collect the cell sample of capacity with assurance;
The method for extracting of step 2. genomic dna:
Adopt the genomic dna of silica gel adsorption extraction steps 1 measured's mouth epithelial cells sample, the extracting time is 2-3 hour, be total to 2 samples of extracting, adopt the running gel imaging method that genomic dna concentration and purity are detected, macroscopic clear white ribbon can judge that the DNA of acquisition can enter next step detection;
Step 3. gene type
Each measured's sample is put into 2 reacting holes respectively, 1 reacting hole detects 961,1095 sites, another 1 reacting hole detects 1494,1555 sites, and the gene type employing fluorescent quantitative PCR technique that each reacting hole is surveyed 2 sites respectively increases, gel electrophoresis technology detects purity, sequencing technologies carries out genotype to these sites and determines:
3-1, the reaction system configuration
Adding reagent in each reacting hole is the quantitative fluorescent PCR reaction system, the primer concentration of standard reaction system is 10uM, the reaction system cumulative volume is 20ul, wherein QPCR MIX is PCR quantitative reagent 5ul, each 0.4ul of forward primer and reverse primer, the dna profiling 3 μ l of 20ng/ μ l, deionized water 11.2ul;
Detect the Mitochondrial DNA 611-1411 forward and the reverse primer in 961,1095 sites:
Forward primer: CTCCTCAAAGCAATACACTG
Reverse primer: TGCTAAATCCACCTTCGAGC
Detect the Mitochondrial DNA 1245-2007 forward and the reverse primer in 1494,1555 sites:
Forward primer: CGATCAACCTAACCACCTCT
Reverse primer: TGGACAACCAGCTATCACCA
3-2, the PCR reaction conditions
2 reacting holes are reacted on ABI9700 type pcr amplification instrument, and reaction conditions is 95 ℃ of preheatings 15 minutes; Carry out 95 ℃ of 35 round-robin, 45 seconds again; 60 ℃, 45 seconds; 72 ℃, 60 seconds; Be cooled to 4 ℃ after 72 ℃, 7 minutes;
3-3, carry out electrophoresis detection with 2 reacting holes at the reacted product of pcr amplification instrument:
A.1% sepharose is inserted small size hole comb;
B.2000bp DNA marker is dna marker thing: 6ul
C.PCR product: 4ul+ electrophoretic buffer r:1ul
D. electrophoretic voltage: 120v
E. electrophoresis time: 20min takes an electrophorogram; 30min takes an electrophorogram
7 sample PCR after products, the electrophoresis result figure of 25ng/ul is about purpose band 800bp;
The electrophoresis result figure of 7 sample PCR after products is:
3-4, purifying
Final concentration: PCR product purification reagent 0.2U SAP+PCR product purification reagent 2.5U EXON1/7ul;
Add reaction system in each reacting hole, the reaction system cumulative volume is 7ul, deionized water ddH2O3.825ul, PCR product purification reagent SAP 0.05ul, PCR product purification reagent E XON10.125ul, PCR product 3ul; Reaction conditions is: 37 ℃, 60min; 80 ℃, 15min; 4 ℃ of constant temperature are preserved;
3-5 checks order each reacting hole behind the purifying, and primer concentration is 1uM, device A BI 3730 sequenators;
3-5-1 takes out PCR purified product, sequencing reagent MIX, order-checking damping fluid seq buffer, 1uM primer, sequencing primer: GCGTTTGGTCCTAGCCTTTC from-20 degree refrigerators;
3-5-2, PCR purified product name, the primer, reaction system, MIX consumption, the PCR reaction conditions of record date, the reaction of doing;
3-5-3 gets a deblocking reaction plate, table top plate name, primer name, date;
3-5-4, each sample need be done two PCR reactions, with two reacting holes, one of them adds first group of primer, detect the Mitochondrial DNA 611-1411 forward and the reverse primer in 961,1095 sites, another adds another group primer, detects the Mitochondrial DNA 1245-2007 forward and the reverse primer in 1494,1555 sites;
3-5-5, add reaction system in each reacting hole, reaction system is the PCR purified product, the deionized water ddH2O of 0.1ul of sequencing primer 1uM primer, 3ul of order-checking damping fluid sequence buffer, 2ul of sequencing reagent mix3.1, the 1.4ul of 0.5ul; After the system branch installed, last whizzer reached 900 rev/mins and promptly stops;
3-5-6 is placed on Sptting plate on the ABI9700 type pcr amplification instrument and reacts, and reaction conditions is 96 ℃ of preheatings 10 seconds; Carry out 96 ℃ of 25 round-robin, 10 seconds again; 50 ℃, 5 seconds; 60 ℃, 4 minutes; Being cooled to 4 ℃ of constant temperature after 60 ℃, 4 minutes preserves;
3-5-7 after amplification finishes, adds 1ul 125mM edta edta in every hole;
3-5-8 adds 100% ethanol 15ul again and precipitates in room temperature in every hole, must not be above 24 hours;
3-5-9 puts into refrigerated centrifuge with 96 orifice plates, and 3650 rev/mins, 4 ℃ centrifugal 30 minutes;
3-5-10 removes supernatant liquor gently, 96 orifice plates is caused centrifugal, and reaching 800 changes and promptly to stop, add 30ul70% ethanol in every hole again, 3650 rev/mins, 4 ℃ centrifugal 15 minutes, remove supernatant liquor gently, 96 orifice plates are caused centrifugal, reaching 800 changes and promptly to stop, and residual alcohol is air-dry, and room temperature was placed 20 minutes;
3-5-11, every hole adds 95% methane amide of 8ul, 5%ddH2O;
3-5-12 carries out the result and reads on ABI 3730, consult the order-checking detected result with online free download software Chromas: 4 positions of each measured have 4 results respectively;
By 5000-10000 measured's detection, summarize: the experiment of 961 positions has 3 kinds of results, and promptly normal result, T deletion mutantion result and C insert the sudden change result; The experiment of 1095 positions has 2 kinds of results, promptly normal result and sudden change result; The experiment of 1494 positions has 2 kinds of results, promptly normal result and sudden change result; The experiment of 1555 positions has 2 kinds of results, promptly normal result and sudden change result;
Step 4, interpretation of result
According to the result of 4 positions of each measured, draw check and analysis and be:
1, do not detect sudden change:
Do not find to carry above site mutation in your detected result;
2. detect sudden change:
You ban use of aminoglycoside medicaments strong suggestion under physician guidance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100403187A CN101560547A (en) | 2008-07-08 | 2008-07-08 | Method for screening aminoglycoside-induced deafness and disability of individual |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100403187A CN101560547A (en) | 2008-07-08 | 2008-07-08 | Method for screening aminoglycoside-induced deafness and disability of individual |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101560547A true CN101560547A (en) | 2009-10-21 |
Family
ID=41219521
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100403187A Pending CN101560547A (en) | 2008-07-08 | 2008-07-08 | Method for screening aminoglycoside-induced deafness and disability of individual |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101560547A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531850A (en) * | 2014-12-10 | 2015-04-22 | 中生北控生物科技股份有限公司 | Kit for detecting SLC26A4 gene mutation and application of kit |
| CN104711366A (en) * | 2015-04-03 | 2015-06-17 | 济南英盛生物技术有限公司 | Drug-induced deafness gene multichannel fluorescence PCR (polymerase chain reaction) detection kit |
| CN105400874A (en) * | 2015-12-02 | 2016-03-16 | 深圳市宝安区妇幼保健院 | Method and kit for realizing sequencing-based typing of mitochondria 12S rRNA genome full-length sequence |
| CN105779591A (en) * | 2016-03-21 | 2016-07-20 | 李琦 | Kit for detecting human mitochondria 12SrRNA gene mutation and application thereof |
| CN106282335A (en) * | 2016-08-10 | 2017-01-04 | 四川金域医学检验中心有限公司 | A kind of detect the primer of juvenile's deaf inheritance risk, test kit, detection method |
| CN108588213A (en) * | 2018-05-02 | 2018-09-28 | 宁波美丽人生医药生物科技发展有限公司 | Aminoglycoside medicaments correlation 12s rRNA gene mutation site detection kits |
-
2008
- 2008-07-08 CN CNA2008100403187A patent/CN101560547A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531850A (en) * | 2014-12-10 | 2015-04-22 | 中生北控生物科技股份有限公司 | Kit for detecting SLC26A4 gene mutation and application of kit |
| CN104711366A (en) * | 2015-04-03 | 2015-06-17 | 济南英盛生物技术有限公司 | Drug-induced deafness gene multichannel fluorescence PCR (polymerase chain reaction) detection kit |
| CN105400874A (en) * | 2015-12-02 | 2016-03-16 | 深圳市宝安区妇幼保健院 | Method and kit for realizing sequencing-based typing of mitochondria 12S rRNA genome full-length sequence |
| CN105400874B (en) * | 2015-12-02 | 2018-08-21 | 深圳市宝安区妇幼保健院 | The method and kit of mitochondria 12S rRNA full-length genome sequence partings |
| CN105779591A (en) * | 2016-03-21 | 2016-07-20 | 李琦 | Kit for detecting human mitochondria 12SrRNA gene mutation and application thereof |
| CN106282335A (en) * | 2016-08-10 | 2017-01-04 | 四川金域医学检验中心有限公司 | A kind of detect the primer of juvenile's deaf inheritance risk, test kit, detection method |
| CN108588213A (en) * | 2018-05-02 | 2018-09-28 | 宁波美丽人生医药生物科技发展有限公司 | Aminoglycoside medicaments correlation 12s rRNA gene mutation site detection kits |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101560547A (en) | Method for screening aminoglycoside-induced deafness and disability of individual | |
| D’Elia et al. | African ancestry is associated with facial melasma in women: a cross-sectional study | |
| García-Cortés et al. | Drug-induced liver injury: a safety review | |
| CN102876794B (en) | Application of mononucleotide polymorphic rs6871626 in detection of susceptibility genes of lepriasis | |
| Kwak et al. | Clinical whole exome sequencing in early onset diabetes patients | |
| Koolen et al. | Koolen-de Vries syndrome | |
| Wu et al. | Preimplantation genetic diagnosis (embryo screening) for enlarged vestibular aqueduct due to SLC26A4 mutation | |
| Li et al. | Mutations in the HFE gene and sporadic amyotrophic lateral sclerosis risk: a meta-analysis of observational studies | |
| CN104694629A (en) | Kit for detecting hereditary deafness susceptibility gene mutation | |
| Yalın et al. | Fabry disease prevalence in renal replacement therapy in Turkey | |
| CN105940116A (en) | Method for screening risk of drug-induced toxicity | |
| Azevedo et al. | DNA methylation profile of genes related to immune response in generalized periodontitis | |
| CN107119113A (en) | Registration screening-gene marker detection method and its application before Noise Exposure workman hilllock | |
| Koolen et al. | Two families with sibling recurrence of the 17q21. 31 microdeletion syndrome due to low-grade mosaicism | |
| CN105506164A (en) | Kit for detecting susceptibility of hebephrenic schizophrenia | |
| Yin et al. | Genetic counseling and prenatal diagnosis for hereditary hearing loss in high-risk families | |
| CN101654702A (en) | Test method of KRAS gene mutation for screening and assessing therapeutic effects of molecular targeted agents | |
| CN106520987A (en) | Application of single nucleotide polymorphic rs3888722 in screening pemphigus foliaceus patients | |
| CN104862379A (en) | Detection kit for human leucocyte antigen genes | |
| CN107686861A (en) | ERBB2 R113Q mutators are used to prepare the application for judging mammary gland genetic susceptibility of cancer kit | |
| CN104059989A (en) | Detection method and kit for susceptible site rs231775 of type I diabetes | |
| Méndez-Rosado et al. | Avoiding a second amniocentesis to corroborate prenatal diagnosis by using refrigerated samples | |
| JP7374634B2 (en) | How to determine susceptibility to retinoid side effects | |
| CN111383713B (en) | ctDNA detection and analysis device and method | |
| CN105400874B (en) | The method and kit of mitochondria 12S rRNA full-length genome sequence partings |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20091021 |