CN101560472A - Novel cordyceps sinensis and method of artificial worm grass cultivation - Google Patents
Novel cordyceps sinensis and method of artificial worm grass cultivation Download PDFInfo
- Publication number
- CN101560472A CN101560472A CNA2008100923020A CN200810092302A CN101560472A CN 101560472 A CN101560472 A CN 101560472A CN A2008100923020 A CNA2008100923020 A CN A2008100923020A CN 200810092302 A CN200810092302 A CN 200810092302A CN 101560472 A CN101560472 A CN 101560472A
- Authority
- CN
- China
- Prior art keywords
- hirsutella
- fchc47
- jiang
- nov
- cordyceps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a bacterial strain which is separated from the worm grass collected in the Daqinggou scenic spot of the part of Changbai mountain, and the host is the bacterial strain of the oak silkworm pupa of antherea pernyi guerin-meneville. The invention also invents the method of worm grass cultivation on artificial medium. The invention has the advantages that a novel strain of cordyceps sinensis is separated out, and the novel strain is used for the cultivating method of artificially cultivating the fruit body and using the oak silkworm pupa as the host. The cultivating method is simple, the cultivating condition can be easily controlled, and the industrialized cultivation can be carried out. The invention provides a novel artificial-cultivated worm grass resource.
Description
Technical field
Biotechnology
Background technology
Chinese caterpillar fungus class fungi refers to be the class fungi that the host finishes its life history with live body or the corpse of insect.Kind surplus the whole world report Chinese caterpillar fungus existing 400, China reports nearly 120 kinds, accounts for 1/4th of the world total.Cordyceps Cordyceps (Fr.) Link. is a kind of battalion saproparasite.Cordyceps sinensis parasitizes the bat moth larvae, and behind infected this bacterium of this worm, the death of will falling ill grows stroma (Chinese caterpillar fungus) to certain time marquis from the polypide head.According to up-to-date classification of fungi system, Chinese caterpillar fungus class fungi is under the jurisdiction of Ascomycota (Ascomycota), gang pyrenomycetes (Pyrenomycetes), Hypocreales (Hypocreales), Clavicipitaceae (Clavicipitaceae).The Cordyceps sinensis anamorph of now having reported mainly contains Chinese caterpillar fungus stey (Hirsutella hepiti), China pilose spore (Hirsutella sinensis), peacilomyce hepiahi (Paecilomyces hepiali), China's Paecilomyces varioti (Paecilomycessinesis), bat moth mortierella (Mortierella hepiali), Chinese caterpillar fungus cephalo mould (Cephdosporiumsinensis), bat moth post mould (Scytalidium hepiale), the curved neck mould (Tolypocladium sinensis) of China, China's golden spore mould (Chrysosporium sinensis), grape ear mould (Stachybotrys) etc.The artificial culture of Chinese caterpillar fungus is a complex physical process extremely, and it is subjected to particular requirements such as kind, insect, climate, environment, and cultivation technique is subjected to following factor affecting.1, cultivation condition: Cordyceps is main to derive from host insect, and insect is main at present, and this insect of artificial propagation also has certain difficulty by wild collection, and it has restricted tame progress.2, bacterial classification: the cultivation of Chinese caterpillar fungus at first will have good pure strain, and the kind in the whole nation is a lot of at present, and the one, select the purity height, not have assorted bacterium, no aged bacterial classification; The 2nd, select infectivity strong, bacterial classification has stronger vitality, can infect the dead kind of falling ill rapidly to insect; The 3rd, select wide accommodation, particularly ambient moisture is changed the kind that certain resistivity will be arranged with other microbial contamination.3, planting type: a kind of is to utilize insect to cultivate and wild the same Chinese caterpillar fungus; Another kind is directly to cultivate sporophore with rice synthetic medium, PDA substratum or other solid medium.
Summary of the invention
The purpose of this invention is to provide a kind of bacterial strain Hirsutella beakdumountain X.L.Jiang, sp.nov.FCHC47, and utilize this bacterial strain to carry out the method for Chinese caterpillar fungus cultivation.
Strains separation involved in the present invention derives from the Chinese caterpillar fungus that gather Yu Mai smalt ditch landscaped area, Changbai Mountain from a strain, the host is the bacterial strain Hirsutellabeakdumountain X.L.Jiang of the cocoon chrysalis (Antherea pernyi Guerin-Meneville) of lepidopteran Saturniidae, sp.nov.FCHC47, depositary institution is called for short CCTCC, and preserving number is M 207152.Characteristics of the present invention are: isolate a strain Hirsutella beakdumountain X.L.Jiang first, the sp.nov.FCHC47 bacterial strain.According to microbial taxonomy, the fungus complete works, the result of fungi identification handbook, the morphological specificity and the 18S rDNA gene sequencing that the present invention relates to bacterial strain are accredited as Hirsutella beakdumountain X.L.Jiang, sp.nov.FCHC47.And invented it and on artificial medium, carried out the method for Chinese caterpillar fungus cultivation.The advantage of this invention is to isolate the novel Cordyceps of a strain and use that this bacterial classification carries out the artificial culture sporophore and be the cultivating method of host's Chinese caterpillar fungus with the cocoon chrysalis, cultivating method is simple, easy and the control of cultivation condition can be carried out the industrialization cultivation, provides a kind of novel artificial to cultivate worm grass resources.
Description of drawings
Fig. 1: artificial culture sporophore picture.
Fig. 2: cocoon chrysalis is cultivated the herb picture for the host.
Embodiment
Embodiment 1
1.Hirsutella beakdumountain X.L.Jiang, the separation and purification of sp.nov.FCHC47 bacterial strain:
Gather the Chinese caterpillar fungus of Yu Mai smalt ditch landscaped area, Changbai Mountain, the host is the cocoon chrysalis (Anthereapernyi Guerin-Meneville) of lepidopteran Saturniidae, downcut stroma from the bombys batryticatus body surface, use 0.1% mercuric chloride solution,, place to cut the sterile region tissue block and be pressed into substratum (potato 200g with sterile water wash surface soup, sucrose 20g, peptone 1g, yeast extract paste 3g, K
2HPO
41.5g, MgSO
40.5g, VB
1In right amount); Culture condition is 22-24 ℃, and incubation time is 7-10 days.When treating that asterism shape Chinese caterpillar fungus bacterium colony appears in media surface, the single bacterium colony of picking is put the test tube slant culture medium culturing.This bacterial strain is at substratum (potato 200g, sucrose 20g, peptone 1g, yeast extract paste 3g, K
2HPO
41.5g, MgSO
40.5g, VB
1Last 25 ℃ in right amount), 15 days colony diameter 2.2～3.0cm, positive brown is white extremely, the fine hair shape, the centre has radial projection; The back side is brown.Hyphae colorless, wide about 2.0～3.5 μ m.Conidium is transparent, do not have to separate, and avette or pseudovum shape is assembled agglomeratingly, and the outside is by mucus bag quilt, 2.7～4.2 * 6.3～9.9 μ m.Conidiophore, the doleiform length that upwards is tapered, the wideest diameter 3.4～5.5 μ m, length 38.4～59 μ m.The 18S rDNA gene sequencing result of this bacterial strain is:
GTTACTCCTAGGTAGGTGTGTTTTACGGCGTAACCGCCCTCCGCGCCTTTAGTGCAAGGTGTGTCTTAGTGCGAGGCTCTACTGCGTAGGGGAGGGCGCGGCGGGGTCGCTACTGCATTTCGGGGGCGGCGCGTTAGCTAGGTCCCCTAACGCTAGGCTCGCCCGCGCTGCGTGCGCGGCGGGGACCGCTTAAGGGTTAAAATAACGCTTAGACAAGCATGCCCGCTAGAGTGCTAGCGGGCGCAATGTGCGTTTTAAGATTCGATAATTCACTAAATTCTGCAATTTACATTACTTATTGCATTTCGCTGCGTTCTTTATTAATGCTAAAACTAAGAGATCCGTTGTTAAAAGTTTTAATTTATTCTGCCTGTGTTTAACTTAAAATGCTACTGCGATAGAGGGTTCTTAGTCCTCTAGCGAGCGCTAGGGCGGTCCCGCCGAGGCAACGCGTAGGGTACGGTTCGCATAGGGTTTAAAAGTCGGGAAACTTAGTAATAATCCCTCCGCTAGTTCACTAACGGAGACCTTGTTACGACTTTTACTTCCAAT
According to microbial taxonomy, the fungus complete works, the result of fungi identification handbook, the morphological specificity and the 18S rDNA gene sequencing that the present invention relates to bacterial strain are accredited as Hirsutella beakdumountain X.L.Jiang, sp.nov.FCHC47.
2. preparation bacterial classification:
With liquid nutrient medium (potato 200g, sucrose 20g, peptone 1g, yeast extract paste 3g, K
2HPO
41.5g, MgSO
40.5g, VB
1In right amount, preparation 1000ml) be sub-packed in the 500ml triangular flask, every bottle adds nutrient solution 200ml, sterilization back inoculation, and 24 ℃ of shake-flask culture 10 days obtain the cultivation bacterial classification.
3. Cordyceps sporophore artificial culture
Rice synthetic medium prescription: nutrient solution (sucrose 1%, K
2HPO
40.15%, MgSO
40.05%, dried silkworm chrysalis meal 1%, 1000ml), polished rice.
During configuration,, add the 45mL nutrient solution with the bottled 30g rice of 500ml can.The sterilization back is cool to 25 ℃, according to the inoculation of aseptic technique rules, puts into culturing room then and cultivates.Lucifuge was cultivated 10 days.When treating that mycelia is covered with the rice medium surface, adopt 21 ℃ of illumination cultivation, continue to cultivate 30-40 days.
4. gather: sporophore growth is to 5-7 centimetre, and complete gently gathering is air-dry or oven drying at low temperature after gathering.
Embodiment 2
1. preparation bacterial classification:
Hirsutella beakdumountain X.L.Jiang, the sp.nov.FCHC47 bacterial strain is inoculated in aseptic culture medium liquid nutrient medium (potato 200g, sucrose 20g, peptone 1g, yeast extract paste 3g, k after activation on the PDA substratum
2HPO
41.5g, MgSO
40.5g, VB
1In right amount, preparation 1000ml, be sub-packed in the 500ml triangular flask, every bottle adds nutrient solution 200ml, seals sterilization), 24 ℃ of shake-flask culture 10 days obtain to cultivate and use bacterial classification.
2. inoculation and cultivation:
To cultivate with bacterial classification and be injected in the fresh tussah silkworm chrysalis body by aseptic technique, every about 0.1ml of cocoon chrysalis inoculation puts into the 500ml glass jar with pupal cell after the inoculation, every bottle of 8 polypides, and polypropylene film seals.As for 22 ℃ of lucifuges 15 days, the pupal cell back of ossifing moved into culturing room, then as for 20 ℃ of illumination cultivation.1000Lux illumination every day 10 hours.Relative air humidity 85%～90%.Induce fruit body primordium to produce, cultivated 40-45 days.
3. gather: sporophore is produced to 6-8 centimetre, and complete gathering is air-dry or oven drying at low temperature after gathering, and obtains the Chinese caterpillar fungus complete stool.
Claims (4)
1, a kind of Cordyceps (Hirsutella beakdumountain X.L.Jiang, sp.nov.FCHC47), this bacterial classification carries out preservation by China typical culture collection center, depositary institution is called for short CCTCC, preserving number is M 207152.
2, with Hirsutella beakdumountain X.L.Jiang, the 18SrDNA nucleotide sequence of sp.nov.FCHC47 bacterial strain:
GTTACTCCTAGGTAGGTGTGTTTTACGGCGTAACCGCCCTCCGCGCCTTTAGTGCAAGGT
GTGTCTTAGTGCGAGGCTCTACTGCGTAGGGGAGGGCGCGGCGGGGTCGCTACTGCATT
TCGGGGGCGGCGCGTTAGCTAGGTCCCCTAACGCTAGGCTCGCCCGCGCTGCGTGCGCG
GCGGGGACCGCTTAAGGGTTAAAATAACGCTTAGACAAGCATGCCCGCTAGAGTGCTAG
CGGGCGCAATGTGCGTTTTAAGATTCGATAATTCACTAAATTCTGCAATTTACATTACTTA
TTGCATTTCGCTGCGTTCTTTATTAATGCTAAAACTAAGAGATCCGTTGTTAAAAGTTTTA
ATTTATTCTGCCTGTGTTTAACTTAAAATGCTACTGCGATAGAGGGTTCTTAGTCCTCTAG
CGAGCGCTAGGGCGGTCCCGCCGAGGCAACGCGTAGGGTACGGTTCGCATAGGGTTTA
AAAGTCGGGAAACTTAGTAATAATCCCTCCGCTAGTTCACTAACGGAGACCTTGTTACG
ACTTTTACTTCCAAT has 90% homology.
3, (Hirsutella beakdumountain X.L.Jiang sp.nov.FCHC47) is used for producing Cordyceps sporophore on rice synthetic medium prescription a kind of Cordyceps.(rice synthetic medium prescription: nutrient solution sucrose 1%, K
2HPO
40.15%, MgSO
40.05%, dried silkworm chrysalis meal 1% is made into mother liquor and makes an addition to polished rice, during configuration, with the bottled 30g rice of 500ml can, adds the 45mL mother liquor).
4, (Hirsutella beakdumountain X.L.Jiang sp.nov.FCHC47) is used for inoculating by spraying for the host at cocoon chrysalis a kind of Cordyceps, cultivates Chinese caterpillar fungus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100923020A CN101560472A (en) | 2008-04-14 | 2008-04-14 | Novel cordyceps sinensis and method of artificial worm grass cultivation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2008100923020A CN101560472A (en) | 2008-04-14 | 2008-04-14 | Novel cordyceps sinensis and method of artificial worm grass cultivation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101560472A true CN101560472A (en) | 2009-10-21 |
Family
ID=41219453
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2008100923020A Pending CN101560472A (en) | 2008-04-14 | 2008-04-14 | Novel cordyceps sinensis and method of artificial worm grass cultivation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101560472A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103098648A (en) * | 2013-01-30 | 2013-05-15 | 广东省微生物研究所 | Cordyceps ramose bacterial strains, cordyceps ramose bacterial strain sporocarps, and artificial cultivation method |
| CN103650910A (en) * | 2012-09-20 | 2014-03-26 | 乳源南岭好山好水冬虫夏草有限公司 | Cordyceps sinensis fruiting body and cultivating method thereof |
| CN103749149A (en) * | 2013-12-20 | 2014-04-30 | 凌中鑫 | Method for cultivating artificial worm grass with mealworm pupa as carrier |
-
2008
- 2008-04-14 CN CNA2008100923020A patent/CN101560472A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103650910A (en) * | 2012-09-20 | 2014-03-26 | 乳源南岭好山好水冬虫夏草有限公司 | Cordyceps sinensis fruiting body and cultivating method thereof |
| CN103650910B (en) * | 2012-09-20 | 2015-10-14 | 乳源南岭好山好水冬虫夏草有限公司 | A kind of cordyceps sporophore and cultivating method thereof |
| CN103098648A (en) * | 2013-01-30 | 2013-05-15 | 广东省微生物研究所 | Cordyceps ramose bacterial strains, cordyceps ramose bacterial strain sporocarps, and artificial cultivation method |
| CN103749149A (en) * | 2013-12-20 | 2014-04-30 | 凌中鑫 | Method for cultivating artificial worm grass with mealworm pupa as carrier |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103160442B (en) | Paecilomyceslilacinus strain having strong pathogenicity for diaphorina citri | |
| CN103430776A (en) | Silkworm pupa-worm grass culture method capable of improving yield and quality | |
| CN111662828B (en) | Metarhizium leylanicum and application thereof | |
| CN103270887B (en) | Silkworm chrysalis northern Chinese caterpillar Fungus industrial cultivation technique | |
| CN107988087B (en) | Blueberry endophytic fungus with growth promoting effect and application thereof | |
| CN1323157C (en) | Chinese caterpillar fungus bionic culturing method | |
| CN102388795A (en) | Method of producing worm grass lotus seeds by virtue of solid state fermentation of lotus seeds | |
| CN102792855A (en) | Cordyceps sinensis host infection strain material and method | |
| CN103122314B (en) | Isaria fumosoroseus and application thereof for preventing and treating bemisia tabaci | |
| CN101560472A (en) | Novel cordyceps sinensis and method of artificial worm grass cultivation | |
| CN106034738B (en) | A kind of method with silkworm pupa as host artificial culture silkworm chrysalis cicada fungus | |
| CN106010987B (en) | A kind of muscardine bacterial strain and its application to prominent back sugarcane rhinoceros cockchafer with pathogenicity | |
| CN104293677A (en) | Arthrobotrys oligospora genetic engineering strain with nematode-killing function, and application thereof | |
| CN113025505B (en) | Metarhizium lepigone and biological control method and application thereof in pupal stage of Spodoptera frugiperda | |
| CN110024623A (en) | L-PROLINE is improving the application in aweto blastopore quantity and hypha biomass | |
| CN104920066B (en) | The method for improving host of Cordyceps sinensis infection rate | |
| CN105670937B (en) | A kind of acquisition methods of Hirsutella sinensis bacterial strain | |
| CN105695390B (en) | A kind of bacteria residue culture promotees the conidiiferous method of Hirsutella sinensis | |
| CN103865801A (en) | Method for improving fruit body production rate of silkworm by virtue of Cordyceps takaomontana in body-surface infection manner | |
| CN110305795B (en) | Hirsutella sinensis and application thereof | |
| CN109618811B (en) | Industrialized artificial cultivation method for cordyceps sinensis | |
| CN102754562A (en) | Artificial cultivation technology for Cordyceps iaponica | |
| JP3252110B2 (en) | Artificial cultivation of Cordyceps using silkworm | |
| CN111226694A (en) | Method for cultivating and obtaining cordyceps militaris sporocarp by taking tenebrio molitor larvae as raw materials | |
| CN113994846B (en) | Application of juvenile hormone analogue methoprene in promotion of hepialus armoricanus larva rigor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20091021 |