CN101555477B - Heavy and light chain variable region gene of monoclonal antibody resisting human amyloid protein, and its uses - Google Patents
Heavy and light chain variable region gene of monoclonal antibody resisting human amyloid protein, and its uses Download PDFInfo
- Publication number
- CN101555477B CN101555477B CN2009100820762A CN200910082076A CN101555477B CN 101555477 B CN101555477 B CN 101555477B CN 2009100820762 A CN2009100820762 A CN 2009100820762A CN 200910082076 A CN200910082076 A CN 200910082076A CN 101555477 B CN101555477 B CN 101555477B
- Authority
- CN
- China
- Prior art keywords
- antibody
- monoclonal antibody
- variable region
- ser
- chain variable
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a heavy and light chain variable region gene of monoclonal antibody resisting human amyloid and coded polypeptide thereof. The invention also relates to the application of thegene and the polypeptide in preparing reagents and drugs for diagnosing Alzheimer's disease, and clones the light and heavy chain variable region genes of the antibody from cultured oligomer high aff inity antibody A8 hybridoma. The obtained gene can correctly code a mouse antibody variable region. Based on the cloned A8 antibody light and heavy chain variable region genes, a gene recombination method can be adopted to construct and express the chimeric antibody, single chain antibody, Fab and other genetic engineering anbodies of a plurality of micromolecules in the hope of being used for diagnosing and treating Alzheimer's disease.
Description
Technical field:
The present invention relates to the heavy chain and the chain variable region gene of anti-human amyloid protein monoclonal antibody, be specifically related to heavy chain and the chain variable region gene encoded polypeptides of the anti-people A of oligomer high-affinity β monoclonal antibody A8.The invention still further relates to described gene and polypeptide purposes at preparation diagnostic reagent and medicine.
Background technology:
Producing the beta amyloid plaque deposition in alzheimer's disease (Alzheimer ' s disease) patient's brain is this sick typical cytopathic.
Alzheimer's disease is treated or prevented to immunotherapy at amyloid (A β) molecule, is an important channel of treatment.At present existing people has carried out a few thing, has obtained curative effect in various degree.But at present can't specific recognition A beta oligomers, so immune effect is undesirable, need specific recognition and in conjunction with the monoclonal antibody of A beta oligomers.
And the discovery high-affinity, the monoclonal antibody gene that specificity is good is a key of further developing the monoclonal antibody of A beta oligomers.
Known solubility A β
1-42Oligomer is the early stage virulence factor of topmost alzheimer's disease, and is the strongest to neuronic toxicity.About the diagnosis and therepic use at 16.5-25KDA β
1-42The oligomer monoclonal antibody has not yet to see report.
Summary of the invention:
The purpose of this invention is to provide anti-people A β monoclonal antibody gene and encoded polypeptides thereof, described gene has specific recognition and in conjunction with the antibody activity fragment of A beta oligomers, is used to prepare the diagnostic reagent and the medicine of alzheimer's disease.
The present invention uses 5 ' RACE technology and has cloned light chain of antibody, heavy chain variable region gene by gene specific primer and anchor primer success from the oligomer high-affinity monoclonal antibody A8 hybridoma of cultivating.Derived heavy chain and chain variable region gene can correct coding mouse antibodies variable regions.Described light chain, heavy chain variable region gene and encoded polypeptides thereof can be used for preparing anti-human amyloid protein monoclonal antibody.
Based on above-mentioned A8 light chain of antibody, heavy chain variable region gene of being cloned into, adopt the method for gene recombination, make up and express genetic engineering antibodies such as multiple micromolecular chimeric antibody, single-chain antibody and Fab, in the hope of diagnosis and the therapeutic purpose that are used for alzheimer's disease.
Detailed description of the present invention is as follows:
The present invention has prepared the anti-people A of oligomer high-affinity β
1-42Monoclonal antibody is named as A8.Set up and preserve by Beijing Jiaotong University's life science and bio-engineering research institute.The inventor has found the monoclonal antibody A8 heavy chain and the chain variable region gene of anti-A beta oligomers, can give expression to specific recognition after the reorganization and in conjunction with the antibody activity fragment of A beta oligomers.
Monoclonal antibody A8 can the specific recognition apparent molecular weight be the A β of 16.5-25KD
1-42Oligomer and rapid ageing Model of Dementia mouse (Senescence Accelerated Mouse, SAM) the A beta oligomers of cerebral tissue.A8 is to A β
1-42The binding ability of oligomer is higher than monomer, A β
1-6, A β
1-12, and A β
1-28A β.Its subclass is IgG
3, antigen recognition site is in A beta polypeptides N end 1-6 amino acids, and the optimum dilution degree that is used for ELISA, protein immunoblotting is 1: 10
6, 1: 4,000.Morris water maze results suggest, abdominal injection A8 can improve the ability of learning and memory of SAMP8.
The inventor uses the method for 5 ' RACE to be cloned into A beta oligomers high-affinity monoclonal antibody A8 light chain, heavy chain variable region gene.One section the most conservative sequences Design primer according to antibody constant region CH-1 district, carry out reverse transcription, 5 ' end at the cDNA product adds Poly (C) tail, uses anchor primer and gene-specific primer at the design of polydeoxyribonucleotide tail by PCR method goal gene to be increased out then.Sequential analysis shows that A8 light chain of antibody and weight chain variabl area sequence and the mouse IgG variable region sequences homology of having submitted to reach 90% and 92%.Can determine that resulting sequence is light chain of antibody and weight chain variabl area sequence, but not the sequence of other gene.The mouse antibodies variable region that gained VH and VL gene codified are correct.
A8 heavy chain and chain variable region gene are to clone from the hybridoma cell strain of the anti-A β of the mouse source property oligomer high-affinity monoclonal antibody that can secrete greater activity.Wherein said heavy chain variable region gene total length is 450bp, and described chain variable region gene total length is 429bp, can be used for expression specificity identification after two gene recombination and in conjunction with the antibody activity fragment of A beta oligomers.
Described anti-people A β
1-42The heavy chain of monoclonal antibody A8 and variable region of light chain are shown in SEQ ID NO:1~SEQ ID NO:4.Wherein:
SEQ ID NO:1 is anti-people A β
1-42Monoclonal antibody variable region of heavy chain dna sequence dna;
SEQ ID NO:2 is anti-people A β
1-42Monoclonal antibody weight chain variable region amino acid sequence.
SEQ ID NO:3 is anti-people A β
1-42Monoclonal antibody variable region of light chain dna sequence dna;
SEQ ID NO:4 is anti-people A β
1-42Monoclonal antibody variable region of light chain amino acid preface
Anti-A beta oligomers monoclonal antibody A8 is light, the clone of heavy chain variable region gene.
The cell strain that secretion produces above-mentioned anti-Alzheimer disease monoclonal antibody is Beijing Jiaotong University's life science and bio-engineering research institute adopts the anti-people A of the mouse source property β monoclonal antibody hybridoma cell strain of traditional myelomatosis and a strain A beta oligomers high-affinity of the method acquisition of splenocyte fusion, called after A8, its antigen is A β 1-42 aggregation, and its excretory antibody molecule hypotype is IgG3.
Described A8 hybridoma is in China typical culture collection center (CCTCC) preservation.
The present invention has carried out following experiment in the anti-people A β monoclonal antibody of preparation and character and Function Identification:
1, the evaluation of antigen prepd and antibody character
The preparation of A β oligomerization mixture (being the used immunizing antigen of the present invention) (seeing embodiment 1, " preparation of 1.A β oligomerization mixture ").Its subclass is IgG
3, the antigen recognition epi-position is in A beta polypeptides N end 1-6 amino acids.
Solubility A β
1-42Oligomer is the early stage virulence factor of topmost AD, and is the strongest to neuronic toxicity.At present, about the diagnosis and therepic use at 16.5-25KDA β
1-42The oligomer monoclonal antibody has not yet to see report.
2, indirect ELISA experiment
The result shows: A8 can fine identification with alkaline coating buffer bag by in the A of 96 orifice plates β oligomerization mixture.Lowest detection is limited to: 0.625 μ g/ml (seeing embodiment 2).
The optimum dilution degree that is used for ELISA is 1: 10
6
3, immunoblotting (Western blot) experiment
The result shows: A8 can separate with SDS-PAGE in fine identification, shifts at the A of nitrocellulose filter β oligomerization mixture, mainly discerns the oligomer (seeing embodiment 3) of 16.5-25KD.
The optimum dilution degree that is used for protein immunoblotting is 1: 4,000.
4. immunohistochemical experiment
Monoclonal antibody A8 can specific recognition rapid ageing Model of Dementia mouse (Senescence Accelerated Mouse P8, SAMP8) the A beta oligomers of cerebral tissue.The result shows: it is clear to dye, and accurate positioning does not have background interference substantially.In carrying out the immunohistochemical methods process, need not antigen retrieval (seeing embodiment 4).
5.Morris determined with Morris water
The result shows: A8 can improve the ability of learning and memory (seeing embodiment 5) of SAMP8.
6, the clone of monoclonal antibody A8 variable region gene
Anti-A beta oligomers monoclonal antibody A8 is light, heavy chain variable region gene (seeing embodiment 6) to utilize the method for 5 ' RACE to increase.
Anti-people A β monoclonal antibody with the present invention's acquisition, utilize experimental techniques such as double-antibody sandwich elisa method (enzyme linked immunosorbent assay), Western blot experiment, immunohistochemical methods, can prepare the reagent of the detection alzheimer's disease of three kinds of different methods respectively.
, heavy chain variable region gene light based on above-mentioned anti-people A beta oligomers monoclonal antibody A8 of being cloned into, can adopt gene engineering method, make up and/or express carrier, cell strain and the antibody of multiple small molecules genetic engineering antibody, as single-chain antibody, chimeric antibody, Fab antibody etc., for use in basis and the clinical study and the application of AD diagnosis, prevention and treatment.Therefore, described anti-people A β monoclonal antibody can also prepare becomes medicine, is used for diagnosis, prevention and treatment alzheimer's disease.
Described gene nucleic acid sequence clone is to corresponding expression vector, and transfection/transform corresponding recipient cell (comprising bacterium, mammalian cell and yeast etc.) obtains the cell strain of the described antibody molecule of high expression level.
In addition, light, the heavy chain variable region gene of anti-people A beta oligomers monoclonal antibody A8 of the present invention also has following purposes:
Make up the gene engineering monoclonal antibody expression system: nucleotide sequence described anti-people A beta oligomers monoclonal antibody A8 is light, heavy chain variable region gene is cloned into corresponding expression vector, transfection/transform corresponding recipient cell (comprising bacterium, mammalian cell and yeast etc.) can obtain the cell strain of the described antibody molecule of high expression level.
The protein product crystal that is obtained after expressing is used for new drug development research: described anti-people A beta oligomers monoclonal antibody A8 is light, heavy chain variable region gene is expressed at different expression systems, behind albumen that is obtained or the polypeptide product purifying, can be made into crystal.This crystal can be used as drug target in the research and development of new drug, be used for the structure design of new drug.
Annotate: the anti-people A beta oligomers monoclonal antibody A8 described in the present specification is light, heavy chain variable region gene, all represents SEQ IDNO:1 and/or SEQ ID NO:2; Described polypeptide by these two genes encodings is all represented SEQ ID NO:3 and/or SEQID NO:4 polypeptide of sequence.
Advantage of the present invention:
At first, the present invention be used for the immunity antigen be A β
1-42The oligomer mixture, good immune effect, mouse immune serum titer height." the polypeptide coupling carrier protein process " that this point is better than using always.
Secondly, the A beta oligomers of the anti-Alzheimer disease monoclonal antibody A 8 specific recognition 16.5-22KD that provide has the application prospect of AD early diagnosis.Because A8 specific recognition solubility A beta oligomers in the immunotherapy experiment, might be avoided combining with fiber, thereby side reactions such as reduction hematencephalon.
Description of drawings:
Fig. 1 is weight, the light chain behind the anti-A beta oligomers monoclonal antibody A8 purifying.1 is molecular weight protein marker (Marker) among the figure, and 2 is heavy chain and the light chain of monoclonal antibody A8.
Fig. 2 is the detection sensitivity of monoclonal antibody A8.
Fig. 3 is the difference that monoclonal antibody A8 and commercialization monoclonal antibody 6E10 discern the A beta oligomers.1: protein molecular weight Marker; 2: detection antibody is A8; 3: detection antibody is 6E10.
Fig. 4 is the situation of monoclonal antibody A8 specific recognition rapid ageing Model of Dementia mouse brain cortex and hippocampus A β.
Fig. 5 is Morris determined with Morris water result, and among the figure, X-coordinate is the time (the 1st, 2,3,4,5 days) after treating, and ordinate zou finds the number (unit: only) of platform mouse for each group.
Fig. 6 is light for the anti-A beta oligomers monoclonal antibody A8 of RT-PCR amplification, the agarose gel electrophoresis figure of heavy chain variable region gene, and M is DL-2000DNA molecular weight Marker among the figure, and 1 is the A8 heavy chain variable region gene, and 2 is the A8 chain variable region gene.
Biomaterial preservation information:
Culture title: hybridoma cell strain A8
Deposit number: CCTCC-C200926
Depositary institution: Chinese typical culture collection center
The preservation time: on April 15th, 2009
Embodiment:
The preparation of the anti-people A of embodiment 1 oligomer high-affinity β monoclonal antibody A8
1.A the preparation of β oligomerization mixture
A β
1-42Peptide is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Reference literature (Lambert M, 1998) method, and carry out necessary adjustment, its external assembling under approximate natural condition is obtained A β
1-42The oligomerization mixture.Earlier with A β
1-42Peptide 1mg be dissolved in ice precooling hexafluoroisopropanol (1,1,1,3,3,3-hexafluoro-2-propannol, HFIP) (Sigma) makes A β
1-42Peptide monomerization, room temperature makes the HFIP volatilization totally behind the 1h.Use (Sigma) 20 μ l dissolving A β 1-42 monomer of anhydrous dimethyl sulphoxide (DMSO) then, be placed on F12 substratum (Sigma) or phosphate buffer (the corresponding 1ml of supplying of volume) at last, put 4 ℃, 24h makes its natural polymerization, detects A β with Western blot
1-42The preparation situation of oligomerization mixture.
2. the immunization of mouse
Get 5 of female BALB/c mouse in age in 6-8 week.Carry out 4 immunity altogether with A β oligomerization mixture respectively: first by 50 a μ g/ dosage with A β oligomerization mixture and equal-volume Fu Shi Freund's complete adjuvant (Sigma) mixing after, abdominal injection.Freund 's incomplete adjuvant (Sigma) is used in the back duplicate injection of 2 weeks at interval, and coupling polypeptide dosage is 30 μ g/.Repeat once after 2 weeks at interval; Again two weeks of interval, carry out booster immunization in the spleen, get spleen behind the 3-4d and merge with pure antigen 50 μ g.
3. 6-8 BALB/c mouse in age in week is got in the preparation of feeder cell, the execution of craning one, and RPMI RPMI-1640 (Sigma) flushing abdominal cavity several under the aseptic condition, with washing fluid 2000rpm, centrifugal 10min.Abandon supernatant, suspend with the RPMI RPMI-1640 that contains 20% calf serum and precipitate, cell counting, adjusting cell concn is 10
5Individual/ml, add in 96 orifice plates, 100 μ l/ holes place 37 ℃, 5%CO
2Hatch in the incubator.
4. cytogamy is got the mouse of reinforced immunological 3-4d, after the eyeball bloodletting, collect serum, draw neck to put to death, aseptic taking-up spleen, after making single cell suspension, in 10: 1 ratios with splenocyte be in the Sp2/0 cell of logarithmic phase (through 8-azaguanine, i.e. 8-Azaguanine, be called for short the 8-AG screening) mix, the centrifugal 10min of 1000rpm abandons supernatant, flicks pipe and makes sedimentation cell in the pasty state in the end, add 0.7ml 50%PEG 4000 (polyethylene glycol in 37 ℃ of water-baths, Sigma), limit edged rotating centrifugal pipe makes cell keep the mixing state, 1min adds, leave standstill 90s in 37 ℃ of water-baths, slowly add 20ml RPMI 1640 liquid immediately, the centrifugal 8min of 800rpm, abandon supernatant, add and contain 20% calf serum (Hangzhou Sijiqing Biological Engineering Material Co., Ltd.), 2%HAT (Sigma), the RPMI-1640 of 1% mycillin (Sigma), mixing gently, adjusting cell concn is 2 * 10
6Individual/ml, adding has had in 96 orifice plates of feeder cell, and 100 μ l/ holes place 37 ℃, 5%CO
2Hatch in the incubator, the observation of cell growing state is added the RPMI RPMI-1640 that contains 20% calf serum, 1%HT (Sigma), 1% mycillin after 1 week day by day, calculates the clonal growth rate by following formula.
Clonal growth rate (%)=(cell clone growth hole/inoculation hole) * 100%
5. the screening of positive colony and subclone
Treat that cell clone grows to (the microscope magnification 4 * 10) in the visual field at 1/3 o'clock, carefully draws cell conditioned medium liquid, 10 μ gml
-1A β oligomerization mixture is an envelope antigen, and the ELISA method detects the antibody in the supernatant, and concrete grammar and judging criterion are seen " 4. cytogamy ", calculates clone's positive rate by following formula.
Clone's positive rate (%)=(the cell clone growth hole of antibody positive hole/detection) * 100%
Adopt limiting dilution assay antagonist secretion male hole to carry out cloning repeatedly, to all mono-clonal hole supernatant antibody positive rate be 100%.
6. the foundation of hybridoma cell strain
The positive colony of cloning is moved into 24 orifice plates, 6 orifice plates and T25 Tissue Culture Flask, and enlarged culturing 60-90d also builds strain.
7. the subgroup identification of monoclonal antibody
The IgG subclass of secreting monoclonal antibody A8 according to mouse IgG subgroup identification test kit (Sigma) the operation hybridoma cell strain of Sigma company is IgG
3
8. the epitope analysis of monoclonal antibody
Use the competitive ELISA method to measure the antigen recognition epi-position of monoclonal antibody: with each peptide section (A β 1-6 of monoclonal antibody and concentration gradient, A β 1-11, A β 12-28) hatches and join the enterprising ELISA that connects of the enzyme plate that is coated with the A beta oligomers in the ranks behind the 1h and detect.The result shows that its epi-position is N end polypeptide A β 1-6.
9. a large amount of preparations and the purifying of monoclonal antibody
The inoculation hybridoma is to the pretreated BABL/c mouse peritoneal of pristane (Sigma), 1 * 10
7Individual hybridoma/only, extract ascites after 7-10 days uses AKTA explore100 protein chromatographic system by Protein A affinity column monoclonal antibody purification, sees Fig. 1.Measure antibody concentration with BCA test kit (U.S. PIERCE company), be 3mg/ml.
The experiment of embodiment 2 indirect ELISAs
1. method
(1) bag quilt: 10 μ gml
-1A β oligomerization mixture is an envelope antigen, adds in the enzyme plate (SUNRISE company), and every hole 100 μ l, 4 ℃ are spent the night.
(2) PBS-T (NaCl 8g, KCl 0.2g, Na
2HPO
4.1.44g, KH
2PO
4.0.44g, Tween-20 0.05ml mends ddH
2O to 1L, pH7.2~7.4) wash plate: 3 times, each 5min.
(3) sealing: add the PBS-T that contains 0.2%BSA, every hole 100 μ l.37℃,2h。
(4), add in 96 orifice plates every hole 100 μ l with the monoclonal antibody A8 of doubling dilution.37℃,2h。Establish blank, negative control and positive control (using the anti-people A β 1-17 of mouse anti human A β serum, Calbiochem company respectively) simultaneously.
(5) PBS-T washes plate: 3 times, and each 5min.
(6) add the sheep anti-mouse igg (Bioisystech Co., Ltd of China fir Golden Bridge in Beijing) of HRP mark of dilution in 1: 10000, every hole 100 μ l.37℃,1h。
(7) PBS-T washes plate: 3 times, and each 5min.
(8) add substrate TMB, every hole 100 μ l, behind the 20min, the 450nm wavelength detects the A value.
Positive judging criterion is as follows:
(sample well A value-blank A value)/(negative control hole A value-blank A value) 〉=2
The greatest dilution that detects is tired for this antibody.
2. result and conclusion
Use we the monoclonal antibody A8 of preparation and can discern the A β oligomerization mixture that wraps quilt.Lowest detection is limited to: 0.625 μ g/ml.See Fig. 2.
The The above results explanation: monoclonal antibody A8 can effectively discern the A β oligomerization mixture of assembled in vitro, and its reaction sensitivity is better.
1. method
Get 50~100 μ g samples, 5 * sample buffer is gone up sample behind the mixing, makes albumen pass through to concentrate glue with 100V voltage earlier.When sample entered separation gel, regulating voltage made it constant in 120V.When the tetrabromophenol sulfonphthalein swimming is bottom gel, finish electrophoresis, take off gel, conventional with the dyeing of Xylene Brilliant Cyanine G R-250 staining; Gel and nitrocellulose filter are put into balance 10min in the container that the trace damping fluid is housed respectively, putting into filter paper, gel, NC film, filter paper successively, become " sandwich " shape; pouring into changes the film damping fluid; glue faces negative pole, and the NC face is towards positive pole, the bubble of carefully avoiding and rush.Connect power supply, make the continuous transferase 12 h of constant current 80mA, cut off the electricity supply.
After changeing film and finishing, with the Ponceau S staining fluid (10 * Ponceau S stock solution compound method is: take by weighing Ponceau S 2g, trichoroacetic acid(TCA) 30g, semi-annular jade pendant base Whitfield's ointment 30g adds water to 100ml; Time spent dilutes with deionized water according to 1: 10 ratio) determine the protein band position, do corresponding mark.Sealing nitrocellulose filter with confining liquid (takes by weighing skim-milk 5g, is dissolved in 0.1mol/L PBST (NaCl 8g, KCl 0.2g, Na
2HPO
4.1.44g, KH
2PO
4.0.44g, Tween-20 0.05ml mends ddH
2O to 1L, pH7.2~7.4) 100ml), 4 ℃ of sealings are spent the night.With confining liquid liquid dilution monoclonal antibody A8, concentration is generally 0.2~1 μ g/ml, hatches 12~14h in 4 ℃, or hatches 2h in 20~37 ℃.Wash nitrocellulose filter 4 times with 0.1mol/L PBST, each 5~10min.Resist with two of PBS dilution HRP mark, extent of dilution is 1: 1000, incubated at room 1h.Wash nitrocellulose filter 4 times with 0.1mol/L PBST, each 5min.According to the explanation of PIERCE chemical luminescence reagent kit, A liquid and B liquid equal-volume are mixed, be added on the nitrocellulose filter, behind 2~5min, with X-ray sheet exposure imaging, observations.Carry out the band sxemiquantitative with Quantity One software (BIO-RAD) software.
2. result and conclusion
Western Blot result, the A8 of purifying mainly discern low-molecular weight oligo body (with 16.5KD left and right sides composition in the identification oligomerization mixture), in addition with monomer, high molecular oligomer and protofibril cross reaction again.6E10 does not have difference to monomer, low-molecular weight oligo body, high molecular oligomer and fibriilar identification.See Fig. 3.
The The above results explanation, monoclonal antibody A8 is the strongest to composition reaction in the 16.5KD left and right sides in the A β oligomerization mixture, and is obviously different to the recognition effect of oligomerization mixture with 6E10.The A β that monoclonal antibody A8 can utilize Western Blot to carry out sample detects.
1. method
(1) dewaxing, aquation.
(2) PBS washed twice each 5 minutes
(3) with distilled water or the fresh 3%H of PBS configuration
2O
2, room temperature sealing 5~10 minutes, distillation washing 3 times.
(4) antigen retrieval.
(5) PBS washed 5 minutes.
(6) drip normal goats serum confining liquid, room temperature 20 minutes.Get rid of unnecessary liquid.
(7) drip monoclonal antibody A8, room temperature was spent the night or 37 ℃ 1 hour (4 ℃ of backs of spending the night were 37 ℃ of rewarmings 45 minutes) in 1 hour or 4 ℃.
(8) PBS gave a baby a bath on the third day after its birth inferior each 2 minutes.
(9) drip biotinylation two anti-(goat anti-mouse IgG), 20 ℃~37 ℃ 20 minutes.
(10) PBS wash 3 times each 2 minutes.
(11) drip reagent SABC, 20 ℃~37 ℃ 20 minutes.
(12) PBS wash 4 times each 5 minutes.
(13) DAB colour developing: DAB colouring reagents box or autogamy chromogenic reagent (mirror is grasped the colour developing degree down).
(14) distillation washing.Hematorylin is redyed 2 minutes, hydrochloride alcohol differentiation.
(15) dehydration, transparent, mounting, microscopy.
2. result and conclusion
The result shows that cortex and hippocampus dyeing are clear, accurate positioning, and background is lower.See Fig. 4.Monoclonal antibody A8 can be used as the antibody of brain cortex and hippocampus A β detection.
Embodiment 5Morris determined with Morris water
1, experiment purpose: detect the therapeutic action of monoclonal antibody A8 to rapid ageing Model of Dementia mouse
2, laboratory animal
Laboratory animal SAMP8 entrusts Department Of Medicine, Peking University's medical experiment animal center to raise available from Beijing Vital River Experimental Animals Technology Co., Ltd..The grouping situation is as follows:
Be divided into antibody A 8 treatment groups, the non-specific IgG injection of mouse group, physiological saline injection group, SAMP8 blank group, 12 every group according to the injectable drug difference.
3, experimental technique
The method of reference literature (Lee EB, 2006), with male SAMP8 mouse of 8 monthly ages of monoclonal antibody A8 abdominal injection (400 μ g/ are only), 1 time weekly, treat after 8 weeks, carry out Morris determined with Morris water (the medical experiment animal center is finished in the Department Of Medicine, Peking University).
Morris determined with Morris water step:
(1) the special water maze of design mainly is made up of the platform of a cylinder shape pond and a removable position.The high 70cm in pond, diameter 80cm, platform diameter 8cm, the sky, pond is connected with computer by a digital camera.
(2) inject clear water in advance in the pond, depth of water 15cm is black at the bottom of pool wall and the pond, makes Chi Shui become opaque black, and platform surface is a black, and mouse can not be seen, the water surface exceeds platform surface 0.5cm.
(3) water temperature is controlled at 22 ± 0.5 ℃, at the place of entry of pond subscript phasing same point as each experiment mice.Paste difform sign on each quadrant corresponding side walls.Platform places in the middle of place of entry quadrant far away, and experimentation keeps the position of platform constant.
(4) each experiment is carried out in the sound damping room, the pond, and light source, the position of each objects of laboratory such as mouse cage remains unchanged.
(5) treatment finishes the back and began training on the 3rd day, if animal is found platform in 120s, is allowed to condition at and stops 20s on the platform, if animal is not found platform, places it in and makes its stop 20s on the platform.
(6) each experiment is exceeded with 120s, and each each treated animal of record can arrive the mouse number of elements of platform.If do not find platform in the setting-up time, computer stops to follow the tracks of, and be 120s writing time.
(7) finish the back in treatment and continued study and test in 4,5,6,7,8 days, write down the situation that every group of mouse found platform.
4, result
A8 treatment group learning and memory improves situation and obviously is better than the non-specific IgG injection of mouse group, physiological saline injection group, SAMP8 blank group.Each group finds the number situation of platform mouse, tests being respectively in the 1st day to the 5th day: A8 treatment group (0,2,3,4,4); Non-specific IgG injection group (1,1,0,0,0), physiological saline injection group, SAMP8 blank group (0,0,1,1,0) are seen Fig. 5 (X-coordinate is the fate after treating, and ordinate zou finds the number of platform mouse for each group).
5, conclusion
Monoclonal antibody A8 has the effect that improves rapid ageing Model of Dementia ability of learning and memory in mice.
The clone of embodiment 6 monoclonal antibody A8 variable region genes
Get the A8 hybridoma (5 * 10 that is in logarithmic phase
6), adopt Trizol reagent method to extract total RNA of hybridoma cell strain A8, take a morsel and carry out the quantitative and 1% denaturing formaldehyde agarose gel electrophoresis of ultraviolet spectrophotometer.Anti-A beta oligomers monoclonal antibody A8 is light, heavy chain variable region gene to utilize the method for 5 ' RACE to increase.Follow respectively according to mouse IgG light chain and CH CH-1 district gene order design gene-specific primer L-GSP1:ACTGGATGGTGGGAAGATGG and H-GSP1:CAGTGGATAGACCGATGGGGG.Is template according to the test kit specification sheets with total RNA, is primer with L-GSP1 and H-GSP1 respectively, uses synthetic cDNA first chain of SuperScripII ThermoScript II.The reverse transcription reaction scheme is: total RNA5 μ g, and GSP 100n mol/L adds no Rnase water to 18 μ L, puts on the ice bath immediately after hatching 10min for 70 ℃; Continuation adds 10 * buffer, 2.5 μ L, 25mmol/L MgCl in reaction solution
22.5 μ L, 10m mol/L dNTP 1 μ L is hatched for 42 ℃ and is added 1 μ L 200U/ μ L SuperScrip II ThermoScript II behind the 1min, and 42 ℃ of reaction 50min are hatched 10min for 70 ℃.Add RNase hydrolysis RNA after reverse transcription finishes, make and only contain cDNA first chain in the product.Using centrifugal column purification cDNA first chain of S.N.A.P, is that substrate adds Poly (C) tail to cDNA first chain 5 ' end with dCTP by terminal deoxynucleotidyl transferase TdT then.
Be template amplification light chain of antibody and heavy chain (VL, VH) variable region gene in order to AAP:GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG and L-GSP2:GGGGAA GATGGATACAGTTGGTGCAGC and AAP and two pairs of primers of H-GSP2GATAGCCGATGGGGGTGTTGTTT TGG with cDNA first chain that adds Poly (C) tail respectively.Amplified production VH (about 450bp) and VL (about 429bp) identify through sepharose (1.5%) electrophoresis, see Fig. 6.After reclaiming purifying with PCR product purification test kit (Omega), with the purpose fragment cloning to the T carrier, sequencing analysis (seeing sequence table 1-4).
Pcr amplification reaction carries out according to ordinary method: with above-mentioned product is template, uses light, the heavy chain variable region gene of heavy chain and light chain primer amplification antibody respectively.Reaction system is: cDNA5 μ L, each 1 μ L of upstream and downstream primer (10mmol/L), 10mmol/L dNTP 2 μ L, 10 * buffer, 5 μ L, add distilled water to 50 μ L, Ex Taq archaeal dna polymerase 1.25 μ l add water to 50 μ l, mixing, instantaneous centrifugal after, put PCR instrument internal reaction.The PCR condition is: 95 pre-sex change 5min, and loop parameter is 94 sex change 40s, 55 annealing 40s, 72 extend 1min, totally 30 circulations, last 72 extend 51min.
Purpose fragment T carrier cloning order-checking scheme is as follows: after the PCR product is reclaimed with test kit (Omega) purifying, be connected into the pMD18-T carrier.The ligation system is: pMD18-T carrier 1 μ l, and PCR product purification heavy chain (or light chain) 4 μ l connect damping fluid 5 μ l, and mixing spends the night for rearmounted 4 ℃, transformed into escherichia coli DH5 α, screening recombinant clone and order-checking.
Anti-A beta oligomers monoclonal antibody A8 is light, heavy chain variable region gene is used for diagnosing, preventing and treat the reagent (box) of AD and the application of medicine in preparation:
Anti-A beta oligomers monoclonal antibody A8 is light, the research of heavy chain variable region gene application facet mainly contains: (1) sets up the sandwich ELISA method that can be used for analyzing the A beta oligomers; (2) prevention of AD and early stage treatment research: be used for AD animal models such as low age SAMP8 or Tg2576 transgenic mouse, the anti-A beta oligomers of vein, abdominal cavity or intracranial injection monoclonal antibody A8 is light, heavy chain variable region gene is relevant polypeptide or antibody, change by observational learning memory behavior, histopathology and molecular cytobiology, obtain laboratory test data; (3) treatment of AD research: be used for advanced age or AD animal models such as old SAMP8 or Tg2576 transgenic mouse, the anti-A beta oligomers of vein, abdominal cavity or intracranial injection monoclonal antibody A8 is light, heavy chain variable region gene is relevant polypeptide or antibody, change by observational learning memory behavior, histopathology and molecular cytobiology, obtain laboratory test data; (4); Polypeptide that A beta oligomers monoclonal antibody A8 is light, heavy chain variable region gene is relevant or antibody are used for each clinical trial phase research; (5) side effect and complication research that polypeptide that A beta oligomers monoclonal antibody A8 is light, heavy chain variable region gene is relevant or antibody are used.(meningoencephalitis, hemorrhage).
With light, protein drug that heavy chain variable region gene reconstitutes a definite form of the present invention, can be directly used in diagnosis and the immunotherapy of AD.
With of the present invention and light, heavy chain variable region gene encoded polypeptides, the novel antibody that can reassemble into mainly contains following several form: (1) chimeric antibody: be that C district with the V district of mouse MAb and human IgG is formed by connecting and is people-mouse chimeric antibody.Because it has intactly preserved specificity and the avidity of mouse MAb, has reduced untoward reactions such as HAMA simultaneously, so demonstrate good effect in immunotherapy.(2) humanized antibody: humanization modified at the variable region gene structure, comprise that CDR transplants, surface amino groups acid residue is modified, the exchange of skeleton district, the location keeps and the epi-position guiding is selected etc., thereby the mouse source property that has not only reduced the variable region has kept specificity and the avidity of mouse MAb simultaneously again.(3) small molecular antibody: mainly contain the Fab antibody formed by VH-CH1 and VL-CH1, with a polypeptide (Gly4Ser) 3 joints be connected single-chain antibody that VH gene and VL gene form, single domain antibody of forming with non covalent bond be combined into Fv fragment antibody, by VH or functional domain of VL by VH and VL, the atom that constitutes by single CDR etc.(4) multivalence miniantibody: mainly contain double-stranded antibody (ScFv)
2, Flex miniantibody, LD miniantibody, F (ab ')
2, F (ab ')
3, (ScFv)
4Deng.Because the polyvalent antigen binding site is arranged, the avidity height, molecular size is moderate, characteristics that the clearance rate in kidney is slower and have high clinical value.(5) bi-specific antibody: be the antibody that a class has dual specificity and dual-use function, claim bifunctional antibody again.(6) recombinant antibody fusion proteins:, have a specific biological activity recombinant protein of target with other biologically functional molecules such as the nucleic acid of non-antibody or enzyme are connected to form gene fragments such as Fab or Fv.(7) phage antibody: the V district gene of Ig is connected after transfecting host bacterium with last gene III of filobactivirus DNA or gene VIII, makes its fusion protein product at film surface outer casing protein expression Fab or ScFv.By this product being taken turns more the affine absorption of related antigen, therefrom filter out required specific antibody.
With light, the heavy chain variable region gene encoded polypeptides that reaches of the present invention, and the antibody that reconstitutes a definite form, carry out various enzymes, vitamin H, fluorescence marks such as (Cy3, Cy5 etc.).
On the basis of above-mentioned research, the A β that utilizes the A β of synthetic or prokaryotic expression and oligomerization is as the standard antigen sample, set up the suitableeest coated antibody and the concentration of sandwich ELISA method analysis, the suitableeest biotinylated detection antibody (A beta oligomers monoclonal antibody specific) and concentration, avidin and TMB with horseradish peroxidase-labeled is detection system simultaneously, obtain solubility A beta oligomers sandwich ELISA analytical procedure, set up the laboratory standard of AD method of early diagnosis.
With above-mentioned AD and AD relative disease diagnostic kit by reorganization of light, heavy chain variable region gene encoded polypeptides or the assembling of deutero-antibody molecule.
Anti-human amyloid protein sequence table .txt
<110〉Beijing Jiaotong University
<120〉anti-human amyloid protein monoclonal antibody heavy and light chain variable region gene and application thereof
<160>4
<170>PatentIn?version?3.5
<210>1
<211>1039
<212>DNA
<213〉people (Homo sapiens)
<400>1
GGGCTCGTAG?TGCAGCTTGC?ATGCCTGCAG?GTCGACGATT?TATGCGGCCG?CATGGACAGG 60
CTTACTTCTT?CATTCCTGCT?GCTGATTGTC?CCTGCATATG?TCTTGTCCCA?AGTTACTCTA 120
AAAGAGTCTG?GCCCTGGGAT?ATTGAAGCCC?TCACAGACCC?TCAGTCTGAC?TTGTTCTTTC 180
TCTGGGTTTT?CACTGAGCAC?TTCTGGTATG?GGTGTAGGCT?GGATTCGTCA?GCCTTCAGGG 240
AAGGGTCTGG?AGTGGCTGGC?ACACATTTGG?TGGGATGATG?ATAAGTACTA?TAACCCATCC 300
CTGAAGAGCC?GGCTCACAAT?CTCCAAGGAT?ACCTCCAGAA?ACCAGGTATT?CCTCAAGATC 360
ACCAGTGTGG?ACACTGCAGA?TACTGCCACT?TACTACTGTG?CTCGAAGGGG?GATCTACTAT 420
GATTACGACA?ACTTTAACTA?CTGGGGCCAA?GGCACCACTC?TCACAGTCTC?CTCAGCCAAA 480
ACAACACCCC?CATCGGTCTA?TCGGATCCCT?CAATCTCTAG?AGGATCCCCG?GGTACCGAGC 540
TCGAATTCGT?AATCATGGTC?ATAGCTGTTT?CCTGTGTGAA?ATTGTTATCC?GCTCACAATT 600
CCACACAACA?TACGAGCCGG?AAGCATAAAG?TGTAAAGCCT?GGGGTGCCTA?ATGAGTGAGC 660
TAACTCACAT?TAATTGCGTT?GCGCTCACTG?CCCGCTTTCC?AGTCGGGAAA?CCTGTCGTGC 720
CAGCTGCATT?AATGAATCGG?CCAACGCGCG?GGGAGAGGCG?GTTTGCGTAT?TGGGCGCTCT 780
TCCGCTTCCT?CGCTCACTGA?CTCGCTGCGC?TCGGTCGTTC?GGCTGCGGCG?AGCGGTATCA 840
GCTCACTCAA?AGGCGGTAAT?ACGGTTATCC?ACAGAATCAG?GGGATAACGC?AGGAAAGAAC 900
ATGTGAGCAA?AAGGCCAGCA?AAAGGCCAGG?AACCGTAAAA?AGGCCGCGTT?GCTGGCGTTT 960
TTCCATAGGC?TCCGCCCCCC?TGACGAGCAT?CACAAAAATC?GACGCTCAAG?TCAGAGGTGG 1020
CGAAACCCGA?CAGGACTAT 1039
<210>2
<211>346
<212>PRT
<213〉people (Homo sapiens)
<400>2
Gly?Leu?Val?Val?Gln?Leu?Ala?Cys?Leu?Gln?Val?Asp?Asp?Leu?Cys?Gly
1 5 10 15
Arg?Met?Asp?Arg?Leu?Thr?Ser?Ser?Phe?Leu?Leu?Leu?Ile?Val?Pro?Ala
20 25 30
Tyr?Val?Leu?Ser?Gln?Val?Thr?Leu?Lys?Glu?Ser?Gly?Pro?Gly?Ile?Leu
35 40 45
Lys?Pro?Ser?Gln?Thr?Leu?Ser?Leu?Thr?Cys?Ser?Phe?Ser?Gly?Phe?Ser
50 55 60
Leu?Ser?Thr?Ser?Gly?Met?Gly?Val?Gly?Trp?Ile?Arg?Gln?Pro?Ser?Gly
65 70 75 80
Lys?Gly?Leu?Glu?Trp?Leu?Ala?His?Ile?Trp?Trp?Asp?Asp?Asp?Lys?Tyr
85 90 95
Tyr?Asn?Pro?Ser?Leu?Lys?Ser?Arg?Leu?Thr?Ile?Ser?Lys?Asp?Thr?Ser
100 105 110
Arg?Asn?Gln?Val?Phe?Leu?Lys?Ile?Thr?Ser?Val?Asp?Thr?Ala?Asp?Thr
115 120 125
Ala?Thr?Tyr?Tyr?Cys?Ala?Arg?Arg?Gly?Ile?Tyr?Tyr?Asp?Tyr?Asp?Asn
130 135 140
Phe?Asn?Tyr?Trp?Gly?Gln?Gly?Thr?Thr?Leu?Thr?Val?Ser?Ser?Ala?Lys
145 150 155 160
Thr?Thr?Pro?Pro?Ser?Val?Tyr?Arg?Ile?Pro?Gln?Ser?Leu?Glu?Asp?Pro
165 170 175
Arg?Val?Pro?Ser?Ser?Asn?Ser?End?Ser?Trp?Ser?End?Leu?Phe?Pro?Val
180 185 190
End?Asn?Cys?Tyr?Pro?Leu?Thr?Ile?Pro?His?Asn?Ile?Arg?Ala?Gly?Ser
195 200 205
Ile?Lys?Cys?Lys?Ala?Trp?Gly?Ala?End?End?Val?Ser?End?Leu?Thr?Leu
210 215 220
Ile?Ala?Leu?Arg?Ser?Leu?Pro?Ala?Phe?Gln?Ser?Gly?Asn?Leu?Ser?Cys
225 230 235 240
Gln?Leu?His?End?End?Ile?Gly?Gln?Arg?Ala?Gly?Arg?Gly?Gly?Leu?Arg
245 250 255
Ile?Gly?Arg?Ser?Ser?Ala?Ser?Ser?Leu?Thr?Asp?Ser?Leu?Arg?Ser?Val
260 265 270
Val?Arg?Leu?Arg?Arg?Ala?Val?Ser?Ala?His?Ser?Lys?Ala?Val?Ile?Arg
275 280 285
Leu?Ser?Thr?Glu?Ser?Gly?Asp?Asn?Ala?Gly?Lys?Asn?Met?End?Ala?Lys
290 295 300
Gly?Gln?Gln?Lys?Ala?Arg?Asn?Arg?Lys?Lys?Ala?Ala?Leu?Leu?Ala?Phe
305 310 315 320
Phe?His?Arg?Leu?Arg?Pro?Pro?Asp?Glu?His?His?Lys?Asn?Arg?Arg?Ser
325 330 335
Ser?Gln?Arg?Trp?Arg?Asn?Pro?Thr?Gly?Leu
340 345
<210>3
<211>1045
<212>DNA
<213〉people (Homo sapiens)
<400>3
ATGAAAAACG?TCAGTGCAAG?CTTGCATGCC?TGCAGGTCGA?CGATTAAGAA?GCTTATGAAG 60
TTGCCTGTTA?GGCTGTTGGT?GCTGATGTTC?TGGATTCCTG?CTTCCAGCAG?TGATGTTTTG 120
ATGACCCAAA?CTCCACTCTC?CCTGCCTGTC?AGTCTTGGAG?ATCAAGCCTC?CATTTCTTGC 180
AGATCTAGTC?AGAGCATTGT?ACATAGTAAT?GGAAACACCT?ATTTAGAATG?GTACCTGCAG 240
AAACCAGGCC?AGTCTCCAAA?GCTCCTGATC?TACAAAGTTT?CCAACCGATT?TTCTGGGGTC 300
CCAGACAGGT?TCAGTGGCAG?TGGATCAGGG?ACAGATTTCA?CACTCAAGAT?CAGCAGAGTG 360
GAGGCTGAGG?ATCTGGGAAT?TTATTACTGC?TTTCAAGGTT?CACGTGTTCC?GCTCACGTTC 420
GGTGCTGGGA?CCAAGCTGGA?GCTGAAACGG?GCTGATGCTG?CACCAACTGT?ATCCATCTTC 480
CCCGAATTCT?AGAATCTCTA?GAGGATCCCC?GGGTACCGAG?CTCGAATTCG?TAATCATGGT 540
CATAGCTGTT?TCCTGTGTGA?AATTGTTATC?CGCTCACAAT?TCCACACAAC?ATACGAGCCG 600
GAAGCATAAA?GTGTAAAGCC?TGGGGTGCCT?AATGAGTGAG?CTAACTCACA?TTAATTGCGT 660
TGCGCTCACT?GCCCGCTTTC?CAGTCGGGAA?ACCTGTCGTG?CCAGCTGCAT?TAATGAATCG 720
GCCAACGCGC?GGGGAGAGGC?GGTTTGCGTA?TTGGGCGCTC?TTCCGCTTCC?TCGCTCACTG 780
ACTCGCTGCG?CTCGGTCGTT?CGGCTGCGGC?GAGCGGTATC?AGCTCACTCA?AAGGCGGTAA 840
TACGGTTATC?CACAGAATCA?GGGGATAACG?CACGAAAGAA?CATGTGAGCA?AAAGGCCAGC 900
AAAAGGCCAG?GAACCGTAAA?AAGGCCGCGT?TGCTGGCGTT?TTTCCATAGG?CTCCGCCCCC 960
CTGACGAGCA?TCACAAAAAT?CGACGCTCAA?GTCAGAGGTG?GCGAAACCCG?ACAGGACTAT?1020
AAAGATACCA?GGCGTTTCCC?CCTGG 1045
<210>4
<211>348
<212>PRT
<213〉people (Homo sapiens)
<400>4
Met?Lys?Asn?Val?Ser?Ala?Ser?Leu?His?Ala?Cys?Arg?Ser?Thr?Ile?Lys
1 5 10 15
Lys?Leu?Met?Lys?Leu?Pro?Val?Arg?Leu?Leu?Val?Leu?Met?Phe?Trp?Ile
20 25 30
Pro?Ala?Ser?Ser?Ser?Asp?Val?Leu?Met?Thr?Gln?Thr?Pro?Leu?Ser?Leu
35 40 45
Pro?Val?Ser?Leu?Gly?Asp?Gln?Ala?Ser?Ile?Ser?Cys?Arg?Ser?Ser?Gln
50 55 60
Ser?Ile?Val?His?Ser?Asn?Gly?Asn?Thr?Tyr?Leu?Glu?Trp?Tyr?Leu?Gln
65 70 75 80
Lys?Pro?Gly?Gln?Ser?Pro?Lys?Leu?Leu?Ile?Tyr?Lys?Val?Ser?Asn?Arg
85 90 95
Phe?Ser?Gly?Val?Pro?Asp?Arg?Phe?Ser?Gly?Ser?Gly?Ser?Gly?Thr?Asp
100 105 110
Phe?Thr?Leu?Lys?Ile?Ser?Arg?Val?Glu?Ala?Glu?Asp?Leu?Gly?Ile?Tyr
115 120 125
Tyr?Cys?Phe?Gln?Gly?Ser?Arg?Val?Pro?Leu?Thr?Phe?Gly?Ala?Gly?Thr
130 135 140
Lys?Leu?Glu?Leu?Lys?Arg?Ala?Asp?Ala?Ala?Pro?Thr?Val?Ser?Ile?Phe
145 150 155 160
Pro?Glu?Phe?End?Asn?Leu?End?Arg?Ile?Pro?Gly?Tyr?Arg?Ala?Arg?Ile
165 170 175
Arg?Asn?His?Gly?His?Ser?Cys?Phe?Leu?Cys?Glu?Ile?Val?Ile?Arg?Ser
180 185 190
Gln?Phe?His?Thr?Thr?Tyr?Glu?Pro?Glu?Ala?End?Ser?Val?Lys?Pro?Gly
195 200 205
Val?Pro?Asn?Glu?End?Ala?Asn?Ser?His?End?Leu?Arg?Cys?Ala?His?Cys
210 215 220
Pro?Leu?Ser?Ser?Arg?Glu?Thr?Cys?Arg?Ala?Ser?Cys?Ile?Asn?Glu?Ser
225 230 235 240
Ala?Asn?Ala?Arg?Gly?Glu?Ala?Val?Cys?Val?Leu?Gly?Ala?Leu?Pro?Leu
245 250 255
Pro?Arg?Ser?Leu?Thr?Arg?Cys?Ala?Arg?Ser?Phe?Gly?Cys?Gly?Glu?Arg
260 265 270
Tyr?Gln?Leu?Thr?Gln?Arg?Arg?End?Tyr?Gly?Tyr?Pro?Gln?Asn?Gln?Gly
275 280 285
Ile?Thr?His?Glu?Arg?Thr?Cys?Glu?Gln?Lys?Ala?Ser?Lys?Arg?Pro?Gly
290 295 300
Thr?Val?Lys?Arg?Pro?Arg?Cys?Trp?Arg?Phe?Ser?Ile?Gly?Ser?Ala?Pro
305 310 315 320
Leu?Thr?Ser?Ile?Thr?Lys?Ile?Asp?Ala?Gln?Val?Arg?Gly?Gly?Glu?Thr
325 330 335
Arg?Gln?Asp?Tyr?Lys?Asp?Thr?Arg?Arg?Phe?Pro?Leu
340 345
Claims (6)
1. anti-human amyloid albumin A β
1-42Monoclonal antibody, the sequence of its heavy chain variable region gene is shown in SEQ ID NO:1; The sequence of its chain variable region gene is shown in SEQ ID NO:3.
2. the described monoclonal antibody of claim 1, the aminoacid sequence of described SEQ ID NO:1 encoded polypeptides is shown in SEQ ID NO:2; The aminoacid sequence of described SEQ ID NO:3 encoded polypeptides such as SEQ ID NO:4.
3. claim 1 or 2 described monoclonal antibodies are the A β of 16.5-25KD at the preparation molecular weight
1-42Application in the oligomer monoclonal antibody.
4. claim 1 or the 2 described monoclonal antibodies application in preparation diagnosis of alzheimer's disease reagent.
5. claim 1 or the 2 described monoclonal antibodies application in making up the gene engineering monoclonal antibody expression system.
6. claim 1 or the 2 described monoclonal antibodies application in the preparation therapeutic agent for alzheimer's disease.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100820762A CN101555477B (en) | 2009-04-22 | 2009-04-22 | Heavy and light chain variable region gene of monoclonal antibody resisting human amyloid protein, and its uses |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2009100820762A CN101555477B (en) | 2009-04-22 | 2009-04-22 | Heavy and light chain variable region gene of monoclonal antibody resisting human amyloid protein, and its uses |
Publications (2)
Publication Number | Publication Date |
---|---|
CN101555477A CN101555477A (en) | 2009-10-14 |
CN101555477B true CN101555477B (en) | 2011-04-20 |
Family
ID=41173757
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2009100820762A Active CN101555477B (en) | 2009-04-22 | 2009-04-22 | Heavy and light chain variable region gene of monoclonal antibody resisting human amyloid protein, and its uses |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN101555477B (en) |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101878301B (en) * | 2007-10-29 | 2014-08-20 | 道健康生活医药株式会社 | Antibody and use thereof |
CN102192985A (en) * | 2010-03-18 | 2011-09-21 | 上海依科赛生物制品有限公司 | Human beta-amyloid kit |
CN104479013B (en) * | 2014-11-14 | 2017-12-12 | 吉林大学 | A kind of single-chain antibody of anti-oligomer of A β 42 and the gene for encoding the single-chain antibody |
CN104558172A (en) * | 2015-01-04 | 2015-04-29 | 东南大学 | Single-domain heavy-chain nanobody for amyloid-beta and application of single-domain heavy-chain nanobody |
CN115925923B (en) * | 2022-09-26 | 2023-09-15 | 吉林大学 | Single-chain antibody catalyzing degradation of Abeta 42 oligomer, single-chain antibody gene and application thereof |
-
2009
- 2009-04-22 CN CN2009100820762A patent/CN101555477B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN101555477A (en) | 2009-10-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101531717B (en) | Anti-Alzheimer disease monoclonal antibody and application thereof | |
CN101555477B (en) | Heavy and light chain variable region gene of monoclonal antibody resisting human amyloid protein, and its uses | |
CN104114583B (en) | The treatment of cancer and/or prophylactic compositions | |
CN103073641B (en) | Anti-human Dlk-1 antibody showing anti-tumor activity in vivo | |
ES2657458T3 (en) | Procedures to treat colorectal cancer | |
CN109206514B (en) | TSLP monoclonal antibody and its preparation method and application | |
CN103003424B (en) | Antibody capable of binding to transforming growth factor alpha and having antiproliferative activity on cancer having Ras gene mutation | |
BRPI0713086A2 (en) | diagnosis and treatment of cancer using anti-desmogleìna-3 antibody | |
KR102276489B1 (en) | Improved anti-VEGFR-2 monoclonal antibody | |
KR20240018579A (en) | B7H3 monoclonal antibody group and its medicinal uses | |
BR112018013653B1 (en) | ANTIBODIES ANTI-PD-1, PROCESS FOR THE PRODUCTION OF THE SAME AND USE OF ANTIBODIES | |
CN101970497A (en) | Anti-epcam antibody and uses thereof | |
ES2808947T3 (en) | Humanized anti-BAG3 antibodies | |
KR20230118922A (en) | Anti-LAG-3 monoclonal antibody, antigen-binding fragment thereof and applications thereof | |
CN103865878B (en) | Antagonism suppresses the monoclonal antibody of vascular endothelial growth factor and its receptors bind and secretes its hybridoma cell line and purposes | |
CN102796707A (en) | Monoclonal antibody hybrid tumor cell strain KGH-R1 of broad spectrum anti-human p21Ras protein and monoclonal antibody | |
BRPI0910509B1 (en) | USE OF ANTIBODY, ANTIBODY AND PHARMACEUTICAL COMPOSITION | |
CN104894074A (en) | Hybridoma cell line capable of secreting S100A9 monoclonal antibody, monoclonal antibody and application thereof | |
CN104693306B (en) | A kind of people mouse chimeric mAb and its preparation method and application | |
CN102719443A (en) | Carboxyl-terminal specific anti-human amyloid protein monoclonal antibody gene and its encoded polypeptide and application | |
CN107840885A (en) | GM CSF antibody and application thereof | |
CN104892759A (en) | Ki67-resistant monoclonal antibody secreted by hybridoma cell line and application of Ki67-resistant monoclonal antibody | |
CN101988067B (en) | Prion isomer monoclonal antibody gene and application thereof | |
CN107744592A (en) | Anti- CD56 antibody and aplysiatoxin coupled complex and its production and use | |
JP2023552664A (en) | Production and use of anti-FSHR antibodies and antibody-drug conjugates thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |