CN101550457B - Liquid phase chip for detecting pathogeny of hand foot and mouth disease, preparation method and applications thereof - Google Patents
Liquid phase chip for detecting pathogeny of hand foot and mouth disease, preparation method and applications thereof Download PDFInfo
- Publication number
- CN101550457B CN101550457B CN2009100279413A CN200910027941A CN101550457B CN 101550457 B CN101550457 B CN 101550457B CN 2009100279413 A CN2009100279413 A CN 2009100279413A CN 200910027941 A CN200910027941 A CN 200910027941A CN 101550457 B CN101550457 B CN 101550457B
- Authority
- CN
- China
- Prior art keywords
- probe
- phase chip
- detection
- liquid phase
- liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a liquid phase chip for detecting pathogeny of diseases, also relates to a preparation method of the liquid phase chip and applications thereof, belonging to the technical field of medical detection. The principle of the invention is as follows: by combining the liquid phase chip technology, 5' end is added with C12 molecular arm and a specificity detection probe which ismodified by amine and contains pathogenic characteristic information, and is coupled with and fluorescent beads to prepare the liquid phase chip; hybridization is carried out to the liquid phase chipand PCR amplified products of a sample to be detected; the obtained hybridization reaction products react with SA-PE; the purpose of fast and accurately detecting pathogeny is achieved by detection ofa liquid phase chip detector, wherein the pathogenic characteristic information is reverse primer marked with biotin. The liquid phase chip has the beneficial effects of: not only overcoming the limitation of common PCR and fluorescent quantitative PCR in multiple detecting aspects, simultaneously overcoming the defects that the solid phase chip has low sensitivity and poor repeatability for detecting results, having characteristics of various detecting types, short reaction time, high sensitivity, strong specificity and accurate detection and having wide application prospect.
Description
Technical field
The present invention relates to a kind of liquid-phase chip that detects disease pathogen, also relate to the preparation method and the application of this liquid-phase chip, belong to technical field of medical detection.
Background technology
(hand, foot and mouth disease are that (pilosity is born in the infant for enterovirus, the acute infectious disease that EV) causes, can cause the fash or the bleb at positions such as heating and hand, foot, oral cavity by multiple enterovirus HFMD) to hand foot mouth disease.Small number of patients can cause severe complications such as the disease relevant with neural system such as aseptic meningitis, BBE, acute slowness paralysis and myocarditis, pulmonary edema, and indivedual severe infant disease progressions are fast, easily takes place dead.The EV that causes HFMD comprises enterovirns type 71 (EV71), A group Coxsackie virus (coxsackie A virus, CAV) and some serotype of Echo virus (echo virus), EV71 and coxsackie virus A 16-type (CAV16) the main cause of disease of HFMD outbreak of epidemic often wherein, the two is closely related on genetics.Different with CAV16, EV71 infects the large percentage that causes severe cases, because EV inapparent infection rate height, infectivity is strong, can cause in a short time and be very popular, and HFMD does not still have effective vaccine and specific treatment means so far, so no matter EV is all to have important value for instructing treatment or controlling the HFMD epidemic situation if being carried out rapid detection.
Liquid-phase chip technology is that a kind of collecting type technology, fluorescent microsphere, laser, digital signal processing and the traditional chemical technology that have developed the mid-90 in 20th century are the new bio molecule high-throughput multi detection technique of one.This technology utilizes polystyrene microsphere as reaction carriers, with fluorescence detector as detection platform, nucleic acid and protein and other are carried out high-throughout many indexs parallel detection, both satisfied the requirement of high throughput testing, also possessed quick and precisely simultaneously, highly sensitive, specificity is good, as a result advantage such as good reproducibility.Liquid-phase chip technology has been widely used in every field since coming out, promoted the fast development of scientific research and clinical detection technique greatly.For example, the applying date is on October 11st, 2005, application number is 200510044899.8, and title is the Chinese patent of " liquichip for parallel detection of colorectal cancer protein marker and preparation method thereof and application ", discloses the application of liquid-phase chip in the large bowel cancer protein marker detects.Liquid-phase chip technology be one flexibly, open technology platform, can make up accordingly as required, thus simultaneously to multiple difference biomolecules to be checked carry out fast, cheap, detection accurately.Up to now, the existing hundreds of covers in the whole world are based on the detection platform of this technology, the exploitation aspect of diagnostic reagent also develops quite rapid, for example the applying date is 2007.04.30, application number is 200710027841.1, title is " detecting liquid phase chip reagent box of multiple anti EB virus antigen-antibody and preparation method thereof ", discloses the application of liquid-phase chip in detecting the nasopharyngeal carcinoma test kit.But, do not have the detection method that liquid-phase chip technology is not used for HFMD cause of disease EV.At present, the detection method of EV comprises that viral separation and Culture, viral nucleic acid detect and three aspects of Serological testing.The authentication method of virus separation and Culture is to utilize EV combination serum and EV71 type standard serum that neutralization test is carried out in the isolated viral strain after cytopathy occurring to identify.Yet the EV that can obtain at present makes up the antiserum(antisera) that does not still comprise EV71 and CAV16 in the serum, and monovalent EV71 antiserum(antisera) may make detected result be false negative because of antigenic drift again, perhaps cross-immune reaction occurs with CAV16.Simultaneously, viral separation method is time-consuming, effort, and it is few to detect kind, can't satisfy the needs of handling a large amount of samples during the disease popularity simultaneously.It is to adopt RT-polymerase chain reaction (reverse transcriptase PCR that viral nucleic acid detects, RT-PCR) technology, main means for current enterovirus rapid detection, this method detection sensitivity height, simple to operate, but has sample contamination, shortcomings such as false positive rate height, simultaneously, regular-PCR and quantitative fluorescent PCR all are unfavorable for multiple detection, because respectively organize all multifactor susceptibility and specificitys that directly influenced multiple detection such as non-compatibility, amplification background height and experimental repeatability difference that primer exists.The same needs that can not satisfy quick diagnosis owing to detect the limitation of flux of Serological testing.Detect though biochip technology is used for enterovirus, can accomplish fast high-flux, traditional solid phase chip costs an arm and a leg, and susceptibility is not high, and the repeatability of detected result is poor.
Summary of the invention
The present invention is directed to the shortcoming that above prior art exists, propose liquid-phase chip of a kind of rapid detection hand foot mouth disease cause of disease and preparation method thereof, and reach by application it detect that kind is many, the reaction times short, the effect of highly sensitive and high specificity.
Principle of the present invention is: in conjunction with liquid-phase chip technology, 5 ' end is added C
12Molecular arm and amido modified after, the specificity detection probe and the fluorescent microsphere coupling that contain the cause of disease characteristic information make liquid-phase chip, again the pcr amplification product of liquid-phase chip and testing sample is hybridized, hybridization product that obtains and SA-PE reaction, detect by the liquid-phase chip detector and to reach the purpose that quick and precisely detects cause of disease, wherein the cause of disease characteristic information reverse primer of vitamin H that has been mark.
Purpose of the present invention is achieved through the following technical solutions: a kind of liquid-phase chip that detects the hand foot mouth disease cause of disease, constitute by the fluorescent microsphere that is coated with specificity detection probe respectively, at least a by in the following sequence-specific probe of its specificity detection probe adds C at 5 ' end
12Molecular arm and amido modified obtaining:
EV-probe CGACTACTTTGGGTGTCCGTGTT
EV71-probe TCACCTGCGAGTGCTTATCAATG
CAV16-probe ATTGGGAATTTCTTTAGCCGTGC
Rnase-probe TTCTGACCTGAAGGCTCTGCGCG。
The present invention detects the liquid-phase chip preparation method of hand foot mouth disease cause of disease, may further comprise the steps: the first step, by to homology comparison in the existing nucleic acid database according to conserved sequence, draws specific probe at least a of following sequence:
EV-probe CGACTACTTTGGGTGTCCGTGTT
EV71-probe TCACCTGCGAGTGCTTATCAATG
CAV16-probe ATTGGGAATTTCTTTAGCCGTGC
Rnase-probe TTCTGACCTGAAGGCTCTGCGCG
5 ' end of second step, the specific probe that obtains in the first step adds C
12Molecular arm and amido modified obtains specificity detection probe;
The 3rd step, with second specificity detection probe and the fluorescent microsphere coupling that obtain of step, become the specific detection microballoon, promptly make required liquid-phase chip.
Above-mentioned specific probe be at EV 5 ' end non-coding region (5 '-UTR), EV71 VP1 district, CAV16 VP1 district each section of nucleotide sequence and a kind of in rnase (Rnase) gene.
In the step 3, per 1 * 10
6The specificity detection probe add-on of individual fluorescent microsphere correspondence is 0.04～0.1nmol.
The present invention detects the application of the liquid-phase chip of hand foot mouth disease cause of disease, mainly may further comprise the steps: the first step, by to homology comparison in the existing nucleic acid database according to conserved sequence, draws at least a of following specific detection primer:
EV forward CCCTGAATGCGGCTAATCC
The reverse ATTGTCACCATAAGCAGCCA of EV
EV71 forward CAGGTTTCAGTRCCATTCAT
The reverse ATTAGGACATGCCCCRTATT of EV71
CAV16 forward GAACCAYCACTCCACRCAGGAG
The reverse GTRCCCGTAGTGGGCATTG of CAV16
Rnase forward AGATTTGGACCTGCGAGCG
The reverse GAGCGGCTGTCTCCACAAGT of Rnase;
Second the step, above-mentioned reverse primer is carried out biotin labeling, obtain the specific detection primer of mark;
The 3rd step, the RT-PCR testing sample that increases obtain the pcr amplification product of testing sample;
The pcr amplification product of the 4th step, testing sample and liquid-phase chip hybridization obtain the hybridization thing;
The 5th step, hybridization product and streptomycete avidin-phycoerythrin react;
The 6th goes on foot, detects by the liquid-phase chip detector.
Above-mentioned steps three, step 4 and step 5 are further realized by following steps:
A. testing sample is carried out primer concentration asymmetric 4 heavy PCR reactions, wherein the forward primer concentration range in the specific detection primer is: 0.04 μ M～0.16 μ M, and the reverse primer concentration range in the specific detection primer is 0.4 μ M～0.8 μ M;
B. the hybridization system is: mixing fluorescent microsphere 5～2.5 μ l of 1.5 * TMAC of 33 μ l, coupling specificities detection probes, pcr amplification product 1～10 μ l of testing sample, blank well replaces the PCR product with equivalent TE, supply reaction volume to 50 μ l with TE, 52 ℃ of hybridization 10min obtain the hybridization product;
C. after the centrifugal 2min of hybridization product abandons supernatant, add streptomycete avidin-phycoerythrin reaction that 1 * TMAC dilution back concentration is 4ug/ml, 52 ℃ of hybridization 10min.
In above-mentioned detection method with the specific detection primer that detects Rnase and specificity detection probe as the positive control in the detection method.
The liquid-phase chip of detection hand foot mouth disease cause of disease provided by the present invention and detection method thereof not only can detect enterovirus, also can carry out somatotype to enterovirns type 71 and coxsackie virus A 16-type simultaneously, thereby the hand foot mouth disease cause of disease is detected and somatotype fast and accurately, what deserves to be mentioned is: introduce Rnase simultaneously as positive quality control, can monitor the working order of whole detection architecture.This method based on liquid-phase chip detection hand foot mouth disease cause of disease has extraordinary signal-noise ratio, designed primer and probe have extraordinary specificity, the enterovirus infection of EV71, CAV16 and other type can be accurately distinguished, and the polyinfection of EV71 and CAV16 can be accurately diagnosed.Its beneficial effect is: not only overcome regular-PCR and the quantitative fluorescent PCR limitation in multiple context of detection, it is not high simultaneously to have overcome solid phase chip susceptibility yet, the defective of the repeatability difference of detected result, and have detect that kind is many, the reaction times short, highly sensitive, high specificity and detect characteristic accurately, have broad application prospects.
Description of drawings
The present invention is further illustrated below in conjunction with accompanying drawing.
Fig. 1 is the principle schematic of detection method of the present invention;
Fig. 2 is the determined gate value of the microballoon of coupling specificities probe;
Fig. 3 is a routine EV71 sample detection figure;
Fig. 4 is a routine CAV16 sample detection figure;
Fig. 5 is that routine Coxsackie B virus 3 types (CBV3) sample detects figure;
Fig. 6 is that routine Coxsackie B virus 5 types (CBV5) sample detects figure;
Fig. 7 is that routine Echo virus 7 types (ECHO7) sample detects figure;
Fig. 8 is that routine Echo virus 30 types (ECHO30) sample detects figure.
Embodiment
Principle of the present invention is as shown in Figure 1: in conjunction with liquid-phase chip technology, 5 ' end is added C
12Molecular arm and amido modified after, the specificity detection probe and the fluorescent microsphere coupling that contain the cause of disease characteristic information make liquid-phase chip, again the pcr amplification product of liquid-phase chip and testing sample is hybridized, hybridization product that obtains and SA-PE reaction, detect by the liquid-phase chip detector and to reach the purpose that quick and precisely detects cause of disease, wherein the cause of disease characteristic information reverse primer of vitamin H that has been mark.
Embodiment one
1. present embodiment detects the liquid-phase chip of hand foot mouth disease cause of disease, be to constitute by the fluorescent microsphere that is coated with specificity detection probe respectively, wherein, specificity detection probe adds C by following sequence-specific probe (having at least a getting final product during practical application) at 5 ' end
12Molecular arm and amido modified obtaining:
EV-probe CGACTACTTTGGGTGTCCGTGTT
EV71-probe TCACCTGCGAGTGCTTATCAATG
CAV16-probe ATTGGGAATTTCTTTAGCCGTGC
Rnase-probe TTCTGACCTGAAGGCTCTGCGCG。
2. the preparation method of above-mentioned liquid-phase chip is as follows:
The first step, utilization bioinformation gain knowledge and associated biomolecule information science software to all EV 5 ' end non-coding regions that can retrieve in the existing nucleic acid database (5 '-UTR), EV71VP1 district and CAV16 VP1 district nucleotide sequence carry out homology and compare, according to conserved sequence, design is at the specific probe of each section; Design specific probe at rnase (Rnase) gene simultaneously as positive control, with the working order of monitoring and detection system.Designed specific probe sequence is as follows:
EV-probe CGACTACTTTGGGTGTCCGTGTT
EV71-probe TCACCTGCGAGTGCTTATCAATG
CAV16-probe ATTGGGAATTTCTTTAGCCGTGC
Rnase-probe TTCTGACCTGAAGGCTCTGCGCG
5 ' end of second step, the specific probe that obtains in the first step adds C
12Molecular arm and amido modified obtains specificity detection probe;
More than specific probe synthetic and modify and finish in two steps by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
The 3rd step, with second specificity detection probe and the fluorescent microsphere coupling that obtain of step, become the specific detection microballoon, promptly make required liquid-phase chip, specific practice is: get 200 μ l (2.5 * 10
6Individual) carboxylated microballoon (available from U.S. Bio-Rad company), abandon supernatant behind the centrifugal 2min of 10000g, add the 2-[N-morpholino] ethyl sulfonic acid (MES) (0.1M, pH=4.5) 25 μ l, mixing.The specificity detection probe that makes among the step 2-1 is diluted to 0.1mM with MES, getting 2 μ l adds in the reaction system, 10mg/ml 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) the 2.5 μ l (1.25～2.5 μ l) that add fresh configuration again, the room temperature lucifuge is hatched 30min behind the mixing, the EDC that repeats to add fresh configuration once, the room temperature lucifuge is hatched 30min once more, (0.02%V/V) (0.1%W/V) each washs once with 0.5ml sodium laurylsulfonate (SDS) with 0.5ml tween 20 (Tween-20), use the resuspended microballoon of 200 μ l Tris-EDTA (TE) at last, 4 kinds of microballoons are mixed in hematimeter counting back, with the concentration to 2000 of every kind of microballoon of TE dilution/μ l, be liquid-phase chip, 4 ℃ keep in Dark Place.Wherein, the prescription of MES coupling buffer is as follows:
0.1M MES coupling buffer (pH=4.5) prescription (250ml):
Filter back 4 ℃ of storages.
3. adopt the above-mentioned liquid-phase chip that makes that sample is detected
The first step, utilization bioinformation gain knowledge and associated biomolecule information science software to all EV 5 ' end non-coding regions that can retrieve in the existing nucleic acid database (5 '-UTR), EV71VP1 district and CAV16 VP1 district nucleotide sequence carry out homology and compare, according to conserved sequence, design and synthesize degenerated primer at each section; Design primer at rnase (Rnase) gene simultaneously as positive control, with the working order of monitoring and detection system.Institute's synthetic primer sequence is as follows:
EV forward (EV-For) CCCTGAATGCGGCTAATCC
EV is (EV-Rev) ATTGTCACCATAAGCAGCCA oppositely
EV71 forward (EV71-For) CAGGTTTCAGTRCCATTCAT
EV71 is (EV71-Rev) ATTAGGACATGCCCCRTATT oppositely
CAV16 forward (CAV16-For) GAACCAYCACTCCACRCAGGAG
CAV16 is (CAV16-Rev) GTRCCCGTAGTGGGCATTG oppositely
Rnase forward (Rnase-For) AGATTTGGACCTGCGAGCG
Rnase is (Rnase-Rev) GAGCGGCTGTCTCCACAAGT oppositely
Second the step, above-mentioned reverse primer EV-Rev, EV71-Rev, CAV16-Rev and Rnase-Rev are carried out biotin labeling, obtain the specific detection primer of mark;
Synthetic and the modification of primer is finished by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd in above-mentioned two steps.
The 3rd step, the RT-PCR testing sample that increases, obtain the pcr amplification product of testing sample, method is as follows: the RT-PCR reaction is primer concentration asymmetric 4 heavy PCR reactions, wherein the concentration of forward primer is got in the specific detection primer: 0.08 μ M, the concentration of reverse primer is got in the specific detection primer: 0.6 μ M.The RT-PCR reaction system is as follows:
5×RT-PCR?Buffer 5μl
dNTP 1μl
Enzyme?mix 1μl
Each 1 μ l of specific detection primer
RNA template 5 μ l
ddH2O 5μl
Totally 25 μ l
The pcr amplification condition is: 50 ℃ of 30min; 95 ℃ of 15min, 94 ℃ of 30sec, 56 ℃ of 1min30sec, 72 ℃ of 30sec, 45 circulations; 72 ℃ of 5min; Obtain the pcr amplification product of testing sample;
The 4th step, the liquid-phase chip hybridization of getting the pcr amplification product of testing sample in the step 3 and making, obtain the hybridization thing, the hybridization system of pcr amplification product and liquid-phase chip is 50 μ l:1.5 * tetramethylammonium chlorides (TMAC), 33 μ l, liquid-phase chip 1 μ l, pcr amplification product 5 μ l, blank well replaces pcr amplification product with equivalent TE, supplies reaction volume to 50 μ l with TE.The condition of hybridization is: 52 ℃ of hybridization 15min;
The 5th step, hybridization product and streptomycete avidin-phycoerythrin (SA-PE) react, abandon supernatant after getting the centrifugal 2min of hybridization product 10000g that step 4 makes, the SA-PE (4ug/ml) of the fresh dilution of adding 1 * TMAC is totally 75 μ l, 52 ℃ of hybridization 10min;
The 6th goes on foot, detects by the liquid-phase chip detector, at first, directly read the microballoon of coupling specificities probe in the above experiment by liquid-phase chip detector (Bio-Plex System), repeat 3 times, the value of determining Gate value is 4335-14262, and the parameter of chip detector is provided with as follows then:
Events:50; Min Events:0; As shown in Figure 2, the determined Gate value:4335-14262 of the microballoon of coupling specificities probe.
Go up machine testing behind hybridization product and the SA-PE reaction 10min.
The prescription of described main solution is as follows:
20%Sarkosyl fill a prescription (250ml):
Filter the back room temperature storage;
1.5 * TMAC hybridization buffer prescription (250ml):
Room temperature storage;
1 * TMAC hybridization buffer prescription (250ml):
Room temperature storage.
5. detected result and data analysis
5.1, positive judgment value (cut-off value) determine to get 8 parts of negative control samples, adopt method of the present invention to detect, calculate every specific specificity and detect microballoon average fluorescent strength (median fluorescent intensity, MFI) mean and standard deviation, detect the cut-off value of index as correspondence with the value of mean+4 times standard deviation gained, be higher than the cut-off value and just be considered as this index positive, each cut-off value that detects index is as follows:
EV：182； EV71：135； CAV16：112； Rnase：128
5.2, sensitivity test result carries out behind the gradient dilution RNA template of EV71 and CAV16 virus separation and Culture thing with method detection of the present invention, the results are shown in Table 1, reduction along with RNA concentration, the fluorescence intensity that detects weakens, the present invention is 1pg to the limit of identification of EV71 and CAV16 RNA, the detection sensitivity height.
Table 1 sensitivity test result
5.3, the specificity test-results
Adopt method of the present invention to detect EV71, CAV16, CBV3, CBV5, ECHO7 and ECHO30 enterovirus separation and Culture sample.As Fig. 3, in the EV71 sample detected figure, coupling EV was universal, the microballoon of EV71 and Rnase specific probe has all obtained higher fluorescent value, be positive, and the microballoon fluorescent value of coupling CAV16 probe was lower than the cut-off value, was negative; As Fig. 4, in the CAV16 sample detected figure, coupling EV was universal, three kinds of microballoons of CAV16 and Rnase probe have obtained higher fluorescent value, be positive, and the microballoon fluorescent value of coupling EV71 probe was lower than 100, was negative; As Fig. 5, detect among the figure at the CBV3 sample; As Fig. 6, detect among the figure at the CBV5 sample; As Fig. 7, detect among the figure at the ECHO7 sample; As Fig. 8, in the ECHO30 sample detects figure, all have only the universal and two kinds of microballoons Rnase probe of coupling EV to obtain positive findings.
5.4, the hand foot mouth disease clinical sample detects
Get 10 parts of hand foot mouth disease clinical samples (picking up from the throat swab and the ight soil of Sentinel point hospital), turn out to be enterovirus infection through fluorescence quantitative PCR detection, and 8 parts be that EV71 infects that 2 parts are the CAV16 infection, the result is as shown in table 2 for its chip detection.The result does contrast with fluorescence quantitative PCR detection, present method detected result and the fluorescence quantitative PCR detection result rate of coincideing reaches 100%, illustrate that the method based on liquid-phase chip detection hand foot mouth disease cause of disease provided by the present invention not only has rapidly and efficiently, the characteristics of multiple detection, and detected result is accurate, stable, reliable.Simultaneously, it can also be seen that, successfully played Quality Control effect as the positive control of this detection method whole testing process to detect Rnase from the result.
Table 2 hand foot mouth disease clinical sample detected result
In addition to the implementation, the present invention can also have other embodiments.All employings are equal to the technical scheme of replacement or equivalent transformation formation, all drop on the protection domain of requirement of the present invention.
Claims (4)
1. a liquid-phase chip that detects the hand foot mouth disease cause of disease is made of the fluorescent microsphere that is coated with specificity detection probe respectively, it is characterized in that: described specificity detection probe adds C by following sequence-specific probe at 5 ' end
12Molecular arm and amido modified obtaining:
EV-porbe CGACTACTTTGGGTGTCCGTGTT
EV71-probe TCACCTGCGAGTGCTTATCAATG
CAV16-probe?ATTGGGAATTTCTTTAGCCGTGC
Rnase-probe?TTCTGACCTGAAGGCTCTGCGCG
2. liquid-phase chip preparation method who detects the hand foot mouth disease cause of disease may further comprise the steps:
The first step, by to homology comparison in the existing nucleic acid database, according to conserved sequence, draw the specific probe of following sequence:
EV-probe CGACTACTTTGGGTGTCCGTGTT
EV71-probe TCACCTGCGAGTGCTTATCAATG
CAV16-probe?ATTGGGAATTTCTTTAGCCGTGC
Rnase-probe?TTCTGACCTGAAGGCTCTGCGCG
5 ' end of second step, the specific probe that obtains in the first step adds C
12Molecular arm and amido modified obtains specificity detection probe;
The 3rd step, with second specificity detection probe and the fluorescent microsphere coupling that obtain of step, become the specific detection microballoon, promptly make required liquid-phase chip.
3. according to the liquid-phase chip preparation method of the described detection hand foot mouth disease of claim 2 cause of disease, it is characterized in that: described specific probe at EV 5 ' end non-coding region (5 '-UTR), EV71VP1 district, CAV16VP1 district each section of nucleotide sequence and at rnase (Rnase) gene.
4. according to the liquid-phase chip preparation method of the described detection hand foot mouth disease of claim 2 cause of disease, it is characterized in that: in described the 3rd step, per 1 * 10
6The specificity detection probe add-on of individual fluorescent microsphere correspondence is 0.04～0.1nmol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100279413A CN101550457B (en) | 2009-05-14 | 2009-05-14 | Liquid phase chip for detecting pathogeny of hand foot and mouth disease, preparation method and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100279413A CN101550457B (en) | 2009-05-14 | 2009-05-14 | Liquid phase chip for detecting pathogeny of hand foot and mouth disease, preparation method and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101550457A CN101550457A (en) | 2009-10-07 |
| CN101550457B true CN101550457B (en) | 2011-07-27 |
Family
ID=41154946
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100279413A Expired - Fee Related CN101550457B (en) | 2009-05-14 | 2009-05-14 | Liquid phase chip for detecting pathogeny of hand foot and mouth disease, preparation method and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101550457B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104073569B (en) * | 2014-07-21 | 2016-06-22 | 广州市妇女儿童医疗中心 | For diagnosing the molecular marked compound of hand-foot-mouth disease pole serious symptom and detection method thereof and test kit |
| CN112111609A (en) * | 2020-10-29 | 2020-12-22 | 上海伯杰医疗科技有限公司 | Universal nucleic acid detection kit for enteroviruses |
| CN114717295B (en) * | 2022-06-09 | 2022-09-30 | 季华实验室 | Liquid phase chip method hybridization buffer solution, preparation method and liquid phase chip detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101392298A (en) * | 2008-07-15 | 2009-03-25 | 江苏省疾病预防控制中心 | Method for detecting flu and H5N1 avian influenza virus by using liquid chip |
-
2009
- 2009-05-14 CN CN2009100279413A patent/CN101550457B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101392298A (en) * | 2008-07-15 | 2009-03-25 | 江苏省疾病预防控制中心 | Method for detecting flu and H5N1 avian influenza virus by using liquid chip |
Non-Patent Citations (1)
| Title |
|---|
| Tsan-Chi Chen等.Combining Multiplex Reverse......Coxsackievirus A16.《Journal of Clinical Microbiology》.2006,第44卷(第6期),2212-2219. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101550457A (en) | 2009-10-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bai et al. | Cas12a-based on-site and rapid nucleic acid detection of African swine fever | |
| Alpdagtas et al. | Evaluation of current diagnostic methods for COVID-19 | |
| Reslova et al. | xMAP technology: applications in detection of pathogens | |
| CN101985665B (en) | Method for detecting various respiratory viruses and primers and probes thereof | |
| CN101392298B (en) | Liquid-phase chip for detecting flu and H5N1 avian influenza virus and specific detection primer and preparation method thereof | |
| Rockett et al. | Detection of novel polyomaviruses, TSPyV, HPyV6, HPyV7, HPyV9 and MWPyV in feces, urine, blood, respiratory swabs and cerebrospinal fluid | |
| Fernandes et al. | Recent advances in point of care testing for COVID-19 detection | |
| CN108913812B (en) | Multiple liquid-phase chip detection method for porcine viral diarrhea pathogen and construction thereof | |
| Murdoch et al. | Emerging advances in rapid diagnostics of respiratory infections | |
| CN105779649A (en) | Immune PCR reagent kit for detecting avian leukemia virus | |
| CN104195268A (en) | Reagent box for detecting aftosa A type, O type and Asia 1 type viruses and preparing method thereof | |
| CN108866244A (en) | Detect RPA primer and probe, kit and its method of prawn irido virus | |
| CN101550457B (en) | Liquid phase chip for detecting pathogeny of hand foot and mouth disease, preparation method and applications thereof | |
| CN106191311A (en) | A kind of quick detection Cavia porcellus LCMV, SV, PVM, Reo 3 virus multiple liquid phase method for gene chip and reagent | |
| Mu et al. | Microfluidic-based approaches for COVID-19 diagnosis | |
| Li et al. | A loop-mediated isothermal amplification-enabled analytical assay for the detection of SARS-CoV-2: A review | |
| CN106636474B (en) | Six kinds of viral primer sets of Multiple immunizations fluoroscopic examination mouse, kit and method | |
| CN106011313B (en) | A kind of the multi-fluorescence immunoassay method and reagent of quick differentiation ILTV, IBV, MG and MS | |
| CN102337352B (en) | Kit for detecting multiple influenza viruses by polymerase chain reaction (PCR) microarray | |
| CN111172301A (en) | PCR fluorescence detection kit for clostridium difficile toxin B and application thereof | |
| Zhang et al. | Diagnostic efficiency of RPA/RAA integrated CRISPR-Cas technique for COVID-19: A systematic review and meta-analysis | |
| CN110129482A (en) | Detect LAMP primer group, kit and the detection method of African swine fever virus | |
| CN112553379B (en) | Method and kit for detecting respiratory infectious disease virus based on liquid chip | |
| CN106319091B (en) | The multi-fluorescence immunoassay method and kit of a kind of quick differentiation canine distemper virus, canine parvovirus and rabies viruses | |
| CN106086241B (en) | A kind of primer, kit and the method for the multi-fluorescence immunoassay of 4 kinds of fowl respiratory pathogens of quick differentiation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110727 Termination date: 20160514 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |