CN101550184A - Marking protein on tumor drug-resistant film surface and application thereof as drug-resistant tumor drug target protein - Google Patents

Abstract

The invention relates to a marking protein on a tumor drug-resistant film surface and an application thereof as the drug-resistant tumor drug target protein, belonging to the field of the diagnosis and the reversion of drug-resistant tumor, and particularly, the protein is known to be cytokeratin 8 (CK8). The invention provides a novel film surface marker for the clinical diagnosis of the drug-resistant tumor and a novel target spot for the design of a novel tumor-resistant drug.

Description

Tumor drug resistance film surface marker albumen and as the purposes of overriding resistance tumor drug target protein

Technical field

The invention belongs to the drug resistance of tumor research field, particularly relate to a kind of tumor drug resistance film surface marker albumen and as the purposes of overriding resistance tumor drug target protein, this albumen is known as cytokeratin-8 PROTEIN C K8).

Background technology

Tumour cell is the one of the main reasons that restricts clinical cancer therapy validity, causes the chemotherapy failure to the tolerance of cancer therapy drug.According to American Cancer Society's statistics, the U.S. has 490,000 routine cancer patients's death every year approximately, and wherein the death of 90% above tumour patient is relevant with drug resistance of tumor cell in varying degrees.Tumour cell produces the phenomenon of crossing drug resistant to the different medicine of a series of structures and mechanism of action, is called tumor multi-medicine drug-resistant, has confirmed that now multiple complex redundancy mechanism fellowship is one of tumor multi-medicine drug-resistant principal element that development takes place.At present, have multiplely at the applied reversal agent of drug resistance of single factor drug-resistant tumor clinical treatment,, but all obtain significance progress as verapamil, cyclosporin A, trifluoperazine, Quinidine etc.

Find new tumor multi-medicine drug-resistant associated protein, to further understanding with understand the potential molecular mechanism that tumor drug resistance takes place, and overcome tumor drug resistance new diagnosis and treatment target spot is provided all have important value for clinical.Now existing multiple effective ways are successfully applied to approach seeks the relevant novel targets of tumor drug resistance, as high-flux medicaments sifting, and biochip technology and chemicobiology etc.The proteomics based on mass spectrometry method of newly-developed is more found and is identified that the new albumen of particular target albumen or unknown function provides novel method and convenient means.After the sample of various sources or difference in functionality state is done and is handled early stage, separate through electrophoresis or liquid chromatography, accurately identify target protein by alternative various mass spectrometry method analyses and with the database information comparison again, become the new proteic cooked mode of a kind of research.

Tremendous development along with neoplasm targeted therapy and targeted drug research, multiple treatment means and medicament forms also are used for the targeted therapy of overriding resistance tumour, comprise new compound entity, micromolecular inhibitor, toxin conjugated monoclonal antibody, antisense nucleic acid medicament and based on RNA interferential gene therapy etc.Wherein monoclonal antibody combines with antigenic specificity because of it, and as carrier and fluorescent marker, or toxin and radioactive substance are coupled at mutually in tumor drug resistance specific diagnosis and the targeted therapy significant application value is arranged.In recent years, the RNA perturbation technique is applied to tumor drug resistance also broad research.

Because the research multi-drug resistance of the tumor has inherent difficulty in the body, therefore a large amount of different tumor tissues source, the drug-resistant cell strain that produces through external drug selectivity effect become the important models of the multifactor resistance mechanism of research, and have now found that kinds of tumors resistance related mechanism in these experimental models.

Summary of the invention

The objective of the invention is to disclose a kind of tumor drug resistance film surface marker albumen and as the purposes of overriding resistance tumor drug target protein.

The surface of cell membrane resistance marker protein that the present invention relates to shows it is a kind of known albumen (CK8) that is called cytokeratin 8 through second order ms evaluation and order-checking, has the gene order shown in the SEQ ID NO:1.

And related tumor drug resistance film surface marker albumen is design overriding resistance tumor drug target protein;

And, also relate to the medicine that utilizes this target protein to design;

And, also relate to purposes as the overriding resistance tumor drug target protein;

And, also relate to the application that preparation is used for drug resistance of tumor clinical diagnosis agent.

The invention has the beneficial effects as follows: the associated protein that is positioned the tumor cell membrane surface provided by the present invention, having overexpression in the drug-resistant tumor cell, hang down the specificity of expressing in responsive tumour cell, is a kind of new tumor drug resistance film surface marker albumen.Therefore, the present invention provides new target spot for the design of overriding resistance tumour new drug, and on this basis, in order to design and the direct new drug of exploitation at drug-resistant tumor.

Description of drawings

Accompanying drawing 1 is that monoclonal antibody 9C6 combines the enzyme linked immunoassay comparison diagram with the difference of responsive and mdr cell MCF-7/MX mdr cell.

Accompanying drawing 2 is difference binding immunoassay trace photos of monoclonal antibody 9C6 and responsive and mdr cell MCF-7/MX mdr cell, and wherein GAPDH is as internal reference.

Accompanying drawing 3 is monoclonal antibody 9C6 specific recognition mdr cell film surface C K8 molecular immune precipitation photos.

Accompanying drawing 4 is monoclonal antibody 9C6 specific recognition mdr cell film surface C K8 molecular immune trace checking photos.

Accompanying drawing 5 is MS/MS mass spectrum sequential analysis figure groups.

Accompanying drawing 6 is the special medicine-resistant cell line MCF-7/MX surface of cell membrane high expression level photos that are positioned.

Accompanying drawing 7 is expression level photos that medicine-resistant cell line MCF-7/MX returns to sensitive cells film surface.

Accompanying drawing 8 is that subcellular components is analyzed photo.

Accompanying drawing 9 is that MCF-7 sensitive cells and MCF-7/MX mdr cell are to fiber adhesion albumen adhesion difference comparison diagram.

Accompanying drawing 10 is significantly to reduce the MCF-7/MX cell to the proteic adhesion experimental result picture of fiber adhesion.

Embodiment

The mammary cancer medicine-resistant cell line MCF-7/MX that the present invention produces through the mitoxantrone in-vitro screening with a strain is as multifactor resistance research model.Existing known mammary cancer resistance associated protein BCRP participates in the formation of this cell drug-resistant phenotype, and following examples explanation participates in another albumen that the present invention relates to of above-mentioned cell resistance mechanism except that BCRP.

For this purpose, the present invention obtains specific antibody at the mdr cell film surface antigen by differential screening, with after immunoprecipitation obtains immune complex; Polyacrylamide gel electrophoresis is isolated antigen, and through MALDI-TOF/TOF MS/MS mass spectroscopy, identifying antigen is Keratin sulfate 8 (CK8), and is proved conclusively with the method for immunoblotting and mutual immunoprecipitation.Particularly importantly, subcellular components analysis and laser confocal microscope are observed the special surface of cell membrane that is positioned of CK8 of all finding the medicine-resistant cell line high expression level.Suppress CK8 with special anti-CK8-RNAi, significantly reduce mdr cell film surface C K8 overexpression and return to the expression level on sensitive cells film surface, these results confirm all that CK8 crosses on multidrug resistance breast cancer cell MCF-7/MX film surface and express.Further CK8 is carried out resistance functional verification test, confirm that film CK8 crosses the dependency of expressing with tumor drug resistance.CK8 known in the state of the art has expression on some tumor cell membrane surface, but not any prompting of tumor cell membrane surface C K8 and drug resistance of tumor, and the present invention proposes tumor cell membrane surface C K8 first to cross expression be a kind of tumor drug resistance marker protein.

Membranin CK8 of the present invention can be used as the target spot of overriding resistance tumour medicine effect, carries out the design of overriding resistance tumour medicine.Described in detail as following embodiment, the present invention has made up bob folder shRNA carrier transfection MCF-7/MX mdr cell, and specificity suppresses the CK8 expression level, and significantly recovers the susceptibility of mdr cell to chemotherapeutic, thus reversing drug resistance.Confirm that film CK8 of the present invention can be used as the action target spot of effective inhibition drug resistance of tumor.Embodiment only is an applicating example, and its application is not limited thereto.

Below enumerate part embodiment for the present invention is specifically described, but do not limit the present invention.

The evaluation of embodiment 1 mdr cell MCF-7/MX and sensitive cells MCF-7 differentially expressed protein.

A, antibody differential screening:

With mdr cell MCF-7/MX (2 * 10 ⁷) as immunogen immune BalB/C mouse.Behind the booster immunization, extracting spleen cell and myelomatosis SP2/0 cell merge in three fundamental immunities and spleen.Screening positive clone screening of employing indirect elisa method and cloning are cultivated: MCF7/MX cell inoculation 96 orifice plates, and incubated overnight adds the hybridoma culture supernatant by 100 μ l/ holes, and 37 ℃ were reacted 2 hours; Abandon supernatant liquor, add sheep anti-mouse igg-HRP, 37 ℃ were reacted 30 minutes; After substrate O-Phenylene Diamine (OPD) effect, 2mol/LH ₂SO ₄Termination reaction, microplate reader detection reaction result.Intersect with corresponding sensitive cells MCF7 simultaneously and screen.Normal BalB/c mice serum is made negative control (1: 1000), and immune serum is made positive control (1: 1000).To detect discrepant positive hole and change 24 orifice plates cultivation 1-2 days over to, counting is got 100 cell inoculation to 96 orifice plates, cultivates detection in 9-10 days.Select the antibody titer height, be single clonal growth, the form good cell carries out cloning and cultivates, all be positive to building the strain standard to all hybridoma supernatant liquors.The method that induces in the hybridoma body produces ascites in a large number, and (NJ) antibody purification 9C6 is used for subsequent experimental for Amersham Bioscience, Piscataway through Protein G-sepharose post.

B, immunoprecipitation, SDS-PAGE separates target protein:

With RIPA Buffer (the 50mM Tris-HCl that contains proteinase inhibitor (Sigma), 150mM NaCl, 0.25% SDS, 1% Triton X-100,0.25% Sodium desoxycholate, 1mM EDTA, 1mM EGTA, 1mM DTT) cracking MCF7/MX and MCF7 cell extract total protein 800-1000 μ g (concentration 1mg/ml).Earlier carry out preclearing in 4 ℃ of jog 1h with 1 μ g isotype IgG control antibodies and 20 μ l, 50% Protein A agarose suspension; The centrifuging and taking supernatant adds 5ug monoclonal antibody 9C6, and 4 ℃ of shaking table effects add 50ul 50% protein A-sepharose suspension after 2 hours again, and 4 ℃ of shaking tables spend the night.Centrifugal fast, give a baby a bath on the third day after its birth time with the RIPA lysate, add in the 2x SDS-PAGE load sample liquid boiling water and boiled the centrifuging and taking supernatant 5 minutes.Handle as negative control in the same way with isotype mouse IgG albumen.Collect supernatant liquor and carry out SDS-PAGE electrophoretic separation and Coomassie brilliant blue dyeing.The electrophoretic band of cutting resistance and sensitive cells significant difference is used for mass spectroscopy.

C, MALDI-TOF/TOF MS mass spectroscopy:

Get above-mentioned blob of viscose and add 30 μ L DD.H ₂O washed twice, 10 minute/time; Add 50mM NH ₄HCO ₃/ acetonitrile=1: 1 solution 30 μ L, 37 ℃ decoloured 20 minutes, and blotted; 3. repeating step 2, take off until blueness; Add acetonitrile 30 μ L and dewater to micelle and bleach fully, vacuum was drained 5 minutes; With the trypsinase liquid storage of 1 μ g/ μ L with 25mMNH ₄HCO ₃Dilute 100 times, every EP pipe adds 8 μ L, puts 37 ℃ of digestion and spends the night.To extract the peptide section and be dissolved in equal-volume matrix working fluid, point sample is on stainless steel plate, after the dry air with the desalination on plate of 0.% trifluoroacetic acid, analyze with AppliedBiosystem Voyager DE STR ABI 4700 MALDI-TOF/TOF mass spectrographs (ABI company), adopt the positive ion mode collection and handle molecular weight ranges in the 700-4000Da data.All albumen are identified with peptide quality collection of illustrative plates and MS/MS.4000 series explorer software, 3.0 (Applied Biosystems, Framingham, CA) gather the peak, with GPS explorer 3.5 (Applied Biosystems, Framingham, CA) retrieval of comparing of the peak information that obtains of operation Mascot Version 1.9.05 software analysis, NCBInr (version NCBI-051015) database.Following criteria for classification is pressed in retrieval: allow a mispairing cutting, coupling peptide section surpasses 4, signal to noise ratio S/N＞10, quality examination precision: parent＜1.0Da, MS/MS fragment＜0.2Da.

D, immunoblotting Western blot and immunoprecipitation checking:

The RIPA lysate effect MCF7/MX and the MCF7 cell of precooling, ultrasonic cell disintegration instrument smudge cells extracts total protein, BCA ^TMProtein Assay Kit (PIERCE) protein quantification.Respectively get 30 μ g total proteins and carry out 10% SDS-PAGE electrophoresis, change film (Millipore, Billerica, MA), 4 ℃ of sealings of 5% skimmed milk are spent the night, cold PBST (containing 0.1% Tween-20) give a baby a bath on the third day after its birth all over after, respectively with suitable dilution monoclonal antibody and the effect of commercial positive antibody room temperature 2 hours, through HRP coupling two anti-effects 1 hour.(IL) colour developing is observed monoclonal antibody and is combined with antigenic specificity for PIERCE, Rockford with SuperSignal WestPico Chemiluminescent Substrate.

The immunoprecipitation verification method is with step B mutually.

The interpretation of result of table 1 MALDI-TOF/TOF MS mass spectrum

Cak. Mass	Obsrv. Mass	±da	± ppm	Start Seq.	End Seq.	Sequcnce	Ion Score	C.I.％ Modificat ion
									965.4686	965.423	0.0456	27	254	261	AQYDELAR	35	42.693
1319.6703	1319.6151	0.0552	22	138	149	AQIFANTVDNAR	34	13.66
									2670.3918	2670.2632	0.1286	28	331	353	YALQMEQLNGLLHLESE LAQTR	81	99.999
3335.5776	3335.4487	0.1289	39	56	90	GGMGSGGLATGIAGGLA GMGGIQNEKETMQSLND R	58	99.658

The result: as shown in Figures 1 and 2, the associativity of monoclonal antibody 9C6 and MCF7/MX mdr cell and MCF7 sensitive cells is variant; The albumen of this differential expression is accredited as Keratin sulfate CK8 by accompanying drawing 3 immunoprecipitations, table 1 mass spectrum, and expression is crossed by the CK8 of checking once more of accompanying drawing 4 immunoblottings checking in the back behind the immunoprecipitation in mdr cell.The above results proves: the albumen of mdr cell MCF-7/MX and sensitive cells MCF-7 differential expression is Keratin sulfate CK8.

Embodiment 2 CK8 are at mdr cell film surface high expression level.

A, laser confocal microscope are observed: the special location of CK8 mdr cell film and high expression level:

MCF7/MX and MCF7 cell be inoculated in respectively 8 hole slide glasss (Laboratory-Tek BrandProducts, Naperville, IL), incubated overnight.Cell membrane dyeing: cell is hatched 5min with 2 μ M CM-DiI (Invitrogen) at 37 ℃, again 4 ℃ of effects 15 minutes.Cold PBS washes twice, and cell is fixed 10 minutes for 37 ℃ with 4% (w/v) Paraformaldehyde 96, again with containing 10% normal sheep serum sealing 1h.The monoclonal antibody C51 of cell and an anti-9C6 or the anti-CK8 of commercialization (Santa Cruz Biotechnology) is at 37 ℃ of effect 1h, afterwards with the sheep anti mouse fluorescence two anti-room temperature effects of FITC mark 30 minutes.Last DAPI (Sigma) (final concentration 1 μ M) effect pair cell nuclear staining in 10 minutes.(Leica, Nussloch Germany) observe laser confocal microscope.

B, anti-CK8-RNAi perturbation technique downward modulation CK8 is at the cytolemma high expression level:

Inoculation MCF-7/MX cells (2.5 * 10 ⁵/ well) in 6 orifice plates, cultivate after 24 hours, with liposome LipofectAMINE 2000 (Invitrogen, Carlsbad, CA) according to the special 20-25 nt CK8 siRNAs mixture (Santa CruzBiotechnology company) at 3 target sites of test kit specification sheets transfection 100nM, non-special siRNA of transfection and transfection reagent are organized in contrast simultaneously.Whether extract total protein reduces with western blot analysis CK8 expression level.Press as above method observation of cell surface immunofluorescence.

C, subcellular components identify that CK8 expresses increase at membrane component:

The cell of monolayer culture lysate (10mM HEPES, pH 7.4; 25mM KCl; 5mM MgCl ₂5mM EDTA) cracking, centrifugal 10 minutes of 200xg removes the nuclear precipitation; Supernatant 20, centrifugal 20 minutes of 000xg, the gained supernatant liquor is cytoplasm component (cytoplasmic fraction (C)), be precipitated as the membranin component of enrichment, with containing 1% Triton X-100,0.5% sodium deoxycholate, the solution dissolving of and 0.1% SDS, 20, behind centrifugal 10 minutes of the 000xg, collect supernatant liquor as the soluble membrane component of denaturing agent (detergent-soluble membrane fraction (M-S)), being precipitated as denaturing agent indissoluble component (detergent-insoluble membrane fraction (M-P)). full cell extract (Whole celllysates (W)) is with improved RIPA lysate or contain 2% SDS, and 5% 2-mercaptoethanol and 25% glycerine are in the 1x SDS-PAGE load sample liquid preparation of 0.05 M Tris-HCl buffer (pH 6.8).Every kind is extracted component and all adds proteinase inhibitor.Each component is through BCA ^TMGet same amount behind Protein Assay Kit (PIERCE) protein quantification and carry out polyacrylamide gel electrophoresis (SDS-PAGE) separation.

The result: laser confocal microscope observation of cell surface fluorescence dye level, the result shows that CK8 is special to be positioned medicine-resistant cell line MCF-7/MX surface of cell membrane as shown in Figure 6, and high expression level.Suppress CK8 with special anti-CK8-RNAi, the result can significantly reduce mdr cell film surface C K8 overexpression and return to the expression level on sensitive cells film surface as shown in Figure 7.Subcellular components is as shown in Figure 8 analyzed photo and is confirmed that also CK8 obviously increases at multidrug resistance breast cancer cell MCF-7/MX membrane component expression amount.Therefore, membranin CK8 can be used as the tumor drug resistance mark at drug-resistant tumor cell surface high expression level.

Embodiment 3 film CK8 inquire in the functional verification and the mechanism of tumor drug resistance.

The sensitive cells of A, transfection CK8 expression vector produces resistance:

The PECE-CK8 expression vector contains total length CK8 encoding gene, and (Navi Mumbai India) is so kind as to give for CancerResearch Institute, Kharghar by Dr.Milind Vaidya.With FuGENE HD (RocheApplied Science) transfection reagent, (Addgene, MA) carrier is to l cell NIH3T3 in the pBABE of common transfection PECE-CK8 of 10: 1 ratio and puromycin resistance.Obtain the positive colony of stably express CK8 with the Puromycin screening.(SRB, Sigma) (151-158) detection is to the susceptibility of chemotherapeutic for Papazisis, K.T.et al. (1997) J.Immunol.Methods 208 for method with the sulforhodamine B that optimizes.With Prism software (GraphPad Software, San Diego, CA) and Y=Bottom+ (Top-Bottom)/{ 1+10^[(LogEC ₅₀-X)] equation model tracing analysis calculating IC ₅₀Value, each clone is got repeated experiments 5 times.Do the analysis of sided t inspection statistics with Prism software (GraphPad Software).

B, the special effective reversing drug resistance phenotype of anti-CK8-RNAi perturbation technique:

Press MCF-7/MX cell (2000/hole) the inoculation 96-orifice plate of preceding method transfection CK8-RNAi, parallel three multiple holes, the medicine that adds different concns places 37 ℃, 5% CO ₂Incubator was cultivated 48 hours.Detect cell toxicant with as above SRB method.With Prism software (GraphPad Software, San Diego, CA) and Y=Bottom+ (Top-Bottom)/{ 1+10^[(LogEC ₅₀-X)] equation model tracing analysis calculating IC ₅₀Value, each clone is got repeated experiments 5 times.Do the analysis of sided t inspection statistics with Prism software (GraphPad Software).

C, film CK8 participate in tumor drug resistance by adhering to resistance mechanism:

96 orifice plates wrap respectively by 10,20 μ g/ml fiber adhesion albumen (FN, Sigma-Aldrich, St Louis, MO) 4 ℃ spend the night after, with 0.5% BSA room temperature sealing 30 minutes, cold PBS gave a baby a bath on the third day after its birth time.Every hole adds 0.1ml 5 * 10 respectively ⁵/ ml MCF-7 or MCF-7/MX cell suspension were hatched 1 hour for 37 ℃, and cold PBS washes the unconjugated cell of twice removal.The adherent cell is fixed with 3% Paraformaldehyde 96, contains 0.5% Viola crystallina (preparation of 30% ethanol) dyeing 15 minutes.PBS washes usefulness 0.1ml dmso solution cell twice, detects the 570nm absorption peak.Three repeated experiments, sided t inspection statistics result.

Table 2 MCF-7/MX transfection siRNAs is to the change of the susceptibility of chemotherapeutic

A IC50 and SD standard deviation are calculated by 5 repeated experiments.

B RR, resistance multiple relatively: the ratio of each experimental group and MCF-7IC50.

C P＜0.001 is compared with transfection contrast siRNA.

D P＜0.05 is compared with the anti-BCRPsiRNA of transfection.

The result: the NIH 3T3 cell of transfection PECE-CK8 expression vector and empty carrier is to the sensitivity difference of chemotherapeutic mitoxantrone relatively respectively, the result shows that both IC50 values are respectively 107.5 ± 4.66 (μ M) and 3.26 ± 1.13 (μ M), and promptly transfection CK8 makes NIH 3T3 cell produce 33 times of resistances to mitoxantrone.Simultaneously, the expression of reducing CK8 with the method for special siRNA significantly increases the susceptibility of mdr cell MCF-7/MX to chemotherapeutic, as shown in table 2: transfection siRNA-CK8 compares with the MCF-7/MX cell of transfection siRNA-Control, the former makes mdr cell to mitoxantrone (Mitoxantrone), the susceptibility of topotecan (Topotecan) and daunorubicin (Daunorubicin) increases by 40.2% respectively, 33.0% and 62.2%, (P＜0.001). while cell adhesion experimental result (being Prism GraphPad software statistics result): accompanying drawing 9 shows that sensitive cells is different to the proteic adhesion of fiber adhesion with mdr cell, and the adhesion of mdr cell significantly strengthens; Accompanying drawing 10 shows that the expression of special interference CK8 significantly reduces the MCF-7/MX cell to the proteic adhesion of fiber adhesion, and adhesion is close with the sensitive cells level.These results show that all film CK8 expresses crossing of drug-resistant tumor cell MCF-7/MX, participates in the formation of tumor drug resistance phenotype.Can draw based on the above results as drawing a conclusion: the cellular localization of Keratin sulfate CK8 and expression amount change gives its new function: crossing of multidrug resistance breast cancer cell film surface C K8 expressed, and has vital role in the formation of the generation development of multidrug resistance and drug-resistant phenotype.

Embodiment 4 uses membranin CK8 as target spot reversing tumor resistance.

A, structure shRNA carrier pGE/CK8-A and pGE/K8-B:

Synthetic following oligonucleotide is through annealing, with BamH/Xba I double digestion, glue reclaim the rna interference vector pGE-1 that is connected into pre-enzyme behind the purifying and cuts (Stratagene, La Jolla, CA), dna sequencing checking insertion sequence makes up anti-CK8 shRNA pGE/CK8-A and pGE/CK8-B interference carrier.With FuGENE HD (RocheApplied Science) transfection reagent respectively transfection psiRNA/BCRP or/and pGE/CK8 and empty plasmid to the MCF-7/MX cell.The cell of stable transfection screens with 400 μ g/ml G418 (Geneticin, Gibco BRL).Synthetic following oligonucleotide sequence is used to make up the CK8 interference carrier:

Pair 1 for pGE/CK8-A

Fw：5’GATCCCGAGTCTGGGATGCAGAACAGAAGCTTG TGTTCTGCATCCCAGACTTTTTTT 3’and Rev

5’CTAGAAAAAAAGTCTGGGATGCAGAACACAAGCTTCTGTTCTGCATCCCAGACTCGG 3’

Pair 2 for pGE/CK8-B

Fw：5’GATCCCGCCATGCCTCCAGCTACAAAGAAGCTTG TTTGTAGCTGGAGGCATGGTTTTTT 3’and Rev

5’CTAGAAAAAACCATGCCTCCAGCTACAAACAAGCTTCTTTGTAGCTGGAGGCATGGCGG 3’

B, transfection interference carrier have the susceptibility of efficient recovery drug-resistant tumor cell to chemotherapeutic:

Detect the reactivity of above-mentioned transfectional cell with as above SRB method to chemotherapeutic.

Table 3 MCF-7/MX transfection shRNAs is to the change of the susceptibility of chemotherapeutic

^aIC50 and SD standard deviation are calculated by 5 repeated experiments

^bRR, resistance multiple relatively: the ratio of each experimental group and MCF-7 IC50

^cP＜0.001 is compared with transfection contrast shRNA

Result: as above shown in the table 3, making up also, transfection bob presss from both sides the shRNA-CK8 carrier to the MCF-7/MX mdr cell, make its susceptibility increase by 36.5%, 30.20% and 60% (P＜0.001) respectively to chemotherapeutic mitoxantrone (Mitoxantrone), topotecan (Topotecan) and daunorubicin (Daunorubicin).Therefore, CK8 might become the novel targets of diagnosis of reversing tumor resistance and treatment as new resistance related film surface marker.Many target treatments for drug-resistant tumor provide strong theoretical basis.

Sequence table

＜110〉Inst. of Hematology, Chinese Academy of Medical Sciences

＜120〉tumor drug resistance film surface marker albumen and as the purposes of overriding resistance tumour medicine action target spot

<160>1

<170>PatentIn version 3.3

<210>1

<211>1771

<212>DNA

<213>Homo sapiens

<400>1

ctaggatctc cgcctggttc ggcccgcctg cctccactcc tgcctctacc atgtccatca 60

gggtgaccca gaagtcctac aaggtgtcca cctctggccc ccgggccttc agcagccgct 120

cctacacgag tgggcccggt tcccgcatca gctcctcgag cttctcccga gtgggcagc 180

gcaactttcg cggtggcctg ggcggcggct atggtggggc cagcggcatg ggatgcatca 240

ccgcagttac ggtcaaccag agcctgctga gcccccttgt cctggaggtg gaccccaaca 300

tccaggccgt gcgcacccag gagaaggagc agatcaagac cctcaacaac aagtttgcct 360

ccttcataga caaggtacgg ttcctggagc agcagaacaa gatgctggag accaagtgga 420

gcctcctgca gcagcagaag acggctcgaa gcaacatgga caacatgttc gagagctaca 480

tcaacaacct taggcggcag ctggagactc tgggccagga gaagctgaag ctggaggcgg 540

agcttggcaa catgcagggg ctggtggagg acttcaagaa caagtatgag gatgagatca 600

ataagcgtac agagatggag aacgaatttg tcctcatcaa gaaggatgtg gatgaagctt 660

acatgaacaa ggtagagctg gagtctcgcc tggaagggct gaccgacgag atcaacttcc 720

tcaggcagct atatgaagag gagatccggg agctgcagtc ccagatctcg gacacatctg 780

tggtgctgtc catggacaac agccgctccc tggacatgga cagcatcatt gctgaggtca 840

aggcacagta cgaggatatt gccaaccgca gccgggctga ggctgagagc atgtaccaga 900

tcaagtatga ggagctgcag agcctggctg ggaagcacgg ggatgacctg cggcgcacaa 960

agactgagat ctctgagatg aaccggaaca tcagccggct ccaggctgag attgagggcc 1020

tcaaaggcca gagggcttcc ctggaggccg ccattgcaga tgccgagcag cgtggagagc 1080

tggccattaa ggatgccaac gccaagttgt ccgagctgga ggccgccctg cagcgggcca 1140

agcaggacat ggcgcggcag ctgcgtgagt accaggagct gatgaacgtc aagctggccc 1200

tggacatcga gatcgccacc tacaggaagc tgctggaggg cgaggagagc cggctggagt 1260

ctgggatgca gaacatgagt attcatacga agaccaccag cggctatgca ggtggtctga 1320

gctcggccta tgggggcctc acaagccccg gcctcagcta cagcctgggc tccagctttg 1380

gctctggcgc gggctccagc tccttcagcc gcaccagctc ctccagggcc gtggttgtga 1440

agaagatcga gacacgtgat gggaagctgg tgtctgagtc ctctgacgtc ctgcccaagt 1500

gaacagctgc ggcagcccct cccagcctac ccctcctgcg ctgccccaga gcctgggaag 1560

gaggccgcta tgcagggtag cactgggaac aggagaccca cctgaggctc agccctagcc 1620

ctcagcccac ctggggagtt tactacctgg ggacccccct tgcccatgcc tccagctaca 1680

aaacaattca attgcttttt tttttggtcc aaaataaaac ctcagctagc tctgaaaaaa 1740

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa a 1771

Claims (5)

1, a kind of tumor drug resistance film surface marker albumen is characterized in that having the gene order shown in the SEQ ID NO:1.

2, tumor drug resistance film surface marker albumen according to claim 1 is characterized in that it being the target protein of design overriding resistance tumour medicine.

3, tumor drug resistance film surface marker albumen according to claim 2 is characterized in that the medicine that utilizes target protein to design.

4, tumor drug resistance film surface marker albumen according to claim 1 is characterized in that the purposes as overriding resistance tumour medicine design target protein.

5, tumor drug resistance film surface marker albumen according to claim 1 is characterized in that preparing the application that is used for drug resistance of tumor clinical diagnosis agent.

Images