CN101532053A - Method for identifying mycobacterium - Google Patents
Method for identifying mycobacterium Download PDFInfo
- Publication number
- CN101532053A CN101532053A CN200810207432A CN200810207432A CN101532053A CN 101532053 A CN101532053 A CN 101532053A CN 200810207432 A CN200810207432 A CN 200810207432A CN 200810207432 A CN200810207432 A CN 200810207432A CN 101532053 A CN101532053 A CN 101532053A
- Authority
- CN
- China
- Prior art keywords
- mycobacterium
- sequence
- authentication method
- standard
- testing
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for identifying mycobacterium. The method comprises the following steps: acquiring a plurality of standard sequences of a plurality of mycobacteria so as to generate a mycobacterium sequence database; by comparing the standard sequences, obtaining a conservation section mutually owned by the standard sequences; preparing a PCR primer according to the conservation section; using the PCR primer to perform the PCR amplification of a DNA solution of the testing mycobacterium so as to obtain an amplification product of the testing mycobacterium; carrying out the sequencing reaction of the amplification product to obtain the sequencing product; carrying out the sequencing analysis of the sequencing product to obtain a sequence of the testing mycobacterium; and by comparing the testing sequence with the standard sequence in the mycobacterium sequence database, determining the type of the testing mycobacterium. The PCP primer is designed according to the conservation section of the standard sequences of various mycobacteria, only a pair of primers is needed for all PCRs and sequencing, thereby greatly reducing the quantity of oligonucleotide needed for experimental population.
Description
Technical field
The present invention relates to biological technical field clinical molecular diagnosis technology, relate in particular to the authentication method of a kind of mycobacterium of the PCR of use order-checking.
Background technology
The quantity of mycobacterium has about 110 kinds at present, and it is many causes that are referred to as the disease of mycobacterial disease.Therefore, the attention that has caused vast researcher is identified in the classification of mycobacterium.。In the prior art, the authenticate technology of mycobacterium is divided three classes.
One class is to adopt the routine biochemistry index to identify mycobacterium, and for example patent CN1298023 is described.This method also is a present clinical laboratory method commonly used, this method qualification time long (needing 1-2 week), and the result of evaluation is subjected to the artificial influence of observing, and accuracy is not very high.
Second class adopts the method for antigen-antibody to carry out serodiagnosis, for example patent CN1388378 adopts this method exactly, the mycobacterium quantity that this method can detect is fewer equally, and every kind of bacterium needs a kind of antibody to detect, and therefore can not identify clinical all relevant mycobacteriums.
The 3rd class adopts chip hybridization technology (the oligonucleotide hybridization detection technique promptly utilizes the oligonucleotide and the detected object DNA of relevant sudden change to hybridize to determine mutation type).Patent CN1724681, CN1896280, CN1071955 are this type of technology, and this type of technology is to the requirement for experiment condition height, unstable result, and the kind of somatotype is less, and every kind of needs are with a probe.Therefore be unfavorable for the clinical criteria application.And the mycobacterium limited amount of the method for chip hybridization detection.
Therefore to press for a kind of identifying species of exploitation many in this area, and the result is stable, and interpretation of result is accurately convenient, is convenient to the mycobacterium authentication method of clinical manipulation and result standardization
Summary of the invention
Because the above-mentioned defective of prior art, it is many that technical problem to be solved by this invention provides a kind of identifying species, and the result is stable, and interpretation of result is accurately convenient, is convenient to the mycobacterium authentication method of clinical manipulation and result standardization.
For achieving the above object, provide the authentication method of a kind of mycobacterium, it is characterized in that, comprised the steps: to obtain a plurality of standard rDNA sequences of multiple mycobacterium, to generate the mycobacterium sequence library.Described a plurality of standard rDNA sequences are compared, obtain the total conservative section of these rDNA sequences.Prepare one couple of PCR primers according to described conservative section.Use described PCR primer that the dna solution of testing mycobacterium is carried out pcr amplification, thereby obtain the amplified production of described testing mycobacterium.Described amplified production is carried out sequencing reaction, obtain the product that checks order.Described order-checking product is carried out sequencing analysis, obtain the rDNA sequence of testing mycobacterium.By the standard sequence in more described sequence to be measured and the described mycobacterium sequence library, determine the type of described testing mycobacterium.
Preferably, also comprise and make 3 ' rDNA sequences match of the base of end and described multiple mycobacterium of described primer.
Preferably, described one couple of PCR primers comprises upstream PCR primer agagtttgatcctggctcag and downstream PCR primer ttgtcgcgttgttcgtgaaa.
Preferably, also comprise described amplified production is carried out purifying.
Preferably,, the concentration dilution of described upstream PCR primer to 1uM, is carried out sequencing reaction to described purified product.
Preferably,, also comprise described amplified production through sequencing reaction is carried out ethanol sedimentation.
Preferably,, also comprise described amplified production through ethanol sedimentation is carried out the methane amide sex change.
Preferably, carry out described sequencing analysis, obtain the order-checking collection of illustrative plates of described testing mycobacterium by capillary electrophoresis.
Preferably, also comprise with described order-checking collection of illustrative plates be converted to described mycobacterium sequence library in the identical form of form of standard rDNA sequence.
Preferably, the standard sequence in sequence described to be measured and the described mycobacterium sequence library determines that the type of described testing mycobacterium also comprises the steps:
Obtain in the described mycobacterium sequence library and the described the most described standard sequence of coupling of order-checking row for the treatment of.Obtain the per-cent of the shared base of sequence to be measured and standard sequence, described per-cent is defined as matching degree.According to described matching degree the standard sequence in the described mycobacterium sequence library is carried out preface, the sequence of matching degree ordering first is judged to be the type of testing mycobacterium.
Preferably, comprise that also two standard sequences of adjacent two matching degrees ordering of acquisition are shared the poor of base number, described difference is defined as certainty factor; And described matching degree is proofreaied and correct according to described certainty factor.
Because according to the conservative section design PCR primer of the flag sequence of multiple mycobacterium, so all PCR and order-checking only need a pair of primer, significantly reduced the quantity of experiment kind of needed oligonucleotide.
Description of drawings
Fig. 1 is the PCR primer sequence synoptic diagram of mycobacterium;
Fig. 2 is a sequence synoptic diagram as a result;
Fig. 3 is Sequence Identification result's a synoptic diagram.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only are used to illustrate the present invention, limit the scope of the invention and be not used in.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition such as molecular cloning: laboratory manual (people such as Sambrook, New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
At present, the quantity of mycobacterium has only about 110 kinds at present, in the present embodiment, obtains the wherein international standard 16srDNA sequence of the text formatting of 105 kinds of mycobacteriums, obtains the mycobacterium sequence library thus.
After this, the 16srDNA sequence of the multiple mycobacterium sample in the mycobacterium sequence library compares, and finds the maximum section of similarity, promptly conservative section.Then, according to described conservative section, design a pair of 16srDNA primer that described multiple mycobacterium can be public.Concrete, make 3 ' 16srDNA sequences match of the base of end and described multiple mycobacterium of described primer.As shown in Figure 1, the described a pair of primer of present embodiment is upstream primer agagtttgatcctggctcag and the interior downstream primer ttgtcgcgttgttcgtgaaa of square frame in the square frame.
The dna solution that how to obtain testing mycobacterium is now described.In the present embodiment, the quantity of testing mycobacterium is 12 kinds, but is not limited to this quantity.At first, the sample that 12 routine different mycobacteriums are infected (from Shanghai Pulmonary Hospital's check acquisition of imposing a punishment) carries out the mycobacterium cultivation with the cultural method of standard, and the bacterium colony that takes a morsel is subsequently put into the sample of sterilized water as authentication method of the present invention.Then, use DNA extraction agent box (article No. W6511, Shanghai China Shun biotechnology company limited) described 12 routine samples to be carried out the DNA extracting work of mycobacterium sample, obtain the dna solution of 12 routine samples thus according to operating process.Described dna solution is used as the dna solution template in subsequent step.
After this, each the sample dna solution that is obtained is made pcr amplification.At first, according to the amplification system of following system configurations 20ul: 10 * buffer, dNTP 2uM, primer 10uM, 1 unit of Taq enzyme.Concrete, described 20ul amplification system comprises the 8.7ul sterilized water, 5ul mycobacterium dna solution template, 0.3ul Hotstar taq enzyme (purchase of Qiagen company), 1ul upstream primer f (10uM), 1ul downstream primer r (10uM), the damping fluid (qiagen company) of 2ul dNTP (promega company) and 2ul PCR enzyme.
H
2O buffer dNTP primer f primer r template DNA Taq
8.7ul 2ul 2ul 1ul 1ul 5ul 0.3ul
Then, the orifice plate (96 orifice plate) that described amplification system is placed on PCR instrument (ABI 2720) is gone up and on described PCR instrument thermal cycle conditions is set according to following PCR condition, and described pcr amplification system is reacted.The annealing temperature of 16srDNA primer is 53 ℃, and concrete reaction conditions is: 95 degree 5 minutes, and 35 thermal cycling steps are set to 95 degree 30 seconds, 53 degree 30 seconds, 72 degree 40 seconds after thermal cycling finishes, are provided with 72 degree and carried out total elongation in 5 minutes, and 4 degree are infinite then.Thus, obtain amplified production with the corresponding 16srDNA of described sample solution.Can carry out quality control to the PCR product on demand, for example, amplified production needs band single (can cross column purification), and concentration (can be diluted) between 30-100ng.
After amplification finishes, use SAP (promega company) and exoI (epicentre company) that described amplified production is carried out purifying.Purification system is the exoI that the SAP of concentration 7.633U/ul adds concentration 20U/ul.Concrete, in 2ul PCR product, add 0.05ul SAP, 0.125ul exoI and 5.825ul ddH
2O.Purification condition is 37 ℃ of following purifying 60 minutes, 80 ℃ of following purifying 15 minutes, then 4 ℃ infinite.Thus, obtain purified amplified production.
After this, use upstream primer to previous step rapid in purified amplified production carry out sequencing reaction.Concrete, described upstream primer with 10uM is diluted to 1uM earlier, mix all ingredients according to following system then: the system of sequencing reaction comprises 4ul Bigdye3.1 (American AB I company), 2ul upstream primer (1uM), amplified production and the 2ul sterilized water that obtain during the 2ul previous step is rapid through ethanol sedimentation.On described PCR instrument, thermal cycle conditions is set according to following PCR condition, 96 degree 10 seconds, 25 thermal cyclings are set to 96 degree 10 seconds, 50 degree 5 seconds, 60 degree 4 minutes are provided with 60 degree 4 minutes after the thermal cycling, and 4 degree are infinite.Thus, obtain having the fluorescently-labeled a series of amplified productions of order-checking, last sequence information can be read and become to the entrained fluorescence of these products on sequenator.
After this, every hole adds about 70% ethanol, 50 μ L to be precipitated in room temperature, and the time must not be above 24 hours more than 15 minutes.3800 rev/mins, 4 ℃ centrifugal 30 minutes.Remove supernatant liquor gently, the inversion of 96 orifice plates is centrifugal, reach 1300 rev/mins and promptly stop.Then, dry ethanol.Placement allowed the ethanol volatilization clean in about ten minutes under the room temperature.Through behind the ethanol sedimentation, removed the impurity and the excess dyestuff of described amplified production.
After this, described amplified production through ethanol sedimentation is carried out Hidi (methane amide) sex change.Concrete, add the Hidi solution of 10 μ L in every hole, 95 degree sex change were taken out and are put into frozen water immediately more than 4 minutes, put 5 minutes.After described Hidi sex change, the DNA in the described PCR product is drawn into strand, the segment electrophoretic velocity difference that differs in size when guaranteeing capillary electrophoresis.
At last, will in previous step is rapid, carry out capillary electrophoresis through methane amide sex change amplified production.In the described capillary electrophoresis process, with the order-checking product with the detection of fluorescent signal by CCD, become readable optical series.In the present embodiment, described amplified production is put into the sample tray of genetic analyzer (3130xl), after the parameter that checks order is provided with, the full automatic sequencing analysis that carries out, the process of its automatization is exactly one and runs electrophoretic process in kapillary, and it is next automatically optical signalling to be become collection of illustrative plates output by described genetic analyzer.Thus, obtain the order-checking collection of illustrative plates of 12 samples.
For the order-checking collection of illustrative plates that is obtained, need be converted into the sequence as a result of using text formatting.In the present embodiment, adopt the sequence analysis 5.3.1 of ABI company that it is analyzed, thereby obtain the sequence of text formatting.
Thus, the 16srDNA of the text formatting of 12 samples being obtained of contrast is the 16srDNA sequence of the text formatting in sequence and the described mycobacterium sequence library as a result, thereby determines the type of the mycobacterium surveyed.
How now will to describe the sequence as a result of more described sequencing reaction and the sequence in the described database in detail, thereby determine the type of testing mycobacterium.
For each bar text sequence to be measured, successively with described mycobacterium sequence library in the standard sequence of each bar mycobacterium compare.In the present embodiment, what sequence alignment used is the Needleman-Wunsch algorithm.For two sequences, at first define the matching score function, if promptly two bases are mated then score+1,, two bases must not be divided into 0 if matching.In order to obtain the highest branch coupling of two sequences, adopt dynamic programming.Concrete, make that Fij is the score of i base after j base of B sequence alignd of A sequence, then can write out following recursion
Fij＝max(Fi-1，j-1+S(Ai，Bj)，Fi，j-1+d，Fi-1，j+d)
Wherein (Ai Bj) is the matching score function to S, and d is for inserting the space number.Obtain recalling the rightest matching scheme after the top score.
Secondly, obtain after the comparison result, the sequence of calculating sequence to be measured and comparison result is shared the per-cent of base, and gained per-cent is matching degree.
Then the sequence in the described mycobacterium sequence library is shared base per-cent and sort, the gap that first of matching degree ordering and the deputy two sequences of ordering are shared the base number is exactly a certainty factor.
The sequence of matching degree ordering first is judged to be the type of testing mycobacterium.
Referring to Fig. 3, specifically describe concrete analysis and evaluation that above-mentioned decision algorithm is realized with software approach.Among Fig. 3, matching degree is 94.5313, represents that promptly the match-percentage of base is 94.5313%, and having part not match is that these problems can be proofreaied and correct with certainty factor because the problem or the sequencing sequence quality problems of the interpretation of sequencing sequence base cause.14 differences of mating number with regard to representative and its base of sequence of the Mycobacterium_chelonae sequence of mating most and second coupling are 14 among Fig. 3, this index has well reflected the credibility of sequencing result, because if the too little software result that promptly might be sequencing quality or base interpretation problems cause of the sequence difference of first and second coupling judges by accident.
Mycobacterium authentication method according to invention has following advantage.
(1) because according to the conservative section design PCR primer of the flag sequence of multiple mycobacterium, so all PCR and order-checking only need a pair of primer, significantly reduced the quantity of experiment kind of needed oligonucleotide.
(2) 105 kinds of mycobacteriums that this selects primer of the present invention have covered present all mycobacterium types substantially, and 16srDNA is the high conservative zone.Thus, if if the mycobacterium in the database has increase, generally speaking, this also can increase them out to primer, and therefore the universality of described primer is fine.
(3) collection of illustrative plates that will check order is converted to text formatting, by judge itself and the matching degree of mycobacterium standard sequence and the type that certainty factor is identified testing mycobacterium, omitted need Basic of Biology and bioinformatic analysis ability pass through to the order-checking collection of illustrative plates need go comparison, judge the type of mycobacterium.Make the general staff also can carry out the evaluation of mycobacterium.
(4) realize the Rapid identification of sequence to be measured and standard sequence by algorithm, also qualification result is carried out Reliability Analysis by certainty factor.Therefore, authentication method of the present invention is fit to be applied to clinical.
(5) this method is cultivated the back only needs 1 day time to carry out identification experiment, has improved efficient than the evaluation of doing biochemical indicator originally, has shortened qualification time, helps Clinical Laboratory
Those skilled in the art should be clear, and the present invention can not break away from the spirit or scope of invention with many other concrete forms realizations.Concrete, should understand the present invention and can realize with following form.
Among the embodiment, dna sequence dna is not limited to the rDNA that settling ratio is 16s, but can be other dna sequence dnas.
Among the embodiment, the quantity that constitutes the mycobacterium in the mycobacterium sequence library is not limited to 105 kinds, and can be other quantity.
Among the embodiment, might not need to convert the order-checking collection of illustrative plates to text formatting, it wants its form consistent with the form of the rDNA sequence of described mycobacterium sequence library.
Example and embodiment at this should think illustratively and nonrestrictive, and the invention is not restricted to details given herein, but can make amendment within the scope of appended claims.
Sequence table
＜110〉Shanghai Tianhao Biotech Co., Ltd.
＜120〉authentication method of mycobacterium
<130>090430
<160>3
<170>PatentIn?version?3.1
<210>1
<211>828
<212>DNA
<213>mycobacterium
<400>1
<210>2
<211>384
<212>DNA
<213>mycobacterium
<400>2
<210>3
<211>600
<212>DNA
<213>mycobacterium
<400>3
Claims (11)
1. the authentication method of a mycobacterium is characterized in that, comprises the steps:
A) obtain a plurality of standard rDNA sequences of multiple mycobacterium, to generate the mycobacterium sequence library;
B) described a plurality of standard rDNA sequences are compared, obtain the total conservative section of these rDNA sequences;
C) prepare one couple of PCR primers according to described conservative section;
D) use described PCR primer that the dna solution of testing mycobacterium is carried out pcr amplification, thereby obtain the amplified production of described testing mycobacterium;
E) described amplified production is carried out sequencing reaction, obtain the product that checks order;
F) described order-checking product is carried out sequencing analysis, obtain the rDNA sequence of testing mycobacterium;
G), determine the type of described testing mycobacterium by the standard sequence in more described sequence to be measured and the described mycobacterium sequence library.
2. the authentication method of mycobacterium as claimed in claim 1 is characterized in that, in the step c), described preparation comprises makes 3 ' rDNA sequences match of the base of end and described multiple mycobacterium of described primer.
3. the authentication method of mycobacterium as claimed in claim 2 is characterized in that, described one couple of PCR primers comprises upstream PCR primer agagtttgatcctggctcag and downstream PCR primer ttgtcgcgttgttcgtgaaa.
4. the authentication method of mycobacterium as claimed in claim 1 is characterized in that, in the step (d), also comprises described amplified production is carried out purifying.
5. the authentication method of mycobacterium as claimed in claim 1 is characterized in that, in the step (e), the concentration dilution of described upstream PCR primer to 1uM, is carried out sequencing reaction to described purified product.
6. the authentication method of mycobacterium as claimed in claim 5 is characterized in that, in the step e), also comprises described amplified production through sequencing reaction is carried out ethanol sedimentation.
7. the authentication method of mycobacterium as claimed in claim 6 is characterized in that, in the step e), also comprises described amplified production through ethanol sedimentation is carried out the methane amide sex change.
8. the authentication method of mycobacterium as claimed in claim 7 is characterized in that, in the step f), carries out described sequencing analysis by capillary electrophoresis, obtains the order-checking collection of illustrative plates of described testing mycobacterium.
9. the authentication method of mycobacterium as claimed in claim 8 is characterized in that, step f) also comprise with described order-checking collection of illustrative plates be converted to described mycobacterium sequence library in the identical form of form of standard rDNA sequence.
10. the authentication method of mycobacterium as claimed in claim 1 is characterized in that, step g) comprises the steps:
(1) obtains in the described mycobacterium sequence library and the described the most described standard sequence of coupling of order-checking row for the treatment of;
(2) per-cent of the shared base of acquisition sequence to be measured and standard sequence, described per-cent is defined as matching degree;
(3) according to described matching degree the standard sequence in the described mycobacterium sequence library is carried out preface, the sequence of matching degree ordering first is judged to be the type of testing mycobacterium.
11. the authentication method of mycobacterium as claimed in claim 10 is characterized in that, step (3) comprises that also two standard sequences that obtain adjacent two matching degrees ordering share the poor of base number, and described difference is defined as certainty factor; And described matching degree is proofreaied and correct according to described certainty factor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810207432A CN101532053A (en) | 2008-12-19 | 2008-12-19 | Method for identifying mycobacterium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810207432A CN101532053A (en) | 2008-12-19 | 2008-12-19 | Method for identifying mycobacterium |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101532053A true CN101532053A (en) | 2009-09-16 |
Family
ID=41102914
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810207432A Pending CN101532053A (en) | 2008-12-19 | 2008-12-19 | Method for identifying mycobacterium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101532053A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102808223A (en) * | 2012-08-02 | 2012-12-05 | 向华 | Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database |
| CN103088139A (en) * | 2013-01-28 | 2013-05-08 | 清华大学 | Primer pair and standard substance for detecting mycobacteria and application thereof |
-
2008
- 2008-12-19 CN CN200810207432A patent/CN101532053A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102808223A (en) * | 2012-08-02 | 2012-12-05 | 向华 | Nucleic acid fingerprint feature spectrum database of mycobacterium tuberculosis and usage of nucleic acid fingerprint feature spectrum database |
| CN103088139A (en) * | 2013-01-28 | 2013-05-08 | 清华大学 | Primer pair and standard substance for detecting mycobacteria and application thereof |
| CN103088139B (en) * | 2013-01-28 | 2015-04-22 | 清华大学 | Primer pair and standard substance for detecting mycobacteria and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105658812B (en) | Large-scale biomolecular analysis with sequence tags | |
| CN114196746A (en) | Detection of nucleic acids | |
| CN105899680A (en) | Nucleic acid probe and method of detecting genomic fragments | |
| CN100588953C (en) | Method for detecting mononucleotide polymorphism with biochip | |
| CN102337338B (en) | Method for simultaneously and quickly detecting number of five types of chromosomes, and kit and application thereof | |
| CN105543380B (en) | A kind of method and device detecting Gene Fusion | |
| CN104520443A (en) | Method of sequence determination using sequence tags | |
| US9738924B2 (en) | Method of DNA detection and quantification by single-molecule hybridization and manipulation | |
| CN108441565B (en) | Fluorescence labeling multiplex amplification kit for 37 STR loci of human Y chromosome and application thereof | |
| CA2905410A1 (en) | Systems and methods for detection of genomic copy number changes | |
| CN102834525B (en) | Use the method for PCR and the HLA somatotype of crude blood | |
| CN109136385A (en) | A kind of fluorescent marker detection kit for the Y-STR locus improving individual identification rate | |
| CN110129422B (en) | Method for analyzing mutation structure of repeated mutation disease of polynucleotide based on long-fragment PCR and single-molecule sequencing | |
| CN101532053A (en) | Method for identifying mycobacterium | |
| CN109929936B (en) | Fluorescence labeling multiplex amplification kit for detecting human Y chromosome rapid mutation STR locus and application | |
| US20100330556A1 (en) | Genome analysis using a nicking endonuclease | |
| EP1215285A1 (en) | Method of analyzing intestinal flora and analytical apparatus | |
| CN107083440A (en) | Kit for detecting chromosome aneuploidy and preparation method and application thereof | |
| EP3514247B1 (en) | Biomarker panel and methods for detecting microsatellite instability in cancers | |
| KR20070086080A (en) | Method, program and system for the standardization of gene expression amount | |
| CN109762909A (en) | A kind of 44 site InDels composite amplification detection kits for sample medical jurisprudence individual appreciation of degrading | |
| CN115188411A (en) | Detection method and system for pathogenic microorganisms and drug resistance genes based on single-molecule self-adaptive sampling sequencing | |
| CN112725511A (en) | Micro-drop digital PCR (polymerase chain reaction) primer, probe, kit and method for quantitatively detecting dendrobium officinale | |
| EP4424845A1 (en) | Method, kit and cartridge for detecting nucleic acid molecule | |
| CN111575386A (en) | Fluorescence multiplex amplification kit for detecting human Y-SNP locus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20090916 |