CN101508993A - Bullfrog lectin gene, encoded lectin and uses thereof - Google Patents
Bullfrog lectin gene, encoded lectin and uses thereof Download PDFInfo
- Publication number
- CN101508993A CN101508993A CNA2009100666488A CN200910066648A CN101508993A CN 101508993 A CN101508993 A CN 101508993A CN A2009100666488 A CNA2009100666488 A CN A2009100666488A CN 200910066648 A CN200910066648 A CN 200910066648A CN 101508993 A CN101508993 A CN 101508993A
- Authority
- CN
- China
- Prior art keywords
- bullfrog
- lectin
- agglutinin
- gene
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to a bullfrog agglutinin gene, agglutinin encoded by the same, and application in pharmacy, belonging to the technical field of gene engineering. The bullfrog agglutinin gene is screened from a constructed bullfrog skin cDNA library with molecule weight of 71.8 Dalton and isoelectric point of 8.75; and a primary structure of polypeptide complete sequence is Phe Leu Thr Phe Pro Gly Met Thr Phe Gly Lys Leu Leu-AMIDATION; C-end is alpha-amidation modification. The gene encoding the bullfrog agglutinin contains 330 bits of nucleotides, wherein encoded mature peptides are nucleotides from 145 to 183 bit. Artificially synthesized bullfrog agglutinin has obvious effects of agglutinating rabbit erythrocyte and inhibiting bacterium growth; due to the advantages of small molecular weight and simple synthesis, the bullfrog agglutinin obtained by the gene can be used in antibacterial feed additive, drug development and a functional molecule which plays a leading role in vector targeting transportation of drug.
Description
Technical field
The present invention relates to the lectin and the application of a kind of bullfrog agglutinin gene and coding thereof, belong to gene engineering technology field.
Background technology
Lectin be zooblast and vegetable cell can both synthesize with excretory, can with sugared bonded protein, in cell recognition and adhesion reaction, play an important role, mainly be to promote intercellular adhesion.The characteristics of lectin maximum are can discern in glycoprotein and the glycolipid, particularly the carbohydrate structure of complexity, the i.e. glycosyl of surface of cell membrane in the cytolemma.Lectin has more than one with sugared bonded site, therefore can participate in the identification and the adhesion of cell, and different cells is connected.Lectin has multiple biological activity in invertebrates blood, can select the various cells of aggegation, and tumour cell is had specific agglutination effect etc., is one of important humoral factor of immune defense.Its function relates to cell growth, differentiation, growth and immunity etc., particularly at the external cell of aggegation, participate in engulfing, packing, solidify, aspects such as hemostasis and trauma repair play an important role.
Drug targeting is carried and the location is the focus of world research.The directed medicine of carrying will greatly improve drug utilization efficient and reduce side effect to specific site of pathological change.Lectin has single-minded glycosyl binding characteristic, and the different organ of organism contains different glycosyls with tissue, so lectin can be single-mindedly combines with different organ or tissue.Because these characteristics, they are considered to always that best drug targeting is carried and location carrier and be subjected to medicine scholar's favor.In decades, the scientific research personnel is seeking suitable lectin drug conveying carrier molecule always, but most known lectin molecular weight are all greater than 10000 at present, the macromolecule lectin is carried as drug targeting and the location carrier may cause serious side effects such as toxicity and immunogenicity, and the small molecular weight lectin will overcome these defectives and as ideal drug conveying carrier molecule.
The contriver carries out the Blast comparison with bullfrog lectin encoding gene of the present invention through database, finds no any homologous genes.
Summary of the invention:
The present invention discloses a kind of bullfrog agglutinin gene.
The present invention also provides according to said gene and has obtained the bullfrog lectin, is a kind of new lectin.
Bullfrog agglutinin gene of the present invention is characterized in that: cDNA is made up of 330 Nucleotide, and it from 5 ' end to 3 ' terminal sequence is:
atgttcaccatgaagaaatccctgttactccttttcttccttgggaccatcaacttatct 60
ctttgtgagggacgacagagagatgtcgatcaagaagaaagaagagatgatccaggtgaa 120
aggaatgttcaaaaaaaaaaacgatttttaacatttcctggaatgactttcggtaaattg 180
ttgggaaaataaccagaaatgttgaaactttgaaaatggaattggaaatcatctgatgtg 240
gaatattatttggctaaatgctcaacagatgtcttataaaaataaataaatatgttgcat 300
acaaaaaaaaaaaaaaaaaaaaaaaaaaaa 330。
Bullfrog lectin of the present invention is characterized in that: molecular weight is 1471.8 dalton, and iso-electric point is 8.75; What encode the bullfrog lectin is 145-183 position Nucleotide, and its aminoacid sequence is:
Phe?Leu?Thr?Phe?Pro?Gly?Met?Thr?Phe?Gly?Lys?Leu?Leu-AMIDATION。
Bullfrog lectin of the present invention is used to prepare antibacterial feed additive.
Bullfrog lectin of the present invention, the application in preparation drug targeting delivery vehicles.
The preparation process of bullfrog lectin of the present invention may further comprise the steps:
1) clone of bullfrog agglutinin gene
The extraction of the total RNA of bullfrog skin, the purifying of mRNA, the synthetic and cDNA library construction of cDNA first chain, design primer utilize PCR method screening bullfrog agglutinin gene.Amplimer length is 20 Nucleotide, upstream primer is 5 '-ATGTTCACCWTGAAGAAATC-3 ', downstream primer is the SMART of CLONTECH company
TM3 ' PCR Primer primer among the cDNA Library Construction Kit, its sequence be 5 '-ATTCTAGAGGCCGAGGCGGCC-3 '.The positive colony that obtains carries out nucleotide sequencing.
The ripe lectin of coding bullfrog all is a 145-183 position Nucleotide, and its aminoacid sequence is:
Phe?Leu?Thr?Phe?Pro?Gly?Met?Thr?Phe?Gly?Lys?Leu?Leu-AMIDATION；
2) the bullfrog lectin is synthetic
Infer according to the gene of coding bullfrog lectin and the aminoacid sequence of bullfrog lectin to synthesize its complete sequence with automatic Peptide synthesizer APEX396.By the desalination of the anti-phase C18 column chromatography of HPLC, purifying.Identify its purity with the high-efficient liquid phase chromatogram HPLC method then, molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
One, the bullfrog lectin detects the agglutination activity of rabbit erythrocyte
Getting fresh rabbit blood adding A Shi liquid (Alsever) volume ratio is 1:1, and mixing prevents blood coagulation gently, can preserve for two weeks in 4 ℃ in A Shi liquid.Washed Red Blood Cells add TBS-Ca
2+The centrifugal 5min of damping fluid 1500～2000rpm～10min supernatant discarded is till supernatant liquor no longer takes on a red color.The dilution red corpuscle, the red corpuscle that 10 μ L wash joins 1mL TBS-Ca
2+In the damping fluid, in 96 orifice plates, add red cell suspension 40～45 μ L, add the sample that 5～10 μ L are dissolved in physiological saline, observed result behind 37 ℃ of 45min-1h.
The result: synthetic bullfrog lectin has the effect of very strong aggegation rabbit erythrocyte, and to record its minimum aggegation concentration to rabbit erythrocyte be 31.25 μ g/mL.
Has single-minded glycosyl binding characteristic according to lectin, the different organ of organism contains different glycosyls with tissue, lectin can be single-mindedly combines with different organ or tissue, and therefore, bullfrog lectin of the present invention can be applied to prepare the drug targeting delivery vehicles.
Two, the effect of bullfrog lectin bacteria growing inhibiting:
Anti-microbial activity detects, and when measuring minimal inhibitory concentration (MIC), adopts doubling dilution to carry out antibiotic detection.With the LB liquid nutrient medium as developing medium.Become every milliliter to contain 10 with LB substratum dilution bacterium colony the reference culture of incubated overnight
5The bacterium liquid of bacterium is inoculated in the LB liquid nutrient medium with bacterium liquid, and the bacterium ultimate density is 10
5
On 96 porocyte culture plates, add in the 90 μ LLB substratum, adding through the bullfrog lectin sample 10 μ L of the present invention that are dissolved in physiological saline of 0.22 μ m aperture membrane filtration as first hole, get 50 μ L behind the mixing and add the 2nd pipe, doubling dilution successively, 50 μ L discard from the 9th hole sucking-off, the 10th piping control tube, each sample repeats twice.Bacterial isolates is institute of animal husbandry and veterinary medicine of Jilin University microorganism and preserve the immunization experiment chamber, result such as table 1.
Table 1, the bacteriostatic activity of bullfrog lectin
Conclusion: bullfrog lectin of the present invention has the effect of bacteria growing inhibiting.
The present invention can be used for preparing antibacterial feed additive;
The present invention also can be used for preparing antibacterials.
Beneficial effect of the present invention is: by bullfrog lectin encoding gene its aminoacid sequence of deriving, synthetic bullfrog lectin has the effect of significant aggegation rabbit erythrocyte and bacteria growing inhibiting, that this bullfrog lectin has is simple in structure, synthetic beneficial features easily, therefore can be used as the functional molecular that play the guiding role in antibacterial feed additive, antibacterials exploitation and the drug targeting delivery vehicles.
Embodiment
Further specify essentiality content of the present invention with embodiment below, but content of the present invention is not limited thereto.
Embodiment 1:
Bullfrog agglutinin gene clone:
I. the total RNA of bullfrog skin extracts
A. the live body bullfrog cleans up with distilled water, and the sterilization pin is ruined marrow from the oblongata chamber of bullfrog, gets 50～100mg bullfrog skin tissue and puts into the dried mortar of baking, and adds 1mL TRIZOL Reagent (Invitrogen company product) and grinds in ice-water bath rapidly.
B. behind the abundant mixing, move into (DEPC pipe) 15～30 ℃ of placements 5min in the 1.5mL centrifuge tube, add equal-volume chloroform vortex mixing 15s, 4 ℃ of centrifugal 15min of 12000 * g.
C. get supernatant and add 500 μ L Virahols, place 5min, vortex 15s mixing, 4 ℃ of centrifugal 10min of 12000 * g for 15～30 ℃.Abandon supernatant, add 1mL 75% ethanol rinsing precipitation, the centrifugal 5min of 7500 * g repeats 1 time.Dry 90s in the Bechtop with 30 μ L RNase-free water dissolving, promptly obtains the bullfrog skin total tissue RNA.
II. the Oligotex of operation steps according to German QIAGEN company adopted in the separation and purification of bullfrog skin mRNA
MRNAMini Kit test kit specification sheets carries out.
III. the structure in bullfrog skin cDNA library
Adopt the CreatorTM SMARTTM cDNA Library Construction Kit library construction test kit of CLONTECH company.
A.cDNA first chain synthesizes (mRNA reverse transcription)
MRNA with purifying is a template, utilizes cDNA to make up CDS III/3 ' Primer:5 '-ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) 30N-1N-3 ' (N=A, C, G or T that test kit provides; N-1=A, Gor C) and SMARTTMIVoligonucleotide:5 '-AAGCAGTGGTATCAACGCAGA GT GG CCATTACG GCCGGG-3 ', at PowerScript
TMUnder the effect of reversed transcriptive enzyme, synthetic cDNA first chain.Reaction system is 10 μ L:1 μ L SMARTIV Oligonucleotide, 1 μ L CDS III primer mixing, 72 ℃ of 2min, ice bath 2min.Add following reagent after centrifugal respectively: 2.0 μ L 5X First-Stand Buffer, 1.0 μ L DTT (20mM), 1.0 μ L dNTP Mix (10mM), 1.0 μ L Power Script reversed transcriptive enzymes, the reaction cumulative volume is 10.0 μ L.42 ℃ of reaction 60min, ice bath is placed 5min, and it is synthetic to stop first chain.-20 ℃ of preservations.
B.LD-PCR method second chain that increases
1.95 ℃ preheating PCR instrument.
2. be template with the first chain cDNA, in reaction tubes, add following reagent successively: 2 μ L cDNA, the first chain synthetic product, 80 μ L deionized waters, 10 μ L 10*Advantage 2PCR damping fluids, 2 μ L 50
*DNTP mixture, 2 μ L, 5 ' PCR primer, 2 μ L CDS 111/3 ' PCR primers and 2 μ L 50
*Advantage 2 PolymeraseMix, reaction system is 100 μ L.
3. in the PCR instrument, increase by following program:
1. 95 ℃ 1 minute;
2. 24 circulations: 95 ℃ of 15 second, 68 ℃ of renaturation 6 minutes.
4. after the loop ends, synthetic cDNA two strands in the centrifuge tube is carried out purifying.
C. the preparation of bacillus coli DH 5 alpha competent cell:
1. the streak inoculation of picking bacillus coli DH 5 alpha list bacterium colony is on fresh LB agar plate, and 37 ℃ are spent the night.Picking list colony inoculation is in the LB liquid nutrient medium of 25mL.
2. spend the night with 37 ℃ of joltings of 220-225rpm.Getting the 10mL overnight culture is inoculated among the 1L LB.Reach 0.5-0.7 up to OD600, ice bath 1h 37 ℃ of violent joltings cultivations.
3. bacterium liquid is transferred in the centrifugal bottle of precooling of sterilization.With 4 ℃ of 4000rpm (2800xg), 15min.Remove the supernatant liquor ice bath.Ice the resuspended precipitation of 10% glycerine of precooling lightly with 1L.
4.4000rpm (2800xg) 4 ℃, 15min is lightly with the resuspended precipitation of 10% glycerine of 0.5L ice precooling.
5.4000rpm (2800xg) 4 ℃, 15min is lightly with the resuspended precipitation of 10% glycerine of 250mL ice precooling.
6.4000rpm(2800xg)4℃，15min。Reach 3.5mL with the resuspended final volume that makes of glycerine.Bacterial density is approximately 3 x 10
10Cell/mL.Equal-volume is packed as 100 μ L/ parts, is put in the dry ice rapidly.Store competent cell at-80 ℃.
7. transform the checking competence with superhelix carrier such as Puc19.Should produce 0.5-1 x 10 at least
10The cell of cfu/ μ g.
D. the conversion that connects and connect product:
1. in Eppendorf tube, add 0.3 μ L TaKaRa pMD18-T carrier, the double-stranded solution of 2.2 μ L bullfrog cDNA, 2.5 μ L 4d H
2O adds 5 μ L Solutionl, and full dose is 10 μ L.
2.16 a ℃ connection is spent the night.
3. full dose (10 μ L) is added in the 100 μ L DH5a competent cells, ice bath 30 minutes.
5.42 ℃ thermal shock is after 90 seconds, ice bath 2 minutes.
6. add LB substratum 800 μ L, 37 ℃ of slow shaking culture (60-80 commentaries on classics/min) 45-60 minute.
7. get 200 μ L and coat on the LB substratum that contains Amp+ 37 ℃ and cultivated 16 hours, form single bacterium colony.
8. each LB plate washs bacterium colony with 5mL LB liquid nutrient medium, and it is frozen to add 30% glycerine.The cDNA library that makes up approximately contains 1 x 10
6Individual independent clone.
IV. bullfrog agglutinin gene colony screening
Amplimer length is 20 Nucleotide, upstream primer: 5 '-ATGTTCACCWTGAAGAAATC-3 ', downstream primer is the 3 ' PCR Primer primer among the SMARTTM cDNA Library Construction Kit: 5 '-ATTCTAGAGGCCGAGGCGGCC-3 '.
The PCR reaction conditions is as follows: 94 ℃ 30 seconds, 50 ℃ 30 seconds, 72 ℃ 2 minutes, totally 35 the circulation, 72 ℃ 10 minutes.
V. bullfrog agglutinin gene sequencing result
Extract plasmid and use M13+ and the M13-order-checking, instrument is the full-automatic nucleotide sequencing instrument of ABI PRISM3730, and gene sequencing result from 5 ' end to 3 ' terminal sequence is:
atgttcaccatgaagaaatccctgttactccttttcttccttgggaccatcaacttatct 60
ctttgtgagggacgacagagagatgtcgatcaagaagaaagaagagatgatccaggtgaa 120
aggaatgttcaaaaaaaaaaacgatttttaacatttcctggaatgactttcggtaaattg 180
ttgggaaaataaccagaaatgttgaaactttgaaaatggaattggaaatcatctgatgtg 240
gaatattatttggctaaatgctcaacagatgtcttataaaaataaataaatatgttgcat 300
acaaaaaaaaaaaaaaaaaaaaaaaaaaaa 330
Bullfrog agglutinin gene nucleotides sequence is classified as: sequence length is 330 bases, sequence type: nucleic acid, chain number: strand, sequence
Kind: cDNA, source: bullfrog skin
What encode the bullfrog lectin is 145-183 position Nucleotide, and its aminoacid sequence is:
Phe?Leu?Thr?Phe?Pro?Gly?Met?Thr?Phe?Gly?Lys?Leu?Leu—AMIDATION
Embodiment 2:
Preparation bullfrog lectin
The preparation method of I, sample: infer according to the gene of coding bullfrog lectin and the aminoacid sequence of bullfrog lectin to synthesize its complete sequence with automatic Peptide synthesizer APEX396.By the desalination of the anti-phase C18 column chromatography of HPLC, purifying.
II, molecular weight determination adopt electron spray ionisation, and (electrospray ionization, ESI), emission voltage is 4.5Kv.
The bullfrog lectin of III, purifying is identified its purity (flow velocity 1.0mL/min with the high-efficient liquid phase chromatogram HPLC method; Moving phase acetonitrile+water+TFA 0.01%, gradient elution; Chromatographic column C18 detects wavelength 220nm), molecular weight determination adopts the fast atom bombardment mass spectroscopy(FABMS) method, and isoelectric focusing electrophoresis is measured iso-electric point, measures the aminoacid sequence structure with automatic Protein Sequencer.
The bullfrog lectin is a kind of single chain polypeptide by Anura animal bullfrog agglutinin gene coding, molecular weight is 1471.8 dalton, iso-electric point is 8.75, and polypeptide complete sequence primary structure is: and phenylalanine-leucine-Threonine-phenylalanine-proline(Pro)-glycine-methionine(Met)-Threonine-phenylalanine-glycine-Methionin-leucine-amidation (Phe Leu Thr Phe Pro Gly Met Thr Phe Gly Lys Leu Leu-AMIDATION).
Claims (4)
1. bullfrog agglutinin gene, it is characterized in that: cDNA is made up of 330 Nucleotide, and it from 5 ' end to 3 ' terminal sequence is:
atgttcaccatgaagaaatccctgttactccttttcttccttgggaccatcaacttatct 60
ctttgtgagggacgacagagagatgtcgatcaagaagaaagaagagatgatccaggtgaa 120
aggaatgttcaaaaaaaaaaacgatttttaacatttcctggaatgactttcggtaaattg 180
ttgggaaaataaccagaaatgttgaaactttgaaaatggaattggaaatcatctgatgtg 240
gaatattatttggctaaatgctcaacagatgtcttataaaaataaataaatatgttgcat 300
acaaaaaaaaaaaaaaaaaaaaaaaaaaaa 330。
2, a kind of bullfrog lectin is characterized in that: molecular weight is 1471.8 dalton, and iso-electric point is 8.75; What encode the bullfrog lectin is 145-183 position Nucleotide, and its aminoacid sequence is:
Phe?Leu?Thr?Phe?Pro?Gly?Met?Thr?Phe?Gly?Lys?Leu?Leu-AMIDATION。
3, the described bullfrog lectin of claim 2 is used to prepare the additive of antiseptic feed.
4, the described bullfrog lectin of claim 2, the application in drug development and preparation drug targeting delivery vehicles.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100666488A CN101508993B (en) | 2009-03-18 | 2009-03-18 | Bullfrog lectin gene, encoded lectin and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100666488A CN101508993B (en) | 2009-03-18 | 2009-03-18 | Bullfrog lectin gene, encoded lectin and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101508993A true CN101508993A (en) | 2009-08-19 |
| CN101508993B CN101508993B (en) | 2011-09-14 |
Family
ID=41001526
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100666488A Expired - Fee Related CN101508993B (en) | 2009-03-18 | 2009-03-18 | Bullfrog lectin gene, encoded lectin and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101508993B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104163869B (en) * | 2013-05-15 | 2018-03-23 | 善笙生物科技股份有限公司 | Recombinant bacteria identification albumen and application thereof |
-
2009
- 2009-03-18 CN CN2009100666488A patent/CN101508993B/en not_active Expired - Fee Related
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104163869B (en) * | 2013-05-15 | 2018-03-23 | 善笙生物科技股份有限公司 | Recombinant bacteria identification albumen and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101508993B (en) | 2011-09-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101265296A (en) | Reptile cathelicidin antibiotic peptide and derivatives, and application thereof | |
| CN106749595B (en) | Tree frog defense peptides cathelicidin-PP and its gene and application | |
| CN104151415A (en) | Natural antimicrobial peptide Alligatorin4 and application thereof | |
| Guo et al. | Global transcriptomic response of Listeria monocytogenes exposed to Fingered Citron (Citrus medica L. var. sarcodactylis Swingle) essential oil | |
| BRPI0619512A2 (en) | bacteriocin-inducing peptides as well as a process for stimulating increased bacteriocin production | |
| CN102816770B (en) | Cotesia plutellae antimicrobial peptide defensin gene, antimicrobial peptide and application | |
| CN101475630B (en) | Bloody noun antibacterial peptide temporin-La, genes thereof and use in pharmacy | |
| CN104761629B (en) | A kind of broad-spectrum high efficacy antimicrobial peptide Pb CATH OH1 and its gene, preparation method and application | |
| CN101724632B (en) | Bullfrog skin active peptide, gene and application thereof in pharmacy | |
| CN101508993B (en) | Bullfrog lectin gene, encoded lectin and uses thereof | |
| Peng et al. | Tissue distribution, expression, and antimicrobial activity of Anas platyrhynchos avian β-defensin 6 | |
| CN103387992A (en) | Gene for coding recombinant porcine beta-defensin-1 and preparation method of porcine beta-defensin-1 | |
| CN102242127A (en) | Preparation method of serial antibacterial peptide Alloferon-1 and application of rAlloferon-1-K | |
| CN109734788A (en) | Migratory locusts mucoprotein Mucin17, its encoding gene and its application | |
| CN102796176B (en) | Kunyuenin, preparation method and application | |
| CN101503459A (en) | Bloody noun antibacterial peptide temporin-Lb, genes thereof and use in pharmacy | |
| CN102115496A (en) | Antimicrobial peptide Pc-CATH1 and gene thereof, chemical synthesis method and application thereof | |
| CN104945494A (en) | Sinonatrix annularis source antibacterial peptide SAC and application | |
| CN108467426B (en) | Taihu lake whitefish host defense peptide and application thereof | |
| CN102276729A (en) | Antibacterial peptide bovine lactoferricin-thanatin (LF-TH) and Escherichia coli recombination preparation method thereof | |
| CN101845092A (en) | Antimicrobial peptide Ea-CATH1 of Equus asinus and genes and application thereof | |
| CN105585626A (en) | Pinctada martensi lectin PmCLEC-1 and application thereof | |
| CN104910265A (en) | Paa robertingeri cathelicidin antibacterial peptide cathelicidin-PR1 as well as gene of coding sequence and application thereof | |
| CN104119434B (en) | Bufo melanostictus antibacterial peptide and its gene and application | |
| WO2022104863A1 (en) | Antibacterial peptide derived from taihu white fish and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110914 Termination date: 20150318 |
|
| EXPY | Termination of patent right or utility model |