CN101508990B - DNA numerator of hairpin RNA for expressing inhibit wheat kernel polyphenol oxidase and uses thereof - Google Patents
DNA numerator of hairpin RNA for expressing inhibit wheat kernel polyphenol oxidase and uses thereof Download PDFInfo
- Publication number
- CN101508990B CN101508990B CN2009100800010A CN200910080001A CN101508990B CN 101508990 B CN101508990 B CN 101508990B CN 2009100800010 A CN2009100800010 A CN 2009100800010A CN 200910080001 A CN200910080001 A CN 200910080001A CN 101508990 B CN101508990 B CN 101508990B
- Authority
- CN
- China
- Prior art keywords
- wheat
- fragment
- sequence
- ppo
- polyphenol oxidase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a DNA molecule expressing a hairpin RNA which inhibits polyphenol oxidase, and application thereof. The DNA molecule expressing the hairpin RNA which inhibits the polyphenol oxidase consists of an A fragment, a B fragment and a C fragment which are connected in sequence, wherein a nucleotide sequence of the A fragment is sequence 1 in a sequence table; the C fragment and the A fragment are reversely compensated; and a nucleotide sequence of the B fragment is sequence 2 in the sequence table. The DNA expressing the hairpin RNA which inhibits the polyphenol oxidase is started by a strong promoter of HMW glutelin subunit 1D*5 expressed by specific of wheat grain, expression of ppo gene of grain filling in transgenic wheat is obviously inhibited, PPO isoenzyme activity is reduced, and whiteness of wheat flour can be improved on the premise that vegetative growth and resistance of wheat are not affected.
Description
Technical field
The present invention relates to the dna molecular and the application thereof of the hairpin RNA of expression inhibiting wheat kernel polyphenol oxidase.
Background technology
The flour whiteness is one of important character of weighing flower characters, controlled by many h and Es.Influence the outward appearance and the color and luster of flour food such as noodles, steamed bun, biscuit, depend primarily on the content of carotenoid (carotenoids) and polyphenoloxidase (Polyphenol Oxidase, PPO, EC 1.10.3.1).Wherein, polyphenoloxidase (PPO) and whole meal flour and flour food thereof brown stain directly related (Baik, 1995 in processing, storage; Kruger, 1994; Hatcher, 1993).Simultaneously, the heritable variation of PPO kind and differential expression also determine the PPO gross activity height in the wheat grain, thereby directly or indirectly influence the whiteness of flour.
Although most of PPO is removed with aleurone layer (wheat bran) in the abrasive dust process in the seed, but residual in the flour is enough to have a strong impact on the whiteness of flour, the exterior quality of flour food (as brightness, color and luster), and make it in storage, send out obfuscation (Abrol, 1970 brown; Kruger, 1994; Baik, 1995; Park, 1997; Anderson, 2001; Okot-Kotber, 2001; Soysal, 2004; Li Junhong, 2000; Ge Xiuxiu, 2003).This brown stain has a strong impact on the quality of whole meal flour and flour food thereof, especially whole-wheat food, thereby extremely flour processing industry and the concern of breeding man.
Common wheat is an allohexaploid, and PPO multigene family member is numerous, is difficult to screen suitable cryptic mutant in natural mutation and induced mutations body (as EMS mutagenesis), makes the conventional hybridization breeding be absorbed in the predicament that lacks corresponding breeding material.
In order to overcome the limitation of traditional breeding way (as selection by mutation), utilize gene engineering to introduce gene and obtain new proterties or eliminate gene and remove bad proterties, widely, successfully be applied in genetic modification of plants and the breeding.In recent years, (Post-Transcriptional Gene Silencing PTGS) has been widely used for downward modulation some key enzyme in (down-regulate) vegetable metabolic process to the gene silencing after transcribing.
FAD2 genes encoding microorganism lipid acid ω 6-desaturase because a two key is introduced in Δ 12 positions of this enzyme catalysis oleic acid (C18:1 Δ 9), forms linolic acid (C18:2 Δ 9,12), so have another name called Δ 12-desaturase.FAD2 is single copy in the arabidopsis gene group.People such as the Smith of Australia CSIRO Plant Industry and Waterhouse were contained the silent carrier of intending southern FAD2 intron (Arabidopsis FAD2intron) and hairpin structure (hairpin structure) and can be caused almost 100% PTGS at the Nature report in 2000.The building mode of the reticent effect of this enhancing is that intron is connected between the just arm and antisense arm of hairpin structure, promptly contain intron hairpin RNA (intron-containing hairpin RNA, ihpRNA).The excision of this intron has the hair clip of helping arm complementary pairing and promotes dimeric formation, thereby can increase substantially reticent efficient.
Summary of the invention
The purpose of this invention is to provide a kind of dna molecular and application thereof that wheat grain suppresses the hairpin RNA of polyphenoloxidase of expressing.
The dna molecular that expression wheat grain provided by the present invention suppresses the hairpin RNA of polyphenoloxidase is to be connected to form successively by A, B and three fragments of C, and the segmental nucleotides sequence of described A is classified the sequence 1 in the sequence table as, described C fragment and described A fragment reverse complemental.
Wherein, described B fragment has no particular limits, and is preferably the intron of eukaryotic gene, and as the FAD2 intron, the segmental nucleotide sequence of described B is specially the sequence 2 in the sequence table.
The recombinant expression vector, transgenic cell line or reorganization bacterium, the described dna molecular total length of amplification and any segmental primer thereof that contain described dna molecular are to also belonging to protection scope of the present invention.
Containing the promotor that starts described dna molecular in the recombinant expression vector of described dna molecular is the strong promoter of the high-molecular-weight glutelin subunit 1Dx5 of wheat grain specifically expressing, and its nucleotide sequence specifically can be sequence 3 in the sequence table.
Another object of the present invention provides a kind of method of wheat that polyphenol oxidase activity reduces of cultivating.
The method of wheat that cultivation polyphenol oxidase activity provided by the present invention reduces is described dna molecular to be imported obtain the wheat that polyphenol oxidase activity reduces in the wheat.
A further object of the present invention provides a kind of method of wheat of cultivating the flour improved whiteness.
The method of wheat of cultivation flour improved whiteness provided by the present invention is that described dna molecular is imported the wheat that obtains the flour improved whiteness in the wheat.
Dna molecular shown in the sequence 1 in the sequence table also belongs to protection scope of the present invention.
The present invention utilizes the strong promoter of the high-molecular-weight glutelin subunit 1Dx5 of wheat grain specifically expressing to start the dna molecular of the hairpin RNA of expression inhibiting polyphenoloxidase, the endogenous ppo expression of gene of seed obviously is suppressed in transgenic wheat, the PPO isozyme is active to be reduced, do not influence that wheat is nourished and grown and the prerequisite of resistance under, can improve the whiteness of whole meal flour.The present invention will provide theoretical foundation, experimental technique and breeding material for improvement, the quality breeding of whole meal flour whiteness, and will be significant to China's Wheat Quality Improvement and fine quality seed selection.
Description of drawings
Fig. 1 is the structural representation of pBAC47P+ppoIR carrier.
Fig. 2 is the T of the commentaries on classics pBAC47P+ppoIR carrier of transplanting
0For wheat plant.
Fig. 3 detects for the Southern hybridization of the wheat of commentaries on classics pBAC47P+ppoIR carrier.
Fig. 4 is the Northern results of hybridization of the wheat of the further commentaries on classics pBAC47P+ppoIR carrier of determining of Southern hybridization.
Fig. 5 is the sxemiquantitative RT-PCR result of the ppo genetic expression of the wheat of the further commentaries on classics pBAC47P+ppoIR carrier of determining of Southern hybridization.
Excellent 9507 PPO activity in Fig. 6 transfer pBAC47P+ppoIR carrier.
Embodiment
The wheat that embodiment 1, cultivation polyphenol oxidase activity reduce
One, the structure of rna interference vector pBAC47P+ppoIR
By comparing the mRNA homology of seed PPO encoding gene and blade PPO encoding gene, choose the seed PPO target fragment of 0.8Kb.A pair of primer TaPPO-s1 and TaPPO-a1 have been designed;
TaPPO-s1：5’-CACCACGGCAACATCGACAGCCT-3’，
TaPPO-a1：5’-ATACCACGGCGAGCCACCGACGC-3’。
Adopt Trizol RNA to extract test kit (day root company) and extract total RNA, two-step approach with M-MLV reverse transcription test kit (Promega company) by specification is carried out reverse transcription-PCR (RT-PCR), the PCR product through 1% agarose gel electrophoresis after, gel scanner (model fti-500, pharmacia biotech company) detects, use sepharose DNA to reclaim test kit (centrifugal column type, it root company) reclaims the 0.8Kb fragment, obtain the target gene fragment of purifying, use pGEM-T Easy Vector System (Promega company) to specifications this fragment to be connected on the pGEM-T Easy carrier.Then, thermal shock transformed competence colibacillus EcoliDH5 α paves positive colony pTE-ppo that plate (operation according to " molecular cloning ") filters out and delivers to Shanghai and give birth to the order-checking of worker company.Sequencing result shows that this segmental nucleotides sequence classifies the sequence 1 in the sequence table as, with the EcoR I of TakaRa company simultaneously enzyme cut pTE-ppo and pBSK-FAD2Int9 (according to AJ27184.1 sequences Design primers F ADI-5:5 '-GGTACCCGGGAATTCAGATCGTCCGTCGCTTCTCTTCCAT-3 ' and the FADI-3:5 '-GAGCTCCCGGGCGGCCGCAAGCTTCTGCAGAAAACCAAAAGCAA-3 ' among the GenBank, is that template is carried out the PCR reaction with the arabidopsis thaliana genomic dna, by Kpn I and Sac I double digestion with this PCR product cloning to German Stratagene company
IIXR Predigested Vector) (endonuclease reaction system and condition is according to the TakaRa specification sheets), reclaim the former the 0.8Kb fragment and the latter's big fragment behind the agarose gel electrophoresis respectively, with T4DNA connect test kit (Promega company) with the 0.8Kb fragment that reclaims and greatly fragment be connected (reaction system and condition are according to Promega company specification sheets) and obtain recombinant DNA molecules, thermal shock transformed competence colibacillus EcoliDH5 α, pave the plate screening positive clone, carry out pcr amplification with primer TaPPO-s1 and AtFAD2I9F (5 '-AGCAGATCTATCGTGAGCGG-3 '), amplify the fragment of 1.9Kb, this clone contains the recombinant plasmid pBSK-FAD2I9-ppo that the ppo fragment is oppositely inserted FAD2 Intron9 downstream.
Cut pTE-ppo and pBSK-FAD2I9-ppo (endonuclease reaction system and condition are according to the TakaRa specification sheets) with the Not I while enzyme of TakaRa company again, reclaim the former the 0.8Kb fragment and the latter's big fragment behind the agarose gel electrophoresis respectively, connect test kit (Promega company) with T4DNA this two fragments connection (reaction system and condition are according to Promega company specification sheets) is obtained recombinant DNA molecules, thermal shock transformed competence colibacillus EcoliDH5 α, pave the plate screening positive clone, carry out pcr amplification with primer TaPPO-s1, amplify the fragment of 2.7Kb, this clone inserts the recombinant plasmid pBSK-ppoIR of FAD2 Intron9 upstream for ppo segment forward.Thereby obtained the pulsating hairpin RNA member of this goal gene.
Xmn I while enzyme with BioLabs company is cut pBAC47P (according to X12928.4 sequences Design primer 1DxP-U:5 '-ATCGCAGCTGGCATGCAAATATGCAACATA-3 ' and the 1Dxp-D:5 '-GAGTCGACCTCACCTTCAGCGACGAGAGCCAGGGGCA-3 ' among the GenBank, with wheat breed Cheyenne (money Buddhist nun) genomic dna is template, carry out pcr amplification, this product cloning is obtained pSP72-1DxP to the pSP72 carrier of Promega company with Pvu II and Sal I double digestion.Cut pSP72-1DxP with Pvu II and HindIII enzyme, add the flat sticky end of dNTP (Promega company) benefit and obtain Segment A; Use primer 1DxP-5:5 '-CTGAAGCTTTGAGTGGCCGTAGAT-3 ' and 1DxP-3:5 '-TCACCGTGCACGCAGCCATG-3 ', with the Cheyenne genomic dna is that template is carried out pcr amplification and obtained about 0.33KB fragment B, Segment A is connected with the T4DNA ligase enzyme with fragment B, obtain pBAC47P) and pBSK-ppoIR (endonuclease reaction system and condition are according to the BioLabs specification sheets), reclaim the former big fragment and latter 2.7Kb fragment behind the agarose gel electrophoresis respectively, connect test kit (Promega company) with T4DNA this two fragments connection (reaction system and condition are according to Promega company specification sheets) is obtained recombinant DNA molecules, thermal shock transformed competence colibacillus EcoliDH5 α, pave the plate screening positive clone, thereby obtain rna interference vector pBAC47P+ppoIR.
Two, pBAC47P+ppoIR transformed wheat
Select the active high kind of wheat grain PPO as the acceptor material that carries out genetic transformation.Be used for kind that wheat immature embryo cultivates and be excellent 9507 and the capital spend No. 1.
Get the back 12 days prematurity seed of pollination, with 70% alcohol rinsing 2 minutes, with 0.1% mercury chloride sterilization 15 minutes, sterilized water washing 3 times, under aseptic condition, choose rataria and be inoculated in rataria inducing culture (interpolation 2mg/L 2,4-D in the MS minimum medium, 30g/L sucrose, 7g/L agar powder, pH5.8) last 3 day.(the pSP72 carrier with Promega company is the carrier that sets out with pBAC47P+ppoIR carrier and selection markers genophore p35SIH3 with particle bombardment, between HindIII and Sal I, insert the CaMV 35S promoter, between Kpn I and EcoRI, insert the NOS terminator, insert the bar gene at BamH I and Sac I restriction enzyme site.CaMV 35S promoter and NOS terminator come from the pBI121 carrier of U.S. Clontech company.The bar gene source is in plant expression vector pBPC30) (Zhang Xiaodong, Liang Rongqi, Chen Xuqing, Yang Fengping, Zhang Liquan.The acquisition of high-quality HMW gluten subunit transgenic wheat and genetic stability thereof and quality trait analysis.Science Bulletin, 2003,48 (5): 474-479) in 3 days the rataria of (China Agricultural University) cotransformation inducing culture.With the rataria that only changes pBSK-FAD2Int9 and p35SIH3 carrier in contrast.
Rataria after the conversion screens on the rataria inducing culture that contains Bialaphos (0.5mM).Resistant calli is transferred to division culture medium, and (the MS minimum medium adds 1mg/L zeatin, 1mg/L IAA, 0.5mMBialaphos, 30g/L sucrose, 7g/L agar powder; PH5.8) on, the differentiation seedling grows and it is moved to the strong plantlets and rootage substratum behind the stem (the MS substratum adds 10mg/L IAA, 80g/L sucrose, 7g/L agar powder; PH5.8) on, treat that seedling grows 2 young leaves, behind the 3-4 bar main root, clean substratum, be transplanted in the little furrow of covered with plastic film of solarium (Fig. 2).
The CTAB method is extracted the wheat T that pBAC47P+ppoIR transforms
1For the plant leaf genomic dna.
PCR detects FAD2 Intron9 and PPO gene identification pBAC47P+ppoIR transforms positive wheat, detects FAD2 Intron9 the primer and be Intron-3 (5 '-CCGCTCACGATAGATCTGCT-3 ') and Intron-5 (5 '-GGTAACGATTCAAGAGAGTCTTC-3 ').
Detect the reaction system of FAD2Intron9: 25 μ l
10×PCR?buffer 2.5μl
dNTP 2.0μl
Primer (10mM) 1.0 μ l
Intron-5(10mM) 1.0μl
rTaq(2.5U) 0.4μl
Genomic dna (30ng/ μ L) 4.0 μ l
ddH
2O 14.1μl
Reaction conditions: behind 95 ℃ of pre-sex change 3min; 94 ℃ of sex change 50Sec, 58 ℃ of annealing 40Sec, 72 ℃ of extension 90Sec, 35 circulations; Last 72 ℃ are extended 7min.
The fragment that pcr amplification goes out 1.1Kb is a FAD2 Intron9 male wheat.
PCR detects the positive plant of FAD2 Intron9 and carries out the Southern hybridization analysis.With FAD2 Intron9 is probe.
The Southern results of hybridization as shown in Figure 3, PCR is accredited as the male wheat and hybridizes into one through Southern
PCR detects the positive plant of FAD2 Intron9 and carries out the Southern hybridization analysis.With FAD2 Intron9 is probe.
The Southern results of hybridization as shown in Figure 3, PCR is accredited as the male wheat further is defined as changeing the pBAC47P+ppoIR carrier through Southern hybridization wheat.
Among Fig. 3, M:DGIMarker (2642bp) ,+: the pBAC47P+ppoIR carrier ,-: contrast, 1-12 is the wheat grain that PCR is accredited as changes the pBAC47P+ppoIR carrier.
Extracted the further wheat grain filling phase seed total RNA of definite commentaries on classics pBAC47P+ppoIR carrier of Southern hybridization, carrying out Northern hybridization analysis (operation carry out) according to " molecular cloning ", thereby with the ppo genetic expression situation of Preliminary detection transfer-gen plant.
The Northern results of hybridization as shown in Figure 4, changeing the strain of pBAC47P+ppoIR carrier wheat is 2-23,2-29,4-2,4-5,4-8, the bands of a spectrum of 4-20 and 4-29 are obviously shallow than the contrast of the 1st swimming lane, illustrate that the ppo genetic expression of these 7 plant weakens.
1-15 is respectively among Fig. 4: contrast, the strain of commentaries on classics pBAC47P+ppoIR carrier wheat are 2-8,2-13,2-23,2-29,4-1,4-2,4-3,4-4,4-5,4-7,4-8,4-20,4-29 and 5-7.
Extracted further total RNA of the wheat grain of definite commentaries on classics pBAC47P+ppoIR carrier of Southern hybridization, reverse transcription becomes cDNA; With the cDNA after the reverse transcription is template, and (GCCCGAGCAACACTGACT and PPO-3 (TGGGTACGAGCGACACG) detect the ppo expression of gene for primer to PPO-5; With the actin gene is that (primer is Actin-F:GGAATCCATGAGACCACCTAC and Actin-R:GACCCAGACAACTCGCAAC to confidential reference items.It is synthetic that worker Bioisystech Co., Ltd is given birth in Shanghai).Do contrast with not genetically modified wheat.With the PCR product through 1% agarose gel electrophoresis after, detects and take pictures at gel scanner (model fti-500, pharmacia biotech company), and Mult1 Gauge image analysis software is analyzed its relative content.
Ppo expression of gene result changes that the ppo expression of gene all significantly decreases compared with the control in the wheat grain of pBAC47P+ppoIR carrier as shown in Figure 5.Illustrate that the ppo expression of gene has been subjected to inhibition in the wheat that changes the pBAC47P+ppoIR carrier.
Among Fig. 5,1-20 changes the wheat strain system of pBAC47P+ppoIR carrier and the ratio of the expression amount of contrast for each.
Three, seed PPO enzyme activity determination
Seed PPO activity determination method is as follows:
Get 1g change the pBAC47P+ppoIR carrier in excellent 9507 whole wheat flours (distilled water soaks in advance), with phosphoric acid buffer (pH6.0) and the homogenate of quartz sand ice bath, the centrifugal 24h of lixiviate afterwards.Get vat liquor 0.2mL, behind the frozen centrifugation, get the 0.05mL supernatant and join in the 0.4mL phosphoric acid buffer (pH6.0), with 0.2mL 100mmol/L neighbour (U/g * min).With in excellent 9507 whole wheat flours in contrast.
PPO activity=Δ A * 1000/ (m * T)
Δ A represents reaction front and back absorbance difference, and m represents whole wheat flour weight (g), and T represents the reaction times (min).
The measurement result that the PPO enzyme is lived as shown in Figure 6, change the pBAC47P+ppoIR carrier in excellent 9507 seeds PPO enzyme live and all significantly decrease compared with the control.
Among Fig. 6,1 is contrast, 2-6 for change the pBAC47P+ppoIR carrier in excellent 9507.
It is excellent 9507 identical that spend in No. 1 result and the commentaries on classics pBAC47P+ppoIR carrier in the capital of changeing the pBAC47P+ppoIR carrier.The capital of changeing the pBAC47P+ppoIR carrier is spent in No. 1 seed the work of PPO enzyme and capital to spend to compare all for No. 1 and is significantly decreased.
Above-mentioned experimental result shows that the endogenous ppo expression of gene of seed is suppressed in the wheat of commentaries on classics pBAC47P+ppoIR carrier, has reduced the activity of PPO isozyme, thereby can improve the whiteness of whole meal flour.
Sequence table
＜110〉China Agricultural University
＜120〉dna molecular of the hairpin RNA of expression inhibiting wheat kernel polyphenol oxidase and application thereof
<130>CGGNARW92151
<160>3
<210>1
<211>725
<212>DNA
＜213〉artificial sequence
<220>
<230>
<400>1
caccacggca?acatcgaccg?cctgtggcac?gtctggcgcc?gcctccgccc?gagcaacacc 60
gacttcaccg?accccgactg?gctcgacgcc?gccttcctct?tctacgacga?ggaggcccgc 120
cccgtgcgcg?tgcgcgtccg?ggactgcctc?gacccggccg?cgctgcggta?cacgtaccag 180
gacgtcggcc?tgccgtggct?caacgccagg?ccggccaagg?cgtccggcgg?gacgccggcg 240
cccgccacaa?ccggtaccct?ccctgccacc?ctggacagga?ccatacgggt?gacggtgacg 300
aggcccagag?tgtccaggag?ccgccgggag?aaggaggagg?aggaggaggt?gctggtcgtg 360
gaggggatcg?agatcgccga?ccatttcaac?aagttcgtca?agttcgacgt?gttggtgaac 420
gagcccgagg?gcggagtggg?cagcacgccg?gcgacggcga?cggggtactg?cgctgggagc 480
ttcgcgcata?cgccgcacat?ggtccggccc?gaggagatga?ggaagggacc?ggtcaagacg 540
gtggcgaggt?tcggcgtgtg?cgacctgatg?gacgacatcg?gggcggacga?cgaccagacg 600
gtggtggtgt?cgctcgtacc?caggtgcggc?ggtgagctgg?tcaccgttgg?cggcgtcagc 660
atcagctacc?tcaagtgaag?ttacctaatg?tggtccgctc?tcgcgtcggt?ggctcgccgt 720
ggtat 725
<210>2
<211>1118
<212>DNA
＜213〉artificial sequence
<220>
<230>
<400>2
tcaacaagct?gaaaactcaa?gactatggaa?tagttttatc?attaattcta?aaaaacagag 60
catgcacaag?aaacaagtgg?taacgattca?agagagtctt?cagacaaatg?atccaaagtg 120
ggaaatcagg?ttgtgaaagg?gattgccaca?aatagaaaat?gcgtggacca?aaaggaataa 180
agagtagaga?agcggcataa?tgtgagaaat?acaaaaacga?ttgcgttgag?aatacgacta 240
gtagtaagta?atacgatgtt?aataaggcag?gtcacatctc?ttgcttgtgg?ttaacatcag 300
tttgcttgta?ttaaaaattc?agcgatcgaa?atcacaaatc?gtattgaaaa?ccaagttgac 360
aaacaaagcc?aaaagaaaac?agttgaagtg?atgtataagc?caccagaatt?tgtcgacatc 420
atatatcaga?tttagatatt?taaacagaaa?ataaaatgtg?acgacggatc?tagaaaattt 480
gccatgcaac?tgtaatcgca?tctgaatcaa?tcaaagagca?tctgatcctg?aattattttg 540
attccaactt?ttatcgtaag?gggtttaaga?gaatctataa?aacttttgtt?ttccttttat 600
tatgtatttt?tactataaaa?acccaatagg?agtaaaaaat?ccaggaaaga?ttcaatagta 660
gaagcagatt?tttacccaga?acaaatagcc?aaaaaatgaa?tacattaaca?aataacaatt 720
tatgctgttt?tttttttttc?aatttccacc?aacccaccag?aaaataaaat?agaataaaga 780
tctaaacaaa?ttggtcaaag?caaatcatct?tagaaaaaaa?gaagaaaagt?gaaaatgcaa 840
catatcgttt?tgtagacgag?agaaactaat?cattgtatga?atgagagagt?tcattattat 900
taatggtgac?agaacataaa?caaacatcag?attctcgacc?aaaagaaaaa?aacagagaaa 960
cagagaatcg?agaccagatc?taaggttgaa?tgtaaggagt?ataagcagat?ctatcgtgag 1020
cggagaaatt?cacagagcag?gagctactgg?aaagaaataa?gaatcaaaat?cgaaaatgag 1080
aagaaatgga?agagaagcga?cggacctgga?gaagcttg 1118
<210>3
<211>762
<212>DNA
＜213〉artificial sequence
<220>
<230>
<400>3
agctttgagt?ggccgtagat?ttgcaaaagc?aatggctaac?agacacatat?tctgccaaac 60
cccaagaagg?ataatcactt?ttcttagata?aaaaagaaca?gaccaatata?caaacatcca 120
cacttctgca?aacaatacat?cagaactagg?attacgccga?ttacgtggct?ttagcagact 180
gtccaaaaat?ctgttttgca?aagctccaat?tgctccttgc?ttatccagct?tcttttgtgt 240
tggcaaactg?cgcttttcca?accgattttg?ttcttctcgc?gctttcttct?taggctaaac 300
aaacctcacc?gtgcacgcag?ccatgagctt?tgagtggccg?tagatttgca?aaagcaatgg 360
ctaacagaca?catattctgc?caaaccccaa?gaaggataat?cacttttctt?agataaaaaa 420
gaacagacca?atatacaaac?atccacactt?ctgcaaacaa?tacatcagaa?ctaggattac 480
gccgattacg?tggctttagc?agactgtcca?aaaatctgtt?ttgcaaagct?ccaattgctc 540
cttgcttatc?cagcttcttt?tgtgttggca?aactgcgctt?ttccaaccga?ttttgttctt 600
ctcgcgcttt?cttcttaggc?taaacaaacc?tcaccgtgca?cgcagccatg?gtcctgaacc 660
ttcacctcgt?ccctataaaa?gcctagccaa?ccttcacaat?cttatcatca?cccacaacac 720
cgagcaccac?aaactagaga?tcaattcact?gatagtccac?cg 762
Claims (7)
1. the dna molecular of the hairpin RNA of expression inhibiting polyphenoloxidase, connect to form successively by A, B and three fragments of C, the segmental nucleotides sequence of described A is classified the sequence 1 in the sequence table as, described C fragment and described A fragment reverse complemental, and the segmental nucleotides sequence of described B is classified the sequence 2 in the sequence table as.
2. the recombinant expression vector that contains the described dna molecular of claim 1.
3. recombinant expression vector according to claim 2 is characterized in that: the nucleotides sequence that starts the promotor of the described dna molecular of claim 1 is classified sequence 3 in the sequence table as.
4. the reorganization bacterium that contains the described dna molecular of claim 1.
5. the application of the described dna molecular of claim 1 in improvement whole meal flour whiteness.
6. cultivating the method for wheat that polyphenol oxidase activity reduces for one kind, is the described dna molecular of claim 1 to be imported obtain the wheat that polyphenol oxidase activity reduces in the wheat.
7. a method of wheat of cultivating the flour improved whiteness is that the described dna molecular of claim 1 is imported the wheat that obtains the flour improved whiteness in the wheat.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100800010A CN101508990B (en) | 2009-03-16 | 2009-03-16 | DNA numerator of hairpin RNA for expressing inhibit wheat kernel polyphenol oxidase and uses thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100800010A CN101508990B (en) | 2009-03-16 | 2009-03-16 | DNA numerator of hairpin RNA for expressing inhibit wheat kernel polyphenol oxidase and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101508990A CN101508990A (en) | 2009-08-19 |
| CN101508990B true CN101508990B (en) | 2011-01-26 |
Family
ID=41001523
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100800010A Expired - Fee Related CN101508990B (en) | 2009-03-16 | 2009-03-16 | DNA numerator of hairpin RNA for expressing inhibit wheat kernel polyphenol oxidase and uses thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101508990B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154347B (en) * | 2009-12-02 | 2012-12-19 | 山东省农业科学院作物研究所 | Method for reducing expression level of PPO (polyphenol oxidase) and PSY (phytoene synthase) genes and special RNAi (RNA interference) vector thereof |
| CN111139261B (en) * | 2019-02-28 | 2022-05-31 | 山东省农业科学院作物研究所 | Method for reducing polyphenol oxidase content of wheat grains by using gene editing |
-
2009
- 2009-03-16 CN CN2009100800010A patent/CN101508990B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN101508990A (en) | 2009-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101979548B (en) | Method for improving rice resistance to bacterial leaf blight by using leaf specific expression artificial microRNA | |
| CN107602681A (en) | The wide gene GW5L of rice grain and its application | |
| CN111187778B (en) | Wheat salt-tolerant gene TaFLZ2 and application thereof | |
| CN107759676B (en) | Plant amylose synthesis related protein Du15, and coding gene and application thereof | |
| CN101693891B (en) | Promoter of shepherd spurse CBF path key gene CbCBF and applications thereof | |
| CN111440804A (en) | Application of corn ZmBES1/BZR1-5 gene in cultivation of large-grain plants | |
| CN109423492B (en) | Application of SlTOE1 gene in regulation and control of flowering time and yield of tomatoes | |
| CN112280786B (en) | Herbicide-tolerant corn even HH2823 transformation event with high nutrient utilization efficiency and specificity identification method and application thereof | |
| CN103183731B (en) | Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof | |
| CN101508990B (en) | DNA numerator of hairpin RNA for expressing inhibit wheat kernel polyphenol oxidase and uses thereof | |
| CN103215278B (en) | Clone of anthurium MYB transcription factor AN2-like gene and expression vector construction | |
| CN110777153B (en) | Populus deltoides androgenesis gene MmS and application thereof | |
| CN108456683B (en) | Function and application of gene SID1 for regulating heading stage of rice | |
| CN102911941B (en) | Root-specific promoter and application thereof | |
| CN109022481B (en) | Creation method of low-methane-emission rice variety | |
| CN102286494A (en) | Porphyra yezoensis ueda TPS (trehalose-6-phosphate synthase) gene and application thereof in enhancing salt tolerance of rice | |
| CN108948162B (en) | Peanut adversity stress gene AhDOG1L and application thereof | |
| CN111979233A (en) | Method for increasing rice grain type and application thereof | |
| CN102154311B (en) | Gene GE1 for controlling size of paddy embryo and use thereof | |
| CN114164291B (en) | Application of rice grain length gene GL10 allele | |
| CN112899274B (en) | Application of miR1432 in regulation and control of rice bacterial leaf blight resistance | |
| CN112342218B (en) | Application of BOC1 protein in regulation and control of rice callus browning | |
| CN114525301B (en) | Application of ZmPHR1 protein in regulating and controlling phosphorus content of corn | |
| CN117431256B (en) | Wheat yellow mosaic disease-resistant gene TaRx-2D, protein encoded by same and application thereof | |
| CN110734911B (en) | Application of miR159b in regulation and control of rice bacterial leaf blight resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110126 Termination date: 20130316 |