CN101508969A - Recombinant lactobacillus casei for expressing infectivity pancreatic necrosis virus VP2 protein and production method thereof - Google Patents

Abstract

The invention provides a recombinant Lactobacillus casei for expressing the infectious pancreas necrosis virus (IPNV) VP2 protein and a preparation method thereof. According to the whole gene sequence of the IPNV VP2 protein and the gene fusion characteristic of expression vector plasmid, a pair of primers are designed to perform PCR to obtain target segment of 1095bp containing the main antigen site of the IPNV VP2 protein, the IPNV VP2 protein obtained through amplification is linked to the surface expressed carrier plasmid pPG1 and enters the cell of the host strain Lactobacillus casei 393 through electrotransformation, and the Lactobacillus casei containing positive recombinant plasmid pPG1-IPNV VP2 is named pPG1-IPNV VP2/L. casei 393. The recombinant pPG1-IPNV VP2/L. casei 393 is expressed under the induction of lactose. In the invention, the Lactobacillus casei expression carrier system of the IPNV VP2 protein is constructed and the target protein of around 40 KDa containing the main antigen site of the IPNV VP2 protein is expressed, and according to the Western blot experiment and indirect immunofluorescence experiment, the expressed foreign protein is capable of reacting with the IPVN immune serum, which shows that the recombinant VP2 protein and the IPNV natural antigen have the same antigenicity.

Description

Express the recombinant lactobacillus casei and the method for making of infectivity pancreatic necrosis virus VP 2 protein

(1) technical field

What the present invention relates to is biological products, the invention still further relates to the preparation method of this biological products.Specifically express the recombinant lactobacillus casei and the method for making of infectivity pancreatic necrosis virus VP 2 protein.

(2) technical background

Infectious pancreatic necrosis is by infectious pancreatic necrosis virus (Infectious pancreas necrosis virus, IPNV) cause a kind of hyperinfection and the acute viral disease of salmon fishes, classical symptom is unusual for moving about, sick fish body colour is dark deeply, abdominal distension, ophthalmoptosis, internal organ organa parenchymatosum hemorrhagic necrosis such as subcutaneous, hepatopancreas, the highly pathogenicity strain to the juvenile fish lethality rate at two monthly ages up to 90%, infect the fish that survives the back and be with poison throughout one's life, discharge cause of disease by ight soil and smart ovum, become the potential contagium.Because of the popular scope of this disease is wide, morbidity and lethality rate height bring great financial loss for China and countries in the world salmon trout aquaculture.Vaccine immunization is this sick major measure of prevention.IPNV mainly infects salmon fishes through skin, digestive tube and the gill, partial mucosa-immune is the principal character of infectious pancreatic necrosis specific immune response, the generation that the height of fish enteron aisle, gill mucous membrane surface Ig content directly determines IPN whether with the severity of disease performance.And at these sick mucosa-immune characteristics, adopting oral immunity is ideal prevention approach comparatively.Therefore select safety non-toxic, can survive in enteron aisle and also can express and transmit the carrier system of antigenic substance, the mucosal immune response that effective irritates nucous membrane immunity system is produced is significant to the control of this disease.

IPNV has two kinds of primary structure albumen, is respectively outer capsid albumen VP2 and inner capsid albumen VP3.VP2 albumen accounts for 62% of virion protein; contain main bone-marrow-derived lymphocyte antigenic determinant; can induce virucidin to provide immanoprotection action for the fish body; while VP2 also carries the virulence determinative and the cell cultures adaptation factor; therefore, VP2 albumen is being brought into play important effect aspect IPNV diagnosis and the immune protection.At present report to be used for the proteic expression main host of IPNV VP2 bacterium be intestinal bacteria and yeast.Intestinal bacteria are proteic host bacterium of expressing heterologous that a class is most widely used, because intestinal bacteria fast growth, and has good representational genetics feature, still extensively be used to expressing heterologous albumen at present, but the fusion rotein at expression in escherichia coli exists with insoluble inclusion body form, not biologically active, and intestinal bacteria contains deleterious cell pyrogen, so its expression product need be done widely and just can be used after detecting.The expressive host that yeast generally is considered to food grade safety has the unexistent advantage of intestinal bacteria, but fusion rotein output is very low again, and yeast expressed target protein needs ability oral immunity fish after the yeast cells wall fragmentation all can not be transmitted undamaged antigenic component as the carrier system of living.

(3) summary of the invention

The object of the present invention is to provide a kind of safe and effective mucosa-immune live bacterial vaccines that can be used in the control infectious pancreatic necrosis, promptly express infectivity pancreatic necrosis virus (Infectious pancreas necrosis virus, IPNV) proteic recombinant lactobacillus casei of VP2 and method for making thereof.

(1) technical problem that will solve

The object of the present invention is achieved like this:

It is that the preserving number that is deposited in Chinese typical culture collection center is CCTCC NO:M 209003, the recombinant lactobacillus casei of called after pPG1-IPNVVP2/Lactobacillus casei 393, preservation date on January 6th, 2009.

Gene fusion characteristics according to the complete genome sequence and the expression vector plasmid of infectivity pancreatic necrosis virus VP 2 protein, design a pair of primer, carry out PCR, acquisition contains the 1095bp purpose fragment (Fig. 1) in IPNV VP2 gene major antigen site, the IPNV VP2 gene clone in plasmid pMD18-T (Fig. 2) that amplification is obtained, and transform in the e. coli jm109 bacterial strain, obtain pMD18-T-IPNV VP2/JM109, the VP2 that pMD18-T-IPNV VP2 double digestion is reclaimed is connected with the vector plasmid pPG1 of surface expression, enter in host bacterium lactobacterium casei Lactobacillus casei 393 cells by the electricity conversion, contain the lactobacterium casei called after pPG1-IPNVVP2/L.casei393 of positive recombinant plasmid pPG1-IPNV VP2.Reorganization pPG1-IPNV VP2/L.casei 393 is expressed under the inducing of lactose.

Amplification IPNV VP2 gene upstream and downstream primer sequence difference:

P15′Ggatcc?a?GAGCGACACATCTTAAAACAAGAGAC3′

P25′CtcgagTTCGGGGTCGTACTTGCCATAG3′。

(2) technical scheme

The product that adopts method of the present invention to obtain through assay is:

1. the enzyme of lactobacterium casei expression vector is cut qualification result

From pMD18-T-IPNV VP2/JM109, extract plasmid pMD18-T-IPNV VP2, carry out double digestion with corresponding restriction restriction endonuclease simultaneously with vector plasmid and reclaim test kit with glue and reclaim and carry out 16 ℃ behind the purifying and spend the night and be connected, connect the product electricity and be transformed into host bacterium lactobacterium casei Lactobacillus casei 393, obtaining the gene fragment that size is about 4400bp behind the recombinant plasmid pPG1-IPNV VP2 single endonuclease digestion, is 1095bp and 3300bp gene fragment with obtaining size behind BamHI, the Xhol I double digestion.With P1, P2 is that primer carries out pcr amplification, obtains being about the 1095bp gene fragment, and (see figure 3) is consistent with the expectation size.Show that IPNV VP2 gene fragment has been inserted among the expression vector pPG1.The sequencing interpretation of result shows that IPNV VP2 gene has been inserted in the expression vector plasmid.Positive reorganization bacterium called after reorganization pPG1-IPNVVP2/L.casei 393 bacterial strains that obtain.

2.IPNV abduction delivering and the Protein Detection of VP2 albumen in lactobacterium casei

Induce the result to show to pPG1-IPNV VP2/L.casei 393 bacterial strains of reorganization and the bacterium of pPG1/L.casei 393 empty plasmids, recombinant protein has obtained expression, and the albumen size is about about 40Kda.Detect by Western-blot and to show that recombinant protein has the ability that the antiserum(antisera) with the IPNV preparation reacts, and have good specificity, be i.e. the reactionogenicity (see figure 4).

3.IPNV the abduction delivering indirect immunofluorescence detected result of VP2 albumen in lactobacterium casei

PPG1-IPNV VP2/L.casei 393 reorganization bacterium and the pPG1/L.casei 393 contrast indirect immunofluorescence experiment results that bacterium carried out show, the visible significantly yellow-green fluorescence (seeing Fig. 5 A) of reorganization bacterium pPG1-IPNV VP2/L.casei 393 fluorescence microscopies, show also that thus the expressed foreign protein of reorganization bacterium is the surface location that is present in thalline; PPG1/L.casei 393 does not find green fluorescence, and thalline is dyed redness (seeing Fig. 5 B).

Enteron aisle pathogenic characteristic and mucosa-immune characteristics based on IPNV; the VP2 gene that the present invention plays main immanoprotection action with IPNV contains major antigen site fragment and is inserted into lactic acid bacteria expression vectors; made up the proteic recombinant lactic acid bacteria expression system of expression IPNV VP2; in the hope of obtaining the oral live bacterial vaccines of IPNV; the specificity mucosa-immune effect that relies on natural anti-microbial effect of milk-acid bacteria and VP2 albumen to stimulate reaches this sick purpose of prevention.

IPNV mainly infects salmon fishes through skin, digestive tube and the gill, partial mucosa-immune is the principal character of infectious pancreatic necrosis specific immune response, the generation that the height of fish enteron aisle, gill mucous membrane surface Ig content directly determines IPN whether with the severity of disease performance.And at these sick mucosa-immune characteristics, adopting oral immunity is ideal prevention approach comparatively.The outstanding advantage of oral immunity is that the irritates nucous membrane immunocyte produces antibody and causes general immunity effectively; but oral immunity need overcome that immune protective antigen was degraded in stomach and enteron aisle before arriving intestinal mucosa or deactivation may, what satisfy this requirement must be that the carrier system of living transmits undamaged antigenic component.Milk-acid bacteria has many advantages as the live vector system of expression and transmission heterogenic antigen, is safe as carrier to animal itself, and intestinal bacteria, Salmonellas just can not be called safe biotechnological formulation as the live vector system; Some milk-acid bacteria can be synthesized some biologically active substances and multiple organic acid again, and these materials itself have bacteriostasis antibiosis.

The present invention is directed to IPN takes place and immune several characteristics; the first line of defence with blocking-up enteric infection disease in experimental design is a purpose; utilize the adhesion of milk-acid bacteria expression system on intestinal mucosa of safety non-toxic; field planting and expression and transmission antigenic substance; thereby antigenic substance; the immunostimulation of mucous membrane is more approached the natural infection approach of virus, so the mucosal immunity that is produced protection effect is with even more ideal.Made up infectivity pancreatic necrosis virus VP 2 protein lactobacterium casei expression vector system among the present invention, expressed the target protein of the about 40KDa that contains IPNV VP2 albumen major antigen site, immunoblot experiment and indirect immunofluorescence assay all show, expressed foreign protein can react with the IPNV immune serum, shows that recombinant VP 2 albumen is the same with the IPNV natural antigen to have an identical antigenicity.

Generally believe at present, express the live vector vaccine of exogenous antigen at host cell surface and offer antigenic best mode to mucomembranous immune system.The pPG1 expression vector of use used in the present invention has the ssUSP secreting signal peptide, has anchoring structure simultaneously, the metal surface expression vector, and the target protein of expression can be anchored to the surface of lactobacterium casei.Behind abduction delivering, carry out the inspection of target protein after 10 times of its culture supernatants are concentrated, the result does not detect the VP2 albumen of expression, as seen the cellular lysate thing has the expression of target protein in the molecular weight size of expection through the SDS-PAGE electrophoresis, Western-bolt detects and confirms that also expressing protein is present on the thalline, viable bacteria body immunofluorescent test after inducing shows, expressed albumen Primary Location is in the surface of thalline, the target protein that has the thalline surface, be antigenic substance effective stimulus immunity system, improve antibody horizontal and established important basic substance.

(4) description of drawings

Fig. 1 infectivity pancreatic necrosis virus VP 2 Gene RT-PCR amplification gel electrophoresis figure

1.DNA MarkerDL2000; 2.VP2 gene PCR amplified production (1095bp)

Fig. 2 recombinant plasmid pMD18-T-VP2 enzyme is cut, the PCR qualification result

1.DNA Marker DL15000; 2.BamHI single endonuclease digestion; 3.PCR negative control; 4,5.BamH I and XhoI double digestion; 6.DNAMarkerDL2000; 7,8.PCR qualification result

Fig. 3 recombinant plasmid pPG1-IPNV VP2 enzyme is cut, the PCR qualification result

1.DNAMarker DL15000; 2,3.BamH I and XhoI double digestion; 4,5.BamHI, XhoI single endonuclease digestion; 6.DNAMarkerDL2000;

7.PCR qualification result

Fig. 4 recombinant lactobacillus casei pPG1-IPNV VP2/L.casei393 expresses VP2 protein SDS-PAGE and Western-blotting qualification result

A: the SDS-PAGE qualification result .1.protein marker of reorganization bacterium pPG1-IPNV VP2/L.casei393 abduction delivering (116kD～18.4kD); 2.pPG1-IPNV VP2/L.casei393 is without lactose-induced; 3.pPG1-IPNV VP2/L.casei393 induces through 1% lactose Lactose;

B: target protein Western-blot qualification result. with albumen transfer printing NC film, successively with rabbit anti-IPNV VP2 serum and the effect of HRP mark goat anti-rabbit igg, colour developing back observations: 1.protein marker (116kD～18.4kD); 2. through lactose-induced pPG1-IPNVVP2/L.casei393, Western blot identifies the immune response belt that the expection size occurs; 3. without lactose-induced reorganization bacterium, the reaction zone that expecting does not appear in Westernblot result.

Fig. 5 recombinant lactobacillus casei pPG1-IPNV VP2/L.casei393 immunofluorescence result

A:pPG1-IPNV VP2/L.casei393 is behind abduction delivering, and indirect immunofluorescence detects the thalline surface and yellow-green fluorescence occurs; B: fluorescent reaction do not occur without inductive pPG1-IPNV VP2/L.casei393 thalline surface, thalline is dyed redness by Evans Blue.

(5) embodiment

For example the present invention is done more detailed description below in conjunction with accompanying drawing:

1.IPNV the structure of VP2 gene lactobacterium casei expression vector

Extract test kit in a small amount with plasmid DNA and extract recombinant plasmid pMD18-T-IPNV VP2 and plasmid pPG1 the plasmid pPG1 lactobacterium casei Lactobacillus casei393 with containing from intestinal bacteria pMD18-T-IPNV VP2/JM109.PPG1 and pMD18-T-IPNV VP2 are carried out respectively respectively the purpose fragment being reclaimed purifying behind the double digestion.The pPG1 of recovery and the purified product of VP2 are connected, to connect the product electricity and transform, contain the lactobacterium casei called after pPG1-IPNV VP2/L.casei 393 of positive recombinant plasmid pPG1-IPNV VP2 in competent cell Lactobacillus casei 393.

2.IPNV the abduction delivering in the VP2 albumen lactobacterium casei

Incubated overnight in the pPG1-IPNV VP2/L.casei 393 single colony inoculation 5mL MRS liquid nutrient mediums is made actication of culture, and activated spawn is inoculated in 10mL in 1: 20 ratio and contains in the MRS substratum of 1% lactose, induces 16h for 30 ℃.Before inducing and induce back sample each 1mL with the centrifugal 5min of 12000r/min, thalline is with the N,O-Diacetylmuramidase of 100 μ L10mg/mL, 37 ℃ of water-bath effect 60min, the centrifugal 5min of 12000r/min abandons supernatant, 2 * SDS-PAGE the sample buffer (containing DTT) that adds 1 * PBS and equivalent, mixing, boiling water bath 5min, the centrifugal 5min of 12000r/min, with the protein standard molecular weight is reference, takes out the 1ml sample respectively and carry out SDS-PAGE and Western-blot analysis after N,O-Diacetylmuramidase is handled.

3. indirect immunofluorescence detects

Learn from else's experience the inductive recombinant lactobacillus casei and contain that each 0.5mL of lactobacterium casei of empty plasmid is centrifugal and remove supernatant after, wash thalline 3 times with PBS respectively; Add rabbit source anti-IPNV VP2 albumen hyper-immune serum, mixing, 37 ℃ of effect 60min, 4000r/min is centrifugal, and 5min removes supernatant, and PBS is centrifugal to wash thalline 3 times; Goat anti-rabbit igg/FITC the fluorescence antibody that adds dilution suspends and mixes back 37 ℃ of effect 60min, and 4000r/min is centrifugal, and 5min removes supernatant, and PBS is centrifugal to wash thalline 3 times; The bacterial sediment thing is suspended in the 200 μ L PBS damping fluids, gets an amount of smear, after the seasoning, and behind the precooling acetone fixed 30min, fluorescence microscope.

Claims (3)

1. recombinant lactobacillus casei of expressing infectivity pancreatic necrosis virus VP 2 protein is characterized in that: it is that to be deposited in Chinese typical culture collection center deposit number be the recombinant lactobacillus casei of CCTCC NO:M209003.

2. method of expressing the recombinant lactobacillus casei of infectivity pancreatic necrosis virus VP 2 protein, it is characterized in that: according to the gene fusion characteristics of the complete genome sequence and the expression vector plasmid of infectivity pancreatic necrosis virus VP 2 protein, design a pair of primer, carry out PCR, acquisition contains the 1095bp purpose fragment in IPNVVP2 gene major antigen site, the IPNV VP2 gene that amplification is obtained is connected with the vector plasmid pPGl of surface expression, enter in the host bacterium lactobacterium casei Lactobacillus casei393 cell by the electricity conversion, contain the lactobacterium casei called after pPGl-IPNV VP2/L.casei 393 of positive recombinant plasmid pPGl-IPNV VP2.Reorganization pPGl-IPNV VP2/L.casei 393 is expressed under the inducing of lactose.

The method of the recombinant lactobacillus casei of expression infectivity pancreatic necrosis virus VP 2 protein according to claim 1 is characterized in that: described primer sequence is:

P1?5′Ggatcca?GAGCGACACATCTTAAAACAAGAGAC?3′，

P2?5′CtcgagTTCGGGGTCGTACTTGCCATAG?3′。

3. the method for making of the recombinant lactobacillus casei of expression infectivity pancreatic necrosis virus VP 2 protein according to claim 2 is characterized in that:

(1) structure of IPNV VP2 gene lactobacterium casei expression vector

Extract test kit in a small amount with plasmid DNA and extract recombinant plasmid pMD18-T-IPNV VP2 and plasmid pPG1 the plasmid pPG1 lactobacterium casei Lactobacillus casei 393 with containing from intestinal bacteria pMD18-T-IPNV VP2/JM109.PPG1 and pMD18-T-IPNV VP2 are carried out respectively respectively the purpose fragment being reclaimed purifying behind the double digestion.The pPG1 of recovery and the purified product of VP2 are connected, to connect the product electricity and transform, contain the lactobacterium casei called after pPG1-IPNV VP2/L.casei 393 of positive recombinant plasmid pPG1-IPNV VP2 in competent cell Lactobacillus casei 393.

(2) abduction delivering in the IPNV VP2 albumen lactobacterium casei

Incubated overnight in the pPG1-IPNV VP2/L.casei 393 single colony inoculation 5mL MRS liquid nutrient mediums is made actication of culture, and activated spawn is inoculated in 10mL in 1: 20 ratio and contains in the MRS substratum of 1% lactose, induces 16h for 30 ℃.Before inducing and induce back sample each 1mL with the centrifugal 5min of 12 000r/min, thalline is with the N,O-Diacetylmuramidase of 100 μ L 10mg/mL, 37 ℃ of water-bath effect 60min, the centrifugal 5min of 12000r/min abandons supernatant, 2 * SDS-PAGE the sample buffer (containing DTT) that adds 1 * PBS and equivalent, mixing, boiling water bath 5min, the centrifugal 5min of 12000r/min, with the protein standard molecular weight is reference, takes out the 1ml sample respectively and carry out SDS-PAGE and Western-blot analysis after N,O-Diacetylmuramidase is handled.

(3) indirect immunofluorescence detects

Learn from else's experience the inductive recombinant lactobacillus casei and contain that each 0.5mL of lactobacterium casei of empty plasmid is centrifugal and remove supernatant after, wash thalline 3 times with PBS respectively; Add rabbit source anti-IPNV VP2 albumen hyper-immune serum, mixing, 37 ℃ of effect 60min, 4000r/min is centrifugal, and 5min removes supernatant, and PBS is centrifugal to wash thalline 3 times; Goat anti-rabbit igg/FITC the fluorescence antibody that adds dilution suspends and mixes back 37 ℃ of effect 60min, and 4000r/min is centrifugal, and 5min removes supernatant, and PBS is centrifugal to wash thalline 3 times; The bacterial sediment thing is suspended in the 200 μ L PBS damping fluids, gets an amount of smear, after the seasoning, and behind the precooling acetone fixed 30min, fluorescence microscope.

Images