CN101508727B - Plant responding low-phosphor and high-salt stress protein, encoding gene and uses thereof - Google Patents

Abstract

The invention discloses protein for plant response to low-phosphorus stress and high-salt stress, a coding gene and application thereof. The protein is protein which has the following amino acid sequences: 1) the protein which has the amino acid residue sequence of SEQ ID No.2 in a sequence table; and 2) the protein which causes the amino acid residue sequence of the SEQ ID No.2 in the sequence table to be replaced and/or lose and/or add by one or more amino acid residues, has functions of improving the plant sensitivity to low-phosphorus stress and high-salt stress and is derived from the SEQ ID No.2. The gene can be used for cultivating new plant varieties with low-phosphorus resistance and high-salt resistance, as well as indicator plants which are sensitive to low phosphorus and high salt.

Description

The albumen of plant responding low-phosphor and high-salt stress and encoding gene thereof and application

Technical field

The present invention relates to albumen and the encoding gene and the application of a kind of plant responding low-phosphor and high-salt stress, particularly derive from a kind of transcription factor and the encoding gene and application of regulating and control plant responding low-phosphor and high-salt stress of Arabidopis thaliana.

Background technology

Food problem is one of several hang-ups of facing of the world today.Soil lacks phosphorus and salinification is two critical limitation factors of restriction agriculture production.Phosphorus ore is non-renewable resource, uses phosphate fertilizer in a large number and can cause environmental pollution; Saline soil is a kind of global low productive soil, or even barren land.Therefore, the understanding plant is to low-phosphorous and reaction mechanism high-salt stress, improve plant self to low-phosphorous and tolerance high-salt stress, become the important research work that how further improves crop yield, extremely countries in the world government and plant and Agricultural Scientist's concern.

Arabidopis thaliana (Arabidopsis thaliana) is a kind of typical model plant (its effect and experimental mouse, fruit bat isotype biophase are worked as), has been widely used in plant genetics, developmental biology and molecular biological research.Arabidopis thaliana has about 1.3 hundred million base pairs, about 2.7 ten thousand genes.Contain the gene that surpasses 1500 encoding transcription factors in the present known arabidopsis gene group, wherein the WRKY gene has 74, and these WRKY gene effects in plant responding low-phosphor and high-salt stress are not clear.Most of genes of Arabidopis thaliana can both find homologous gene with it in other plant, the overwhelming majority of relevant Arabidopis thaliana finds to be applied to the research of other plant.Research in the past is verified, will help scientist to find the method that improves crop yield to the research of Arabidopis thaliana.In the face of the serious day by day low-phosphorous and high salt problem of soil in the farm crop production, the clone regulates and control the transcription factor gene of plant responding low-phosphor and high-salt stress and its function is studied, and to cultivating anti-low-phosphorous and anti-high salt crop varieties as early as possible important practice significance is arranged.

Summary of the invention

The purpose of this invention is to provide albumen and the encoding gene and the application of a kind of plant responding low-phosphor and high-salt stress.

The albumen of plant responding low-phosphor provided by the present invention and high-salt stress, name is called AtLPST (Arabidopsisthaliana Low Phosphate and Salt Tolerance), deriving from the environmental Arabidopis thaliana (Arabidopsis thaliana) of Colombia, is following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 2;

(b) with the amino acid residue sequence of sequence in the sequence table 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and have the plant stress tolerance function by (a) deutero-protein.

Wherein, the protein sequence shown in the sequence in the sequence table 2 is made up of 553 amino-acid residues.

In order to make AtLPST in (a) be secreted in cell pericentral siphon or the substratum or to make its function-stable, proteinic N end that can the amino acid residue sequence of sequence 2 is formed in by sequence table connects signal peptide sequence, for the AtLPST in (a) is convenient to purifying, proteinic N end or C end that can the amino acid residue sequence of sequence 2 is formed in by sequence table connect label as shown in table 1.

The sequence of table 1. label

Label	Residue	Sequence
			Poly-Arg	5-6 (being generally 5)	RRRRR
Poly-His	2-10 (being generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tagII	8	WSHPQFEK
			c-myc	11	EQKLISEEDL

Above-mentioned (b) but in the AtLPST synthetic, also can synthesize its encoding gene earlier, carry out biology according to following method again and express and to obtain.The encoding gene of AtLPST in above-mentioned (b) can be by the codon with one or several amino-acid residue of disappearance in the dna sequence dna of sequence in the sequence table 1, and/or carry out the missense mutation of one or several base pair, and/or at the encoding sequence of its 5 ' end attach signal peptide, and/or obtain at the encoding sequence that its 5 ' end and/or 3 ' end connects the label shown in the table 1.

The proteic encoding gene (AtLPST) of the protein plant responding low-phosphor of above-mentioned plant responding low-phosphor and high-salt stress and high-salt stress also belongs to protection scope of the present invention.

The proteic cDNA gene of above-mentioned plant responding low-phosphor and high-salt stress can have one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 1 nucleotide sequence;

2) can be with 1 under the rigorous condition of height) nucleotide sequence of described dna sequence dna hybridization.

Wherein, sequence 1 is made up of 1662 deoxynucleotides in the sequence table, and 5 of sequence 1 ' end 1-1659 position nucleotides sequence is classified encoding sequence (ORF) as in sequence table, and coding has the protein of the amino acid residue sequence of sequence 2 in the sequence table.

The proteic genomic gene of above-mentioned plant responding low-phosphor and high-salt stress can have one of following nucleotide sequence:

1) SEQ ID № in the sequence table: 3 nucleotide sequence;

2) can be with 1 under the rigorous condition of height) nucleotide sequence of described dna sequence dna hybridization.

Sequence 3 is made up of 2597 Nucleotide in the sequence table, from 5 of sequence 3 ' end 125-490 position Nucleotide is first exon, from 5 of sequence 3 ' end 696-797 position Nucleotide is second exon, from 5 of sequence 3 ' end 890-1042 position Nucleotide is the 3rd exon, from 5 of sequence 3 ' end 1126-1447 position Nucleotide is the 4th exon, from 5 of sequence 3 ' end 1540-1656 position Nucleotide is the 5th exon, is the 6th exon from 5 of sequence 3 ' end 1776-2393 position Nucleotide.From 5 of sequence 3 ' end 491-695 position Nucleotide is first intron, from 5 of sequence 3 ' end 798-889 position Nucleotide is second intron, from 5 of sequence 3 ' end 1043-1125 position Nucleotide is the 3rd intron, from 5 of sequence 3 ' end 1448-1539 position Nucleotide is the 4th intron, is the 5th intron from 5 of sequence 3 ' end 1657-1775 position Nucleotide.From 5 of sequence 3 ' end 1-124 position Nucleotide is 5 ' UTR, and the 2394-2597 position is 3 ' UTR.

The rigorous condition of above-mentioned height can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.

The expression vector, transgenic cell line and the host bacterium that contain the proteic encoding gene of above-mentioned plant responding low-phosphor and high-salt stress all belong to protection scope of the present invention.

Utilize any carrier that can guide foreign gene to express in plant, remove or make the AtLPST gene expression amount to reduce AtLPST clpp gene provided by the present invention, plant just shows anti-low-phosphorous and resistance to high salt shape; Perhaps with AtLPST gene overexpression in plant, plant just shows low-phosphorous sensitivity and high brine sensitivity shape.For the ease of transgenic plant cells or plant being identified and screening, can process employed carrier, as the antibiotic marker thing that adds the alternative mark of plant or have resistance.By the plant transformed host both can be monocotyledons, also can be dicotyledons.Gene pairs of the present invention is cultivated anti-low-phosphorous and anti-high salt new variety, and plant is to low-phosphorous significant with research high-salt tolerance, as utilize gene of the present invention can design siRNA this gene of sudden change or this gene of deletion mutantion are disturbed, inserted to this expression of gene, thereby improve the tolerance of plant to low-phosphorous and high salt.Cross in the gene transferred plant of the present invention and express, can be used as the plant indicator of soil phosphorus index and salt index, the low-phosphorous and/or high salt of early warning soil.

The invention will be further described below in conjunction with drawings and Examples.

Description of drawings

Fig. 1 is that wild-type, AtLPST overexpression plant (35S::ATLPST-9) and AtLPST knock out the phenotype observations of mutant (atlpst-1) under low-phosphorous condition.

Fig. 2 is the phenotype observations of seedling under high salt condition that wild-type, AtLPST overexpression plant (35S::ATLPST-9) and AtLPST knock out mutant (atlpst-1).

Fig. 3 is the phenotype observations of Cheng Miao under high salt condition that wild-type, AtLPST overexpression plant (35S::ATLPST-9) and AtLPST knock out mutant (atlpst-1).

Fig. 4 is an AtLPST expression of gene result of variations under the low-phosphorous condition.

Fig. 5 is an AtLPST expression of gene result of variations under the high salt condition.

Fig. 6 is the phosphorus content measurement result that wild-type, AtLPST overexpression plant (35S::ATLPST-9) and AtLPST knock out mutant (atlpst-1).

Fig. 7 is potassium, the sodium content measurement result that wild-type, AtLPST overexpression plant (35S::ATLPST-9) and AtLPST knock out mutant (atlpst-1).

Embodiment

Method among the following embodiment if no special instructions, is ordinary method

The albumen of embodiment 1, plant responding low-phosphor and high-salt stress and the acquisition of encoding gene thereof

Extracting the total RNA of Arabidopis thaliana (Columbia type) seedling, reverse transcription in 10 days is cDNA.Be template, utilize a pair of primer that is respectively equipped with KpnI and SacI restriction enzyme site to carry out pcr amplification with this cDNA, obtain the cDNA total length of drought-enduring genes involved.Primer sequence is as follows:

Primer1：5’-ggtaccATGGACAGAGGATGGTCTGGTCTC-3’(KpnI)；

Primer2：5’-gagctcCTATTGATTTTTGTTGTTTCCTTCGCCGTCGT-3’(SacI)。

Adopt the Pyrobest archaeal dna polymerase of the high-fidelity of Takara company to increase, amplification system is 50 μ L, contain 10 * Pyrobest PCR damping fluid, 5.0 μ L, 10mM dNTP mix 1.0 μ L, each 1.0 μ L of primer, Pyrobest enzyme 0.5 μ L, template 3.0 μ L (0.1ug), replenish sterilization ultrapure water to 50 μ L, reaction system is operated on ice.On PE 9700 instruments, increase, pre-sex change 5min, 95 ℃ of sex change 30s, 56 ℃ of 30s, 72 ℃ of 2min, 30 of cycle numbers, 72 ℃ are extended 10min.

Amplified fragments is carried out electrophoresis with 0.8% sepharose, reclaim amplified fragments, be connected to the pMD18-T carrier, the enzyme evaluation of cutting, increase, check order, sequencing result shows, the fragment that above-mentioned pcr amplification obtains has the nucleotide sequence of sequence 1 in the sequence table, for regulation and control plant responding low-phosphor of the present invention and high-salt stress cDNA unnamed gene are AtLPST, the nucleotide sequence of sequence 1 is by 1662 based compositions in the sequence table, its encoding sequence is the 1-1659 position Nucleotide of sequence 1 in sequence table, the amino acid residue sequence that coding has sequence 2 in the sequence table.The correct recombinant vectors called after pMD18-AtLPST that contains AtLPST with above-mentioned acquisition.

Extract 10 days total DNA of Arabidopis thaliana (Columbia type) seedling, be template, utilize a pair of primer to carry out pcr amplification, obtain the genomic dna total length of drought-enduring genes involved with this DNA.Primer sequence is as follows:

Primer3：5’-ACAGACTCTTTCTTAATCTCTCTCTCTTTC-3’；

Primer4：5’-AAAGCTTTAAAGGCAATGCTAATTAAG-3’。

Adopt the Pyrobest archaeal dna polymerase of the high-fidelity of Takara company to increase, amplification system is 50 μ L, contain 10 * Pyrobest PCR damping fluid, 5.0 μ L, 10mM dNTP mix 1.0 μ L, each 1.0 μ L of primer, Pyrobest enzyme 0.5 μ L, template 3.0 μ L (0.1ug), replenish sterilization ultrapure water to 50 μ L, reaction system is operated on ice.On PE 9700 instruments, increase, pre-sex change 5min, 95 ℃ of sex change 30s, 56 ℃ of 30s, 72 ℃ of 3.5min, 30 of cycle numbers, 72 ℃ are extended 10min.

The PCR product being checked order, obtain the nucleotide fragments of 2597bp, is the nucleotide sequence with sequence 3 in the sequence table, is regulation and control plant responding low-phosphor of the present invention and high-salt stress genomic gene, with its called after gAtLPST.GAtLPST is connected to the recombinant vectors called after pMD18-gAtLPST that the pMD18-T carrier obtains.5 of sequence 3 ' end 125-490 position Nucleotide is first exon in the sequence table, from 5 of sequence 3 ' end 696-797 position Nucleotide is second exon, from 5 of sequence 3 ' end 890-1042 position Nucleotide is the 3rd exon, from 5 of sequence 3 ' end 1126-1447 position Nucleotide is the 4th exon, from 5 of sequence 3 ' end 1540-1656 position Nucleotide is the 5th exon, is the 6th exon from 5 of sequence 3 ' end 1776-2393 position Nucleotide.From 5 of sequence 3 ' end 491-695 position Nucleotide is first intron, from 5 of sequence 3 ' end 798-889 position Nucleotide is second intron, from 5 of sequence 3 ' end 1043-1125 position Nucleotide is the 3rd intron, from 5 of sequence 3 ' end 1448-1539 position Nucleotide is the 4th intron, is the 5th intron from 5 of sequence 3 ' end 1657-1775 position Nucleotide.From 5 of sequence 3 ' end 1-124 position Nucleotide is 5 ' UTR, and the 2394-2597 position is 3 ' UTR.

The albumen of embodiment 2, plant responding low-phosphor and high-salt stress and the functional verification of encoding gene thereof

One, the acquisition of AtLPST overexpression plant (35S::ATLPST-9)

The recombinant vectors pMD18-AtLPST that contains the AtLPST gene and pBIB-Super carrier (the pBIB-Super construction of carrier: utilize primer aagcttGTGGGCCTGTGGTCTCAAGAT and tctagaCTAGAGTCGATTTGGT that adopt embodiment 1 to be obtained from plasmid pMSP-1 (Ni M, Cui D, Einstein J, NarasimhuluS, Vergara C, Gelvin SB.Strenght and tissue specificity of chimaericpromoters derived from the octopine and mannopine systhase genes.19957:661-676.) amplifies the super promoter sequence of long 1.1kb in; The super promotor that amplification is obtained is with HindIII and XbaI double digestion, reclaim the super promoter fragment, in being inserted between the HindIII of plasmid pBIB (Becher D.Binaryvectors which al low the exchange of plant selectable markers and reportergenes.Nucleic Acids Res.199018:203.) and the XbaI enzyme cutting site, obtain the pBIB-Super plasmid), carry out big system enzyme with restriction endonuclease XbaI and KpnI simultaneously and cut.The AtDT gene fragment and the linearizing pBIB-Super plasmid fragment of cutting are reclaimed, connect, and sequence verification, promptly obtain the correct recombinant vectors that contains the AtLPST gene of checking and its called after Super::AtLPST.

Utilize Agrobacterium-mediated Transformation to infect Columbia wild-type Arabidopis thaliana plant Super::AtLPST.Thereby obtaining 1 generation of AtLPST overexpression T changes Super::AtLPST Arabidopis thaliana plant.Through changeing Super::AtLPST Arabidopis thaliana positive plant and separate containing on the MS substratum of 50mg/L Totomycin screening, promptly obtain changeing Super::AtLPST Arabidopis thaliana list copy homozygous lines, i.e. AtLPST overexpression strain system in 3 generations of T than statistics.

Two, wild-type, AtLPST overexpression plant (Super::AtLPST) and AtLPST knock out the phenotype observations of mutant (atlpst-1) under low-phosphorous or high salt condition

1, wild-type, AtLPST overexpression plant (Super::AtLPST-9) and AtLPST knock out the phenotype observations of mutant (atlpst-1) under low-phosphorous condition

On the MS substratum, sprout the back wild-type Arabidopis thaliana (Columbia type) in one week of growth, AtLPST overexpression plant (commentaries on classics Super::AtLPST Arabidopis thaliana list copy homozygous lines that step 1 obtains, name is called Super::AtLPST-9) and AtLPST knock out the immigration of mutant (atlpst-1) (available from ABRC) Arabidopis thaliana seedling and contain the low-phosphorous MS substratum of 10 μ MPi (based on normal MS substratum, Pi concentration is adjusted into 10 μ M by 1.25mM, and other composition is consistent with normal MS substratum.Normal MS substratum consists of: every liter of solution contains 1650mgNH ₄NO ₃, 1900mg KNO ₃, 370mg MgSO ₄7H ₂O, 170mg KH ₂PO ₄, 440mg CaCl ₂2H ₂O, 22.3mg MnSO ₄4H ₂O, 0.83mg KI, 0.025mg CuSO ₄5H ₂O, 6.25mg H ₃BO ₅, 0.025mg CoCl6H ₂O, 8.65mg ZnSO ₄7H ₂O, 0.25mg Na ₂MoO ₄2H ₂O, 27.8mgFeSO ₄7H ₂O, 37.3mg Na ₂EDTA) go up continued growth 10 days, observe its proterties.Is as contrast with continuation in each strain of MS culture medium culturing.

The result as shown in Figure 1, on the low-phosphorous MS substratum growth 10 days after, AtLPST overexpression plant (Super::AtLPST-9) shows obvious low-phosphorus stress symptom, the leaf look becomes tawny or purple, growth of seedling is subjected to obvious inhibition; Wild-type Arabidopis thaliana (Columbia type) plant and AtLPST knock out sudden change (atlpst-1) body and still grow normally, tangible low-phosphorus stress symptom do not occur.1 is the wild-type plant among Fig. 1, and 2 is AtLPST overexpression plant (Super::AtLPST-9), and 3 knock out mutant (atlpst-1) for AtLPST.

2, wild-type, AtLPST overexpression plant (Super::AtLPST-9) and AtLPST knock out the phenotype observations of mutant (atlpst-1) under high salt condition

The wild-type Arabidopis thaliana (Columbia type), AtLPST overexpression plant (Super::AtLPST-9) and the AtLPST that sprout back one week of growth on the MS substratum knock out mutant (atlpst-1) Arabidopis thaliana seedling move into contain 170mM NaCl high salt MS substratum (adding 170mM NaCl on the basis of MS substratum again) upward continued growth observe its proterties after 10 days.

The result as shown in Figure 2, on high salt MS substratum, AtLPST overexpression plant (Super::AtLPST-9) shows obvious high-salt stress symptom, the leaf look becomes white, growth of seedling is subjected to obvious inhibition; The high-salt stress symptom that the performance of wild-type plant is slight, the leaf look becomes yellow, and growth is subjected to certain inhibition; Still grow normally and AtLPST knocks out mutant (atlpst-1), the high-salt stress symptom do not occur.1 for AtLPST knocks out mutant (atlpst-1) among Fig. 2, and 2 is AtLPST overexpression plant (Super::AtLPST-9), and 3 is the wild-type plant.

Wild-type, AtLPST overexpression plant (Super::AtLPST-9) and the AtLPST in the sprouting and the week of growing knock out the seedling replanting of mutant (atlpst-1) in soil on the MS substratum, continued growth, watered once in per 3 days, illumination every day 16 hours, light intensity is 100 μ mol/ (m ²* s), temperature is 22 degrees centigrade, and humidity is 50%.The Arabidopis thaliana seedling after 3 weeks of continued growth, stops to water in soil, and the 170mM NaCl solution replacement water of using equal volume instead waters, and waters once in three days, observes proterties (watering salt (170mM NaCl) among Fig. 3) after 20 days.To continue normally to water is contrast (normally watering among Fig. 3).

The result changes and waters NaCl solution after 20 days as shown in Figure 3, and AtLPST overexpression plant (Super::AtLPST-9) shows obvious high-salt stress symptom, and the leaf look becomes yellow or white, and growth is subjected to obvious inhibition; The high-salt stress symptom that the performance of wild-type plant is slight, the leaf look of Lao Ye becomes yellow or white, and growth is subjected to certain inhibition; Still grow normally and AtLPST knocks out mutant (atlpst-1), the high-salt stress symptom do not occur.1 is the wild-type Arabidopis thaliana among Fig. 3, and 2 is ATLPST overexpression plant (Super::ATLPST-9), and 3 knock out mutant (atlpst-1) for ATLPST.

3, AtLPST expression of gene result of variations under the low-phosphorous and high salt condition

The wild-type Arabidopis thaliana in one week of germination and growth (Columbia type) seedling is transferred to low-phosphorous MS substratum respectively and (contains 10 μ M Pi on the MS substratum, promptly based on normal MS substratum, Pi concentration is adjusted into 10 μ M by 1.25mM, and other composition is consistent with normal MS substratum.Normal MS culture medium solution consists of for every liter: 1650mgNH ₄NO ₃, 1900mg KNO ₃, 370mg MgSO ₄7H ₂O, 170mg KH ₂PO ₄, 440mg CaCl ₂2H ₂O, 22.3mg MnSO ₄4H ₂O, 0.83mg KI, 0.025mg CuSO ₄5H ₂O, 6.25mg H ₃BO ₅, 0.025mg CoCl6H ₂O, 8.65mg ZnSO ₄7H ₂O, 0.25mg Na ₂MoO ₄2H ₂O, 27.8mgFeSO ₄7H ₂O, 37.3mg Na ₂EDTA) or on the high salt MS substratum (on the basis of MS substratum, adding the solid medium that 170mM NaCl obtains again) cultivate.Culture condition adopts illumination cultivation full sun, 22 degrees centigrade of temperature, light intensity 100 μ mol/ (m ²* s).Time point at set intervals divides the root cap sampling to associated materials, extracts total RNA, and the extraction of total RNA is undertaken by the product description of Invitrogen Trizol Reagent.

Total RNA of said extracted after 1.0% agarose gel electrophoresis checked for integrity, is combined with ultraviolet spectrophotometer and electrophoresis method and to make accurate quantification.The RNA that gets same amount then respectively carries out electrophoresis Northern hybridization then.The preparation method of the probe fragment of Northern hybridization is as follows:

CDNA full length product with the AtLPST gene is a template, with following primer to increasing

Prmier5：CTTTGGCGATGTCTAGAATTGA；

Primer6：CCTCACCTACTGCTCTCGTAGG。

It is that the AtLPST gene specific cDNA fragment of 600bp is as probe that pcr amplification goes out length.

During the growth of low-phosphorous MS substratum the AtLPST gene expression results as shown in Figure 4, Fig. 4 result shows that the AtLPST gene is subjected to the low-phosphorus stress abduction delivering; During the growth of high salt MS substratum the AtLPST gene expression results as shown in Figure 5, the result shows that the AtLPST gene obviously is subjected to the high-salt stress abduction delivering.

4, wild-type, AtLPST overexpression plant (Super::AtLPST-9) and AtLPST knock out the phosphorus content measurement result of mutant (atlpst-1)

Wild-type (WT), AtLPST overexpression plant (Super::AtLPST-9) and AtLPST knock out mutant (atlpst-1) and grow on the MS substratum, move to MS substratum (normal processing among Fig. 6) or low-phosphorous MS substratum (low-phosphorous processing among Fig. 6) after 7 days respectively and (contain 10 μ M Pi, promptly based on normal MS substratum, Pi concentration is adjusted into 10 μ M by 1.25mM, and other composition is consistent with normal MS substratum.Normal MS culture medium solution consists of: 1650mg NH ₄NO ₃, 1900mg KNO ₃, 370mg MgSO ₄7H ₂O, 170mg KH ₂PO ₄, 440mg CaCl ₂2H ₂O, 22.3mg MnSO ₄4H ₂O, 0.83mg KI, 0.025mg CuSO ₄5H ₂O, 6.25mg H ₃BO ₅, 0.025mg CoCl6H ₂O, 8.65mg ZnSO ₄7H ₂O, 0.25mg Na ₂MoO ₄2H ₂O, 27.8mg FeSO ₄7H ₂O, 37.3mg Na ₂EDTA) go up continued growth 10 days, divide the sampling of root and bizet.Sample spends the night 80 ℃ of oven dry, carries out ashing treatment (300 ℃ 1 hour, 575 ℃ 6 hours) then in muffle furnace.Sample after the ashing carries out phosphorus content with the vanadium molybdenum yellow method and measures with 5mL 0.1N HCl lixiviate, vat liquor.Vanadium molybdenum yellow method method is specific as follows described: the extracting solution 2.00mL behind the absorption constant volume puts into the 10mL volumetric flask, adds 2 dinitrophenol indicator, and dropping 6mol/L NaOH is neutralized to solution and just has been yellow, adds 2.00mL vanadium ammonium molybdate reagent, water constant volume 10mL.Measure at wavelength 450nm place after 15 minutes, regulate instrument zero with blank solution (vat liquor of blank test develops the color by above-mentioned steps).Typical curve: accurately draw 50g/L Pi reference liquid and (utilize KH ₂PO ₄With distilled water preparation reference liquid) 0,0.2,0.5,1,1.5,2,3mL puts into the 10mL volumetric flask respectively, by the above-mentioned steps colour developing, promptly gets 0,1.0,2.5,5.0,7.5,10,15g/mL Pi (utilizes KH ₂PO ₄With distilled water preparation reference liquid) standard serial solution, measure with liquid to be measured, read absorbancy, then drawing standard curve and ask linear regression equation.

The result as shown in Figure 6, the result shows, under the normal growth condition (in the MS substratum, normal processing among Fig. 6), root of AtLPST overexpression plant (Super::AtLPST-9) and bizet phosphorus content all are starkly lower than the root and the bizet phosphorus content of wild-type (WT), and AtLPST knocks out the phosphorus content of mutant (atlpst-1) and the not obviously difference of phosphorus content of wild-type; Under low-phosphorous condition (in the low-phosphorous MS substratum, low-phosphorous processing among Fig. 6), the bizet phosphorus content of AtLPST overexpression plant (Super::AtLPST-9) is starkly lower than the bizet phosphorus content of wild-type, AtLPST knocks out the bizet phosphorus content of the bizet phosphorus content of mutant (atlpst-1) apparently higher than wild-type, and the root phosphorus content of three kinds of plant is obviously difference not.The result shows, after AtLPST is knocked out, causes plant phosphorus content under low-phosphorous condition to increase than wild-type; Behind the AtLPST overexpression, cause the plant normal condition still be under the low-phosphorous condition phosphorus content of plant all reduce.

5, wild-type, AtLPST overexpression plant (Super::AtLPST-9) and AtLPST knock out potassium, the sodium content measurement result of mutant (atlpst-1)

Wild-type (WT), AtLPST overexpression plant (Super::AtLPST-9) and AtLPST knock out mutant (atlpst-1) and grow on the MS substratum, move on MS or high salt (170mM NaCl) substratum continued growth after 7 days respectively 10 days, sampling.Sample spends the night 80 ℃ of oven dry, ashing in muffle furnace then (300 ℃ 1 hour, 575 ℃ 6 hours).The 10mL 0.1N HCl lixiviate of ashing sample, vat liquor atomic absorption method (A protein kinase, interacting with two calcineurin B-like proteins, regulates K ⁺Transporter AKT1 in Arabidopsis.Xu J, Li HD, Chen LQ, WangY, Liu LL, He L, Wu WH.Cell, 2006,125:1347-1360) carry out the mensuration of potassium, sodium content.

The result as shown in Figure 7, under normal MS condition, potassium content in the AtLPST overexpression plant (Super::AtLPST-9) is starkly lower than the potassium content of wild-type, and the potassium content that AtLPST knocks out in the mutant (atlpst-1) is compared not obviously difference with the potassium content of wild-type (WT); Under high salt condition, potassium content in the AtLPST overexpression plant (Super::AtLPST-9) is starkly lower than the potassium content of wild-type (WT), AtLPST knocks out potassium content in the mutant (atlpst-1) a little more than the potassium content of wild-type, simultaneously the sodium content of AtLPST overexpression plant (Super::AtLPST-9) is apparently higher than the sodium content of wild-type, and the sodium content that AtLPST knocks out mutant (atlpst-1) is starkly lower than the sodium content of wild-type.Show that AtLPST can cause the potassium content of plant to reduce behind the overexpression in plant, and then cause plant sodium content under high salt condition to increase, make the plant performance the salt sensitivity; AtLPST by after being knocked out, causes plant potassium content under high-salt stress to make plant show the phenotype of anti-high-salt stress than wild-type height and sodium content is lower than wild-type in plant.

Sequence table

<160>3

<210>1

<211>1662

<212>DNA

＜213〉Arabidopsis Arabidopis thaliana (Arabidopsis thaliana)

<400>1

atggacagag?gatggtctgg?tctcactctt?gattcatctt?ctcttgatct?tttaaaccct 60

aatcgtattt?ctcataagaa?tcaccgacgt?ttctcaaatc?ctttggcgat?gtctagaatt 120

gacgaagaag?atgatcagaa?gacgagaata?tcaaccaacg?gtagtgaatt?taggtttccg 180

gtgagtctct?caggtattcg?tgatcgtgaa?gatgaagatt?tttcatctgg?cgttgctgga 240

gataatgacc?gtgaagttcc?cggcgaagtg?gatttcttct?ccgacaagaa?atctagggtt 300

tgtcgtgaag?acgacgaagg?atttcgtgtg?aagaaggaag?aacaagatga?tcgaacggac 360

gtaaataccg?gtttgaatct?tcgaacaact?ggtaatacaa?agagtgatga?gtcaatgatc 420

gatgatggag?aatcttccga?aatggaagat?aagcgtgcga?aaaatgagtt?ggtgaaatta 480

caagatgagt?tgaagaaaat?gacaatggat?aatcaaaagc?ttagagaatt?gcttacacaa 540

gttagcaaca?gttacacttc?acttcagatg?catcttgttt?cactaatgca?gcaacagcaa 600

caacagaaca?ataaggtaat?agaagctgct?gagaagcctg?aggagacgat?agtaccaagg 660

caatttattg?atttaggccc?tacgagagca?gtaggtgagg?ccgaggatgt?gtcaaattct 720

tcatccgaag?atagaactcg?ttcggggggt?tcttctgcag?ccgagaggcg?tagtaacggg 780

aagagacttg?ggcgtgaaga?aagccccgaa?actgagtcca?acaaaattca?gaaggtgaat 840

tctactaccc?cgacgacatt?tgatcaaacc?gctgaagcta?cgatgaggaa?agcccgtgtc 900

tccgttcgtg?cccgatcgga?agctccgatg?ataagcgatg?gatgtcaatg?gagaaaatat 960

ggccagaaga?tggccaaagg?gaatccttgt?ccgcgggcat?attaccgctg?cacgatggcc 1020

acgggctgtc?ccgttcgcaa?acaagttcaa?cattgcgcgg?aagacagatc?aattctgatt 1080

acaacctacg?agggaaacca?taaccatccg?ttgccgccag?ccgcggtagc?catggcttct 1140

accaccacgg?cggcggctaa?catgttgcta?tccgggtcaa?tgtctagtca?cgacgggatg 1200

atgaacccta?caaatttact?agctagggct?gttcttcctt?gctccacaag?catggcaaca 1260

atctcagcct?ccgcgccgtt?tccaaccgtc?acattagacc?tcacccactc?acctccgcct 1320

cctaatggtt?ccaatccttc?ctcttccgcg?gctaccaaca?acaaccacaa?ctcactgatg 1380

cagcggccgc?aacaacaaca?acagcaaatg?acgaacttac?ctccgggaat?gctacctcat 1440

gtaataggcc?aggcattgta?taaccaatcc?aagttctcgg?ggctgcagtt?ctctggtggc 1500

tctccctcga?cggcagcgtt?ttctcagtca?cacgcggtgg?ctgatacaat?aacggcactc 1560

acagctgacc?cgaatttcac?ggcggctctt?gcagccgtta?tttcttctat?gatcaatggt 1620

acgaaccacc?acgacggcga?aggaaacaac?aaaaatcaat?ag

1662

<210>2

<211>553

<212>PRT

＜213〉Arabidopsis Arabidopis thaliana (Arabidopsis thaliana)

<400>2

Met?Asp?Arg?Gly?Trp?Ser?Gly?Leu?Thr?Leu?Asp?Ser?Ser?Ser?Leu?Asp

1 5 10 15

Leu?Leu?Asn?Pro?Asn?Arg?Ile?Ser?His?Lys?Asn?His?Arg?Arg?Phe?Ser

20 25 30

Asn?Pro?Leu?Ala?Met?Ser?Arg?Ile?Asp?Glu?Glu?Asp?Asp?Gln?Lys?Thr

35 40 45

Arg?Ile?Ser?Thr?Asn?Gly?Ser?Glu?Phe?Arg?Phe?Pro?Val?Ser?Leu?Ser

50 55 60

Gly?Ile?Arg?Asp?Arg?Glu?Asp?Glu?Asp?Phe?Ser?Ser?Gly?Val?Ala?Gly

65 70 75 80

Asp?Asn?Asp?Arg?Glu?Val?Pro?Gly?Glu?Val?Asp?Phe?Phe?Ser?Asp?Lys

85 90 95

Lys?Ser?Arg?Val?Cys?Arg?Glu?Asp?Asp?Glu?Gly?Phe?Arg?Val?Lys?Lys

100 105 110

Glu?Glu?Gln?Asp?Asp?Arg?Thr?Asp?Val?Asn?Thr?Gly?Leu?Asn?Leu?Arg

115 120 125

Thr?Thr?Gly?Asn?Thr?Lys?Ser?Asp?Glu?Ser?Met?Ile?Asp?Asp?Gly?Glu

130 135 140

Ser?Ser?Glu?Met?Glu?Asp?Lys?Arg?Ala?Lys?Asn?Glu?Leu?Val?Lys?Leu

145 150 155 160

Gln?Asp?Glu?Leu?Lys?Lys?Met?Thr?Met?Asp?Asn?Gln?Lys?Leu?Arg?Glu

165 170 175

Leu?Leu?Thr?Gln?Val?Ser?Asn?Ser?Tyr?Thr?Ser?Leu?Gln?Met?His?Leu

180 185 190

Val?Ser?Leu?Met?Gln?Gln?Gln?Gln?Gln?Gln?Asn?Asn?Lys?Val?Ile?Glu

195 200 205

Ala?Ala?Glu?Lys?Pro?Glu?Glu?Thr?Ile?Val?Pro?Arg?Gln?Phe?Ile?Asp

210 215 220

Leu?Gly?Pro?Thr?Arg?Ala?Val?Gly?Glu?Ala?Glu?Asp?Val?Ser?Asn?Ser

225 230 235 240

Ser?Ser?Glu?Asp?Arg?Thr?Arg?Ser?Gly?Gly?Ser?Ser?Ala?Ala?Glu?Arg

245 250 255

Arg?Ser?Asn?Gly?Lys?Arg?Leu?Gly?Arg?Glu?Glu?Ser?Pro?Glu?Thr?Glu

260 265 270

Ser?Asn?Lys?Ile?Gln?Lys?Val?Asn?Ser?Thr?Thr?Pro?Thr?Thr?Phe?Asp

275 280 285

Gln?Thr?Ala?Glu?Ala?Thr?Met?Arg?Lys?Ala?Arg?Val?Ser?Val?Arg?Ala

290 295 300

Arg?Ser?Glu?Ala?Pro?Met?Ile?Ser?Asp?Gly?Cys?Gln?Trp?Arg?Lys?Tyr

305 310 315 320

Gly?Gln?Lys?Met?Ala?Lys?Gly?Asn?Pro?Cys?Pro?Arg?Ala?Tyr?Tyr?Arg

325 330 335

Cys?Thr?Met?Ala?Thr?Gly?Cys?Pro?Val?Arg?Lys?Gln?Val?Gln?Arg?Cys

340 345 350

Ala?Glu?Asp?Arg?Ser?Ile?Leu?Ile?Thr?Thr?Tyr?Glu?Gly?Asn?His?Asn

355 360 365

His?Pro?Leu?Pro?Pro?Ala?Ala?Val?Ala?Met?Ala?Ser?Thr?Thr?Thr?Ala

370 375 380

Ala?Ala?Asn?Met?Leu?Leu?Ser?Gly?Ser?Met?Ser?Ser?His?Asp?Gly?Met

385 390 395 400

Met?Asn?Pro?Thr?Asn?Leu?Leu?Ala?Arg?Ala?Val?Leu?Pro?Cys?Ser?Thr

405 410 415

Ser?Met?Ala?Thr?Ile?Ser?Ala?Ser?Ala?Pro?Phe?Pro?Thr?Val?Thr?Leu

420 425 430

Asp?Leu?Thr?His?Ser?Pro?Pro?Pro?Pro?Asn?Gly?Ser?Asn?Pro?Ser?Ser

435 440 445

Ser?Ala?Ala?Thr?Asn?Asn?Asn?His?Asn?Ser?Leu?Met?Gln?Arg?Pro?Gln

450 455 460

Gln?Gln?Gln?Gln?Gln?Met?Thr?Asn?Leu?Pro?Pro?Gly?Met?Leu?Pro?His

465 470 475 480

Val?Ile?Gly?Gln?Ala?Leu?Tyr?Asn?Gln?Ser?Lys?Phe?Ser?Gly?Leu?Gln

485 490 495

Phe?Ser?Gly?Gly?Ser?Pro?Ser?Thr?Ala?Ala?Phe?Ser?Gln?Ser?His?Ala

500 505 510

Val?Ala?Asp?Thr?Ile?Thr?Ala?Leu?Thr?Ala?Asp?Pro?Asn?Phe?Thr?Ala

515 520 525

Ala?Leu?Ala?Ala?Val?Ile?Ser?Ser?Met?Ile?Asn?Gly?Thr?Asn?His?His

530 535 540

Asp?Gly?Glu?Gly?Asn?Asn?Lys?Asn?Gln

545 550

<210>3

<211>2597

<212>DNA

＜213〉Arabidopsis Arabidopis thaliana (Arabidopsis thaliana)

<400>3

acagactctt?tcttaatctc?tctctctttc?aaccaaaccc?ctaaacaaaa?aaaaaataca?60

ttttctgatc?tctctaaaaa?tctttctcct?tcgttaatct?gtgatctct?ttctttttct 120

atatatggac?agaggatggt?ctggtctcac?tcttgattca?tcttctcttg?atcttttaaa?180

ccctaatcgt?atttctcata?agaatcaccg?acgtttctca?aatcctttgg?cgatgtctag?240

aattgacgaa?gaagatgatc?agaagacgag?aatatcaacc?aacggtagtg?aatttaggtt?300

tccggtgagt?ctctcaggta?ttcgtgatcg?tgaagatgaa?gatttttcat?ctggcgttgc?360

ggtttgtcgt?gaagacgacg?aaggatttcg?tgtgaagaag?gaagaacaag?atgatcgaac?480

ggacgtaaat?ctaagtacga?cttttcgata?aatcatatga?aatacaattt?tcttactaat?540

ggtttgtatt?agtgtggacg?tgtcataatt?tggtttacat?ttgaaatatc?aaataaaaat?600

accaaatttt?gtttcatttt?tttttttttg?ataaaggtat?catattttgt?tttcttacaa?660

aatgatttct?aaatttgaat?tttaatttgt?tatagaccgg?tttgaatctt?cgaacaactg?720

gtaatacaaa?gagtgatgag?tcaatgatcg?atgatggaga?atcttccgaa?atggaagata?780

agcgtgcgaa?aaatgaggta?agtttagttt?gattttacat?tagtaatatt?taatagatga?840

ataatttgaa?ccggtttgat?taatatttcg?attttttttt?gtttatcaca?gttggtgaaa?900

ttacaagatg?agttgaagaa?aatgacaatg?gataatcaaa?agcttagaga?attgcttaca?960

caagttagca?acagttacac?ttcacttcag?atgcatcttg?tttcactaat?gcagcaacag?1020

caacaacaga?acaataaggt?aaataattat?tagattgatc?aaccacaagt?aaatggaatt?1080

taccctacat?gaataggcaa?ttaattttgg?tgaacctata?tgattaggta?atagaagctg?1140

ctgagaagcc?tgaggagacg?atagtaccaa?ggcaatttat?tgatttaggc?cctacgagag?1200

cagtaggtga?ggccgaggat?gtgtcaaatt?cttcatccga?agatagaact?cgttcggggg?1260

gttcttctgc?agccgagagg?cgtagtaacg?ggaagagact?tgggcgtgaa?gaaagccccg?1320

aaactgagtc?caacaaaatt?cagaaggtga?attctactac?cccgacgaca?tttgatcaaa?1380

ccgctgaagc?tacgatgagg?aaagcccgtg?tctccgttcg?tgcccgatcg?gaagctccga?1440

tggtaagttg?atttattaga?tactaatact?tataagacta?tataaaaaat?aaactatgtg?1500

ctttagagat?taattatctt?tgtactttat?gtttctatag?ataagcgatg?gatgtcaatg?1560

gagaaaatat?ggccagaaga?tggccaaagg?gaatccttgt?ccgcgggcat?attaccgctg?1620

cacgatggcc?acgggctgtc?ccgttcgcaa?acaagtaaga?tttaaaagat?ttaaccattg?1680

gactaaaaga?ttcttgttgt?aaaaacatta?gagatttcaa?tgtatatatg?tttgcgtgat?1740

tggctaatac?gttcggtccg?aaatgatatt?tataggttca?acgttgcgcg?gaagacagat?1800

caattctgat?tacaacctac?gagggaaacc?ataaccatcc?gttgccgcca?gccgcggtag?1860

ccatggcttc?taccaccacg?gcggcggcta?acatgttgct?atccgggtca?atgtctagtc?1920

acgacgggat?gatgaaccct?acaaatttac?tagctagggc?tgttcttcct?tgctccacaa?1980

gcatggcaac?aatctcagcc?tccgcgccgt?ttccaaccgt?cacattagac?ctcacccact?2040

cacctccgcc?tcctaatggt?tccaatcctt?cctcttccgc?ggctaccaac?aacaaccaca?2100

actcactgat?gcagcggccg?caacaacaac?aacagcaaat?gacgaactta?cctccgggaa?2160

tgctacctca?tgtaataggc?caggcattgt?ataaccaatc?caagttctcg?gggctgcagt?2220

tctctggtgg?ctctccctcg?acggcagcgt?tttctcagtc?acacgcggtg?gctgatacaa?2280

taacggcact?cacagctgac?ccgaatttca?cggcggctct?tgcagccgtt?atttcttcta?2340

tgatcaatgg?tacgaaccac?cacgacggcg?aaggaaacaa?caaaaatcaa?tagaaaaata?2400

ttacattttt?tttttgggta?tctacatttt?ttttccaact?gggttatagg?aaacagagag?2460

tttatttcat?tgattcacat?ttgttctgtt?tcgtaccaaa?atcccagtaa?atatacaaaa?2520

gcaaactata?ctcaagttca?tattcgtaaa?cactataaat?agttacgtaa?cttaattagc?2580

attgccttta?aagcttt 2597

Claims (2)

1. plant responding low-phosphor and high-salt stress albumen are being cultivated the application in the plant of low-phosphorous and high-salt stress resistance or susceptibility raising, and described plant is an Arabidopis thaliana;

The proteic amino acid residue sequence of described plant responding low-phosphor and high-salt stress is shown in SEQ ID № .2 in the sequence table.

2. the proteic encoding gene of plant responding low-phosphor and high-salt stress is being cultivated the application in the plant of low-phosphorous and high-salt stress resistance or susceptibility raising, and described plant is an Arabidopis thaliana;

The nucleotide sequence of described plant responding low-phosphor and the proteic encoding gene of high-salt stress is as SEQ ID № in the sequence table: 1 or sequence table in SEQ ID №: shown in 3.

Images