CN101503700A - Double-plasmid expression system capable of producing virus-like particles containing large segments of RNA - Google Patents

Abstract

The invention relates to a double-plasmid expression system capable of producing a virus-like particle packing large-fragment RNA, which belongs to the field of biotechnology. The double-plasmid expression system capable of expressing the virus-like particle containing large-fragment RNA consists of a plasmid PET-MC and a plasmid pACYC-X, wherein the PET-MC is constructed by integrating pET-28(b) with mature enzyme protein of phage MS2 and capsid protein cDNA, and the pACYC-X is constructed by integrating a 19mer packing site of the phage MS2 and the cDNA of target RNA. The invention has the advantage that the virus-like particle expressed by the double-plasmid expression system contains long-fragment RNA. Different target fragments to be amplified by virus are constructed together to form a chimera which is packed into the virus-like particle, thus the virus-like particle can be taken as a multi-target nucleic acid standard and a quality control material applicable to simultaneous detection of a plurality of viruses for the same specimen so as to save cost and simplify operation procedures.

Description

A kind of double-plasmid expression system that produces virus-like particles containing large segments of RNA

Technical field

The present invention relates to a kind of double-plasmid expression system that produces virus-like particles containing large segments of RNA, belong to biological technical field.

Background technology

RNA viruses such as hepatitis C virus (Hepatitis C virus, HCV), human immunodeficiency virus (humanimmunodeficiency virus, HIV), the severe acute respiratory syndrome coronavirus (Severe acuterespiratory syndrome coronavirus, SARS-CoV), HPAI (High Pathogenic AI) virus H5N1 etc. is the pathogenic agent that a class can cause human serious disease.Viral RNA detects for the early diagnosis of infecting, and the dynamic observing of antiviral therapy curative effect, and is requisite means.Since earlier 1990s, people gradually adopt molecular diagnosis method (Molecular diagnostic assay) to detect viral RNA, the sensitive special main detection mode that makes it to become many viral RNAs of this type of technology, even unique detection mode.At present the most frequently used detection method comprise real-time fluorescence quantitative PCR (real time reaverse transcription PCR, RT-PCR), the amplification (TMA) of nucleotide sequence dependent amplification NASBA, branched chain DNA RT-PCR detection method and ligase enzyme enzymatic chain reaction (LCR), transcriptive intermediate.

Use molecular diagnosis method to detect RNA viruses and will obtain reliable result, the strict quality measure must be arranged, the very crucial quality control product that specific RNA viruses a bit will be arranged exactly.Simultaneously, carry out quantitative assay, also the RNA viruses standard substance must be arranged usually virus.The quality control product of RNA viruses augmentation detection and standard substance comprise the RNA (armored RNA) of naked RNA fragment, virion and the band armor at present.Exposed RNA is easy to be subjected to extensively rnase (the RNA nuclease of existence, ribonuclease, RNase) degraded, and, is that it can not be monitored the whole process that detects with exposed RNA as another defectives of standard substance, because the existence of RNase is generally arranged in the sample, directly it being added sample can be degraded, even it is added in the lysate, the RNase that standard substance are subjected in the sample degrades.With virion during as standard substance, because virion is infectious, and, its preparation transportation difficulty, so, although the someone uses bovine diarrhea virus (BVDV) as the internal standard product that detect HCV at present, perhaps with the HCV virion as the HCV standard substance that the standard substance replacement WHO of detection HCV RNA provides, perhaps use the HIV virion as general viral RNA standard substance.But these technology can't overcome problems such as virion infectivity, virion preparation transportation difficulty, that is to say that virion is not the ideal standard substance.In view of the defective of above-mentioned two kinds of standard substance, need that design a kind ofly prepares simply, the RNA examination criteria product of quantitatively easy, anti-RNase.The armored RNA technology of inventions such as DuBois can satisfy above-mentioned requirements, prepares anti-RNase, the communicable RNA of lifeless matter.Armored RNA is a MS2 phage sample virus-like particle, is envelope protein of MS2 phage and the mixture of RNA.DuBois etc. express virus-like particle with simple substance grain expression system, when making up plasmid, utilize molecule clone technology successively with maturing enzyme albumen, envelope protein, packaging site and the viral standard substance sequence clone of MS2 downstream to expression vector, through abduction delivering, the envelope protein assembling assembly virus-like particle also is packaged in purpose RNA in the envelope protein.Armored RNA prepares convenient transportation, quantitatively easy, and the whole process that can detect with the form monitoring of internal reference thing.Nowadays, armored RNA has been widely used in the quality control product of RT-PCR and branched chain DNA detection.But the segmental length of RNA of this method packing has only about 500bp, and when the RNA fragment length surpassed 500bp, packaging efficiency significantly reduced.When detecting RNA viruses, although the fragment of most of RT-PCR test kit amplifications is no more than 500bp, if but the virus-like particle of above-mentioned anti-RNase can be packed the RNA of long segment, then it has using value more widely in the quality control of the clinical detection of RNA viruses and stdn.For example, adopt bDNA technology for detection HIV, employed HIV RNA standard substance will grow to about 3kb.At this moment, can not obtain a virus-like particle that can be used as quality control product and standard substance that includes the exogenous RNA of length like this with aforesaid method; In addition, with regard to the detection of certain specific virus, the amplified target fragment of the RT-PCR test kit of different reagent manufacturer production may be different, if the purpose fragment of different manufacturers is building up on the RNA chain, and be packaged in the envelope protein, form virus-like particle, just can directly compare between the so different laboratories the result; If the purpose fragment that will increase different virus is built together in addition, form mosaic, and be packaged in the virus-like particle, applicable many target nucleic acids standard substance and quality control product when detecting when this virus-like particle just can be used as same sample carried out a plurality of virus, both provided cost savings, also simplified schedule of operation.

MS2 is the sense single stranded rna phage, and genome contains 3569 Nucleotide, the 4 kinds of protein molecules of encoding: maturing enzyme albumen, envelope protein, replicase protein and crack protein.Envelope protein is made up of the subunit of 180 chemical structure unanimities, and each subunit contains 129 amino-acid residues, forms the icosahedron symmetrical structure.' end exists a loop-stem structure of being made up of 19 bases (19mer) in replicative enzyme 5, it is the interactional position of envelope protein dimer and RNA, the mixture that this interaction forms is the signal of phage oneself packing, on the basis of mixture, the driving that maturing enzyme albumen and other envelope protein molecule knot are incorporated in free energy forms corresponding space conformation down, finishes the assembling of MS2 phage.The loop-stem structure of 19mer (hairpin structure) mainly is made up of three parts such as ring that the VITAMIN B4 of a base pairing stem ,-10 projections and 4 Nucleotide form.Base sequence is 5ACAUGAGGAUUACCCAUGU3 ', is+1 with the replicative enzyme initiator codon.Among the 19mer only the position of 4 Nucleotide the identification particularly important of envelope protein is being guaranteed under the stem base pairing situation-4 ,-7 and-10 VITAMIN B4 and-5 s' pyrimidine and envelope protein interaction ^[16], 3 important VITAMIN B4 (4 ,-7 ,-10) combine with the envelope protein dimer by different way.

ROWSELL etc. have made up the aptamers of four kinds of RNA loop-stem structures, C-variant, F5, F6 and F7, the secondary structure of these aptamers is different with wild-type, wherein,-5 of C-variant is cytosine(Cyt), replaced the uridylic of wild-type, the C-variant aptamers has been compared with wild-type with the avidity of capsid protein improved 6 times, or even 50 times.Important difference between C-variant aptamers and the wild-type loop-stem structure is the N4 of C-5 and the Sauerstoffatom of phosphate group on-6 has formed intramolecular hydrogen bond.

Pickett and Peabody have designed double-plasmid expression system and have expressed virus-like particle, one of them plasmid expression envelope protein, and the 3000bplacZ gene in the packaging site of another plasmid expression 19mer and its downstream.Found that the envelope protein of expression can be packed the exogenous rna that contains the 19mer loop-stem structure, but the exogenous rna length of packing has only 500bp, rather than the 3000bp of expection; Pack gained phage sample particle in addition and contain host's ribosome-RNA(rRNA) (rRNA).The double-plasmid expression system of Pickett and Peabody design does not comprise maturing enzyme albumen, but maturing enzyme albumen is important to the integrity that guarantees packaged gene in virus-like particle, do not have the proteic virus-like particle of maturing enzyme, the RNA of its internal packing is easily degraded by RNase.So the virus-like particle of Pickett and Peabody is defective virus-like particle, promptly lacks ripe characteristic, to the RNase sensitivity.In another experiment of Pickett and Peabody, they have adjusted the ratio of envelope protein and exogenous RNA, and the RNA of result's packing has only purpose RNA, and does not pack host RNA, and the eurythmy of this explanation envelope protein and exogenous RNA also is very important.

Summary of the invention

The technical problem to be solved in the present invention is: provide a kind of the expression to contain big fragment RNA viruses sample particulate double-plasmid expression system.

For achieving the above object, the present invention is by the following technical solutions:

A kind of expression contains big fragment RNA viruses sample particulate double-plasmid expression system, form by plasmid PET-MC and plasmid pACYC-X, wherein pET-MC is made up by pET-28 (b) integration phage MS2 maturing enzyme albumen and capsid protein cDNA and forms, and pACYC-X is that PACYCDuet-1 integrates the 19mer packaging site of phage MS2 and the cDNA structure of purpose RNA forms (composition).

Described pACYC-X is the pACYC-3V plasmid.

The mosaic sequence of described pACYC-3V plasmid expression packaging site and 3 kinds of viruses.

The mosaic sequence of described 3 kinds of viruses is SARS-Cov (SARS-CoVl, SARS-CoV2, SARS-CoV3), one section HCV and two sections H5N1 (M300 and HA300).

Double expression plasmid pACYC-3V and PET-MC system, be present among the coli strain pACYC-dnet-1-ET-28b, this coli strain is preserved in (address: Datun Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, China Microbial Culture Preservation Commission common micro-organisms center, postcode: 100101), preservation date is on March 31st, 2008, the classification of suggestion colon bacillus Escherichia coli by name, preserving number is CGMCC No.2425.

Described double expression plasmid pACYC-3V and PET-MC system, the described nucleotide sequence of expressed sequence table SEQ ID No.1.

In the present invention, our two pUC pUC application carrier are plasmid pET-28 (b) and pACYCDuet-1, and plasmid pET-28 (b) and pACYCDuet-1 are low copy plasmid, and copy number is respectively 18-20 and 18-22.Both replicons are respectively ColE1 and P15A, are the different consistency plasmids of replicon, and both resistance differences, so can coexist as in the same bacterial strain.Both promotors are all T7, so both efficient of transcribing should be identical.Characteristics based on above two plasmids, maturing enzyme albumen and envelope protein are implemented in pET-28 (b), and the cDNA of the packaging site of 19mer and purpose RNA is implemented in pACYCDuet-1, and two plasmids are transformed into same bacterial strain and express, and the envelope protein of expression and the ratio of RNA should be coordinated.PACYCDuet-1 is a dual-expression vector in addition, two groups of multiple clone site and two identical promotors and terminator are arranged, so we can be implemented in the cDNA of the packaging site of maturing enzyme albumen and coating egg and 19mer and purpose RNA respectively two multiple clone site of pACYCDuet-1, the ratio of envelope protein of Biao Daing and RNA also should be coordinated like this.

In order to pack the virus-like particle that contains big fragment RNA, we have designed the two pUC pUCs of application and have expressed virus-like particle, one of them plasmid expression maturing enzyme albumen and envelope protein, another plasmid expression packaging site and exogenous RNA.The envelope protein of Biao Daing is only packed exogenous RNA like this, and does not pack the gene order of phage, so in theory, Bao Zhuan exogenous RNA fragment should be about 3500bp in this way.

In order to prove the effect of double-plasmid expression system, we have successfully made up PET-MC and PACYC-3V, the former expresses ripe zymoprotein and capsid protein, the latter expresses the mosaic sequence of 3 kinds of viruses of packaging site and 2250bp, what packaging site was used is the C-5 varient, and the position of packaging site is placed on the centre of purpose RNA, apart from 1200bp base place, upstream.Through inducing success expression virus-like particle, the virus-like particle of expression has been packed the 2250bp of total length.Experiment showed, that this virus-like particle has good stability.This contains the coli strain called after pACYC-dnet-1-ET-28b of double expression plasmid pACYC-3V and PET-MC, be preserved in (address: Datun Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, China Microbial Culture Preservation Commission common micro-organisms center, postcode: 100101), preservation date is on March 31st, 2008, the classification of suggestion colon bacillus Escherichiacoli by name, preserving number is CGMCC No.2425.

The advantage of invention is: the virus-like particle that two pUC pUCs that the present invention makes up are expressed includes long fragment rna.We are built together the purpose fragment that different virus will increase, form mosaic, and be packaged in the virus-like particle, applicable many target nucleic acids standard substance and quality control product when detecting when this virus-like particle just can be used as same sample carried out a plurality of virus, both provided cost savings, also simplified schedule of operation.

The invention will be further described below in conjunction with the drawings and specific embodiments; it is not limitation of the invention; according to prior art well known in the art; embodiments of the present invention are not limited to this; therefore all this areas of having done according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.

Description of drawings

Fig. 1 is pET-28a (+) plasmid map.

Fig. 2 is the PACYCDuet-1 plasmid map.

Fig. 3 is virus-like particle dialysis back result.

Fig. 4 is checking VLP particulate result.

Fig. 5 is for extracting TA clone, electrophoresis result.

Fig. 6 is the sample 10000/ML of 4 ℃ of placements, the fluorescent PCR result.

Fig. 7 is the sample 10000/ML of 37 ℃ of placements, the fluorescent PCR result.

The sample 10000/ML that Fig. 8 places for room temperature, the fluorescent PCR result.

Embodiment

The plasmid that adopts among the embodiment, bacterial classification and reagent are as follows:

Plasmid PET-28 (b) purchases the company in Novagen

Plasmid PACYC ^Duet-1Purchase company in Novagen

Plasmid pNCCL is so kind as to give by Peabody.

PGEM-T Easy Vector Systems: purchase company in Promega

Product bacterial strain BL21 (DE3) purchases the company in Tiangen

Restriction enzyme, T4DNA ligase enzyme are purchased in NEB company, RNA extraction agent box and are purchased in Qiagen

The structure of embodiment 1:pET-MC

One. maturing enzyme albumen and the capsid protein sequence of amplification MS2

With the pNCCL plasmid is template, the maturing enzyme albumen of pcr amplification MS2 and capsid protein sequence 81-1741.

Primer: 5 '-CG G GATCCTGGCTATCGCTGTAGGTAGCC-3 ' 81-101

5’-CCC A AGCTTATGGCCGGCGTCTATTAGTAG-3’1721-1741

Reaction system: amplification 4 each 50 μ l:10*buffer5ul of pipe; Taq 0.4ul; DNTP 1ul; Primerl1ul; Primer2 1ul; Mgcl ₂3ul; NCCL 1ul; DEPC water 37.6ul.

Loop parameter: 94 ℃ 3 minutes; 94 ℃ 30 seconds, 57 ℃ 30 seconds, 72 ℃ 30 seconds, repeat 40 circulations; 72 ℃ 2 minutes; 72 ℃ 10 minutes.

Electrophoresis result shows that the fragment length of amplification is 1700bp, meets expection.

The segmental TA clone of the maturing enzyme albumen of two .MS2 and capsid protein

MS2 maturing enzyme albumen and capsid protein fragment with in the ordinary method recovery running gel are connected the PCR product according to the test kit specification sheets with pGEM-T Easy Vector, 4 ℃ of connections are spent the night.Get 5 μ l and connect product, add 200 μ l competence bacteriums, the mixing ice bath left standstill 30 minutes gently.Pipe is put into the circulator bath of heating in advance to 42 ℃, exactly place 90S, do not shake.Placed 2 minutes on ice.The LB nutrient solution that adds 37 ℃ of pre-temperature of 200ul, 37 ℃ of vibrations (200rpm) were cultivated 1 hour.Converted product is applied on the LB culture plate (containing 1mol/l IPTG 4 μ l, 20mg/ml X-gal 40 μ l) that contains 100 μ g/ml penbritins, is inverted overnight incubation for 37 ℃.The result meets expection, visible blue, the hickie bacterium colony of substratum.

Three. extract the TA cloned plasmids that has transformed

Choose 7 single bacterium colonies of white after the conversion, be inoculated into and contain in the antibiotic LB substratum of AMP, the cultivation base unit weight is 4ml, divides jolting to spend the night in 37 ℃, 300rpm/.The substratum that jolting is spent the night centrifugal 5 minutes with the rotating speed of 10,000 * g is outwelled supernatant, test tube is inverted in blots nutrient solution on the paper handkerchief as far as possible.Extract the specification sheets operation according to the TAKARA plasmid, extract the TA cloned plasmids.Electrophoresis determines to meet pre-after date, with MS2TA in-20 ℃ of preservations.

Four. make up the PET-MC plasmid

Application limitations restriction endonuclease BamHI and HindIII double digestion MS2TA clone and carrier PET-28 (b), 37 ℃ of enzymes were cut four hours.Reaction system: BSA 0.4ul, hindIII 2ul, BamHI 2ul, buffer 5ul, MS2TA 41.6ul.

Cut product according to the operation of NEB specification sheets with above-mentioned enzyme and make up the PET-MS2 plasmid.Linked system is: 10*buffer1ul; Meet enzyme 1ul; PET-28 (b) 5ul; MS2 3ul.4 ℃ of connections are spent the night.Get 5 μ l and connect product, add 200 μ l competence bacteriums, the mixing ice bath left standstill 30 minutes gently.Pipe is put into the circulator bath of heating in advance to 42 ℃, exactly placed 90 seconds, placed 2 minutes on ice.The LB nutrient solution that adds 37 ℃ of pre-temperature of 200ul, 37 ℃ of vibrations (200rpm) were cultivated 1 hour.Converted product is applied on the LB culture plate that contains 100 μ g/ml kana mycins, is inverted overnight incubation for 37 ℃.The result: dull and stereotyped visible bacterial growth meets expection.

Five. extract the PET-MC plasmid

Choose the single bacterium colony after the conversion, be inoculated into and contain in the antibiotic LB substratum of kana, the cultivation base unit weight is 4ml, divides jolting to spend the night in 37 ℃, 300rpm/.The substratum that jolting is spent the night centrifugal 5 minutes with the rotating speed of 10,000 * g is outwelled supernatant, test tube is inverted in blots nutrient solution on the paper handkerchief as far as possible.Extract the specification sheets operation according to the TAKARA plasmid, extract the PET-MC plasmid.Send the order-checking of three rich polygala root biotech companies with the plasmid of said extracted, sequencing result is correct.

The structure of embodiment 2:pACYC-3V

One. use six sections chimeric section sequences of OVERLAP technology amplification

Six sections sequences comprise three sections SARS-Cov (SARS-CoV1, SARS-CoV2, SARS-CoV3), one section HCV and two sections H5N1 (M300 and HA300).

The first round PCR six sections little sequences that at first increase.

The amplification of SARS-CoV1: template pBSSR-V6 is so kind as to give by consonance medical university basis.Amplification

15224～15618 sequences of SARS-CoV

Primer: S-SARS1:5 ' TATCCAAAATGTGACAGAGCCATG3 ' LAP-SARS1:5 ' ACGCTGAGGTGTGTAGGT GCAGGTAAGCGTAAAACTCATCCAC3 '

The amplification of SARS-CoV2: template pNCCL-SARS is made up by this chamber.Amplification SARS-CoV18038～18340 sequences

Primer: A-SARS2:5 ' TAACCAGTCGGTACAGCTACTAAG3 '

LAP-SARS：5’AGTTTTACGCTTACCTGCACCTACACACCTCAGCGTTGATATAAAG3’

The amplification of SARS-CoV3: template pBSSR7-8 is by being so kind as to give by consonance medical university basis.Amplification SARS-CoV328110～28692 sequences.

Primer A-SARS35 ' ACTACGTGATGAGGAGCGAGAAGAG3 '

LAP-SARS35‘AGCTGTACCGACTGGTTAACAAATTAAAATGTCTGATAATGGACCCC

The amplification of HCV: template pNCCL-HCV plasmid is made up by this chamber.18～310 aligning primers of amplification HCV: S-HCV ACATGAGGATCACCCATGTGGCGACACTCCACCATAGATCACTC3 ' HCV-LAP15ATGTAAGACCATTCCGGC TCGCAAGCACCCTATCAGGCAGTAC3

The amplification of HA300: template pNCCL-H5N1 plasmid is made up by this chamber.295～611 sequences of amplification H5N1.Primer: A-HA300:5GAATCCGTCTTCCATCTTTCCCCCACAGTACCAAAAGATCTTC3HA3 00LAP:5 ' CTGATAGGGTGCTTGCGA GCCGGAATGGTCTTACATAGTGGAG3 '

The amplification of M300: template pNCCL-H5N1 plasmid is made up by this chamber.17～373 sequences of amplification H5N1.M300-S’5’TT GGCCGG↓CC?GAGTCTTCTAACCGAGGTCGAAACG3’

M+SLAP15’ATGGCTCTGTCACATTTTGGATAGAGTAGCTGAGTGCGACCTCCTTAG

Second takes turns pcr amplification SARS-CoV1+SARS-CoV2 and HCV+HA300

The amplification of SARS-CoV1+SARS-CoV2: template is above-mentioned small segment SARS-CoV1 and the glue recovery product of SARS-CoV2.

Primer: S-SARS1:5 ' TATCCAAAATGTGACAGAGCCATG3

LAP-SARS2 ⁺：5’ATCAGACATTTTAATTTGT?TAACCAGTCGGTACAGCTACTAAG3’

The amplification of HCV+HA300: template is above-mentioned small segment HCV and the glue recovery product of HA300.

Primer: FIVELAP2:5 ' CGCTCCTCATCACGTAGT ACATGAGGATCACCCATGTGGC3 ' OverlapA ': 5 ' CC TTAAT ↓ TAACCCACAGTACCAAAAGATCTTCTTG '

Third round pcr amplification SARS-CoV1+SARS-CoV2+SARS-CoV3

The amplification of SARS-CoV1+SARS-CoV2+SARS-CoV3: applying template is that the glue of SARS-CoV1+SARS-CoV2 and SARS-CoV3 reclaims product.

Primer: M+SLAP2:

5’AAGGAGGTCGCACTCAGCTACTCTATCCAAAATGTGACAGAGCCATG3’

FIVELAP1：5’CATGGGTGATCCTCATGT?ACTACGTGATGAGGAGCGAGAAGAG3’

Four-wheel pcr amplification SARS-CoV1+SARS-CoV2+SARS-CoV3+HCV+HA300

The amplification of SARS-CoV1+SARS-CoV2+SARS-CoV3+HCV+HA300: applying template is above-mentioned SARS-CoV1+SARS-CoV2+SARS-CoV3 and the glue recovery product of HCV+HA300.

Draw I thing: M+SLAP2 ':

5’AAGGAGGTCGCACTCAGCTACTC?TATCCAAAATGTGACAGAGCCATG3’

OverlapA’：5‘CC TTAAT↓TAACCCACAGTACCAAAAGATCTTCTTG’

The 5th takes turns pcr amplification M300+SARS-CoV1+SARS-CoV2+SARS-CoV3+HCV+HA300

The amplification of M300+SARS-CoV1+SARS-CoV2+SARS-CoV3+HCV+HA300: applying template is above-mentioned SARS-CoV1+SARS-CoV2+SARS-CoV3+HCV+HA300 and the glue recovery product of M300.

Primer: M300-S ': 5 ' TT GGCCGG ↓ CCGAGTCTTCTAACCGAGGTCGAAACG3 '

OverlapA’：5‘CC TTAAT↓TAACCCACAGTACCAAAAGATCTTCTTG’

Two. the TA clone of six sections mosaic sequences

Six sections mosaic fragments with in the ordinary method recovery running gel are connected the PCR product according to the test kit specification sheets with pGEM-T Easy Vector, 4 ℃ of connections are spent the night.Get 5 μ l and connect product, add 200 μ l competence bacteriums, the mixing ice bath left standstill 30 minutes gently.Pipe is put into the circulator bath of heating in advance to 42 ℃, exactly place 90S, do not shake, placed 2 minutes on ice.The LB nutrient solution that adds 200ul37 ℃ of pre-temperature, 37 ℃ of vibrations (200rpm) were cultivated 1 hour.Converted product is applied on the LB culture plate (containing 1mol/l IPTG 4 μ l, 20mg/ml X-gal 40 μ l) that contains 100 μ g/ml penbritins, is inverted overnight incubation for 37 ℃.The result meets expection, visible blue, the hickie bacterium colony of substratum.

Three. extract the TA cloned plasmids that has transformed

Choose the white single bacterium colony after the conversion, be inoculated into and contain in the antibiotic LB substratum of AMP, the cultivation base unit weight is 4ml, divides jolting to spend the night in 37 ℃, 300rpm/.The substratum that jolting is spent the night centrifugal 5 minutes with the rotating speed of 10,000 * g is outwelled supernatant, test tube is inverted in blots nutrient solution on the paper handkerchief as far as possible.Extract the specification sheets operation according to the TAKARA plasmid, extract the TA cloned plasmids.Electrophoresis determines to meet pre-after date, with 3VTA in-20 ℃ of preservations.

Four. make up the pACYC-3V plasmid

Application limitations restriction endonuclease FSEI and PACI double digestion 3VTA clone and carrier PACYCDuet-1,37 ℃ of enzymes are cut and are spent the night.Reaction system: BSA 0.4ul, FSEI 2ul, PACI 2ul, buffer 5ul, 3VTA (PACYCDuet-1) 41.6ul.

Cut product according to the operation of NEB specification sheets with above-mentioned enzyme and make up the pACYC-3V plasmid.Linked system is: 10*buffer1ul; Meet enzyme 1ul; PACYCDuet-15ul; 3V 3ul.4 ℃ of connections are spent the night.Get 5 μ l and connect product, add 200 μ l competence bacteriums, the mixing ice bath left standstill 30 minutes gently.Pipe is put into the circulator bath of heating in advance to 42 ℃, exactly placed 90 seconds, placed 2 minutes on ice.The LB nutrient solution that adds 37 ℃ of pre-temperature of 200ul, 37 ℃ of vibrations (200rpm) were cultivated 1 hour.Converted product is applied on the LB culture plate that contains 100 μ g/ml paraxin, is inverted overnight incubation for 37 ℃.The result: dull and stereotyped visible bacterial growth meets expection.

Five. extract the pACYC-3V plasmid

Choose the single bacterium colony after the conversion, be inoculated into and contain in the antibiotic LB substratum of paraxin, the cultivation base unit weight is 4ml, divides jolting to spend the night in 37 ℃, 300rpm/.The substratum that jolting is spent the night centrifugal 5 minutes with the rotating speed of 10,000 * g is outwelled supernatant, test tube is inverted in blots nutrient solution on the paper handkerchief as far as possible.Extract the specification sheets operation according to the TAKARA plasmid, extract the pACYC-3V plasmid.Send the order-checking of three rich polygala root biotech companies with the plasmid of said extracted, sequencing result is correct.

Embodiment 3: double expression plasmid pACYC-3V and PET-MC are transformed into e. coli bl21

One. cotransfection:

Two plasmid equal-volumes mix 10ul altogether, and the 10ul plasmid joins in the pipe that the 200ul competent cell is housed, and rotates mixing content several times gently, put in the ice 30 minutes.Pipe is put into the circulator bath of heating in advance to 42 ℃, place 90S, do not shake.Fast pipe is moved on in the ice bath, make cell cooling 2 minutes.Add nonresistant LB substratum 200ul.37 ℃ of shaking culture 1 hour.Coated plate is in the flat board that contains paraxin and KANA mycin then.Place room temperature to liquid-absorbent flat board.Be inverted plate, cultivated 16 hours in 37 ℃.As a result, the visible colony growth of substratum meets expected results.

Two. extract plasmid:

Choose the single bacterium colony after the conversion, be inoculated in the LB substratum that contains paraxin and KANA mycin, the cultivation base unit weight is 10ml, divides jolting to spend the night in 37 ℃, 300rpm/.The substratum that jolting is spent the night centrifugal 5 minutes with the rotating speed of 10,000 * g is outwelled supernatant, test tube is inverted in blots nutrient solution on the paper handkerchief as far as possible.Add the resuspended liquid of 250ul cell, thermal agitation suspends cell fully.Add the 250ul cell pyrolysis liquid, put upside down mixing 4 times, about 5 minutes of incubated at room.Add the 10ul Sumizyme MP, put upside down mixing 4 times, about 5 minutes of incubated at room.Add the 350ul neutralizer, put upside down mixing immediately 4 times.With the rotating speed of 12,000 * g centrifugal 15 minutes.With the rotating speed of 12,000 * g centrifugal 15 minutes.Liquid is moved in the extraction column, avoid sneaking into the throw out of white.At room temperature, with maximum speed of revolution centrifugal 1 minute, from collection tube, take out extraction column, outwell filtrate.Extraction column is inserted in the collection tube again.Add 700ul and wash post liquid (dissolving with 95%ethonal in advance) in post.At room temperature, with maximum speed of revolution centrifugal 1 minute, from collection tube, take out extraction column, outwell filtrate.Extraction column is inserted in the collection tube again.Add 700ul once more and wash post liquid, wash step more than the repetition.At room temperature, with maximum speed of revolution centrifugal 2 minutes.With extraction column be moved into one new, in the aseptic 1.5ml centrifuge tube, carefully do not bring into and wash post liquid.Add water that 50ul do not have restriction endonuclease in post, the wash-out plasmid, at room temperature, with maximum speed of revolution centrifugal 1 minute.Behind the DNA wash-out, take out extraction column.Put into-20 ℃ of preservations.Electrophoresis result shows, meets expection.

Three. transformed inducing and expressing of plasmid; Ultrasonic broken bacterium is extracted virus-like particle

Get 1 single colony inoculation to containing in the antibiotic LB liquid nutrient medium of paraxin and KANA, the cultivation base unit weight is 4ml, divides jolting to spend the night in 37 ℃, 300rpm/.The bacterium liquid 40UL that gets incubated overnight is in the liquid nutrient medium of 10ML, and jolting was cultivated 2 hours 40 minutes, survey OD value and be 0.6 o'clock adding IPTG to final concentration be 1mmol/ml.37 ℃, 300rpm/ divide jolting to cultivate 16 hours.Get 3ml bacterium liquid in 4 ℃, 14000rpm, centrifugal 2 minutes.With PBS liquid washing 3 times, add supersound process liquid 250UL then and suspend.Using ultrasound carries out broken bacterium.4 ℃, 14000rpm, centrifugal 10 minutes.Get supernatant 20UL respectively and add DNase and RNase5UL respectively, put into 37 ℃ 1 hour.Electrophoresis result shows, meets expected results.

Four. to two plasmid expression virus-like particles surpass from and the dialysis:

The expression product suspension is weighed, add the ratio of 0.6g Cscl2, Cscl2 is joined in the suspension, use centrifugal 20 hours of 21 ℃ of 56300rmp of TI90 centrifugal head in the 1g expression product.Super from after, begin slowly the liquid sucking-off from liquid level, 1ml adorns 1 pipe, row electrophoresis in the time of then.To there be the pipe of band to mix, with supersound process liquid dialysed overnight.Two plasmid expression virus-like particles are super from the back result, and 2,3,4 manage in concentrating.See Fig. 3.

Five. checking VLP particle, RT-PCR.

1. experimental design: upstream primer: M300RT-S:5 ' GGATTTGTATTCACGCTCACC3 ' '

Downstream primer: Overlap-A-2:5 ' TCCCTGGTATGGACATGCTGAGCTC3 ';

Overlap-A-15’TGTTGGGTATGCATCGTTCTTTTTG3’

2. reverse transcription: 95 ℃ of 5 minutes lytic virus sample particles at first, discharge RNA, use primer Overlap-A-1 and carry out reverse transcription.The reverse transcription system: MM-LV-Buffer 5ul, MM-LV 1ul, dNTP 1ul, 3V-SIXRNA5ul, Overlap-A-1 1ul, DEPC water 13ul amounts to 25ul, 42 ℃ of water-baths one hour.

3.PCR amplification

Upstream primer: M300RT-S:5 ' GGATTTGTATTCACGCTCACC3 ' '

Downstream primer: Overlap-A-2:5 ' TCCCTGGTATGGACATGCTGAGCTC3 '

Loop parameter: 94 ℃ of 3min; 94 ℃ of 30s, 53-63 ℃ of 30s, 72 ℃ of 1min (35 circulations); 72 ℃ of 10min.The results are shown in Figure 4.Interpretation of result: 1 negative contrast, 2,3 is not cracking of virus-like particle, 3,4 is virus-like particle cracking but RT not.6,7,8,9,10 for after being virus-like particle cracking and RT-PCR.

With the PCR product cloning to pGEM-T easy carrier

The by specification operation is connected the PCR product with pGEM-T Vector.4 ℃ of connections are spent the night.Get 5 μ l and connect product, add 100 μ Ltop10 competence bacteriums, the mixing ice bath left standstill 30 minutes gently.Pipe is put into the circulator bath of heating in advance to 42 ℃, exactly place 90S, do not shake.Placed 2 minutes on ice.The LB nutrient solution that adds 200ul37 ℃ of pre-temperature, 37 ℃ of vibrations (200rpm) were cultivated 1 hour.Converted product is applied on the LB culture plate (containing 1mol/l IPTG 4 μ l, 20mg/ml X-gal 40 μ l) that contains 100 μ g/ml penbritins, is inverted overnight incubation for 37 ℃.Result: see blue hickie growth.

5. extract the TA clone, electrophoresis result is seen Fig. 5, meets expected results.Send the order-checking of three rich companies with above-mentioned plasmid 4,5.Sequencing result (SEQ ID No.1):

CCCCCACAGTACCAAAAGATCTTCTTGGTTGGTATTATTGTAGCTCCTCTTTATTGTTGGGTATGCACTGTTCTTTTTGATAAGCCATACCACATTTCTGAAAAAGGAGGACTTCCCATTGTATGGACATGCTGAGCTCACCCCTGATGAGGCTTCATGATTGGACCAAGAACTTTTGGGGATGATCTGAAT

TTTCTCAAAATGGTTTATTCTGCTCAGTAGGTGTTTCAGTTCTTCATAGTCGTTGAAATCCCCTGGGTAACAGAGGTCATTGGCTGGATTGGCCTTCTCCACTATGTAAGACCATTCCATGTGACAGAGCCATGCTTTACATGCTTAGGATAATGGCCTCTCTTGTTCTTGCTCGCAAACATAACACTTGCTGTAACTTATCGCACCGTTTCTACAGGTTAGCTAACGAGTGTGCGCAAGTATTAAGTGAGATGGTCATGTGTGGCGGCTCACTATATGTTAAACCAGGTGGAACATCATCCGGTGATGCTACAACTGCTTACGCTAATAGTGTCGTTAACATTTGTCGAGCTGTTACAGCCAATGTAAATGCGCTTCTTTCAACTGATGGTAATAAGATAGCTGACAAGTATGTCCGCAATCTACAACACAGGCTCTATGAGTGTCTCTATAGAAATAGGGATGTTGATCATGAATTCGTGGATGAATTTTACGCTTACCTGCACCTACACACCTCAGCGTTGATATAAAGTTCAAGACTGAAGGATTATGTGTTGACATACCAGGCATACCAAAGGACATGACCTACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCAATGGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCTGTCACGCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGTACCGACTGGTTAACAAATTAAAATGTCTGATAATGGACCCCAATCAAACCAACGTAGTGCCCCCGCATACATTTGGTGGACCCACAGATTCACTGACAATAACAGAATGGAGGCGCATTGGGCAAAGCCAAAACAGCGCCGACCCCAAGGTTTACCCAATAATACTGCGTCTGATCACAGCTCTCACTCAGCATGGCAAGGAGGAACTTAGATTCCCTCGAGGCCAGGGCGTTCCAATCAACACCAATAGTGGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCCGACGAGTTCGTGGTGGTGACGGCAAAATGAAAGAGCTCAGCCCCAGATGGTACTTCTATTACCTAGGAACTGGCCCAGAAGCTTCACTTCCCTACGGCGCTAACAAAGAAGGCATCGTATGGGTTGCAACTGAGGGAGCCTTGAATACACCCAAAGACCACATTGGCACCCGCAATCCTAATAACAATGCTGCCACCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAGGGAAGCAGAGGCGGCAGTCAAGCCTCTTCTCGCTCCTCATCACGTAGT GGCGACACCCCACCATAGATCACTCCCCTGTGATGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATTAACCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGCTCGCGAGCCGGGAATGGTCTTACATAGTGGAGAAGGCCAATCCAGCCAATGACCTCTGTTACCCAGGGGATTTCAACGACTATGAAGAACTGAAACACCTACTGAGCAGAATAAACCACTTTGAGAAAATTCAGATCATCCCCAAAAGTTCTTGGTCCAATCATGAAGCCTCATCAGGGGTGAGCTCAGCATGTCCCATACCAGGGAAATCACTAGTGAATTCGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGC

Culture presevation information: the coli strain called after pACYC-dnet-1-ET-28b that contains double expression plasmid pACYC-3V and PET-MC that the embodiment of the invention 3 makes up, be preserved in (address: Datun Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, China Microbial Culture Preservation Commission common micro-organisms center, postcode: 100101), preservation date is on March 31st, 2008, the classification of suggestion colon bacillus Escherichia coli by name, preserving number is CGMCC No.2425.

Embodiment 4: the virus-like particle stability experiment

Reagent: Shanghai section China hepatitis C virus nucleic acid amplification fluorescent quantitative detection kit

Instrument: lightcycle

Sample: with 20% new-born calf serum virus-like particle is diluted to the about 10000/ML of content, 100000/ML, 1000000/ML, the preparation amount of each concentration is 10ml.Final concentration by 0.1% adds Thiomersalate.Carry out packing then, every pipe branch loading amount is 100ul.

Different content sample Detection of Stability is placed condition

Place by last table, place 3 under every kind of condition, specific time name a person for a particular job its be placed on～70 ℃, experiment finishes back one the same machine testing.Do contrast with～70 ℃ of frozen samples.

PCR the results are shown in Figure 6-Fig. 8, and the result is stable.

Sequence table

＜110〉Beijing Hospital

＜120〉a kind of double-plasmid expression system that produces virus-like particles containing large segments of RNA

<130>

<160>1

<170>PatentIn?version?3.3

<210>1

<211>2145

<212>DNA

＜213〉synthetic

<400>1

Claims (7)

1. can express and contain big fragment RNA viruses sample particulate double-plasmid expression system for one kind, it is characterized in that: form by plasmid PET-MC and plasmid pACYC-X, wherein pET-MC is made up by pET-28 (b) integration phage MS2 maturing enzyme albumen and capsid protein cDNA and forms, and pACYC-X integrates the 19mer packaging site of phage MS2 by PACYCDuet-1 and the cDNA of purpose RNA forms.

2. a kind of expression the according to claim 1 contains big fragment RNA viruses sample particulate double-plasmid expression system, and it is characterized in that: described pACYC-X is the pACYC-3V plasmid.

3. a kind of expression the according to claim 2 contains big fragment RNA viruses sample particulate double-plasmid expression system, it is characterized in that: the mosaic sequence of described pACYC-3V plasmid expression packaging site and 3 kinds of viruses.

4. a kind of expression the according to claim 3 contains big fragment RNA viruses sample particulate double-plasmid expression system, it is characterized in that: the mosaic sequence of described 3 kinds of viruses is SARS-Cov (SARS-CoV1, SARS-CoV2, SARS-CoV3), one section HCV and two sections H5N1 (M300 and HA300).

5. double expression plasmid pACYC-3V and PET-MC system, it is characterized in that: be present among the coli strain pACYC-dnet-1-ET-28b, this coli strain is preserved in (address: Datun Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, China Microbial Culture Preservation Commission common micro-organisms center, postcode: 100101), preservation date is on March 31st, 2008, the classification of suggestion colon bacillus Escherichia coli by name, preserving number is CGMCC No.2425.

6. double expression plasmid pACYC-3V according to claim 5 and PET-MC system is characterized in that: the described nucleotide sequence of expressed sequence table SEQ ID No.1.

7. coli strain pACYC-dnet-1-ET-28b, it is characterized in that: contain double expression plasmid pACYC-3V and PET-MC system, be preserved in (address: Datun Road, Chaoyang District, Beijing City Institute of Microorganism, Academia Sinica, China Microbial Culture Preservation Commission common micro-organisms center, postcode: 100101), preservation date is on March 31st, 2008, the classification of suggestion colon bacillus Escherichia coli by name, preserving number is CGMCCNo.2425.