CN101501056A - Aptamers that bind thrombin with high affinity - Google Patents

Abstract

The invention provides aptamers capable of binding to thrombin useful as therapeutics for and diagnostics of coagulation related disorders and/or other diseases or disorders in which thrombin has been implicated. The invention further provides materials and methods for the administration of aptamers capable of binding to thrombin.

Description

Fit with the high-affinity bind thrombin

Invention field

[0001] the present invention relates generally to the nucleic acid field, more specifically relate to can bind thrombin fit, it is as the blood coagulation associated conditions and/or relate to other disease or the treatment of conditions agent and the diagnostic reagent of zymoplasm.The present invention further provides be used to use can bind thrombin fit material and method.

Background of invention

[0002] fit is the nucleic acid that has the high degree of specificity binding affinity by the outer interaction partners molecule of classical water Sen-Ke Like base pairing.

[0003] is similar to the peptide that produces by phage display or monoclonal antibody (＂ mAbs ＂), fitly can specificity be incorporated into selected target, and regulate the activity of target, for example, by in conjunction with fit, can block the ability that their target works.Produce by external chosen process from random sequence oligonucleotides set, prepared surpass 100 kinds proteic fit, described albumen comprises somatomedin, transcription factor, enzyme, immunoglobulin (Ig) and acceptor.Typical fit size is 10-15kDa (a 30-45 Nucleotide), in conjunction with its target, and distinguishes closely-related target (as fit typically debond other albumen from homologous genes family) with inferior nmole avidity.A series of structural researches have proved the fit binding interactions (as hydrogen bonding, static complementation, hydrophobic contact, steric exclusion) that can utilize same type, and they drive avidity and highly selective combination in antibody-antigenic compound.

[0004] the fit feature that has many as therapeutical agent and diagnostic reagent needs comprises highly selective and avidity, biopotency and remarkable pharmacokinetic properties.In addition, they provide with antibody and compare special competitive advantage with other protein biology, for example:

[0005] 1) speed and control.Fit is to produce by external fully process, makes it possible to produce rapidly initial lead, comprises the treatment lead.External selection makes fit selectivity and avidity can be subjected to tight control, and makes it possible to produce lead, comprises the lead of toxin immunity and non-immunogenic target.

[0006] 2) toxicity and immunogenicity.Fit class has shown upward acceptable toxicity of treatment, and lacks immunogenicity.Giving (every day, 10mg/kg continued 90 days) in rat or the marmot long-term application with high level is fit, do not observing toxicity by clinical, cell or biochemical the measurement.Although immunne response by antagonist self, can significantly limit the effectiveness of a lot of monoclonal antibodies, but producing at fit antibody is unusual difficulty, be likely since fit can not be by MHC by the T presented by cells, and immunne response is trained for usually and can not discerns nucleic acid fragment.

[0007] 3) uses.Although the Antybody therapy agent of great majority approval is recently used (typical case was above 2-4 hour) by venoclysis, but fit also can using (in monkey research by subcutaneous injection, fit bioavailability by subcutaneous administration〉80% (Tucker et al, J.Chromatography B.732:203-212,1999)).This species diversity mainly is owing to low relatively solubleness, and therefore most of therapeutic mAbs need large volume.Owing to have good solubleness (〉 150mg/mL) (fit: 10-50kDa with relative low molecular weight; Antibody: 150kDa), can be by passing fit dosage weekly to send less than the volume injection of 0.5mL.In addition, fit small volume makes them can be penetrated into the conformation blocked-off region that does not allow antibody or antibody fragment to penetrate, and another advantage based on fit treatment or prevention is provided.

[0008] 4) scale and cost.Therapeutic is fit to be chemosynthesis, therefore can easily press scale production according to producing needs.Although the difficulty of scale production has limited the availability of some biological products at present, and the cost of the fund of large-scale protein factory is huge, but single extensive oligonucleotide synthesizer can be produced more than the 100kg/, and only needs the fund input of appropriateness relatively.

[0009] 5) stability.Therapeutic is fit to be chemically stable.They are suitable for regaining activity in essence after being exposed to such as the heat and the factor of denaturing agent, and can be at room temperature as lyophilized powder standing storage (〉 1 year).

Zymoplasm

[0010] zymoplasm is a kind of multifunctional protein enzyme, and it has short coagulating and anticoagulating active.As a kind of coagulase, zymoplasm condenses Fibrinogen, activates factor V, VIII and XIII, and activates thrombocyte.Zymoplasm to the cutting of fibrinogenic specificity initial the polymerization of fibrin monomer, this is the main incident during blood clot forms.Central event during platelet thrombus forms is the platelet activation from " non-binding " to " combination " pattern.Zymoplasm is the physiology activator of platelet aggregation.Therefore, as setting accelerator, zymoplasm plays a crucial role in blocking-up hemorrhage (physiological hemostasis) and formation angiemphraxis thrombus (pathologic thrombosis).

[0011] as antithrombotics, zymoplasm is in conjunction with thrombomodulin (TM), promptly a kind of glycoprotein at the vascular endothelial cell surface expression.TM by the avtive spot conformation the allosteric change and TM and zymoplasm on the eclipsed combination of Fibrinogen binding site, make substrate specificity change into PROTEIN C from Fibrinogen and thrombocyte.The activated PROTEIN C is at phosphatide surface, Ca ²⁺With second kind of vitamin k-dependent protein cofactor, promptly under the existence of Protein S, by protein cleavage degradation factor Va and VIIIa anticoagulant.Therefore, the formation of zymoplasm-TM mixture is converted into the anti-freezing enzyme with zymoplasm from coagulase, and the normal equilibrium between these two kinds of opposite activity hematostatic is regulated is crucial.

The blood coagulation illness

[0012] blood vessel injury and thrombosis are represented multiple vascular disease, comprise the critical event in atherosclerotic the causing a disease.Cause various disease states and a plurality of position, look like different as the pathogenic course of thrombotic thrombocyte in coronary artery, ventricle and the heart valve prosthesis and/or coagulation system activation.Therefore, the use of platelet suppressant drug, antithrombotics or the two combination may need and the thrombolytics associating of opening the blood vessel of sealing and preventing to block again.

[0013] the controlled proteolysis that carries out of the compound by coagulation cascade is crucial for hemostasis.Therefore, have multiple complex regulation system, its part is based on the proteinase inhibitor of a series of high degree of specificity.Under a kind of pathological condition, excessive generation that can be by active protease or suppress active deactivation and the inhibition activity of interrupt function.The lasting inflammation that reacts on multiple wound (tissue injury) or infect (Sepsis) depends on the proteolytic ferment of blood plasma cascade system, comprises zymoplasm, and the proteolytic ferment in lysosome source.By the proteolytic enzyme of appearance simultaneously and the imbalance between their the inhibition conditioning agent, strengthened the multiple organ failure (MOF) under these situations.In addition, the thrombin activity imbalance in the brain may cause neurodegenerative disease.

Coronary bypass grafting (CABG) operation

[0014] in calendar year 2001, ACC has reported in the U.S. and has estimated at the coronary heart disease that 1,240 ten thousand patient diagnosis suffer from certain form.Consider the importance of zymoplasm in coagulation process, the active medicament of antithrombotic agents or minimizing or Trombin inhibiting is that for example coronary bypass grafting (after this being expressed as ＂ CABG ＂) operation, percutaneous coronary are got involved the antithrombotics that adopts in (after this being expressed as ＂ PCI ＂) and the acute coronary syndrome process.From calendar year 2001, the U.S. surpasses 570,000 CABG operations every year, and estimates worldwide to surpass 700,000 times and should perform the operation.At present, the most frequently used antithrombotics is a heparin, and it must use with the toxinicide protamine.But the Heparin-Protamine treatment is relevant with many serious side effects, comprises hemorrhage and thrombopenia (platelet count minimizing), and it is normally asymptomatic, but may be relevant with life-threatening artery or venous thrombosis.In addition, the Heparin-Protamine treatment has many other shortcomings, comprising: with the non-specific binding of plasma proteins, cause the resistance among some patients; Heparin can not suppress blood clot bonded zymoplasm; Heparin has nonlinear kinetics, causes being not easy to control dosage; And heparin is from the preparation of ox or porcine tissue, and it has the inherent safety risk that the possibility that comes from transmitted virus and/or Protein virus causes.Therefore, many renewals, more expensive antithrombotics is as low molecular weight heparin and Angiomax

, significantly come into the market.But these compounds have similar side effect, and their anticoagulating active can not reverse rapidly.

[0015] therefore, have the remarkable unsatisfied medical need to the antithrombotics of safety, reasonable price, described antithrombotics does not need independent reversal agent, and not relevant with side effect listed above and shortcoming.Therefore, adopting minimizing or the active medicament of Trombin inhibiting in the treatment of blood coagulation associated conditions is useful as therapeutical agent.

Summary of the invention

[0016] the invention provides the illness that is used for the treatment of thrombin-mediated, as the material and the method for acute and chronic blood coagulation associated conditions.The present invention further provides and be used to regulate zymoplasm,, be used for therapeutic composition and method in experimenter or patient's anti-freezing especially for reducing or the blood coagulation of Trombin inhibiting mediation.

[0017] in a kind of specific embodiments, the fit of bind thrombin target is provided, the wherein blood coagulation of this fit minimizing or Trombin inhibiting mediation, and this fit ARC2172 of being (SEQ IDNO 294) or have ability fit of the blood coagulation of essentially identical minimizing or Trombin inhibiting mediation with ARC2172 (SEQ ID NO 294), wherein this is fit with less than 1nM, preferably, be more preferably less than 250pM, be more preferably less than the K of 200pM less than 300pM _DIn conjunction with human thrombin, and described fit length is 56 Nucleotide or still less, 55 Nucleotide or still less, 50 Nucleotide or still less, 45 Nucleotide or still less, 40 Nucleotide or still less, 35 Nucleotide or still less, 30 Nucleotide or still less, 28 Nucleotide or still less, 26 Nucleotide or still less.In some embodiments, fit length is at least 22 Nucleotide.In another embodiment, the fit of bind thrombin target is provided, the wherein blood coagulation of this fit minimizing or Trombin inhibiting mediation, and this fit ARC2172 of being (SEQ ID NO 294) or have ability fit of the blood coagulation of essentially identical minimizing or Trombin inhibiting mediation with ARC2172 (SEQ ID NO294), and this fit most of thymidines or uridine do not comprise the 5-bromouracil deoxyribose modification.In some embodiments, this is fit with less than 1nM, preferably less than 300pM, is more preferably less than 250pM, is more preferably less than the K of 200pM _DIn conjunction with human thrombin.In some embodiments, the length that this is fit is 56 Nucleotide or still less, 55 Nucleotide or still less, 50 Nucleotide or still less, 45 Nucleotide or still less, 40 Nucleotide or still less, 35 Nucleotide or still less, 30 Nucleotide or still less, 28 Nucleotide or still less, 26 Nucleotide or still less.In some embodiments, fit length is at least 22 Nucleotide.In some embodiments, can determine dissociation constant by the dot blotting titration of hereinafter embodiment 1 description.

[0018] in some embodiments, by measuring fit minimizing or suppressing activated clotting time (ACT), prothrombin time (PT) and/or activated partial thromboplastin time (aPTT), assess the ability of the blood coagulation of fit minimizing of the present invention or Trombin inhibiting mediation.Preferably, by measuring the ability of fit minimizing ACT, the blood coagulation of assessment thrombin-mediated.In a kind of preferred embodiment,, assess the ability of fit minimizing of the present invention or anticoagulant by measuring ACT with the Hemochron Jr. instrument (ITCMed, Edison NJ) of hereinafter embodiment 3B description.In some embodiments, of the present invention in vivo fit, the particularly blood coagulation of minimizing or Trombin inhibiting mediation among the people experimenter.In some embodiments, fit blood coagulation of the present invention in external minimizing or Trombin inhibiting mediation.

[0019] in a kind of particular, provides the fit of bind thrombin, wherein this fit being selected from: SEQ ID NOs 9-41,43-191,193-204,208-304,307-329,331-332,334,336-337,340-392,396-397,400 and 402-440.In one embodiment, provide bind thrombin and comprise the fit of following nucleotide sequence: CCTAGGTTGGGTAGGGTGGTGG.In specific embodiments, provide and comprised sequence fit that is selected from down group: ACTGCCTAGGTTGGGTAGGGTGGTGGCAGT (ARC2169 (SEQ ID NO 283)), GCTGCCTAGGTTGGGTAGGGTGGTGGCAGC (ARC2170 (SEQ ID NO292)), CTGCCTAGGTTGGGTAGGGTGGTGGCAG (ARC2171 (SEQ IDNO 293)) and CGCCTAGGTTGGGTAGGGTGGTGGCG (ARC2172 (SEQTD NO 294)).

[0020] in another embodiment, provides to comprise the fit of following nucleotide sequence: N ₁N ₂N ₃TAGGTTGGGTAGGGTGGTN ' ₃N ' ₂N ' ₁, N wherein ₁, N ₂Or N ₃Be respectively with N ' ₁, N ' ₂Or N ' ₃Form any Nucleotide of base pair, wherein N ₁, N ₂And N ₃Nucleotide that can be respectively identical naturally or different Nucleotide, and the blood coagulation of this fit minimizing or Trombin inhibiting mediation.In some embodiments, N ₁, N ₂Or N ₃It is deoxynucleotide.In other embodiments, N ₁, N ₂Or N ₃In at least two comprise 2 ' OMe and modify.

[0021] in another embodiment, provides to comprise the fit of following nucleotide sequence: N ₁N ₂N ₃N ₄TAGGTTGGGTAGGGTGGT N ₄N ' ₃N ' ₂N ' ₁, N wherein ₁, N ₂, N ₃Or N ₄Be respectively with N ' ₁, N ' ₂, N ' ₃Or N ' ₄Form any Nucleotide of base pair, wherein N ₁, N ₂, N ₃And N ₄Nucleotide that can be respectively identical naturally or different Nucleotide, and the blood coagulation of this fit minimizing or Trombin inhibiting mediation.In some embodiments, N ₁, N ₂, N ₃Or N ₄It is deoxynucleotide.In other embodiments, N ₁, N ₂, N ₃Or N ₄In at least two comprise 2 ' OMe and modify.

[0022] in another embodiment, provides to comprise the fit of following nucleotide sequence: N ₁N ₂N ₃N ₄N ₅TAGGTTGGGTAGGGTGGT N ' ₅N ₄' N ' ₃N ' ₂N ' ₁, N wherein ₁, N ₂, N ₃, N ₄Or N ₅Be respectively with N ' ₁, N ' ₂, N ' ₃, N ' ₄Or N ' ₅Form any Nucleotide of base pair, wherein N ₁, N ₂, N ₃, N ₄And N ₅Nucleotide that can be respectively identical naturally or different Nucleotide, and the blood coagulation of this fit minimizing or Trombin inhibiting mediation.In some embodiments, N ₁, N ₂, N ₃, N ₄Or N ₅It is deoxynucleotide.In other embodiments, N ₁, N ₂, N ₃, N ₄Or N ₅In at least two comprise 2 ' OMe and modify.

[0023] in another embodiment, provides to comprise the fit of following sequence: N ₁N ₂N ₃N ₄N ₅N ₆TAGGTTGGGTAGGGTGGT N ' ₆N ' ₅N ₄' N ' ₃N ' ₂N ' ₁, N wherein ₁, N ₂, N ₃, N ₄, N ₅Or N ₆Be respectively with N ' ₁, N ' ₂, N ' ₃, N ' ₄, N ' ₅Or N ' ₆Form any Nucleotide of base pair, wherein N ₁, N ₂, N ₃, N ₄, N ₅Or N ₆Nucleotide that can be respectively identical naturally or different Nucleotide, and the blood coagulation of this fit minimizing or Trombin inhibiting mediation.

[0024] in some embodiments, above-described N in fit is guanosine or cytidine nucleotide residue.In the another embodiment aspect this of the present invention, this is fit with the KD bind thrombin less than 1nM.In another embodiment of this respect of the present invention, the fit ability that has the blood coagulation of essentially identical minimizing or Trombin inhibiting mediation at least with ARC2172 (SEQ ID NO 294).In some embodiments in this respect, the zymoplasm target is a human thrombin.

[0025] in some fit embodiments of the present invention, most nucleoside acid is thymus nucleic acid.In some embodiments, of the present invention fit be thymus nucleic acid, single stranded deoxyribonucleic acid particularly.In some embodiments of the present invention, at least 14, preferably at least 16, more preferably at least 18 Nucleotide are deoxynucleotides.In a kind of particular, the fit picodna sequence TAGGTTGGGTAGGGTGGT that comprises.In some embodiments, fit at least one chemically modified that comprises of the present invention particularly is selected from down the chemically modified of group: the chemistry in the sugared position of nucleic acid replaces; The chemistry of phosphoric acid position replaces; Replace with the chemistry of base position.In some embodiments, chemically modified does not cause the 5-bromouracil deoxyribose of fit most of thymidines or uridine residue to be modified.In some embodiments, modification is selected from: mix the Nucleotide of modification, 3 ' add cap, and with the puting together of high molecular, non-immunogenic compound, with puting together of lipophilic compound, particularly wherein high molecular, non-immunogenic compound are polyalkylene glycols, particularly polyoxyethylene glycol.

[0026] in some embodiments, above-described antithrombin of the present invention is fit, as ARC2172, reduces or suppresses blood coagulation in the static blood, particularly continue under the room temperature more especially under room temperature under the concentration of 5 μ M, to continue at least about 30 minutes at least about 30 minutes.

[0027] in some embodiments, provide a kind of method, comprised to the experimenter, particularly people experimenter or extracorporeal circulation are used of the present invention fitly, and its amount effectively reduces or suppress the blood coagulation of thrombin-mediated among the experimenter.

[0028] in some embodiments, provide a kind of composition, antithrombin of the present invention fit or its salt and pharmaceutically acceptable carrier or thinner that it comprises effective minimizing or suppresses the amount of the blood coagulation of thrombin-mediated among the experimenter.In some embodiments, be included in the fit ARC2172 of being of antithrombin (SEQ ID NO 294) in the composition of the present invention.A kind of method is provided, has comprised to the experimenter that needs are arranged, particularly people experimenter and use composition of the present invention.In some embodiments of the present invention, people experimenter is that kidney is impaired, and the antithrombin of using in the method for the invention of the present invention is fit does not put together in PEG.In some embodiments, use in the method for the invention fit people experimenter have heparin-induced thrombocytopenia, be the heparin resistance and/or have an impaired liver function.

[0029] in some embodiments of the inventive method, before experimenter's the operative procedure, during, afterwards or its arbitrary combination, it is fit to use antithrombin of the present invention for experimenter, particularly people experimenter.In some embodiments, operative procedure is heart operation.In some embodiments, operative procedure is selected from: cardiopulmonary bypass surgery, coronary artery bypass graft surgery, percutaneous coronary intervention, angioplasty, cardiovascular and peripheral blood vessel open and blood vessel in operation, support place operation, heart valve replacement operation, be used for the treatment of coronary artery disease and/or vein or artery vascular disease operation and be used for the treatment of the operation of peripheral arterial occlusion disease.In some embodiments of the inventive method, antithrombin is fit to be ARC2172 (SEQ ID NO 294).In a kind of particular of the inventive method, fit is ARC2172 (SEQ ID NO 294), and operative procedure is a coronary artery bypass graft surgery.In the another kind of particular of the inventive method, of the present invention fit be ARC2172, operative procedure is a cardiopulmonary bypass surgery, and uses open, non-heparin bonded loop (non-heparin bondedcircuit) in the surgical procedure.In the another kind of particular of the inventive method, fit is ARC2172 (SEQID NO 294), and operative procedure is that percutaneous coronary is got involved.

The accompanying drawing summary

[0030] Fig. 1 carries out external fit selection (SELEX from the random sequence oligonucleotides set ^TM) synoptic diagram of process.

[0031] Fig. 2 is the diagram of the PEG of 40kDa branch.

[0032] Fig. 3 is the diagram that is connected in the PEG of 40kDa branch of fit 5 ' end.

[0033] Fig. 4 is the diagram of describing representative standard single Pegylation, poly ethylene glycolization and carrying out the multiple Pegylation strategy of dimerization by Pegylation.

[0034] Fig. 5 describes the prediction secondary structure of the fit ARC2169 of zymoplasm (SEQ ID NO 283), ARC2171 (SEQ ID NO 293) and ARC2172 (SEQ ID NO 294).

[0035] Fig. 6 describes with the diagram of nitrocellulose filter in conjunction with the binding curve of the ARC2172 (SEQ ID NO 294) that measures measurement and ARC183 and human thrombin.

[0036] Fig. 7 describes with cellulose filter membrane in conjunction with the diagram of the ARC2172 (SEQ IDNO 294) that measures measurement with the binding curve of people, pig and rat zymoplasm.

[0037] Fig. 8 describes the diagram to the comparison of the influence of prothrombin time (PT) with the ARC2172 (SEQED NO 294) of the human plasma external test of Citrated and ARC183.

[0038] Fig. 9 describes the ARC2172 (SEQ ID NO 294) of personnel selection whole blood external test and the ARC183 diagram to the comparison of the influence in activated clotting time (ACT).

[0039] Figure 10 describes the diagram to the comparison of the influence of activated partial thromboplastin time (aPTT) with the ARC2172 (SEQ ID NO 294) of human plasma external test and ARC183.

[0040] Figure 11 is diagram that describe to adopt the comparison of the influence of ARC2172 and 183 pairs of static blood coagulations of ARC in the mensuration of people's whole blood.

[0041] Figure 12 shows that the fit rat IV of antithrombin of embodiment 4A description injects the table of the experimental study design of research.

[0042] Figure 13 is a PEG group of describing the different sizes be connected in ARC2172 (SEQ ID NO 294) to the diagram of the comparison of the influence in activated clotting time (ACT) in the rat of accepting the fit IV of 1.5 micromoles/kg and injecting.

[0043] Figure 14 is the table that the fit rat IV of antithrombin that embodiment 4B describes injects the experimental study design of research.

[0044] Figure 15 describes ARC2172 (SEQ ID NO 294) and the ARC186 diagram to the comparison of the influence in activated clotting time (ACT) in the rat of accepting 12.2mg/kg (ARC2172 (SEQ ID NO 294)) or the fit IV of 30mg/kg (ARC183) and injecting.

[0045] Figure 16 summarizes ARC2172 (SEQ ID NO 294) and the ARC186 table to the influence in activated clotting time (ACT) in the rat of accepting 12.2mg/kg (ARC2172 (SEQ ID NO 294)) and the fit IV of 30mg/kg (ARC183) and injecting.

[0046] Figure 17 is the table to the experimental study design that antithrombin is fit in the kidney of rats ligation model that shows that embodiment 4C describes.

[0047] Figure 18 shows as IV to inject when using 12.2mg/kg (ARC2172 (SEQ IDNO294)) that ARC2172 in kidney ligation and the sham-operation rat (SEQ ID NO 294) is to the diagram of the comparison of the influence in activated clotting time (ACT).

[0048] Figure 19 shows as IV to inject when using 30mg/kg (ARC183) that ARC183 is to the diagram of the comparison of the influence in activated clotting time (ACT) in kidney ligation and the sham-operation rat.

[0049] Figure 20 summarize to accept in the macaque that the fit IV of 0.46 micromole/kg injects the fit ARC2172 of antithrombin (SEQ ID NO 294), ARC2949 (SEQ ID NO 434), ARC2169 (SEQ ID NO 283) and ARC2840 (SEQ ID NO 423) to the table of the influence in activated clotting time (ACT).

[0050] Figure 21 show to accept in the macaque that the fit IV of 0.46 micromole/kg injects the fit ARC2172 of antithrombin (SEQ ID NO 294), ARC2949 (SEQ ID NO 434), ARC2169 (SEQ ID NO 283) and ARC2840 (SEQ ID NO 423) to the diagram of the comparison of the influence in activated clotting time (ACT).

[0051] Figure 22 shows that the fit monkey IV of antithrombin that embodiment 4E describes injects+table of the experimental study design of infusion studies.

[0052] Figure 23 shows that single IV injects to use and during continuous subsequently 1 hour infusion, ARC2172 (SEQ ID NO 294) (two doses) and ARC183 are to the diagram of the comparison of the influence in activated clotting time (ACT) in the macaque.

[0053] Figure 24 summarizes single IV to inject and use and during continuous subsequently 1 hour infusion, ARC2172 (SEQ ID NO 294) (two doses) and ARC183 are to the table of the influence in activated clotting time (ACT) in the macaque.

[0054] Figure 25 is comparison ARC2172 (SEQ ID NO 294) to the diagram of the influence of the platelet aggregation of thrombin induction and ADP inductive platelet aggregation.

[0055] diagram of Figure 26 influence that to be comparison ARC2172 (SEQ ID NO 294) suppress the acetylsalicylic acid and the Integrilin dependency of platelet aggregation.

[0056] Figure 27 is the table that shows the experimental design of the research of ARC2172 (SEQ ID NO 294) and heparin in the Pigs Hearts lung bypass model of describing among the embodiment 5A.

[0057] Figure 28 is the summary of Pigs Hearts lung bypass research approach.

[0058] Figure 29 is the diagram that shows the activated clotting time (ACT) in the control animal (no antithrombotics is handled) opening, that the bypass of non-heparin bonded Pigs Hearts lung is used in studying that embodiment 5A describes.

[0059] Figure 30 be show opening that embodiment 5A describes, accept in the non-heparin bonded Pigs Hearts lung bypass research heparin IV inject ACT is kept the diagram in activated clotting time (ACT) in 400 seconds the pig.

[0060] Figure 31 be show opening that embodiment 5A describes, accept in the non-heparin bonded Pigs Hearts lung bypass research ARC2172 (SEQ ID NO 294) IV inject ACT is kept the diagram in activated clotting time (ACT) in 400 seconds the pig.

[0061] Figure 32 shows the diagram to the comparison of the influence in activated clotting time (ACT) (on the longitudinal axis mapping for second) of heparin and ARC2172 (SEQ ID NO 294) in the employing cardiopulmonary bypass model open, non-heparin bonded bypass loop that embodiment 5A describes.

[0062] Figure 33 is the diagram of the plasma concentration of TAT mixture in the control animal (the no antithrombotics is handled) opening of embodiment 5A description, that the bypass of non-heparin bonded Pigs Hearts lung is used in studying.

[0063] Figure 34 be show opening that embodiment 5A describes, accept in the non-heparin bonded Pigs Hearts lung bypass research heparin IV inject ACT is kept the diagram of the plasma concentration of TAT mixture in 400 seconds the pig.

[0064] Figure 35 be show opening that embodiment 5A describes, accept in the non-heparin bonded Pigs Hearts lung bypass research ARC2172 (SEQ ID NO 294) inject ACT is kept the diagram of the plasma concentration of TAT mixture in 400 seconds the pig.

Detailed Description Of The Invention

[0065] set forth hereinafter the details of one or more embodiments of the present invention in the appended description. Although can be used for implementing or test the present invention to above-described any method and material similar or that be equal to, what describe at present is preferred method and material. Can clear and definite other features, objects and advantages of the present invention from specification. In specification, singulative also comprises plural number, unless context explicitly points out the opposite meaning. Unless opposite definition is arranged, all technology that the present invention uses and science term have the identical meanings that the technical field of the invention those of ordinary skill is understood usually. In the situation of conflict, be as the criterion with this specification.

SELEX ^TMMethod

[0066] be that the employing title is ＂ carries out part by index concentration evolution ＂ (the ＂ SELEX of system for the preparation of fit appropriate method^TMProcess ＂), this process general description is in Fig. 1. SELEX^TMMethod is the method for the external evolution of the nucleic acid molecules that target molecule is had the high degree of specificity combination, and be described in the U.S. Patent application series No.07/536 that has for example abandoned at present, submit to June 11 nineteen ninety, 428, name is called the U.S. Patent No. 5 of " nucleic acid ligands ", 475,096; The United States Patent (USP) 5,270,163 (also referring to WO 91/19813) that is called " nucleic acid ligands " with name. The fit combination that is considered to target molecule is had high degree of specificity, this for example is because the order of magnitude of fit binding affinity to target is not exposed to the initial nucleic acid library of target or the binding affinity of set before being higher than. Every kind of SELEX^TMThe nucleic acid ligands of identifying, namely every kind fit, be given target compound or the ligands specific of molecule. SELEX^TMMethod is based on the view of uniqueness, be that nucleic acid has enough abilities and forms multiple 2 and 3 dimensional organization, multi-functional with the enough chemistry in their monomer, as the part of any compound basically (namely form specific binding to), no matter be monomer or polymer. The molecule of any size or composition can be as target.

[0067]SELEX ^TMThe initial point that rises as the large library of single stranded oligonucleotide that comprises sequence at random or set. Described oligonucleotides can be DNA, RNA or the DNA/RNA heterozygote of modifying or not modifying. In some instances, set-inclusion 100% at random or at random oligonucleotides of part. In other example, set-inclusion at random or at random oligonucleotides of part, it comprises at least one fixed sequence program and/or the conserved sequence that mixes in the randomized sequence. In other example, set-inclusion at random or at random oligonucleotides of part, it comprises and is positioned at its 5 ' and/or 3 ' terminal at least one fixed sequence program and/or conserved sequence, described sequence can comprise the total sequence of all molecules of oligonucleotides set. Fixed sequence program is the total sequence of oligonucleotides in the set, mixing of they is purpose for preliminary election, the hybridization site of CpG motif as described further below, PCR primer, RNA polymerase are (such as T3, T4, T7 and SP6) promoter sequence, restriction site or homopolymerization sequence, such as poly-adenylate or poly-thymidine acid bundle, catalytic core, be used for the site of the affine post of selective binding, and other promotes the sequence of interested oligonucleotides clone and/or order-checking. Conserved sequence is except previously described fixed sequence program, by many fit total sequences in conjunction with identical target.

[0068] oligonucleotides of set preferably comprises randomized sequence part and the necessary fixed sequence program that effectively increases. Typically, the oligonucleotides of initial set contains flank in 5 ' and 3 ' the fixing end sequence in the zone, inside of 30-50 random nucleotide. In several ways production randomization nucleotides comprises chemical synthesis and carry out the size selection from the nucleus of at random cutting. Can import or increase the sequence variations of test nucleic acid before selection/amplification cycles or in the process.

[0069] the at random sequence of oligonucleotides part can be any length, and can comprise ribonucleotide and/or deoxyribose nucleotides, and can comprise modification or non-natural nucleotides or nucleotide analog. Referring to for example U.S. Patent No. 5,958,691; U.S. Patent No. 5,660,985; U.S. Patent No. 5,958,691; U.S. Patent No. 5,698,687; U.S. Patent No. 5,817,635; U.S. Patent No. 5,672,695 and the open WO 92/07065 of PCT. Can synthesize random oligonucleotide from the oligonucleotides that the phosphoric acid diester linkage connects with solid phase oligonucleotides synthetic technology well known in the art. Referring to for example Froehler et al, Nucl.Acid Res.14:5399-5467 (1986) and Froehler et al, Tet.Lett.27:5575-5578 (1986). Also can use liquid phase process, such as the synthetic random oligonucleotide of three ester synthetic methods. Referring to for example Sood et al, Nucl. Acid Res.4:2557 (1977) and Hirose et al, Tet.Lett., 28:2449 (1978). The typical case who carries out at the automation dna synthesizer synthesizes generation 10¹⁴-10 ¹⁶Individual individual molecule, this is most of SELEX^TMTest enough numbers. In the sequences Design enough large at random sequence area increased the possibility that every kind of synthetic molecules may represent unique sequences.

[0070] can prepare by the automation chemical synthesis on the dna synthesizer the initial library of oligonucleotides. For synthetic randomized sequence, each nucleotides in building-up process adds the mixture that adds all four kinds of nucleotides in the step, makes it possible to mix at random nucleotides. Described as mentioned, in one embodiment, random oligonucleotide comprises sequence fully at random; But in other embodiments, random oligonucleotide can comprise nonrandom or part sequence section at random. Can prepare part sequence at random with different moles than adding four kinds of nucleotides by adding at each in the step.

[0071] the initial library of oligonucleotides can be RNA or DNA. In these cases, when the RNA library when the initial library, its typical case prepares by t7 rna polymerase in-vitro transcription DNA library and purifying with t7 rna polymerase or modification. Then under the condition of combination RNA or DNA library are mixed with target being conducive to, and with identical general selection scheme, carry out in conjunction with, distinguish and the progressively repetition of amplification, to satisfy binding affinity and the standard of any needs basically optionally. More specifically, from the mixture of the initial set that contains nucleic acid, SELEX^TMMethod may further comprise the steps: (a) be conducive to that mixture and target are removed; (b) nucleic acid from specific binding in target molecule is distinguished the nucleic acid of not combination; (c) nucleic acid-target compound that dissociates; (d) amplification is from the nucleic acid of nucleic acid-target complex dissociation, to produce the mixture that is rich in part of nucleic acid; (e) repeat to repeat to produce high degree of specificity, the required period of high affinity nucleic acid part of target molecule in conjunction with, the step of distinguishing, dissociating and increasing. Selecting in the fit situation of RNA SELEX^TMMethod further may further comprise the steps: (i) before the amplification of step (d) reverse transcription from the nucleic acid of nucleic acid-target complex dissociation; (ii) cross the Cheng Qian restarting this, transcribe the nucleic acid from the amplification of step (d).

[0072] in the mixtures of nucleic acids that contains possible in a large number sequence and structure, there is the broad incorporation affinity to given target. For example comprising, the mixtures of nucleic acids of the randomization section of 20 nucleotides can have 4²⁰Plant candidate's possibility. Those that target is had a higher affinity constant may be incorporated into target. After distinguishing, dissociating and increase, produce the second mixtures of nucleic acids, the material standed for of the higher binding affinity of enrichment. Other selection of taking turns is conducive to optimal ligand gradually with increasing, until the mixtures of nucleic acids that obtains mainly only comprises one or more sequences. Can clone, check order these sequences and test separately binding affinity, as pure part or fit.

[0073] repeats to select and amplification cycles, until the target that realization needs. At great majority generally speaking, continue to select/increase, until when the cycle repeats, do not reach remarkable improvement in conjunction with intensity. The method typically is used for about 10¹⁴Plant different nucleic acid species and take a sample, but also can be used for as many as 10¹⁸Planting different nucleic acid species takes a sample. Usually, in 5-20 cyclic program, select the aptamer molecule. In one embodiment, only introduce heterogeneous property in the initial selected stage, heterogeneous property in whole reproduction process, do not occur.

[0074] at SELEX^TMA kind of embodiment in, the nucleic acid ligands of strong combination is very effective with selected target for separating these for selection course, to such an extent as to only need one to select and amplification cycles. Described effective selection for example can occur in the chromatogram type process, and the ability that its amplifying nucleic acid and target on being combined in post associate is carried out so that pillar enough allows the nucleic acid ligands of high-affinity to separate with the mode of separating.

[0075] under many circumstances, not to carry out SELEX^TMRepeating step until identify single nucleotide ligand. The nucleic acid ligands solution of height target-specific can comprise nucleic acid structure or motif family, and it has some conserved sequences and some and can replace or add and the sequence of the affinity of not appreciable impact nucleic acid ligands and target. By before finishing, stopping SELEX^TMProcess can be determined the sequence of some members in the nucleic acid ligands solution family.

[0076] known multiple nucleic acids one-level, secondary and three level structures of existing. Shown that the most normal structure and motif that participation Fei Wotesen-the Ke Rieke type interacts are called hairpin loop, symmetry and asymmetric protrusion, false knot and their multiple combination. Nearly all situation of described motif shows that they can form in the nucleotide sequence that is no more than 30 nucleotides. For this reason, the SELEX that usually preferably has adjacent randomization section^TMProgram begins with the nucleotide sequence of the randomization section that contains about 50 nucleotides of the 20-that has an appointment, and in some embodiments, is about 40 nucleotides of about 30-. In an example, 5 '-fixing: at random 3 '-fixed sequence program comprises the at random sequence of about 50 nucleotides of about 30-.

[0077] improved core SELEX^TMMethod is to realize some specific purposes. For example, U.S. Patent No. 5,707,796 have described and have utilized SELEX^TMSelect to have certain structural features with the combination of gel electrophoresis, such as the nucleic acid molecules of crooked DNA. U.S. Patent No. 5,763,177 have described based on SELEX^TMMethod, be used for to select to contain can in conjunction with and/or the nucleic acid ligands of the optical active group of photo-crosslinking and/or light deactivation target molecule. U.S. Patent No. 5,567,588 and U.S. Patent No. 5,861,254 have described based on SELEX^TMMethod, it realizes the height that target molecule has between the oligonucleotides of height and low-affinity is effectively distinguished. U.S. Patent No. 5,496,938 have described and are carrying out SELEX^TMObtain the method for improved nucleic acid ligands after the process. U.S. Patent No. 5,705,337 have described the method that part is covalently attached to its target.

[0078] SELEX ^TMAlso can be used to obtain the nucleic acid ligands in an above site on the binding target molecule, and obtain to comprise nucleic acid ligands in conjunction with the non-nucleic acid species of specific site on the target.SELEX ^TMThe means of separating and identifying the nucleic acid ligands that is incorporated into any foreseeable target are provided, and described target comprises big and atom molecule, as nucleic acid binding protein with do not know that bind nucleic acid is the albumen of the part of its biological function, and cofactor and other small molecules.For example, U.S. Patent No. 5,580,737 disclose by can be with the SELEX of high-affinity in conjunction with caffeine and closely related analogue theophylline ^TMThe nucleotide sequence of identifying.

[0079] anti--SELEX ^TMBe a kind ofly to improve the specific method of nucleic acid ligands and target molecule by eliminating the nucleic acid ligands sequence that has a cross reactivity with one or more non-target molecules.Anti-SELEX ^TMComprise following steps: (a) candidate's mixture of preparation nucleic acid; (b) candidate's mixture is contacted with target, wherein with respect to candidate's mixture, the nucleic acid higher with the avidity of target can distinguish from the rest part of candidate's mixture; (c) distinguish the higher nucleic acid of avidity and the rest part of mixture; (d) the higher nucleic acid of avidity is dissociated from target; (e) the higher nucleic acid of avidity is contacted with one or more non-target molecules, make that remove the nucleic acid ligands that non-target molecule is had high degree of specificity avidity is removed; (f) nucleic acid that increases and only target molecule is had the avidity of high degree of specificity produces the combination of being rich in target molecule and has the higher relatively avidity and the nucleic acid mixture of specific nucleotide sequence.As mentioned to SELEX ^TMDescription, repeat as required to select and amplification cycles, up to the purpose that needing to realize.

[0080] problem that nucleic acid may be run into as therapeutical agent and the vaccine oligonucleotide that is the phosphodiester form may be in body fluid show between the effect that needs by in such as the cell of endonuclease and exonuclease and perienzyme degrade rapidly.Therefore, SELEX ^TMMethod comprises the high affinity nucleic acid part of identifying the Nucleotide that contains modification, and the Nucleotide of described modification is given improved feature to part, passs feature as improved body internal stability or improved sending.The chemistry that the example of described modification is included in ribose and/or phosphoric acid and/or base position replaces.The SELEX that contains the Nucleotide of modification ^TMThe nucleic acid ligands of identifying is described in for example U.S. Patent No. 5,660,985, it has described the oligonucleotide of nucleotide derivative of 8 chemically modifieds of 5 of being included in 2 of ribose ' position, pyrimidine and purine, U.S. Patent No. 5,756,703, its described comprise a plurality of 2 '-oligonucleotide of the pyrimidine modified, with U.S. Patent No. 5,580,737, its described contain one or more usefulness 2 '-amino (2 '-NH ₂), 2 '-fluoro (2 '-F), and/or 2 '-the O-methyl (2 '-OMe) nucleic acid ligands of the high degree of specificity of the Nucleotide modified of substituting group.

[0081] modification of the nucleic acid ligands of the present invention's consideration includes but not limited to provide those modifications of other chemical group, and described other chemical group mixes extra electric charge, polarity, hydrophobicity, hydrogen bond, electrostatic interaction and flowability for nucleic acid ligands base or nucleic acid ligands as a whole.The modification that produces the oligonucleotide colony of nuclease-resistant also can comprise key, sugared change, sequence change or its combination between the Nucleotide of one or more replacements.Described modification include but not limited to 2 ' sugar-modified, 5 pyrimidines are modified, 8 purine are modified, the replacement of replacement, 5-bromine or the 5-iodo-uridylic of the modification of the outer amine of ring, 4-sulphur uridine; Backbone modifications, thiophosphatephosphorothioate or alkyl phosphate are modified, are methylated and uncommon base pairing combination, as different base-different cytidine and isoguanine riboside.Modification can comprise that also 3 ' and 5 ' modifies, as adds cap.

[0082] in one embodiment, provide oligonucleotide, wherein P (O) O group is by P (O) S (＂ thiophosphatephosphorothioate ＂), P (S) S (＂ phosphorodithioate ＂), P (O) NR ₂(＂ amidate ＂), P (O) R, P (O) OR ', CO or CH ₂(＂ formyl radical ＂) or 3 '-amine (NH-CH ₂-CH ₂-) replace, wherein each R and R ' they are H or replacement or unsubstituted alkyl independently.Can be by-O-,-N-or-the S-key, linking group is connected in adjacent nucleotide.And do not require that all keys in the oligonucleotide all are identical.Use as this paper, the term thiophosphatephosphorothioate comprises that the one or more non-bridge joint Sauerstoffatom in the phosphodiester bond is replaced by one or more sulphur atoms.

[0083] in further embodiment, oligonucleotide comprises the glycosyl group of modification, and for example, one or more hydroxyls are replaced by halogen, aliphatic group or sense turns to ester or amine.In one embodiment, 2 '-position of furanose residue is by any one replacement in O-methyl, O-alkyl, O-allyl group, S-alkyl, S-allyl group or the halogen group.Synthetic 2 '-method of the sugar modified is described in for example Sproat, et al, Nucl.Acid Res.19:733-738 (1991); Cotten, et al., Nucl.Acid Res.19:2629-2635 (1991); And Hobbs, et al, Biochemistry12:5138-5145 (1973).Other modification is well known by persons skilled in the art.Described modification can be SELEX ^TMCrossing the Cheng Qian modifies or SELEX ^TMModifying (modification of the unmodified part of Jian Dinging in the past) after the process maybe can be by mixing SELEX ^TMCarry out in the process.

[0084] SELEX ^TMCross that the Cheng Qian is modified or by mixing SELEX ^TMThe modification of carrying out produces the SELEX to them in the process ^TMTarget has high degree of specificity and has improved stability, as the nucleic acid ligands of body internal stability.The SELEX that nucleic acid ligands is carried out ^TMModification can cause improved stability after the process, as the body internal stability, and the binding ability of nucleic acid ligands is not had disadvantageous effect.

[0085] SELEX ^TMMethod comprises according to U.S. Patent No. 5,637,459 and U.S. Patent No. 5,683,867 in description selected oligonucleotide and other selected oligonucleotide and non-oligonucleotide functional unit are made up.SELEX ^TMMethod further comprises according to for example U.S. Patent No. 6,011,020, U.S. Patent No. 6,051,698 and the description of the open No.WO 98/18480 of PCT selected nucleic acid ligands and lipophilic or non-immunogenic high-molecular weight compounds be combined in diagnosis or treat in the mixture.These patents and application instructed effective amplification of shape and other characteristic and oligonucleotide widely and duplication characteristic and with the property combination of the needs of other molecule.

[0086] disclosed and passed through SELEX ^TMMethod is identified the nucleic acid ligands of little flexible peptide.Little peptide has flexible structure, and usually exists in solution with the balance of multiple conformation, therefore, thinks that at first its binding affinity may be subjected to combining with flexible peptide the restriction of back conformational entropy loss.But U.S. Patent No. 5,648 has proved the feasibility of identifying the nucleic acid ligands of little peptide in solution in 214.In this respect, identified substrate P, promptly a kind of high-affinity RNA nucleic acid ligands of 11 amino acid whose peptides.

[0087] typically by above-described SELEX ^TMProcess selects that target of the present invention is had the fit of high degree of specificity and binding affinity.As SELEX ^TMThe part of process optionally subsequently is used for minimizing in conjunction with the sequence of target to selecting, to determine to have the minmal sequence of the binding affinity that needs.Optional by carry out sequence at random or directed mutagenesis, selected sequence and/or minimized sequence are optimized, increasing binding affinity, or which position in definite sequence is crucial to binding affinity.In addition, can select,, make degraded in its antibody to stablize fit molecule with the sequence of the Nucleotide that mixes modification.

2 ' the SELEX that modifies ^TM

[0088] in order to make the fit therapeutical agent that is suitable for use as, preferably synthetic cheaply and intravital security and stability.The fit typical case of wild type rna and DNA is unsettled in vivo, because they are subjected to the degraded of nuclease easily.By mixing modification group, can significantly increase resistance to nuclease degradation in 2 ' position.

[0089] fluorine and amino group have successfully mixed the oligonucleotide set, have therefrom selected fit subsequently.But, these are modified has significantly increased the synthetic fit cost that obtains, and may introduce safety issue in some cases, this is because the degraded by the Nucleotide modified and use Nucleotide as DNA synthetic substrate subsequently, and the Nucleotide of modification can be recycled in the host DNA.

[0090] provided hereinly contain 2 '-O-methyl (＂ 2 '-OMe ＂) Nucleotide fit overcome a lot of above-mentioned defectives.Contain 2 '-oligonucleotide of OMe Nucleotide is a nuclease-resistant, and can synthesize cheaply.Although 2 '-OMe Nucleotide is ubiquitous in biosystem, the natural polymerization enzyme do not accept 2 under physiological condition '-OMe NTPs is as substrate, therefore do not have 2 '-OMe Nucleotide is recycled to the consideration in the host DNA.Be used to prepare the fit SELEX of 2 '-modification ^TMMethod is described in the U.S. Provisional Patent Application series No.60/430 that for example submitted on December 3rd, 2002,761, the U.S. Provisional Patent Application series No.60/487 that submitted on July 15th, 2003,474, the U.S. Provisional Patent Application series 60/517 that on November 4th, 2003 submitted to, 039, the U.S. Patent application No.10/729 that on December 3rd, 2003 submitted to, 581, and the U.S. Patent application No.10/873 of submission on June 21st, 2004,856, its denomination of invention is " method of external selection 2 '-methyl substituted nucleic acid of O-", introduces all in full at this and above-mentionedly applies for reference.

[0091] the present invention includes the fit of bind thrombin and minimizing or Trombin inhibiting function, it contains the Nucleotide (as have the Nucleotide of modification in 2 ' position) of modification, thereby preparation is than nucleotide pair enzyme and chemical degradation and the heat and the more stable oligonucleotide of mechanical degradation of unmodified.Although in the literature (referring to for example Green et al., Current Biology 2,683-695,1995) exist contain 2 '-some fit examples of OMe, these all are to obtain by the transcript library that external selection is modified, in the described transcript C and U residue be 2 '-fluorine (2 '-F) replace, and A and G residue be 2 '-OH.In case identify functional sequence, subsequently A and G residue have all been tested the tolerance that 2 '-OMe is replaced, and synthesized again have A that all tolerance 2 '-OMe replace and G residue as 2 '-OMe residue fit.Fit most of A that produce in this two steps mode and the tolerance of G residue with 2 '-the OMe residue replaces, but on average about 20% do not tolerate.Therefore, with this method produce 2 '-the OMe residue tends to contain 2-4 2 '-OH residue, and therefore damaged synthetic stability and increased cost.Mix responsive transcription by the Nucleotide that will modify, described reaction produces and is used to pass through SELEX ^TM(and/or its any changes and improvements, comprise described herein those) select and the stable oligonucleotide of the oligonucleotide set that enrichment is fit, method of the present invention has been eliminated the needs that the fit oligonucleotide of selecting (for example by synthesizing the fit oligonucleotide of the Nucleotide with modification again) carried out stabilization.

[0092] in one embodiment, the invention provides comprise 2 of ATP, GTP, CTP, TTP and UTP Nucleotide '-OH, 2 '-F, 2 '-deoxidation and 2 '-combination that OMe modifies fit.In another embodiment, the invention provides comprise 2 of ATP, GTP, CTP, TTP and UTP Nucleotide '-OH, 2 '-F, 2 '-deoxidation, 2 '-OMe, 2 '-NH ₂With 2 '-that methoxyethyl is modified is fit.In another embodiment, provide comprise 2 of ATP, GTP, CTP, TTP and UTP Nucleotide '-OH, 2 '-F, 2 '-deoxidation, 2 '-OMe, 2 '-NH ₂With 2 '-methoxyethyl modify 5 ⁶Plant the fit of combination.

[0093] of the present invention 2 ' modify fit be to adopt the polysaccharase of modifying, as the T7 polysaccharase preparation of modifying, the speed that described polysaccharase mixes the modified nucleotide with the large-substituent that is positioned at furanose 2 ' position is higher than the wild-type polysaccharase.For example, single mutation T7 polysaccharase (Y639F) (wherein 639 tyrosine residues is changed into phenylalanine) easily utilize 2 ' deoxidation, 2 ' amino-and 2 ' fluoro-triphosphopyridine nucleotide (NTPs) as substrate, and be widely used in the synthetic RNAs that is used for the modification of multiple application.But, these mutation T 7 polysaccharases of report can not easily utilize (promptly mixing) have 2 ' big substituting group as 2 '-OMe or 2 '-azido-(2 '-N ₃) substituent NTPs.In order to mix 2 ' big substituting group, described double T 7 polymerase mutants (Y639F/H784A), its Histidine of 784 is changed into alanine residue, and has the Y639F sudden change, and used it under the condition of limited, be used to mix the pyrimidine NTPs of modification.Referring to Padilla, R.and Sousa, R., Nucleic Acids Res., 2002,30 (24): 138.Also describe 784 Histidine and changed into the single mutation T7 polysaccharase (H784A) of alanine residue.Padilla et al，Nucleic Acids Research，2002，30：138。In two sudden changes of Y639F/H784A and H784A single mutation T7 polysaccharase, make it possible to mix bigger Nucleotide substrate such as the change of the less amino-acid residue of L-Ala, as 2 '-Nucleotide of OMe replacement.

[0094] common, find under condition disclosed herein, the Y693F single mutant can be used to mix except that GTP all 2 '-NTPs that OMe replaces, and the Y639F/H784A double-mutant can be used to mix all 2 '-NTPs of OMe replacement, comprise GTP.Expection is when using under condition disclosed herein, and the H784A single mutant has the character that is similar to Y639F and Y639F/H784A mutant.

[0095] can use modified nucleotide fully, or with the modified nucleotide Synthetic 2 of a subgroup '-oligonucleotide modified.Described modification can be identical or different.All Nucleotide can be modified, and can contain identical modification.All Nucleotide can be modified, but contain different modifications, and for example, all Nucleotide that contain identical base can have one type modification, and the Nucleotide that contains other base can have dissimilar modifications.All purine nucleotides can have one type modification (or unmodified), and all pyrimidine nucleotides have another kind of dissimilar modification (or unmodified).In this way, with the arbitrary combination of modifying, for example comprise ribonucleotide (2 '-OH), deoxyribonucleotide (2 '-deoxidation), 2 '-F and 2 '-OMe Nucleotide prepares transcript or transcript set.Contain 2 '-mixture of transcribing of OMe C and U and 2 '-OH A and G is called ＂ rRmY ＂ mixture, and the fit ＂ of the being called rRmY ＂ that is selected from wherein is fit.Contain deoxidation A and G and 2 '-mixture of transcribing of OMe C and U is called ＂ dRmY ＂ mixture, and the fit ＂ of the being called dRmY ＂ that is selected from wherein is fit.Contain 2 '-OMe A, C and U, and 2 '-mixture of transcribing of OH G is called ＂ rGmH ＂ mixture, and the fit ＂ of the being called rGmH ＂ that is selected from wherein is fit.Alternatively contain 2 '-mixture of transcribing of OMe A, C, U and G and 2 '-OMe A, C and U and 2 '-F G is called " substituting mixture ", and being selected from wherein fit being called, " to substitute mixture " fit.Contain 2 '-OMe A, U, C and G, wherein maximum 10% G is that the mixture of transcribing of ribonucleotide is called ＂ r/mGmH ＂ mixture, and the fit ＂ of the being called r/mGmH ＂ that is selected from wherein is fit.Contain 2 '-mixture of transcribing of OMe A, U and C and 2 '-F G is called ＂ fGmH ＂ mixture, and the fit ＂ of the being called fGmH ＂ that is selected from wherein is fit.Contain 2 '-mixture of transcribing of OMe A, U and C and deoxidation G is called ＂ dGmH ＂ mixture, and the fit ＂ of the being called dGmH ＂ that is selected from wherein is fit.The mixture of transcribing that contains deoxidation A and 2 '-OMe C, G and U is called ＂ dAmB ＂ mixture, and the fit ＂ of the being called dAmB ＂ that is selected from wherein is fit.The mixture of transcribing that contains 2 '-OH Nucleotide is called ＂ rN ＂ mixture, and the fit ＂ of the being called rN ＂ or the ＂ rRrY ＂ that are selected from wherein are fit.＂ mRmY ＂ is fit contain all 2 '-the O-methyl nucleotide, and pass through SELEX usually ^TMThe back substitutes and to derive from the r/mGmH oligonucleotide, when may the time, with 2 '-OMe G is alternative any 2 '-OH G.

[0096] a kind of preferred embodiment comprise 2 '-OH, 2 '-deoxidation and 2 '-arbitrary combination of OMe Nucleotide.A kind of preferred embodiment comprises 2 '-deoxidation and 2 '-arbitrary combination of OMe Nucleotide.A kind of even preferred embodiment be adopt 2 '-arbitrary combination of deoxidation and T-OMe Nucleotide, wherein pyrimidine be 2 '-OMe (as dRmY, mRmY or dGmH).

[0097] (preceding) mixes the Nucleotide of modifying of the present invention fit (as SELEX before chosen process ^TMCrossing the Cheng Qian modifies).Randomly, pass through SELEX ^TMCrossing the Cheng Qian modifies the of the present invention fit of Nucleotide mix modification and can further pass through SELEX ^TMModifying after the process (is SELEX ^TMCross the SELEX after the Cheng Qian is modified ^TMModify after the process) further modify.SELEX ^TMCross the Cheng Qian and modify generation SELEX ^TMTarget has the nucleic acid ligands of the modification of high affinity, and also improves the body internal stability.SELEX ^TMModify after the process, promptly modify (as the SELEX of passing through that has of former evaluation ^TMCross the modification that the Cheng Qian is modified the brachymemma of the part of the Nucleotide mix, disappearance, replacement or added Nucleotide), can cause further improving the body internal stability and to having the SELEX of passing through ^TMCrossing the Cheng Qian modifies the binding ability of the nucleic acid ligands of the Nucleotide mix and does not have disadvantageous effect.

[0098] for accept 2 at polysaccharase '-prepare 2 under the condition of the NTPs that modifies '-modify (as 2 '-OMe) set of rna transcription thing, preferred polysaccharase is Y693F/H784A double-mutant or Y693F single mutant.Other polysaccharase particularly shows those that highly tolerate to 2 ' big-substituting group, also can be used for the present invention.Can be by measuring in the ability of mixing the Nucleotide of modification under the condition of transcribing disclosed herein, this ability of screening described polymkeric substance.

[0099] determined that many factors are important to the condition of transcribing that is used for method disclosed herein.For example, mix the 5 ' end that DNA transcribes 5 ' terminal fixed sequence program of template, when about at least preceding 6 residues of the transcript that obtains all are purine, observe the gain in yield of the transcript of modification when leading sequence.

[00100] another important factor of transcript that obtains to mix the Nucleotide of modification be 2 '-existence or the concentration of OHGTP.Transcribe and can be divided into two stages: first stage is initial, and wherein 3 '-C-terminal at GTP (or another kind of guanosine that replaces) adds NTP, and to produce dinucleotides, it prolongs about 10-12 Nucleotide subsequently; Second stage is to extend, and wherein the carrying out of transcribing surpasses approximately preceding 10-12 the Nucleotide that adds.Have been found that contain a small amount of 2 that transcribing of excessive 2 '-OMe GTP add in the mixture '-OH GTP enough make polysaccharase with 2 '-OH GTP is initial to transcribe, in case but transcript enters the extension stage, 2 '-minimizing distinguished between OMe and 2 '-OH GTP, and 2 '-OMe GTP with respect to 2 '-OH GTP excessive make mainly mix 2 '-OMe GTP.

[00101] with 2 '-another important factor that Nucleotide that Ome replaces mixes transcript is to use divalence magnesium and manganese in transcribing mixture.The various combination that has been found that the concentration of magnesium chloride and Manganous chloride tetrahydrate influences 2 '-the methylate productive rate of transcript of O-, the optimum concn of magnesium chloride and Manganous chloride tetrahydrate depend on divalent-metal ion compound NTPs responsive transcription mixture in concentration.In order to obtain the methylate maximum yield of transcript (i.e. all A, C and U, and about 90% G Nucleotide) of the maximum 2 ' O-that replaces, when every kind of NTP existed with the concentration of 0.5mM, approximately the concentration of 5mM magnesium chloride and 1.5mM Manganous chloride tetrahydrate was preferred.When the concentration of every kind of NTP was 1.0mM, approximately the concentration of 6.5mM magnesium chloride and 2.0mM Manganous chloride tetrahydrate was preferred.When the concentration of every kind of NTP was 2.0mM, approximately the concentration of 9.6mM magnesium chloride and 2.9mM Manganous chloride tetrahydrate was preferred.Under any circumstance, depart from maximum 2 times of these concentration, still obtain the transcript of the modification of significant quantity.

[00102] it also is important transcribing with GMP or guanosine initiation.This effect is caused by the specificity of the polysaccharase of nuclei originis thuja acid.Therefore, 5 ' terminal nucleotide of any transcript that produces in this way be likely 2 '-OH G.The preferred concentration of GMP (or guanosine) is 0.5mM, even is more preferably 1mM.Also have been found that to comprise PEG in the responsive transcription, preferred PEG-8000, the Nucleotide that mixes modification for maximum is useful.

[00103] for maximum in transcript mix 2 '-OMe ATP (100%), UTP (100%), CTP (100%) and GTP (about 90%) (＂ r/mGmH ＂), following condition is preferred: HEPES damping fluid 200mM, DTT40mM, spermidine 2mM, PEG-8000 10% (w/v), TritonX-1000.01% (w/v), MgCl ₂5mM (6.5mM, wherein every kind 2 '-concentration of OMe NTP is 1.0mM), MnCl ₂1.5mM (2.0mM, wherein every kind 2 '-concentration of OMe NTP is 1.0mM), 2 '-OMe NTP (every kind) 500 μ M (more preferably 1.0mM), 2 '-OH GTP 30 μ M, 2 '-OH GMP 500 μ M, pH7.5, Y639F/H784A T7 RNA polymerase 15 units/ml, inorganic pyrophosphatase 5 units/ml and length are the Allopurinol leader sequence of at least 8 Nucleotide.Use as this paper, the Y639F/H784A mutation T 7RNA polysaccharase of a unit (or this paper point out any other mutation T 7RNA polysaccharase) be defined as under the r/mGmH condition with 1 nmole 2 '-OMe NTPs mixes the amount of the enzyme that needs in the transcript.As defined herein, the inorganic pyrophosphatase of a unit is defined as the enzyme amount of pH7.2 and 1.0 moles of inorganic orthophosphates of 25 ℃ of following per minute release.

[00104] for maximum in transcript mix (100%) 2 '-OMe ATP, UTP and CTP (＂ rGmH ＂), following condition is preferred: HEPES damping fluid 200mM, DTT40mM, spermidine 2mM, PEG-800010% (w/v), Triton X-1000.01% (w/v), MgCl ₂5mM (9.6mM, wherein every kind 2 '-concentration of OMe NTP is 2.0mM), MnCl ₂1.5mM (2.9mM, wherein every kind 2 '-concentration of OMe NTP is 2.0mM), 2 '-OMe NTP (every kind) 500 μ M (more preferably 2.0mM), pH7.5, Y639F T7 RNA polymerase 15 units/ml, inorganic pyrophosphatase 5 units/ml and length are the Allopurinol leader sequence of at least 8 Nucleotide.

[00105] for maximum in transcript mix (100%) 2 '-OMe UTP and CTP (＂ rRmY ＂), following condition is preferred: HEPES damping fluid 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-1000.01% (w/v), MgCl ₂5mM (9.6mM, wherein every kind 2 '-concentration of OMe NTP is 2.0mM), MnCl ₂1.5mM (2.9mM, wherein every kind 2 '-concentration of OMe NTP is 2.0mM), 2 '-OMe NTP (every kind) 500 μ M (more preferably 2.0mM), pH7.5, Y639F/H784A T7 RNA polymerase 15 units/ml, inorganic pyrophosphatase 5 units/ml and length are the Allopurinol leader sequence of at least 8 Nucleotide.

[00106] mixes (100%) deoxidation ATP and GTP and 2 '-OMe UTP and CTP (＂ dRmY ＂) for maximum in transcript, following condition is preferred: HEPES damping fluid 200mM, DTT 40mM, spermine 2mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-1000.01% (w/v), MgCl ₂9.6mM, MnCl ₂2.9mM, 2 '-OMe NTP (every kind) 2.0mM, pH7.5, Y639F T7 RNA polymerase 15 units/ml, inorganic pyrophosphatase 5 units/ml and length are the Allopurinol leader sequence of at least 8 Nucleotide.

[00107] for maximum in transcript mix (100%) 2 '-OMe ATP, UTP and CTP and 2 '-F GTP (＂ fGmH ＂), following condition is preferred: HEPES damping fluid 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-1000.01% (w/v), MgCl ₂9.6mM, MnCl ₂2.9mM, 2 '-OMe NTP (every kind) 2.0mM, pH7.5, Y639F T7 RNA polymerase 15 units/ml, inorganic pyrophosphatase 5 units/ml and length are the Allopurinol leader sequence of at least 8 Nucleotide.

[00108] mixes (100%) deoxidation ATP and 2 '-OMeUTP, GTP and CTP (＂ dAmB ＂) for maximum in transcript, following condition is preferred: HEPES damping fluid 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-1000.01% (w/v), MgCl ₂9.6mM, MnCl ₂2.9mM, 2 '-OMe NTP (every kind) 2.0mM, pH7.5, Y639F T7 RNA polymerase 15 units/ml, inorganic pyrophosphatase 5 units/ml and length are the Allopurinol leader sequence of at least 8 Nucleotide.

[00109] for above-mentioned every kind of situation, (a) transcribe preferably at about 20 ℃-50 ℃, preferred about 30 ℃-40 ℃, more preferably from about carried out at least 2 hours under 37 ℃ the temperature, and (b) use the 50-300nM double-stranded DNA to transcribe template (first round is used the 200nM template, to increase diversity (dRmY uses the 300nM template in transcribing)), each wheel uses about 50nM subsequently, 1/10 diluent of the PCR reaction of optimizing adopts above-described condition).Preferred DNA transcribe template be described in hereinafter (wherein ARC254 and ARC256 all 2 '-transcribe under the OMe condition, ARC255 transcribes under the rRmY condition).

SEQ ID NO 1

5’-CATCGATGCTAGTCGTAACGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGAACGTTCTCTCCTCTCCCTATAGTGAGTCGTATTA-3’

SEQ ID NO 2

5’-CATGCATCGCGACTGACTAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGAACGTTCTCTCCTCTCCCTATAGTGAGTCGTATTA-3’

SEQ ID NO 3

5’CATCGATCGATCGATCGACAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGAACGTTCTCTCCTCTCCCTATAGTGAGTCGTATTA-3`

[00110] to transcribe under the condition at rN of the present invention, the responsive transcription mixture comprises 2 '-OH adenosine triphosphate (ATP), 2 '-OH guanosine triphosphate (GTP), 2 '-OH cytidine triphosphate(CTP) (CTP) and 2 '-OH uridine triphosphate (UTP).The oligonucleotide that utilizes rN of the present invention to transcribe the modification that mixture produces comprise basic all 2 '-OH adenosine, 2 '-OH guanosine, 2 '-OH cytidine and 2 '-the OH uridine.In a kind of preferred embodiment that rN transcribes, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 80% in all adenosine nucleoside acid be 2 '-the OH adenosine, in all guanosine Nucleotide at least 80% are 2 '-the OH guanosine, in all cytidine nucleotides at least 80% are 2 '-the OH cytidine, and at least 80% in all uridine Nucleotide be 2 '-the OH uridine.In a kind of preferred embodiment that rN transcribes, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 90% in all adenosine nucleoside acid be 2 '-the OH adenosine, in all guanosine Nucleotide at least 90% are 2 '-the OH guanosine, in all cytidine nucleotides at least 90% are 2 '-the OH cytidine, and at least 90% in all uridine Nucleotide be 2 '-the OH uridine.In a kind of the most preferred embodiment that rN transcribes, the oligonucleotide of the modification that obtains comprises such sequence, wherein 100% in all adenosine nucleoside acid be 2 '-the OH adenosine, in all guanosine Nucleotide 100% are 2 '-the OH guanosine, in all cytidine nucleotides 100% are 2 '-the OH cytidine, and 100% in all uridine Nucleotide be 2 '-the OH uridine.

[00111] to transcribe under the condition at rRmY of the present invention, the responsive transcription mixture comprises 2 '-OH adenosine triphosphate, 2 '-OH guanosine triphosphate, 2 '-O-methylcytidine triphosphoric acid and 2 '-O-methyluridine triphosphoric acid.The oligonucleotide that utilizes rRmY of the present invention to transcribe the modification that mixture produces comprise basic all 2 '-OH adenosine, 2 '-OH guanosine, 2 '-O-methylcytidine and 2 '-the O-methyluridine.In a kind of preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 80% in all adenosine nucleoside acid be 2 '-the OH adenosine, in all guanosine Nucleotide at least 80% are 2 '-the OH guanosine, in all cytidine nucleotides at least 80% are 2 '-the O-methylcytidine, and at least 80% in all uridine Nucleotide be 2 '-the O-methyluridine.In a kind of preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 90% in all adenosine nucleoside acid be 2 '-the OH adenosine, in all guanosine Nucleotide at least 90% are 2 '-the OH guanosine, in all cytidine nucleotides at least 90% are 2 '-the O-methylcytidine, and at least 90% in all uridine Nucleotide be 2 '-the O-methyluridine.In a kind of the most preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein 100% in all adenosine nucleoside acid be 2 '-the OH adenosine, in all guanosine Nucleotide 100% are 2 '-the OH guanosine, in all cytidine nucleotides 100% are 2 '-the O-methylcytidine, and 100% in all uridine Nucleotide be 2 '-the O-methyluridine.

[00112] to transcribe under the condition at dRmY of the present invention, the responsive transcription mixture comprises 2 '-deoxyadenosine triphosphate, 2 '-deoxyguanosine triphosphate, 2 '-O-methylcytidine triphosphoric acid and 2 '-O-methyluridine triphosphoric acid.Utilize the oligonucleotide of the modification that the dRmY of the present invention condition of transcribing produces comprise basic all 2 '-Desoxyadenosine, 2 '-pancreatic desoxyribonuclease, 2 '-O-methylcytidine and 2 '-the O-methyluridine.In a kind of preferred embodiment, the oligonucleotide of the modification of the present invention that obtains comprises such sequence, wherein at least 80% in all adenosine nucleoside acid be 2 '-Desoxyadenosine, in all guanosine Nucleotide at least 80% are 2 '-pancreatic desoxyribonuclease, in all cytidine nucleotides at least 80% are 2 '-the O-methylcytidine, and at least 80% in all uridine Nucleotide be 2 '-the O-methyluridine.In a kind of preferred embodiment, the oligonucleotide of the modification of the present invention that obtains comprises such sequence, wherein at least 90% in all adenosine nucleoside acid be 2 '-Desoxyadenosine, in all guanosine Nucleotide at least 90% are 2 '-pancreatic desoxyribonuclease, in all cytidine nucleotides at least 90% are 2 '-the O-methylcytidine, and at least 90% in all uridine Nucleotide be 2 '-the O-methyluridine.In a kind of the most preferred embodiment, the oligonucleotide of the modification of the present invention that obtains comprises such sequence, wherein 100% in all adenosine nucleoside acid be 2 '-Desoxyadenosine, in all guanosine Nucleotide 100% are 2 '-pancreatic desoxyribonuclease, in all cytidine nucleotides 100% are 2 '-the O-methylcytidine, and 100% in all uridine Nucleotide be 2 '-the O-methyluridine.

[00113] to transcribe under the condition at rGmH of the present invention, the responsive transcription mixture comprises 2 '-OH guanosine triphosphate, 2 '-O methylcytidine triphosphoric acid, 2 '-O-methyluridine triphosphoric acid and 2 '-O-methyladenosine triphosphoric acid.The oligonucleotide that utilizes rGmH of the present invention to transcribe the modification that mixture produces comprise basic all 2 '-OH guanosine, 2 '-O methylcytidine, 2 '-O-methyluridine and 2 '-the O-methyladenosine.In a kind of preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 80% in all guanosine Nucleotide be 2 '-the OH guanosine, in all cytidine nucleotides at least 80% are 2 '-the O-methylcytidine, in all uridine Nucleotide at least 80% are 2 '-the O-methyluridine, and at least 80% in all adenosine nucleoside acid be 2 '-the O-methyladenosine.In a kind of preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 90% in all guanosine Nucleotide be 2 '-the OH guanosine, in all cytidine nucleotides at least 90% are 2 '-the O-methylcytidine, in all uridine Nucleotide at least 90% are 2 '-the O-methyluridine, and at least 90% in all adenosine nucleoside acid be 2 '-the O-methyladenosine.In a kind of the most preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein 100% in all guanosine Nucleotide be 2 '-the OH guanosine, in all cytidine nucleotides 100% are 2 '-the O-methylcytidine, in all uridine Nucleotide 100% are 2 '-the O-methyluridine, and 100% in all adenosine nucleoside acid be 2 '-the O-methyladenosine.

[00114] to transcribe under the condition at r/mGmH of the present invention, the responsive transcription mixture comprises 2 '-O-methyladenosine triphosphoric acid, 2 '-O-methylcytidine triphosphoric acid, 2 '-O-methylguanyl triphosphate, 2 '-O-methyluridine triphosphoric acid and 2 '-the OH guanosine triphosphate.The oligonucleotide that utilizes rGmH of the present invention to transcribe the modification that mixture produces comprise basic all 2 '-O-methyladenosine, 2 '-O-methylcytidine, 2 '-O-methylguanosine and 2 '-the O-methyluridine, wherein guanosine Nucleotide colony has about 10%2 '-OH guanosines at most.In a kind of preferred embodiment, the oligonucleotide that the r/mGmH of the present invention that obtains modifies comprises such sequence, wherein at least 80% in all adenosine nucleoside acid be 2 '-the O-methyladenosine, in all cytidine nucleotides at least 80% are 2 '-the O-methylcytidine, in all guanosine Nucleotide at least 80% are 2 '-the O-methylguanosine, in all uridine Nucleotide at least 80% are 2 '-the O-methyluridine, and being no more than in all guanosine Nucleotide about 10% be 2 '-the OH guanosine.In a kind of preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 90% in all adenosine nucleoside acid be 2 '-the O-methyladenosine, in all cytidine nucleotides at least 90% are 2 '-the O-methylcytidine, in all guanosine Nucleotide at least 90% are 2 '-the O-methylguanosine, in all uridine Nucleotide at least 90% are 2 '-the O-methyluridine, and being no more than in all guanosine Nucleotide about 10% be 2 '-the OH guanosine.In a kind of the most preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein 100% in all adenosine nucleoside acid be 2 '-the O-methyladenosine, in all cytidine nucleotides 100% are 2 '-the O-methylcytidine, in all guanosine Nucleotide at least 90% are 2 '-the O-methylguanosine, in all uridine Nucleotide at least 100% are 2 '-the O-methyluridine, and being no more than in all guanosine Nucleotide about 10% be 2 '-the OH guanosine.

[00115] to transcribe under the condition at fGmH of the present invention, the responsive transcription mixture comprises 2 '-O-methyladenosine triphosphoric acid, 2 '-O-methyluridine triphosphoric acid, 2 '-O-methylcytidine triphosphoric acid and 2 '-the F guanosine triphosphate.Utilize the oligonucleotide of the modification that the fGmH of the present invention condition of transcribing produces comprise basic all 2 '-O-methyladenosine, 2 '-O-methyluridine, 2 '-O-methylcytidine and 2 '-the F guanosine.In a kind of preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 80% in all adenosine nucleoside acid be 2 '-the O-methyladenosine, in all uridine Nucleotide at least 80% are 2 '-the O-methyluridine, in all cytidine nucleotides at least 80% are 2 '-the O-methylcytidine, and at least 80% in all guanosine Nucleotide be 2 '-the F guanosine triphosphate.In a kind of preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 90% in all adenosine nucleoside acid be 2 '-the O-methyladenosine, in all uridine Nucleotide at least 90% are 2 '-the O-methyluridine, in all cytidine nucleotides at least 90% are 2 '-the O-methylcytidine, and at least 90% in all guanosine Nucleotide be 2 '-the F guanosine triphosphate.In a kind of the most preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein 100% in all adenosine nucleoside acid be 2 '-the O-methyladenosine, in all uridine Nucleotide 100% are 2 '-the O-methyluridine, in all cytidine nucleotides 100% are 2 '-the O-methylcytidine, and 100% in all guanosine Nucleotide be 2 '-the F guanosine triphosphate.

[00116] to transcribe under the condition at dAmB of the present invention, the responsive transcription mixture comprises 2 '-deoxyadenosine triphosphate, 2 '-O-methylcytidine triphosphoric acid, 2 '-O-methylguanyl triphosphate and 2 '-O-methyluridine triphosphoric acid.The oligonucleotide that utilizes dAmB of the present invention to transcribe the modification that mixture produces comprise basic all 2 '-Desoxyadenosine, 2 '-O-methylcytidine, 2 '-O-methylguanosine and 2 '-the O-methyluridine.In a kind of preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 80% in all adenosine nucleoside acid be 2 '-Desoxyadenosine, in all cytidine nucleotides at least 80% are 2 '-the O-methylcytidine, in all guanosine Nucleotide at least 80% are 2 '-the O-methylguanosine, and at least 80% in all uridine Nucleotide be 2 '-the O-methyluridine.In a kind of more preferred, the oligonucleotide of the modification that obtains comprises such sequence, wherein at least 90% in all adenosine nucleoside acid be 2 '-Desoxyadenosine, in all cytidine nucleotides at least 90% are 2 '-the O-methylcytidine, in all guanosine Nucleotide at least 90% are 2 '-the O-methylguanosine, and at least 90% in all uridine Nucleotide be 2 '-the O-methyluridine.In a kind of most preferred embodiment, the oligonucleotide of the modification that obtains comprises such sequence, wherein 100% in all adenosine nucleoside acid be 2 '-Desoxyadenosine, in all cytidine nucleotides 100% are 2 '-the O-methylcytidine, in all guanosine Nucleotide 100% are 2 '-the O-methylguanosine, and 100% in all uridine Nucleotide be 2 '-the O-methyluridine.

[00117] in each case, subsequently can be with transcription product as SELEX ^TMLibrary in the process is used to identify fit and/or definite conservative motif that given target is had the sequence of height binding specificity.The sequence that obtains is partially stabilizedization, removed this step from this process, with the fit sequence that is optimized, and therefore obtains the fit of more highly stableization.2 '-OMeSELEX ^TMThat another advantage of process is that the sequence that obtains has probably is required 2 in still less the sequence '-OH Nucleotide, may not have.As long as kept 2 ' OH Nucleotide, can be by carrying out SELEX ^TMThe back is modified its removal.

[00118] as described below, under the condition except that above-described optimal conditions, can obtain to mix fully the lower but still useful productive rate of the transcript of the 2 ' Nucleotide that replaces.For example, above-mentioned change of transcribing condition is comprised:

[00119] the HEPES buffer concentration can be 0-1M.The present invention also considers to use the buffer reagent of other pKa as 5-10, comprises for example three-methylol-aminomethane.

[00120] DTT concentration can be 0-400mM.Method of the present invention also provides uses other reductive agent, comprises for example mercaptoethanol.

[00121] concentration of spermidine and/or spermine can be 0-20mM.

[00122] PEG-8000 concentration can be 0-50% (w/v).Method of the present invention also provides uses other hydrophilic polymer, comprises for example PEG or other polyalkylene glycol of other molecular weight.

[00123] Triton X-100 concentration can be 0-0.1% (w/v).Method of the present invention also provides uses other nonionic detergent, comprises for example other stain remover, comprises other Triton-X stain remover.

[00124] MgCl ₂Concentration can be 0.5mM-50mM.MnCl ₂Concentration can be 0.15mM-15mM.MgCl ₂And MnCl ₂Must be present in the scope of description, in preferred embodiments, with the MgCl of about 10-3 ₂: MnCl ₂Ratio exists, and preferably, this ratio is about 3-5:1, and more preferably, this ratio is about 3-4:1.

[00125] 2 '-OMe NTP concentration (every kind) can be 5 μ M-5mM.

[00126] 2 '-OH GTP concentration can be 0 μ M-300 μ M.

[00127] 2 '-OH GMP concentration can be 0-5mM.

[00128] pH can be pH6-pH9.Method of the present invention can be implemented in the active pH scope of most of polysaccharases of the Nucleotide that mixes modification.In addition, method of the present invention provides to choose wantonly in the responsive transcription condition uses sequestrant, comprises for example EDTA, EGTA and DTT.

Aptamer medicinal chemistry

[00129] aptamer medicinal chemistry is fit improvement technology, the wherein group of the fit variant of chemosynthesis.The group of these variants is typically fit different with the parent by introducing single replacement, and owing to this substituent position differs from one another.Then these variants are compared to each other or with the parent relatively.The improvement of feature may be enough significant, makes single substituent introducing just enough for realizing the particular treatment standard.

[00130] or, the information of collecting from monotropic body group can be used to design other variant group, wherein introduces more than one substituting group simultaneously.In a kind of layout strategy, all single variants that replace are sorted, select preceding 4, synthesize and measure all possible two (6 kinds), three (4 kinds) and four (1 kinds) combination of these 4 kinds single replacement variants.In second kind of layout strategy, think that best single substituting group is new parent, synthetic and mensuration comprises single all possible two variants that replace that replace variant that this ordering is the highest.Can adopt other strategy, these strategies can repeated application, makes the substituting group number increase gradually, and continues to identify further improved variant.

[00131] can adopt aptamer medicinal chemistry, as study local rather than introduce substituent method comprehensively.Because fit is to find in by the library of transcribing preparation, any at SELEX ^TMThe substituting group of introducing in the process all must be introduced comprehensively.For example, introduce phosphorothioate bond if desired between Nucleotide, then they only can introduce at each A (or each G, C, T, U etc.) (replacing) comprehensively.Can easily find to need thiophosphatephosphorothioate by this process, and can not tolerate the fit of described thiophosphatephosphorothioate at other A at some A (or some G, C, T, U etc.).

[00132] the utilizable substituent kind of aptamer medicinal chemistry method only is subjected to they are produced and be introduced into as solid phase synthesis reagent the restriction of the ability of oligomer synthetic schemes.This method is not limited only to Nucleotide.The aptamer medicinal chemistry scheme can comprise the substituting group of introducing spatial volume, hydrophobicity, wetting ability, lipotropy, lipotropism, positive charge, negative charge, neutral charge, zwitter-ion, polarizability, nuclease resistance, conformation rigidity, conformation flexibility, protein binding feature, quality etc.The aptamer medicinal chemistry scheme can comprise base modification, sugar-modified or phosphodiester bond modification.

[00133] when considering the substituting group type that possibility is useful in the fit scope of therapeutic, may need to introduce the substituting group that belongs to following one or more types:

(1) Already in intravital substituting group, as 2 '-deoxidation, 2 '-ribose, 2 '-O-methyl purine or pyrimidine, or the 5-methylcytidine.

(2) be the substituting group of a part of the therapeutical agent of approval, the oligonucleotide that connects as thiophosphatephosphorothioate.

(3) hydrolysis or be degraded to the substituting group of one of above-mentioned two classes, the oligonucleotide that connects as methyl-phosphonate.

[00134] zymoplasm of the present invention is fit comprises fit by the exploitation of above-described aptamer medicinal chemistry.

Bind thrombin fit

[00135] material of the present invention comprises that a series of length are the aptamer of 13-51 Nucleotide, and its bind thrombin, and in certain embodiments is in vivo and/or based on reducing or the anticoagulant enzymic activity in the mensuration of cell.Preferably, of the present invention fit with the high-affinity bind thrombin, its KD preferably less than about 250pM, is more preferably less than about 200pM less than about 300pM.

[00136] fit providing of the present invention treats and/or prevents some and knownly caused or the hypotoxicity of otherwise relevant with zymoplasm blood coagulation associated conditions, safety and effective form by zymoplasm.Fit also providing of the present invention is used to regulate blood coagulation, safety and effective form especially for anti-freezing, described adjusting blood coagulation, particularly anti-freezing is relevant with following operative procedure: for example percutaneous coronary is got involved, comprise placing rack, with the relevant operation of peripheral arterial occlusion disease (PAOD), and cardiopulmonary bypass (CPB) program, comprise coronary bypass grafting (CABG) operation.Of the present invention fitly have effect to anti-freezing, and it can be measured by activated clotting time (ACT) and other conventional blood coagulation measuring method, and does not cause unwanted secondary action, as platelet activation (for example using generation with heparin).In addition, in some embodiments, antithrombin is fit to have short pharmacokinetics (PK) and pharmacokinetics (PD) transformation period, and it causes rapidly, the effect of reversible antithrombin.

[00137] zymoplasm as therapeutical agent of the present invention and/or diagnostic reagent comprises following sequence in conjunction with fit example: SEQ ID NOs 9-41,43-191,193-204,208-304,307-329,331-332,334,336-337,340-392,396-397,400 and 402-440.

[00138] the fit hereinafter embodiment 1 and 2 that is described in of other of bind thrombin.

[00139] these fitly can comprise modification described below, for example comprise, put together in lipophilic or high-molecular weight compounds such as PEG, mix to add cap portion, mix the Nucleotide of modification, the replacement in the phosphate backbone, and key between thiophosphatephosphorothioate Nucleotide.

[00140] In one embodiment of the present invention, provide the fit of bind thrombin that a kind of isolating, non-natural exists.In some embodiments, fit dissociation constant (the ＂ K that exists of described isolating, non-natural to zymoplasm _D＂) less than 100 μ M,,,,,,,,, be more preferably less than about 200pM preferably less than 250pM less than about 300pM less than 500pM less than 1nM less than 50nM less than 100nM less than 500nM less than 1 μ M.Can determine dissociation constant by the dot blotting titration of hereinafter embodiment 1 description.

[00141] in another embodiment, the function of fit minimizing of the present invention or Trombin inhibiting.In another embodiment of the invention, the variant of fit bind thrombin, and reduce or suppress its function.Zymoplasm variant used herein comprises the variant of exercising essentially identical function with zymoplasm, preferably include essentially identical structure, and, in some embodiments, comprise 70% sequence identity with the aminoacid sequence of zymoplasm, preferred 80% sequence identity, more preferably 90% sequence identity, more preferably 95% sequence identity.In some embodiments of the present invention, determine the sequence identity of target variant with BLAST described below.

[00142] term in two or more nucleic acid or protein sequence content " sequence identity " is meant when for maximum corresponding when comparing and comparing, with one of following sequence comparison algorithm or by the identical of visual inspection measurement or have the same amino acid residue of particular percentile or the two or more sequences or the subsequence of Nucleotide.For sequence compares, a common sequence is as canonical sequence, and cycle tests compares with it.When adopting sequence comparison algorithm, will test and canonical sequence input computer, if necessary, specify the subsequence coordinate, and specified sequence algorithm routine parameter.Sequence comparison algorithm calculates the sequence identity per-cent of cycle tests with respect to canonical sequence based on specified program parameter then.Can be by for example Smith ﹠amp; Waterman, local homology's algorithm of Adv.Appl.Math.2:482 (1981), by Needleman ﹠amp; Wunsch, the homology alignment algorithm of J MolBiol.48:443 (1970), by Pearson ﹠amp; Lipman, computer realization (the GAP in the Wisconsin Genetics software package of these algorithms is retrieved, passed through to the similarity method of Proc.Nat ' l.Acad.Sci.USA 85:2444 (1988), BESTFIT, FASTA, and TFASTA, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or (, infra) be used for the optimum comparison of the sequence of comparison generally referring to Ausubel et al. by visual inspection.

[00143] example that is suitable for determining an algorithm of sequence identity per-cent is the algorithm that is used for basic local comparison gopher (after this being called ＂ BLAST ＂), referring to for example Altschul etal., J Mol.Biol.215:403-410 (1990) and Altschul et al, Nucleic Acids Res., 15:3389-3402 (1997).Being used to carry out the software that BLAST analyzes can obtain from NCBI's (after this being called ＂ NCBI ＂) is open.Employing is from the obtainable software of NCBI, for example BLASTN (at nucleotide sequence) and BLASTP (at aminoacid sequence) determine that the default parameters of sequence identity is described in McGinnis et al, Nucleic Acids Res., 32:W20-W25 (2004).

[00144] in another embodiment of the invention, fit with comprise SEQ ID NOS:43-44,48-49,52,63,72,82,84,92,97,116,130,141,143,146,166,172,185,283,292-294,319-329,331-332,334,336-337,340-392,396-397,400, the fit ability of any one sequence among the 402-433 with essentially identical bind thrombin.In other embodiments of the present invention, fit with comprise SEQ ID NOS:43-44,48-49,52,63,72,82,84,92,97,116,130,141,143,146,166,172,185,283,292-294,319-329,331-332,334,336-337,340-392,396-397,400, the fit ability of any one sequence among the 402-433 with essentially identical structure and bind thrombin.

[00145] in another embodiment of the invention, fit and SEQ ID NOs.:11,15,21,23,32,34,84,86,92,94,116,191,197,200,283-285,287,289-290,292-304,307-318,411, any one sequence has the ability of essentially identical minimizing or anticoagulant among the 434-438 and 440.In another embodiment of the present invention, fit and SEQ IDNOs.:11,15,21,23,32,34,84,86,92,94,116,191,197,200,283-285,287,289-290,292-304,307-318,411,434-438 and 440 any one sequence have the ability and the essentially identical structure of essentially identical minimizing or anticoagulant.In another embodiment, the fit SEQ ID NOS 191,197,283 that has of the present invention, 292-294,411 and 434-440 in any one sequence.In another embodiment, of the present invention fit as the activeconstituents in the pharmaceutical composition.In another embodiment, of the present invention fit or comprise fit composition of the present invention and be used for the treatment of the blood coagulation associated conditions, as the blood coagulation illness of acute and chronic thrombin-mediated.In another embodiment, of the present invention fit or comprise fit composition of the present invention before the operative procedure that gets involved such as coronary artery bypass graft (CABG) program or percutaneous coronary, during, afterwards or its arbitrary combination, as antithrombotics.

[00146] in some embodiments, aptamer therapeutics agent of the present invention has high-affinity and high specific to their target, the harmful side effect that replaces from non-natural nucleotide when reducing the aptamer therapeutics agent simultaneously and decomposing in patient or subject.In some embodiments, the therapeutic composition that contains aptamer therapeutics agent of the present invention is fluorinated Nucleotide not, or contain low amount of fluorinated Nucleotide.

[00147] can be with any oligonucleotide synthetic technology known in the art, comprise that solid phase oligonucleotide synthetic technology well known in the art is (referring to for example Froehler et al, Nucl.Acid Res.14:5399-5467 (1986) and Froehler et al, Tet.Lett.27:5575-5578 (1986)) and liquid phase process, as three ester synthetic methods (referring to for example Sood et al, Nucl.Acid Res.4:2557 (1977) and Hirose et al, Tet.Lett., 28:2449 (1978)) synthetic of the present invention fit.

[00148] ARC2172 (SEQ ID NO 294) is synthetic the manufacturing, and has molecular formula C ₂₅₆H ₃₁₉N ₁₀₄O ₁₅₈P ₂₅(free acid form), molecular weight (MW) is 8,155.24 dalton.The salt form of ARC2172 (SEQ ID NO 294) has molecular formula C ₂₅₆H ₂₉₄Na ₂₅N ₁₀₄O ₁₅₈P ₂₅, corresponding MW is 8704.77 dalton.The chemical name of the sodium salt of ARC2172 (SEQ IDNO 294) is 2 '-Deoxyribose cytidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-Deoxyribose cytidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-Deoxyribose cytidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-deoxythymidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-Desoxyadenosine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-Deoxyribose cytidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-deoxythymidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-deoxythymidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-deoxythymidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-Desoxyadenosine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-deoxythymidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-deoxythymidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-Deoxyribose cytidine acyl group-(3 ' → 5 ' O; the O-phosphoryl)-2 '-pancreatic desoxyribonuclease, the 25-sodium salt.

Pharmaceutical composition

[00149] the present invention also comprises the pharmaceutical composition of the fit molecule that contains bind thrombin.In some embodiments, composition is suitable for inner the use, and comprises the pharmaceutical active compounds of the present invention of significant quantity, its be independent or with one or more pharmaceutical acceptable carriers combinations.Described compound is particularly useful, because they have the toxicity of very low (if there is).

[00150] composition of the present invention can be used for the treatment of or prevent pathology, as disease or illness, or the symptom of disease described in the reduction of patient or illness.For example, the pathology that composition of the present invention can be used for the treatment of or prevention is relevant with blood coagulation, the pathology that particularly relevant with zymoplasm blood coagulation is relevant.Composition of the present invention can be used for to suffering from disease or illness, or the experimenter of susceptible disease or illness uses, and described disease or illness be with of the present invention fit relevant with high-affinity bonded target, or derives from described target.

[00151] composition of the present invention is used for to suffering from disease or illness, or the experimenter of susceptible disease or illness uses, and described disease or illness be with of the present invention fit relevant with high-affinity bonded target, or derives from described target.Composition of the present invention can be used for the treatment of in patient with pathology or experimenter's the method.This method comprises to patient or experimenter to be used fit or comprises fit composition, described fit in conjunction with the target protein (as zymoplasm) that participates in pathology, and what make fit and target protein combines the change target, the biological function of zymoplasm for example, thus treat this pathology.

[00152] have pathology and/or need the patient or the experimenter of anti-freezing, promptly patient or the experimenter by method treatment of the present invention can be vertebrates, Mammals more especially, and as dog, cat, monkey and/or ungulate, as horse, or people more especially.

[00153] in some embodiments, before operation gets involved, during this time or afterwards, or its arbitrary combination, use of the present invention fit, as ARC2172 (SEQ ID NO 294), described operation gets involved as CABG, PCI, angioplasty, cardiovascular and peripheral blood vessel is opened and the interior operation of blood vessel, the operation of placing rack in periphery/coronary artery or vein, place artificial organs, valvular operation, be used for the treatment of coronary artery disease and/or vein or artery, as the Renal artery, aorta abdominalis, vascular disease in the carotid artery are used for the treatment of peripheral arterial occlusion disease (＂ PAOD ＂).In some embodiments of this method, use of the present invention fit, with prevention operation back thrombosis, as after hip replacement, knee prosthesis etc.In some embodiments of this method, get involved the property operation in minimum, as before peritoneoscope, the gynaecology's operation etc., during, afterwards, or its arbitrary combination is used fit.

[00154] of the present invention fit, as ARC2172 (SEQ ID NO 294), be used in heparin-induced thrombocytopenia (＂ HIT ＂), heparin resistance, impaired renal function and/or liver function damage patient's the anticoagulant therapy.In further embodiment, the present invention relates to treat the situation in people or other Mammals, wherein need to reduce or Trombin inhibiting.Of the present inventionly fitly can be used for Mammals, comprise the people, be used for the treatment of and/or prevent hypercoagulative state in thrombosis and/or blood and the tissue, comprise acute coronary syndrome, congestive heart failure, atrial fibrillation, venous thrombosis, as venous thrombosis, pulmonary infarction, artery thrombosis, as myocardial ischemia, myocardial infarction, unstable angina, form based on thrombotic palsy and peripheral arterial thrombosis.In addition, fit can being used for the treatment of and/or the atherosis illness of prevention of arterial (disease) is as coronary artery disease, cerebral arterial disease and peripheral arterial disease.In some embodiments, of the present invention fit, as ARC2172 (SEQ ID NO 294), can be used for the anticoagulant therapy of the intravascular coagulation of hemodialysis and distribution.In some embodiments, the fit method that can be used for washing and/or wrap of the present invention by the conduit that uses in patient's body, support and mechanism, and as the antithrombotics of external preservation blood, blood plasma and other blood products.

[00155] further, fitly can be used for other disease, wherein blood coagulation can be the process that works in a kind of basis, or the source of secondary pathology, as cancer, comprises transfer, inflammatory diseases, comprises sacroiliitis, and diabetes.

[00156] composition of the present invention can be used in for example operation, as before the heart operation, during and/or treatment afterwards need in the patient of anti-freezing or experimenter's the method.In regulating the method for blood coagulation, in some embodiments of the present invention, for example before the CABG operation, during and/or afterwards, can use the fit of antithrombin by continuous intravenous infusion or intravenous push.In these embodiments, can be as sodium salt in composition of the present invention, ooze, provide fit in the pH neutrality, aqueous salts solution waiting.

[00157] in force, use fit or its pharmaceutically acceptable salt enough to apply the bioactive amount that needs, described activity for example reduces or suppresses fit target, and promptly zymoplasm and Fibrinogen and PAR-I's combines.

[00158] an aspect of of the present present invention comprises fit composition of the present invention, other treatment associating of itself and blood coagulation associated conditions.Fit composition of the present invention for example can comprise that more than one are fit.In some instances, the composition co-administered of the present invention fit composition that contain one or more The compounds of this invention useful with another kind, another kind of useful composition is anti-inflammatory agent, immunosuppressor, antiviral agent etc. for example.In addition, compound of the present invention can with above-described cytotoxic agent, cytostatics or chemotherapeutics, co-administered as alkylating agent, metabolic antagonist, mitotic inhibitor or cytotoxic antibiotics.Usually, the formulation that can be used for the known treatment agent of described associating at present is suitable.

[00159] " combination therapy " (or " co-therapy ") comprises uses fit composition of the present invention and at least a second medicament, and described second medicament is as a part that is intended to provide from the acting in conjunction of these therapeutical agents the particular treatment of beneficial effect.The beneficial effect of associating includes but not limited to the pharmacokinetics or the pharmacokinetics acting in conjunction that are caused by uniting of these therapeutical agents.Co-administered these therapeutical agents typical case carries out (depending on the associating of selection, normally branch, hour, day or week) in the time period of determining.

[00160] still, " combination therapy " may, but be not intended to usually comprise and use in these therapeutical agents two or more that as the part of the single treatment plan that separates, described scheme is along band and at random cause associating of the present invention." combination therapy " be intended to comprise in sequential mode and use these therapeutical agents, that is, wherein use every kind of therapeutical agent in the different time, and use these therapeutical agents in the mode of basic while, or in the therapeutical agent at least two kinds.For example, can be by using single capsule of every kind of therapeutical agent to the experimenter with fixed proportion, or single capsule of a plurality of every kind of therapeutical agents, realize using substantially simultaneously.

[00161] can realize the sequential of every kind of therapeutical agent or use substantially simultaneously that described approach includes but not limited to local approach, oral route, intravenous route, intramuscular approach and directly absorbs by mucosal tissue by any suitable pathways.Can be by identical approach or by the agent of different approaches administering therapeutic.For example, first kind of therapeutical agent in the associating of selection can be used by injection, and other therapeutical agent in the associating can topical application.

[00162] or, for example, can all therapeutical agents of topical application, maybe can use all therapeutical agents by injection.The order of administering therapeutic agent is not very crucial, unless otherwise noted." combination therapy " also can comprise and the further co-administered above-described therapeutical agent of other bioactive ingredients.When combination therapy further comprises non-drug therapy, can carry out non-drug therapy in any suitable time, as long as from the acting in conjunction of the associating of therapeutical agent and non-drug therapy, reach beneficial effect.For example, under suitable situation, when non-drug therapy interim (may be a couple of days or even several weeks) is removed, still reach beneficial effect from the using of therapeutical agent.

[00163] treatment of the present invention or pharmaceutical composition comprise the therapeutic activity composition of significant quantity usually, and it is dissolved or dispersed in the pharmacy acceptable medium.Pharmacy acceptable medium or carrier comprise any and whole solvent, dispersion medium, dressing, antibacterial agent and anti-mycotic agent, isotonic agent and absorption delay agent etc.Describedly be used for the medium of pharmaceutically active substance and the use of reagent is well known in the art.Supplementary active ingredients also can be mixed in the therapeutic composition of the present invention.

[00164] according to present disclosure, medicine or pharmacology preparation of compositions will be that those skilled in the art understand.Typically, described composition can be prepared as the injectable agent, for example liquor or suspension; Be suitable for before injection, being dissolved in or being suspended in the solid form in the liquid; Be used for Orally administered tablet or other solid; Controlled release capsule; Or any other enforcement of using at present, comprise eye drop, frost, washing lotion, ointment, inhalation etc.Sterile preparation is used for handling in field operation the sterile preparation of specific region as surgeon, physician or health care worker, also is useful especially as the use based on the brinish washing lotion.Composition also can send by microdevice, microparticle or sponge and pass.

[00165] when preparation, therapeutical agent will be used in the mode compatible with formulation, and use with the pharmacology significant quantity.Preparation is easily used with multiple formulation, for example as the type of above-described Injectable solution, but also can use drug release capsules etc.

[00166] in context, the amount of the activeconstituents that use and the volume of composition depend on the host animal that will treat.The accurate amount of using required active compound depends on practitioner's judgement, and all is distinctive to each individuality.

[00167] typically utilizes the minimum volume of the required composition of dispersed activity compound.The suitable scheme that is used to use also is variable, but the typical case is the initial application compound, and monitoring result, gives the further dosage of control at interval with other then.

[00168] for example, for Orally administered with tablet or capsule (as gelatine capsule) form, the inert support that active pharmaceutical ingredient can be accepted with oral, nontoxic, pharmacy is as combinations such as ethanol, glycerine, water.In addition, when needs or in case of necessity, also suitable binder, lubricant, disintegrating agent and tinting material can be mixed mixture.Suitable binder comprises starch, magnesium aluminum silicate, starch paste, gelatin, methylcellulose gum, Xylo-Mucine and/or polyvinylpyrrolidone, natural sugar, as glucose or beta lactose, corn sweetener, natural and synthetic gum, as Sudan Gum-arabic, tragacanth or sodiun alginate, polyoxyethylene glycol, wax etc.The lubricant that is used for these formulations comprises sodium oleate, sodium stearate, Magnesium Stearate, Sodium Benzoate, sodium-acetate, sodium-chlor, silicon-dioxide, talcum powder, stearic acid, its magnesium or sodium salt and/or polyoxyethylene glycol etc.Disintegrating agent includes but not limited to, starch, methylcellulose gum, agar, bentonite, xanthan gum starch, agar, alginic acid or its sodium salt or foaming mixtures etc.Thinner comprises for example lactose, dextrose, sucrose, N.F,USP MANNITOL, sorbyl alcohol, Mierocrystalline cellulose and/or glycine.

[00169] compound of the present invention also can be with described oral dosage form, uses as controlled release and continuous release tablet or capsule, pill, powder, particle, elixir, tincture, suspension, syrup and emulsion.Suppository is advantageously from fats emulsion or suspension preparation.

[00170] pharmaceutical composition can be sterilization and/or contain adjuvant, as sanitas, stablizer, wetting agent or emulsifying agent, solution promotor, regulate the salt and/or the damping fluid of osmotic pressure.In addition, they also contain other material that therapeutic value is arranged.Prepare composition according to routine mixing, granulation or method for coating, and typically contain the 0.1%-75% that has an appointment, preferably the activeconstituents of about 1%-50%.

[00171] for example, can pass through preparation liquid such as dissolving, dispersion, particularly injectable composition.Active compound is dissolved in the pure solvent of pharmacy, or with this solvent, thereby form injectable solution or suspension, described solvent is water, salt solution, dextrose hydrate, glycerine, ethanol etc. for example.In addition, can prepare the solid form that is suitable for before injection, being dissolved in the liquid.

[00172] compound of the present invention can be used with intravenously (injecting or infusion), intraperitoneal, subcutaneous or intramuscular form, and all adopts the known form of pharmacy field those of ordinary skill.The injectable agent can prepare with conventionally form, is prepared as liquor or suspension.

[00173] parenteral injection is used and is generally used for subcutaneous, intramuscular or intravenous injection and infusion.In addition, a kind of method that is used for parenteral administration is according to U.S. Patent No. 3,710, and 795 utilize the implantation of slowly-releasing or sustained release system, and it guarantees to keep the dosage of constant level, and this patent is hereby incorporated by.

[00174] in addition, can the part by carrier, inhalation in the suitable nose use and use preferred compound of the present invention with form in the nose, or use known to a person of ordinary skill in the art through the skin skin patch by using through the skin approach.Certainly, for to send the form of delivery system to use through skin, application dosage will be successive in dosage, rather than be interrupted.Other preferred topical formulations comprises frost, ointment, washing lotion, aerosol spray and gel, and wherein the concentration typical case of activeconstituents is 0.01%-15%w/w or w/v.

[00175] for solids composition, vehicle comprises N.F,USP MANNITOL, lactose, starch, Magnesium Stearate, soluble saccharin, talcum powder, Mierocrystalline cellulose, glucose, sucrose, magnesiumcarbonate of pharmaceutical grade etc.Active compound defined above also can adopt for example polyalkylene glycol, and for example propylene glycol is formulated as suppository as carrier.In some embodiments, advantageously from fats emulsion or suspension preparation suppository.

[00176] compound of the present invention also can send delivery system with liposome, uses as little individual layer bubble, big individual layer bubble and multilayer bubble form.Also can comprise that cholesterol, stearylamine or phosphatidylcholine form liposome from multiple phosphatide.In some embodiments, the film of lipid composition is carried out hydration, form the lipid layer of packaging medicine with the aqueous solution of medicine, as U.S. Patent No. 5,262, the description in 564.For example, fit molecule described herein can be provided as the mixture that the high-molecular weight compounds of the non-immunogenic that makes up with lipophilic compound or with methods known in the art forms.An example of the mixture of association nucleic acid is in U.S. Patent No. 6,011, provides in 020.

[00177] but also compound of the present invention can be coupled to soluble polymer as the fixed pharmaceutical carrier of target.Described polymkeric substance can comprise the polyethylene oxide polylysine that polyvinylpyrrolidone, pyran co-polymer, poly-hydroxypropyl-Methacrylamide-phenol, polyhydroxyethylaspanamidephenol or palmityl residue replace.In addition, compound of the present invention can be coupled to the biodegradable polymkeric substance that a class is used to realize medicine controlled releasing, for example, the crosslinked or amphiphilic block copolymer of poly(lactic acid), poly epsilon caprolactone lactone, polyhydroxybutyrate, poe, polyacetal, poly-dihydropyrane, polybutylcyanoacrylate and hydrogel.

[00178] if desired, the pharmaceutical composition that use also can contain the nontoxic auxiliary substance of minimum, and for example wetting agent or emulsifying agent, pH buffer reagent and other material are as sodium-acetate and triethanolamine oleate.

[00179] utilizes fit dosage to select, comprise patient's type, species, age, body weight, sex and medical condition according to multiple factor; The severity of the situation for the treatment of; Route of administration; Patients " renal function and liver function; With the specific fit and salt that adopts.General doctor or animal doctor can easily determine the significant quantity of prevention, antagonism or blackout conditions progress, and prescribe.

[00180] molecular weight that provides in the following dosage is only relevant with fit oligomer weight, do not comprise any by with put together the quality of giving such as peg moiety.When specifying effect to use, oral dosage of the present invention is oral about 0.05-7500mg/ day.Composition preferably with contain 0.5,1.0,2.5,5.0,10.0,15.0,25.0,50.0,100.0,250.0,500.0 and the tablet form of the band indentation of 1000.0mg activeconstituents provide.Infusion dosage, intranasal dose and transdermal dosage will be 0.05-7500mg/ days.Through skin, intravenously and intraperitoneal dosage will be 0.05-12,000mg/ day.

[00181] the effective plasma level level of The compounds of this invention is 0.002mg/mL-50mg/mL.

[00182] compound of the present invention can be used with single agent every day, maybe can with whole per daily doses with every day 2,3 or 4 times separate doses use.

Regulate the pharmacokinetics and the bio distribution of aptamer therapeutics agent

[00183] importantly regulates all therapeutical agents, comprise fit pharmacokinetics feature, thereby mate need medicinal based on oligonucleotide.Although at the cell external target fit without undergoing with cell in send and pass (as situation) relevant difficulty based on the therapeutical agent of antisense molecule and RNAi, but describedly fitly still target organ and tissue must can be distributed in, and (unmodified) keeps consistent time period of dosage regimen with needs in vivo.

[00184] therefore, the invention provides the pharmacokinetics of the fit composition of influence, particularly regulate the material and the method for fit pharmacokinetics.Of the present invention have than the long half-lift (t _1/2) zymoplasm can be used for the treatment of various disease conditions in conjunction with fit-PEG conjugate, for example heparin-induced thrombocytopenia (HIT), acute coronary syndrome (ACS) and venous thrombosis (DVT).These fit conjugates show than the long half-lift t _1/2Influence for example reduces producing the necessary dosage of effect that needs.Have than the long half-lift fit conjugate also can be used for chronic disease.Of the present invention have than the long half-lift (t _1/2) fit, comprise the fit of fit conjugate of the present invention and/or stabilization, also can be used as the antithrombotics in blood collection, blood circulation or the blood storing unit, wherein this device comprises the fit mixture of the fit or of the present invention antithrombin of antithrombin of the present invention of significant quantity.The example of described device includes but not limited to blood taking bag, heparin tube and blood sampling syringe.In a kind of particular, in blood storing unit such as blood bag, use the of the present invention fit of significant quantity, wherein blood stores a couple of days, preferred about 2 weeks down at about 4 ℃.

[00185] by modifying part (as the PEG polymkeric substance) and fit puting together, and/or mix modification Nucleotide (as 2 '-fluorine or 2 '-the O-methyl) change the chemical constitution of nucleic acid, realize the controllability (i.e. the ability that reduces or suppress) of fit pharmacokinetics.The ability of regulating fit pharmacokinetics is used to improve the treatment application of existence, or is used to develop new treatment application.For example, in some treatments are used, for example under the antitumor or acute nursing situation that may need rapid medicine removing or upgrade, need to reduce fit retention time in circulation.Perhaps, in other treatment is used, for example need therapeutical agent systemic circulation keep treatment, may need to increase fit retention time in circulation.

[00186] in addition, the controllability of fit pharmacokinetics is used for changing the bio distribution of aptamer therapeutics agent the experimenter.For example, in some treatments are used, may in a kind of effort, change the bio distribution of aptamer therapeutics agent, so that target is decided the tissue or the certain organs (or organ group) of particular type.In these were used, the aptamer therapeutics agent preferentially accumulated in particular organization or organ.In other treatment is used, may need target to show the cell marking relevant or the tissue of symptom surely with specified disease, cell injury or other unusual pathology, make the aptamer therapeutics agent preferentially in affected tissue, accumulate.For example, the name of submitting on March 5th, 2004 is called the U.S. Provisional Application series No.60/550790 of " pharmacokinetics of aptamer therapeutics agent and chorologic controlled adjustment " and the name submitted on March 7th, 2005 is called the U.S. non-provisional application series No.11/075 of " pharmacokinetics of aptamer therapeutics agent and chorologic controlled adjustment ", describe in 648, Pegylation (for example using 20kDa PEG polymkeric substance Pegylation) target with the aptamer therapeutics agent has the tissue of inflammation surely, makes the aptamer therapeutics agent of Pegylation preferentially accumulate in the tissue of inflammation is arranged.

[00187] in order to determine the pharmacokinetics and the bio distribution collection of illustrative plates of aptamer therapeutics agent (as fit conjugate or have chemistry fit of change, as the Nucleotide modified fit), many parameters have been monitored.Described parameter comprises for example transformation period (t of fit composition _1/2), plasma clearance (Cl), volume of distribution (Vss), area under the concentration-time curve (AUC), maximum serum or plasma concentration (Cmax) and the average retention time (MRT) of observing.As use herein, term ＂ AUC ＂ represents the fit area under curve of using the plasma concentration of back aptamer therapeutics agent to the time mapping.The AUC value is used for assessing the bioavailability (being the per-cent of the aptamer therapeutics agent that circulation is used after fit the using) and/or the total body clearance (Cl) (being the speed that the aptamer therapeutics agent is removed from circulation) of given aptamer therapeutics agent.Volume of distribution is associated the fit amount that exists in the plasma concentration of aptamer therapeutics agent and the body.Vss is big more, outer fit many more (promptly the overflowing) that exist of blood plasma more.

[00188] the invention provides by puting together in regulating part fit, as small molecules, peptide or polymer end groups, or regulate pharmacokinetics and chorologic material and method in the body of fit composition of stabilization in a controlled manner by the Nucleotide that in fit, mixes modification.As described herein, put together the modification part and/or change the Nucleotide chemistry and form, changed the basic sides of fit retention time in circulating and the distribution in tissue.

[00189] except removing by nuclease, the oligonucleotide treatment agent is filtered by kidney and is removed.Therefore, the nuclease resistance oligonucleotide typical earth surface that intravenously is used reveals＜transformation period of 10min, unless can block filtration.This can be distributed to the tissue from leaving blood flow fast by promoting, or is increased to greater than the effective big or small cutoff value of renal glomerulus by the apparent molecular weight that makes Nucleotide and realizes.The puting together (Pegylation) and can significantly increase fit retention time in circulation of little therapeutical agent described below and PEG polymkeric substance, thus reduce administration frequency and strengthen validity the blood vessel target.

[00190] fit can puting together in multiple modification part, high-molecular weight polymer for example is as PEG; Peptide is as Tat (proteic 13 the amino acid whose fragments of HIV Tat (Vives, et al. (1997), J.Biol.Chem.272 (25): 16010-7)); Ant (derives from 16 the amino acid whose sequences (Pietersz, et al. (2001), Vaccine 19 (11-12): 1397-405)) and the Arg of the 3rd spiral of fruit bat feeler foot (antennapedia) homeoprotein ₇(comprise poly arginine (Arg ₇) peptide (Rothbard, et al. (2000), the Nat.Med.6 (11): 1253-7 of penetration cell weak point, positively charged; Rothbard, J et al. (2002), J.Med.Chem.45 (17): 3612-8)); And small molecules, as lipophilic compound, as cholesterol.In multiple conjugates described herein,, the most significantly changed fit body internal characteristic by compound with the PEG group.For example, aptamer therapeutics agent and the compound of 20kDa PEG polymkeric substance that blended 2 ' F and 2 '-OMe modifies have hindered the kidney filtration, and promote the fit tissue healthy and that inflammation is arranged that is distributed to.In addition, 20kDa PEG polymkeric substance-fit conjugate proof is preventing that fit kidney is effective equally with 40kDa PEG polymkeric substance in filtering.Although a kind of effect of Pegylation is at fit removing, the system that the existence by 20kDa part provides exposes and prolongs, and also promotes the fit tissue that is distributed to, the particularly tissue of highly dabbling organ and is positioned at the tissue in inflammation site.Fit-20kDa PEG polymer conjugate instructs the fit inflammation site that is distributed to, and makes that Pegylation is fit preferentially to accumulate in the tissue of inflammation is arranged.In some cases, the fit conjugate of 20kDa Pegylation can be assessed cell, for example nephrocyte inside.

[00191] also can regulate fit plasma clearance with the Nucleotide of modifying.For example, mix 2 '-unconjugated fit the comparing of the stable chemistry of F and 2 '-OMe with the fit of unmodified, show rapid forfeiture (being rapid plasma clearance) and be distributed to the tissue rapidly from blood plasma, mainly be distributed in the kidney, described unconjugated fit be present fit characteristic feature because it shows height nuclease stability in vitro and in vivo.

PEG deutero-nucleic acid

[00192] description is as mentioned derived to nucleic acid with high molecular non-immunogenic polymkeric substance, has the pharmacokinetics of change nucleic acid and the potential of pharmacokinetic property, makes nucleic acid become more effective therapeutical agent.Active favourable change can comprise that the resistance to nuclease degradation increases, passes through the filtration minimizing of kidney, immune exposure is reduced and change therapeutical agent distribution in vivo.

[00193] fit composition of the present invention can be derived with polyalkylene glycol (＂ PAG ＂) part.PAG deutero-nucleic acid is described in the U.S. Patent application series No.10/718 that submitted on November 21st, 2003, and 833, it is incorporated herein by reference in full at this.Be used for typical polymers of the present invention and comprise polyoxyethylene glycol (＂ PEG ＂), be also referred to as polyethylene oxide (＂ PEO ＂) and polypropylene glycol (comprising poly-Isopropanediol).In addition, the random or segmented copolymer of different oxiranes (as oxyethane and propylene oxide) can be used for a lot of the application.In its most common form, polyalkylene glycol as PEG, is with hydroxyl terminated linear polymer: HO-CH at each end ₂CH ₂O-(CH ₂CH ₂O) n-CH ₂CH ₂-OH.This polymkeric substance, α, the alpha, omega-dihydroxy polyoxyethylene glycol also can be expressed as HO-PEG-OH, wherein-the following structural unit of PEG-symbology :-CH ₂CH ₂O-(CH ₂CH ₂O) n-CH ₂CH ₂-, wherein the typical scope of n is about 4-about 10000.

[00194] as directed, the PEG molecule is bifunctional, and is called " PEG glycol " sometimes.The terminal portions of PEG molecule is the hydroxylic moiety of relative anergy, promptly-the OH group, it can activate or be converted into funtion part, is used for PEG is connected in other compound of the reaction site that is positioned on the compound.Described activatory PEG glycol is referred to herein as two activatory PEG.For example, the terminal portions official with the PEG glycol can turn to the active carbonic acid ester, be used for by use succinyl-active ester from N-hydroxy-succinamide partly replace relative anergy hydroxylic moiety-OH and with amino part selective reaction.

[00195] in a lot of the application, need add cap for an end of PEG molecule with the part of basic anergy, make that the PEG molecule is unifunctional (or single activatory).Under the situation of the protein for treatment agent of a plurality of reaction site of displaying activatory PEGs usually, difunctional activatory PEGs causes extensively cross-linked, produces the not good aggregation of function.In order to prepare single activatory PEGs, typically use anergy methoxyl group terminal portions-OCH ₃Replace the hydroxylic moiety on the PEG glycol molecules end.The cap end that do not add of PEG molecule typically is converted into the reactive terminal part, and it can activate, and is used to connect the reaction site on upward surperficial or all glairy molecules.

[00196] PAGs is typically in water, and has dissolving properties in a lot of organic solvents, lacks toxicity, and lacks immunogenic polymkeric substance.A kind of purposes of PAGs is that polymkeric substance is covalently attached to insoluble molecule, makes the PAG-molecule " conjugate " that obtains solvable.For example, shown that water soluble becomes when water-fast drug taxol and PEG coupling.Greenwald，et al，J.Org.Chem.，60：331-336(1995)。The PAG conjugate not only increases solvability and stability usually, also can prolong the blood circulation transformation period of molecule.

[00197] poly-alkylated compound size typical case of the present invention is 5-80kDa, but can use any size, and its selection depends on fit and uses.The size of other PAG compound of the present invention is 10-80kDa.Other other PAG compound sizes of the present invention are 10-60kDa.For example, the size of PAG polymkeric substance can be at least 10,20,30,40,50,60 or 80kDa.Described polymkeric substance can linearity or ramose.In some embodiments, polymkeric substance is PEG.In some embodiments, polymkeric substance is the PEG of branch.In other embodiments, polymkeric substance is the PEG of 40kDa branch that describes among Fig. 2.In some embodiments, the PEG of 40kDa branch is connected in 5 ' the fit end that Fig. 3 describes.

[00198] opposite with biological expressed proteins therapeutical agent, the exonuclease treatment agent is typically synthetic from activatory monomer Nucleotide chemistry.Can prepare PEG-nucleic acid conjugate by with the synthetic PEG that mixes of identical repeated monomer.For example, by being converted into the phosphoramidite form activatory PEGs can to mix the solid phase oligonucleotide synthetic.Perhaps, oligonucleotide is synthetic can mix competition with the fixed point of reactive PEG connection site.The most common ground, this is by realizing (mixing with the modifier phosphoramidite in last coupling step at solid phase synthesis) at the 5 '-terminal primary amine that dissociates that adds.Adopt this method, reactive PEG (as activatory PEG, its will with amine reaction and with its formation key) with the oligonucleotide combination of purifying, and in solution, carry out linked reaction.

[00199] the PEG chorologic ability of puting together to change therapeutical agent is relevant with many factors, comprises the apparent size (as according to the hydrodynamic radius measurement) of conjugate.Known bigger conjugate (〉 10kDa) filtration of kidney is passed through in more effective blocking-up, and increases the serum half-life of little macromole (as peptide, antisense oligonucleotide) subsequently.Proved that the PEG conjugate blocks filtering ability and be increased to about 50kDa along with the PEG size and increase (further increase and have minimum beneficial effect, because the transformation period is subjected to the qualification that macrophage-mediated metabolism rather than kidney are removed).

[00200] production high molecular weight PEGs s (〉 10kDa) may be difficult, invalid and costliness.As the approach of synthetic macromolecule amount PEG-nucleic acid conjugate, former work concentrates on the generation of high molecular activated PEG s.A kind of molecule for preparing described molecule relates to formation ramose activated PEG, and wherein two or more PEGs are connected in the center of carrying activating group.The terminal portions of these high molecular weight PEGs molecules, (OH) part can activate promptly relevant anergy hydroxyl, or is converted into funtion part, and other compound that is used on the reaction site of one or more PEGs and compound is connected.Ramose activated PEG s has 2 ends of surpassing, and under two or more terminal situations of activation, described activatory high molecular weight PEGs molecule is called many activatory PEGs in this article.In some cases, be not that all ends of the PEG of branch molecule all activate.When any two ends of the PEG of branch molecule activated, described PEG molecule was called two activatory PEGs.Under only terminal activatory situation of the PEG of branch molecule, described PEG molecule is called single activatory.As an example of this method, described by two mono methoxy PEGs are connected in and be activated the activated PEG (Harris et al, Nature, vol.2:214-221,2003) that the Methionin core that is used to react prepares subsequently.

[00201] the invention provides the synthetic another kind of economic method that comprises high molecular weight PEGs-nucleic acid (preferably fit) conjugate of poly ethylene glycol nucleic acid.The present invention also comprises the poly oligonucleotide that PEG connects, and for example, dimerization is fit.The present invention also relates to the high molecular composition, wherein the PEG steady component is the joint that separates fit different piece, and for example, PEG puts together in single fit sequence, make that the linear array of the fit composition of high molecular is nucleic acid-PEG-nucleic acid (PEG-nucleic acid) n for example, wherein n is more than or equal to 1.

[00202] high molecular composition of the present invention comprises that molecular weight is those of 10kDa at least.The big or small typical case of composition is that molecular weight is 10-80kDa.The size of high molecular composition of the present invention is at least 10,20,30,40,50,60 or 80kDa.

[00203] steady component is a kind of molecule, or the part of molecule, and it improves the pharmacokinetics and the pharmacokinetic properties of the fit composition of high molecular of the present invention.In some cases, steady component is the part of a kind of molecule or molecule, and it makes two or more fit or fit structural domains contiguous, or the overall rotary freedom of the fit composition of high molecular of the present invention is reduced.Steady component can be a polyalkylene glycol, and as polyoxyethylene glycol, it can be linearity or ramose homopolymer or heteropolymer.Other steady component comprises the polymkeric substance such as peptide nucleic acid(PNA) (PNA).Oligonucleotide also can be a steady component; Described oligonucleotide can comprise the Nucleotide of modification and/or the key of modification, as thiophosphatephosphorothioate.Steady component can be the integral part of fit composition, that is, and and it and fit covalent bonding.

[00204] composition of the present invention comprises the fit composition of high molecular, and wherein two or more nucleic acid moieties and at least one polyalkylene glycol moiety covalency are puted together.Polyalkylene glycol moiety is as steady component.In fit arbitrary terminal covalent attachment, polyalkylene glycol is connected nucleic acid moiety together in the composition in the molecule in polyalkylene glycol moiety, thinks that polyalkylene glycol is the connection portion.In described composition, the primary structure of covalent molecule comprises linear array: nucleic acid-PAG-nucleic acid.An example is to have primary structure: the composition of nucleic acid-PEG-nucleic acid.Another example is following linear array: nucleic acid-PEG-nucleic acid-PEG-nucleic acid.

[00205] in order to prepare nucleic acid-PEG-nucleic acid conjugate, initial nucleic acid makes it carry single reaction site (for example, it is single activatory).In a kind of preferred embodiment, this reaction site is by add the modifier phosphoramidite in last step of the solid phase synthesis of oligonucleotide, at the 5 '-terminal amino of introducing.After the oligonucleotide of modifying removed protection and purifying, in the minimum solution of the spontaneous hydrolysis that makes activatory PEG, rebuild with high density.In a kind of preferred embodiment, the concentration of oligonucleotide is 1mM, and the solution of rebuilding contains 200mMNaHCO ₃Damping fluid, pH8.3.By slowly, progressively adding highly purified bifunctional PEG, initial conjugate synthetic.In a kind of preferred embodiment, by deriving, at two terminal activated PEG glycol (two activatory) with the succinimido propionic ester.After the reaction, by gel electrophoresis or liquid chromatography purifying PEG-nucleic acid conjugate, with separate fully, part and unconjugated kind.Can connect a plurality of spissated PAG molecules (for example as random or segmented copolymer) or littler PAG chain, to reach all lengths (or molecular weight).Can between the PAG of all lengths chain, use non-PAG joint.

[00206] 2 '-O-methyl, 2 '-nucleotide modification of fluorine and other modification makes fit stable nuclease-resistant, and increases the transformation period in its body.3 '-3 '-the dT cap also increases the exonuclease resistance.Referring to for example United States Patent (USP) 5,674,685; 5,668,264; 6,207,816 and 6,229,002, be incorporated herein every piece of described patent as a reference.

The PAG of reactive nucleic acid derives

[00207] can be by single functional activation PEG and the reaction that contains the nucleic acid of an above reaction site, preparation high molecular PAG-nucleic acid-PAG conjugate.In one embodiment, nucleic acid is double reactive, or two activatory, and contains two reaction site: synthetic by conventional phosphoramidite, and 3 '-5 '-two polyoxyethylene glycolization of Fig. 4 explanation and introduce 5 ' in the oligonucleotide-amino and 3 '-amino for example.In an alternative embodiment, can adopt for example 5-position, the 8-position of purine or 2 '-a site of ribose of pyrimidine, reaction site is introduced interior location as the connection primary amine.In described embodiment, nucleic acid can have some activatory or reactive site, and thinks many activatory.Behind the synthetic and purifying,, make simultaneously under the condition of spontaneous hydrolysis minimum the oligonucleotide of modification and single activatory PEG are made up in the selective reaction that promotes with the oligonucleotide reaction site.In preferred embodiments, with succinimido propionic ester activation mono methoxy-PEG, and carry out link coupled at pH8.3 and react.In order to drive the synthetic of disubstituted PEG, provide the PEG excessive with respect to the oligonucleotide stoichiometry.After the reaction, by gel electrophoresis or liquid chromatography purifying PEG-nucleic acid conjugate, with separate fully, part and unconjugated kind.

[00208] the syndeton territory also can have one or more connected polyalkylene glycol moiety.Described PAGs can be an all lengths, and can be with suitable being used in combination, with the molecular weight of the needs that reach composition.

[00209] can be by the effect of chemical constitution and effect length given joint.Oversize, too short or and the zymoplasm joint that forms the form of disadvantageous space and/or ionic interaction will block the formation of mixture between fit and the zymoplasm.Be longer than to stride between the nucleic acid and may reduce combination stability by the effective concentration that makes part apart from required joint.Therefore, must optimize joint usually and form and length, thereby make fit and avidity maximum target.

[00210] is incorporated herein all open source literatures quoted and patent document herein as a reference, as pointing out that especially and separately every piece of described open source literature and patent document are hereby incorporated by.It is prior art that the quoting of open source literature and patent document is not intended to admit any one piece in them, does not admit that also its constitutes the interior perhaps date of prior art.Described the present invention, it will be appreciated by those of skill in the art that and can implement the present invention with multiple embodiments by written explanation, above stated specification and hereinafter embodiment only illustrate and unrestricted claim.

Embodiment

Embodiment 1: fit selection and sequence

[00211] the overall purpose of this program is to find by reducing or anticoagulant enzymic activity and fit as potential antithrombotics.Particularly, the fit antithrombotics of potential will combine outer site (exosite) 1 combination with the Fibrinogen of zymoplasm, combine this enzyme with substrate (Fibrinogen) competition thus.

[00212] in order to keep the fit relevant pharmacokinetic property that dissociates rapidly of DNA with the bind thrombin of identifying in the past, carries out fit selection with single DNA composition with following sequence 5GGTTGGTGTGGTTGG3 ' (SEQ ID NO 4) (ARC 183).Use the nitrocellulose filter capture complexes, follow the heparin that adds 10-100 times of molar excess, effectively block, thereby realize the discovery of the outer site of high-affinity 1 wedding agent from the outer site 2 of the non-neutral of fit set.In addition, other strategy that enters our SELEX scheme comprises: catch and abandon the fit mixture of thrombogen being designed for to remove in the former fit initial step of bind thrombin, and the mixture of thrombogen and r-hirudin/zymoplasm mixture is contacted with fit set, catch and abandon thrombogen/fit and zymoplasm/r-hirudin/fit mixture then.Introduce zymoplasm/r-hirudin mixture and be intended to effectively present outer site 2, be used for competing when invalid, from the set of unwanted non-inhibity wedding agent, catch and remove when independent heparin.Finally, these selection strategies have caused producing and a series of zymoplasm have been had the fit of high-affinity, described fit the minimizing in vitro and in vivo or the activity of Trombin inhibiting.

Embodiment 1A: the blood coagulation enzyme dna is selected #1

[00213] carries out selection, adopt fit in conjunction with human thrombin of the Nucleotide set evaluation formed by deoxynucleotide (DNA), obtain that human thrombin is had the fit of high-affinity based on the nitrocellulose Filter column.

The set preparation

[00214] uses ABI EXPEDITE ^TMDna synthesizer is synthetic have sequence 5 '-dna profiling of GATCGATCCTCAGCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GGGATTTAGCTTCCTCTTACACGC-3 ' (ARC1488, SEQ ID NO 5).A series of N in the dna profiling can be any Nucleotide combinations, and produce the fit unique sequences district that obtains.Under standard conditions with primer 5 '-GATCGATCCTCAGCCAC-3 ' (ARC1489, SEQ ID NO 6) and 5 '-TATACGACTCAGCGTGTAAGAGGAAGCTAArA-3 ' (ARC 1490, SEQ IDNO 7) carries out pcr amplification to template.After the amplification, with ethanol sedimentation PCR product, (333mM NaOH, 15min), subsequently with the HCL neutralization, and adds methane amide sample loading buffer, purifying then by 90 ℃ to carry out basic hydrolysis then.Disengaging latch on 10% denaturing polyacrylamide gel, from the single stranded DNA set of gel excision with the higher motion migration, passive wash-out is used isopropanol precipitating.The sequence of sets that obtains is the reverse complemental fragment of the cutting of ARC1488, and length is 50nt, has following sequence:

5′-TCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGCTGAGGATCGATC-3′(ARC1538，SEQ ID NO 8)。

Select

[00215] carries out 12 taking turns selection altogether at zymoplasm.Take turns the 1st, preparation is by 3mL 1XDPBS (w/Ca ²⁺And Mg ²⁺) (Gibco, catalog number (Cat.No.) 14040, Invitrogen, Carlsbad, CA), 2 * 10 ¹⁴ARC1538 DNA set and 900 picomole zymoplasms (300nM final concentration) (Enzyme Research Labs, South Bend, IN) association reaction of Zu Chenging of individual molecule.Under the room temperature with association reaction incubation 2 hours.In the incubation process, preparation Centrex nitrocellulose Filter column (Schleicher ﹠amp; Schuell, Keene NH) is used for selecting.With 1mL 0.5M KOH each post was handled 15 minutes.After the processing,, use 1mL ddH by the centrifugal KOH (2000rpm, 1 minute) that removes ₂O was with pillar extra process 15 minutes.Then by the centrifugal ddH that removes ₂O (2000rpm, 1 minute).The association reaction thing that brings Selection In in the Filter column of preparation is by centrifugal rotation (2000rpm, 1 minute).Use 1 * DPBS (w/Ca then ²⁺And Mg ²⁺) (Gibco, catalog number (Cat.No.) 14040, Invitrogen, Carlsbad, CA) washing pillar.After the washing,,, and be collected in the 1.5mLEppendorf pipe then by centrifugal rotation (2000rpm, 1 minute) with being heated to 90 ℃ 1mL elution buffer (7M urea, 300mM NaOAc, 5mM EDTA) in advance with pillar wash-out 3 minutes.Virahol and 1 μ l glycogen with 1 volume precipitates elutriant then.

[00216] selection of all subsequent rounds after taking turns for the 1st is introduced negative selection post, so that remove non-specific filter membrane wedding agent from set before the positive is selected.According to the negative post of selecting of summary preparation above.Make the 200 μ l 1X DPBS (w/Ca that take turns selection from front one ²⁺And Mg ²⁺) (Gibco, catalog number (Cat.No.) 14040, Invitrogen, Carlsbad CA) selects post with the mixture of 60 picomole set by feminine gender, and collection, carries out previously described association reaction step then.In subsequent rounds, also add competitor tRNA,, and in trailing wheel, heparin is added positive the selection in the step with the increase selective pressure, with the outer site 2 of combination, and the outer site 2 that prevents fit bind thrombin.The selection condition that adopts is summarized in following table 1.

[00217] amplification of ARC1538 DNA set need be in 5 '-terminal phosphorylated, then the constant region specificity is connected in 5 ' of sequence-end 3 '-primer of ARC1488 synthetic DNA sequence (promptly be used to increase initial), carries out the standard pcr amplification then.Therefore, at post precipitation, selected set is resuspended in 9 μ l ddH ₂Among the O, in reaction, add 10 μ l 2X kinases consistency damping fluid (8ul 1M DTT+1mL 2X quick ligase enzyme damping fluid (New EnglandBiolabs, Beverly, MA)) 1 μ l T4 PNK (New England Biolabs, Beverly, MA), 37 ℃ of following incubations 20 minutes.Behind the incubation, 100 picomole, 3 ' primer 5 '-TATACGACTCAGCGTGTAAGAGGAAGCTAArA-3 ' (ARC1490) (SEQID NO 7) and 100 picomole 3 ' be connected primer 5 '-GGGATTTAGCTTCC[3T] add 1 μ l T4 ligase enzyme (New EnglandBiolabs among-3 ' (ARC1491) (the SEQ ID NO 192), Beverly, MA), and at room temperature incubation is 10 minutes.Make reactant contain 5 ' primer 5 '-GATCGATCCTCAGCCAC-3 ' (ARC1489) and in the PCR mixture of 3 ' primer (ARC 1490) reaches 200 μ l.With following condition cycle P CR reaction: 94 ℃ of following sex change 1 minute, carry out 94 ℃ following 30 seconds, 54 ℃ of following 30 seconds and 72 ℃ of following circulations of 1 minute.Cycle P CR is about 10ng/ μ l up to end product, this be with 4% E-Gel (Invitrogen, Carlsbad, CA) assessment (below table 1 rightmost one row in be called " PCR threshold value ").Then product is planted in the bigger PCR reaction, be used for further DNA cloning (20 μ l add the total PCR volume of 400 μ l).

[00218] after the amplification, with ethanol sedimentation PCR product, (333mMNaOH, 15min), subsequently with the HCL neutralization, and adds methane amide sample loading buffer, purifying on 10% PAGE gel then by 90 ℃ to carry out basic hydrolysis then.The product of passive wash-out purifying, precipitation quantitatively, enters next round then and selects.

[00219] selecting is to carry out as single selection, takes turns up to the 7th, wherein selects to be divided into two branches (referring to table 1).A branch of selecting continues to increase severity, and this measures by reducing the zymoplasm protein concentration.

Table 1: the DNA that carries out at human thrombin selects the SELEX condition of #1

The monitoring chosen process

[00220] in selection, carries out dot blotting in conjunction with mensuration, so that the protein binding avidity of monitoring set.With trace ³²The combination of the RNA of P mark and the serial dilutions of human thrombin (1nM-1000nM), and be 1 * DPBS (w/Ca of 30 μ l in final volume under the room temperature ²⁺And Mg ²⁺) (Gibco catalog number (Cat.No.) 14040, Invitrogen, Carlsbad, CA)+0.1mg/ml BSA in incubation 30 minutes.Adopt Minifold I dot blotting, 96-hole vacuum filtration manifold (Schleicher ﹠amp; Schuell, Keene, NH), by nitrocellulose filter analysis association reaction.Adopted by Protran nitrocellulose (Schleicher ﹠amp; Schuell, Keene, NH), Hybond-P nylon (Amersham Biosciences, Piscataway, NJ) and GB002 gel trace paper (Schleicher﹠amp; Scluiell, Keene, NH) the three layer filtration medium of Zu Chenging.Be captured on the nitrocellulose filter with protein bound RNA, and not protein-bonded RNA is captured on the nylon leaching film.The introducing of gel trace paper only is the supporting dielectric as other filter membrane.After the filtration, separate filter membranous layer, drying, and at phosphor screen (Amersham Biosciences, Piscataway, NJ) last exposure, usefulness Storm 860

The trace imaging system (Amersham BioSciences, Piscataway, NJ) quantitative.When observe human thrombin exist down with the condition that lacks zymoplasm under the significantly positive ratio of RNA bonded, then according to the specification sheets of manufacturers, (CA) pair set is cloned for Invitrogen, Carlsbad to clone test kit with TOPO TA.

The 9th and 12 take turns clone and order-checking

[00221] based on the combination of set, selects the 9th to take turns the set of taking turns with the 12nd, be used for clone and order-checking.In order to screen, to merge from two and select ramose the 9th to take turns and the 12nd take turns set by sequence family.With 25 micromolar synthetic scales, synthetic all unique DNA cloned sequences.Prothrombin time (PT mensuration) screening with hereinafter embodiment 3A description reduces or the active ability of Trombin inhibiting from the 9th clone who takes turns.The PT measurement result is reported in the hereinafter table 17 of embodiment 3.Demonstrating the 12nd takes turns set and does not have and cause the new unique sequences proceeded.

[00222] takes turns the sequence of gathering the clone who obtains from the 9th of merging and list in hereinafter table 2.Each clone's district at random is behind sequence 5 ' TCCC, in the preceding termination of GTGGCTGAGGATCGTATC3 ' (SEQ ID NO 42).But, because 5 '-the TCCC sequence is not the part of PCR primer, can observe some sudden changes in SELEX and order-checking process.Therefore, can observe point mutation in this zone hereinafter in the sequence.Unless otherwise noted, each sequence of hereinafter listing is with 5 ' to 3 ' direction indication, and at DNA SELEX ^TMSelect under the condition, wherein all Nucleotide all are deoxynucleotides.

Table 2: from the 9th clone who takes turns DNA SELEX #1 who carries out at human thrombin

AMX(453)_A6(SEQ ID NO 9)

TCCCATCGATCTGGGGTAATTTACTGGGTCGGGTGGCTGAGGATCGATC

AMX(453)_A9(SEQ ID NO 10)

ATCCCAATGTTGAGACGAGTAGGTGTGGGTAGGGTGGCTGAGGATCGATC

AMX(453)_B6(SEQ ID NO 11)

TCCCATCGAGCTCAGTCTAGGATGGGTAGGGTGGTGGCTGAGGATCGATC

AMX(453)_B8(SEQ ID NO 12)

TCCCATCGAGCCGGGGTATGATTATGGGTGGGGTGGCTGAGGATCGATC

AMX(453)_B10(SEQ ID NO 13)

TCCCATCGATCTGGGGTAGTTTTATTGGGTCGGGTGGCTGAGGATCGATC

AMX(453)_B12(SEQ ID NO 14)

TCCCGATCGGTCTGGGGTGTGTTCATGGTTTGGGTGGCTGAGGATCGATC

AMX(453)_C10(SEQ ID NO 15)

TCCTGATTGATCTGAGGGGTATTGTTGGCGTGGGTGGCTGAGGATCGATC

AMX(453)_D12(SEQ ID NO 16)

TCCCGATTGATCTGAGGGGTATTGTTGGCGTGGGTGGCTGAGGATCGATC

AMX(453)_E4(SEQ ID NO 17)

TCCCGTAATCGAGTCTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC

AMX(453)_E8(SEQ ID NO 18)

TCCTATGATCGAATGACTAAGGGGTGGGGTGGGTGGCTGAGGATCGATC

AMX(453)_E10(SEQ ID NO 19)

TCCCGGGTCGTATCCGTTTGTGGGTGGTCTGGGTGGCTGAGGATCGATC

AMX(453)_E12(SEQ ID NO 20

TCCCGTAATTGAGCCTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC

AMX(453)_F6(SEQ ID NO 21)

TCCTGATCGGATGTGGTGGGTTATTGGTTTGGGTGGCTGAGGATCGATC

AMX(453)_F7(SEQ ID NO 22)

TCCCGAGCGATACTGTCTAGGTTGGGTAGGGTGGTGGCTGAGGATCGATC

AMX(453)_F11(SEQ ID NO 23)

TCCCGAGCGATATTGTCTAGGTTGGGTAGGGTGGTGGCTGAGGATCGATC

AMX(453)_G5(SEQ ID NO 24)

TCCCATGATCGTTAGATTCAGGGATGGTGTGGGTGGCTGAGGATCGATC

AMX(453)_G11(SEQ ID NO 25)

TCCCGTATCGAGCTTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC

AMX(453)_H11(SEQ ID NO 26)

TCCCTTTTGACCTGCAAGAACGGTTGGTGTGGGTGGCTGAGGATCGATC

AMX(454)_B7(SEQ ID NO 27)

TCCCGGATCGTTTTGCTTCAAAGGTTGGGTTGGGTGGCTGAGGATCGATC

AMX(454)_B9(SEQ ID NO 28)

CCCGACTGATTCTTACCTTAGGGATGGTGTGGGTGGCTGAGGATCGATC

AMX(454)_B12(SEQ ID NO 29)

TCCCTGGTTTCGATCTGTTTTGGTTGGTCTGGGTGGCTGAGGATCGATC

AMX(454)_D5(SEQ ID NO 30)

TCCCATCGATTCGGGGTTTTTTAGTGGTATGGGTGGCTGAGGATCGATC

AMX(454)_D6(SEQ ID NO 31)

TCCCATCGATTTGGGGTAGTTCTATTGGGTTGGGTGGCTGAGGATCGATC

AMX(454)_D11(SEQ ID NO 32)

TCCCTGCTTGTCGATATTTTAGGGTTGGTGTGGGTGGCTGAGGATCGATC

AMX(454)_D12 SEQ ID NO 33)

TCCCTCGATCCGGGGTGTCTTTCGTGGGCTGGGTGGCTGAGGATCGATC

AMX(454)_F2(SEQ ID NO 34)

TCCCGAGCGATATTGCCTAGGTTGGGTAGGGTGGTGGCTGAGGATCGATC

AMX(454)_F7(SEQ ID NO 35)

TCCCTCGATCTAAGGTGTTTATTATGGTGTGGGTGGCTGAGGATCGATC

AMX(454)_F9(SEQ ID NO 36)

TCCCTGCATCGAGCCTCTATGGGATGGTTTGGGTGGCTGAGGATCGATC

AMX(454)_G2(SEQ ID NO 37)

TCCCGATCGTTCCGTGGGGTAGTGTTGGTTGGGGTGGCTGAGGATCGATC

AMX(454)_G6(SEQ ID NO 38)

TCCCTATGGATTCGGGGTACGTTAGTGGTCTGGGTGGCTGAGGATCGATC

AMX(454)_H3(SEQ ID NO 39)

TCCCATCGATCTGGGGTAGTTTTATTGGGTTGGGTGGCTGAGGATCGATC

AMX(454)_H6(SEQ ID NO 40)

TCCCTGTTGTTCCGGGGTGGTTTAATGGTTTGGGTGGCTGAGGATCGATC

AMX(454)_H7(SEQ ID NO 41)

TCCCATTAGGTCCGTATACTGGTGAGGTTGGGTGGCTGAGGATCGATC

Embodiment 1B:

[00223] carried out twice extra DNA and selected, be used for 1 based on the nitrocellulose Filter column) by mixing thrombogen, identify that with respect to thrombogen human thrombin is had the fit of high-affinity in negative SELEX step; 2), identify that deflection is fit in conjunction with the zymoplasm in outer site 2 by selecting to add zymoplasm/r-hirudin mixture in the step in feminine gender.Zymoplasm/r-hirudin mixture should effectively block the outer site 1 and the avtive spot of zymoplasm, makes it possible to catch and remove site 2 wedding agents outside the potential from set.In addition, as select 1, in wheel subsequently, select to add heparin in the step in the positive, with the outer site 2 of combination, and the outer site 2 that prevents fit bind thrombin.

Set preparation and selection

[00224] the description preparation according to embodiment 1A above is used for the new DNA set of selecting.(Enzyme Research Labs, South Bend IN) has carried out 9 taking turns selection altogether at human thrombin.In the 1st took turns, association reaction was by 3mL 1X DPBS (w/Ca ²⁺And Mg ²⁺) (Gibco, catalog number (Cat.No.) 14040, Invitrogen, Carlsbad, CA), 2 * 10 ¹⁴The ARC1538 DNA set and the 900 picomole zymoplasms (300nM final concentration) of individual molecule are formed.Under the room temperature with association reaction incubation 2 hours.In the incubation process, preparation Centrex Filter column (Schleicher ﹠amp; Schuell, Keene NH) is used for selecting.With 1mL 0.5M KOH each post was handled 15 minutes.After the processing,, use 1mL ddH by the centrifugal KOH (2000rpm, 1 minute) that removes ₂O was with pillar extra process 15 minutes.Then by the centrifugal ddH that removes ₂O.The association reaction thing that brings Selection In in the Centrex of preparation is by centrifugal rotation (2000rpm, 1 minute).Use 1 * DPBS (w/Ca then ²⁺And Mg ²⁺) (Gibco, catalog number (Cat.No.) 14040, Invitrogen, Carlsbad, CA) washing pillar and by centrifugal rotation (2000rpm, 1 minute).After the washing,,, and be collected in the 1.5mL Eppendorf pipe then by centrifugal 1 minute of 2000rpm with being heated to 90 ℃ 1mL elution buffer (7M urea, 300mM NaOAc, 5mM EDTA) in advance with pillar wash-out 3 minutes.Virahol and 1 μ l glycogen with 1 volume precipitates elutriant then.

[00225] selection of all subsequent rounds after taking turns for the 1st is introduced negative selection post, so that remove non-specific filter membrane wedding agent from set before the positive is selected.Prepare this post according to above summary.Make the 200 μ l DPBS (w/Ca that take turns selection from front one ²⁺And Mg ²⁺) (Gibco, catalog number (Cat.No.) 14040, Invitrogen, Carlsbad CA) selects post with the mixture of 60 picomole set by feminine gender, and collection, carries out association reaction then.In subsequent rounds, also add competitor tRNA,, and in trailing wheel, heparin is added positive the selection in the step with the increase selective pressure, with the outer site 2 of combination, and the outer site 2 that prevents fit bind thrombin.The selection condition that adopts is summarized in following table 3.According to description amplification and the selected set of purifying of embodiment 1A above to SELEX 1.

[00226] selecting is to carry out as single selection, takes turns up to the 3rd, wherein selects to be divided into two branches (referring to table 3).A branch (selecting 2) continues according to the description of front, wherein selects to use in the step 300nM human thrombin former in every feminine gender of taking turns.With feminine gender select in the step the 150nM thrombogen (Athens Research, Athens, GA) and 150nM zymoplasm and r-hirudin (CT) mixture is proceeded another branch (selecting 3) for American Diagnostica, Stamford.

Table 3: the blood coagulation enzyme dna is selected the selection condition of #2 and #3

The monitoring chosen process

[00227] in selection, carries out dot blotting in conjunction with mensuration, so that the protein binding avidity of monitoring set.With trace ³²The combination of the RNA of P mark and the serial dilutions of human thrombin (1nM-1000nM), and be 1 * DPBS (w/Ca of 30 μ l in final volume under the room temperature ²⁺And Mg ²⁺) (Gibco catalog number (Cat.No.) 14040, Invitrogen, Carlsbad, CA)+0.1mg/ml BSA in incubation 30 minutes.Adopt Minifold I dot blotting, 96-hole vacuum filtration manifold (Schleicher ﹠amp; Schuell, Keene, NH), by nitrocellulose filter analysis association reaction.Adopted by Protran nitrocellulose (Schleicher ﹠amp; Schuell, Keene, NH), Hybond-P nylon (Amersham Biosciences, Piscataway, NJ) and GB002 gel trace paper (Schleicher﹠amp; Scluiell, Keene, NH) the three layer filtration medium of (from top to bottom) composition.Be captured on the nitrocellulose filter with protein bound RNA, and not protein-bonded RNA is captured on the nylon leaching film.The introducing of gel trace paper only is the supporting dielectric as other filter membrane.After the filtration, separate filter membranous layer, drying, and at phosphor screen (Amersham Biosciences, Piscataway, NJ) last exposure, usefulness Storm 860

The trace imaging system (AmershamBiosciences, Piscataway, NJ) quantitative.

[00228] when observe human thrombin exist down with the condition that lacks zymoplasm under the significantly positive ratio of RNA bonded, then according to the specification sheets of manufacturers, (CA) pair set is cloned for Invitrogen, Carlsbad to clone test kit with TOPO TA.

DNA selects the 7th of #2 and #3 to take turns: order-checking and colony screening

[00229], cloned from the 7th of selection #2 and #3 and taken turns set, order-checking, and the ability of screening bind thrombin with sandwich filter membrane in conjunction with mensuration based on above-described set combination of in selection, monitoring.With 25 micromolar synthetic scales, by IDT synthetic DNA in order.From take turns the sequence of gathering 66 combinations that obtain from the 7th of two selections, select 20 unique sequences to be used for measuring in the dot blotting screening of 1 point.With _γ ^-32P ATP carries out 5 ' end mark to clone's transcript, and (NJ) rotation purifying is to remove excessive mark for Princeton Separations, Adelphia with the Centrisep post.With cumulative volume 30 μ l 1X DPBS (w/Ca ²⁺And Mg ²⁺) (Gibco, Catalog #14040, Invitrogen, Carlsbad, in CA)+/-clone of the mark of 10nM zymoplasm and 0.1mg/ml BSA incubation trace 30 minutes.Behind the incubation, association reaction adopts the dot blotting of describing among the embodiment 1A of front in conjunction with determinator.For definite clone's who selects kD, use _γ ^-32P ATP carries out 5 ' end mark to clone's transcript.Serial dilutions (according to the avidity of specific cloning to zymoplasm, scope is 1pM-1000nM) with human thrombin is measured k at dot blotting in measuring _DValue, and 1:1 RNA is described in substitution: and the formula of albumen composition, it is (fit in conjunction with ratio=amplitude * ([zymoplasm]/(K to obtain data _D+ [zymoplasm])) (KaleidaGraph v.3.51, Synergy Software, Reading, PA).

[00230] takes turns the sequence that obtains from the 7th and be listed in the table below 4.The corresponding of each clone tabulated in table 5 hereinafter in conjunction with feature.For listing in hereinafter each sequence of table 4, each clone's district at random begins behind sequence 5 ' TCCC, in the preceding termination of GTGGCTGAGGATCGTATC3 ' (SEQ ID NO 42).Unless otherwise noted, each sequence of hereinafter listing is with 5 ' to 3 ' direction indication, and at DNA SELEX ^TMSelect under the condition, wherein all Nucleotide all are deoxynucleotides.

Table 4: the sequence of selecting the 7th clone who takes turns of #2 and #3 available from the blood coagulation enzyme dna

AMX(395)_A1(SEQ ID NO 43)

TCCCTGCAATTCGATCAGCAGGGGTGGTGTGGGTGGCTGAGGATCGATC

AMX(395)_A4(SEQ ID NO 44)

TCCCGGGAGATCGCTTCGAAAATGGTTGGCGTGGGTGGCTGAGGATCGATC

AMX(395)_A5(SEQ ID NO 45)

TCCCACGCATCGATCCTATATGGGTGGCATGGGGTGGCTGAGGATCGATC

AMX(395)_A11(SEQ ID NO 46)

TCCCGTAATCGAGCCTGGTATTGTTGGCCTGGGTGGCTGAGGATCGATC

AMX(395)_B5(SEQ ID NO 47)

TCCCGCAATCGGTACTCAGGAGGATGGTTGGGGTGGCTGAGGATCGATC

AMX(395)_B7(SEQ ID NO 48)

TCCCGGGATCGAGTCCGATTAGGGATGGTGTGGGTGGCTGAGGATCGATC

AMX(395)_C1(SEQ ID NO 49)

TCCCGGGTGGTTATCTTCTCAGGGATGGTGTGGGTGGCTGAGGATCGATC

AMX(395)_C3(SEQ ID NO 50)

TCCCAAGCGATCTGTAAGGGATGGGGTTGCGGGTGGCTGAGGATCGATC

AMX(395)_D5(SEQ ID NO 51)

TCCCGAGTGTCATATCATCAGAGGTTGGAGTGGGTGGCTGAGGATCGATC

AMX(395)_D11(SEQ ID NO 52)

TCCCAAGATCGGTACATACAGTGGGTGGTGAGGGTGGCTGAGGATCGATC

AMX(395)_E2(SEQ ID NO 53)

TCCTATCATACGGGTCTTCTATTGGGTCGGGGTGGCTGAGGATCGATC

AMX(395)_E4(SEQ ID NO 54)

TCCCGACTTCGATTACTCAGGGGTGGCTGGGTGGCTGAGGATCGATC

AMX(395)_E7(SEQ ID NO 55)

TCCCGGTCGAGTCCTCACGAAGGGTTGGGAGGGTGGCTGAGGATCGATC

AMX(395)_E8(SEQ ID NO 56)

TCCCATGATCGTCAGATTCAGGGATGGTGTGGGTGGCTGAGGATCGATC

AMX(395)_E11(SEQ ID NO 57)

TCCCGGTCGTATTAGTGTGGGTGGTGTAGGGTGGTGGCTGAGGATCGATC

AMX(395)_F3(SEQ ID NO 58)

TCCCATAGTATCGAGCCGATTGGATGGTCTGGGTGGCTGAGGATCGATC

AMX(395)_G2(SEQ ID NO 59)

TCCCACGGTCCTCACCTAGGATGGTTAGGGTGGTGGCTGAGGATCGATC

AMX(395)_G11(SEQ ID NO 60)

TCCCAGAGCGGAAATCCTCAGGGGTGGGTGGGTGGCTGAGGATCGATC

AMX(39)_H9(SEQ ID NO 61)

TCCCGGTAGCGATCCAGAGAGGGATGGGGTGGTGGCTGAGGATCGATC

AMX(395)_H10(SEQ ID NO 62)

TCCCGCAGTATCGGTCTGGTTGGTTGGATGGGGTGGGTGAGGATCGATC

Table 5: select available from DNA #2 and #3 the 7th clone who takes turns in conjunction with feature

10nM coagulates

During hemase

In conjunction with %

SEQ ID NO clone

(screening)

Kd(nM)

43 AMX(395)_A1 40.77 6.40

44 AMX(395)_A4 19.64 29.38

45 AMX(395)_A5 3.29 N/A

46 AMX(395)_A11 35.80 N/A

47 AMX(395)_B5 17.10 N/A

48 AMX(395)_B7 32.82 14.48

49 AMX(395)_C1 40.23 7.48

50 AMX(395)_C3 3.57 N/A

51 AMX(395)_D5 13.39 N/A

52 AMX(395)_D11 31.92 5.55

53 AMX(395)_E2 6.51 N/A

54 AMX(395)_E4 24.02 N/A

55 AMX(395)_E7 9.12 N/A

56 AMX(395)_E8 21.31 N/A

57 AMX(395)_E11 33.70 N/A

58 AMX(395)_F3 6.29 N/A

59 AMX(395)_G2 33.10 N/A

60 AMX(395)_G11 21.89 N/A

61 AMX(395)_H9 9.61 N/A

62 AMX(395)_H10 2.80 N/A

* N/A represents not measure K _D

DNA selects the 9th of #2 and #3 to take turns: order-checking and colony screening

[00231] based on above-described set combination of monitoring in selection, according to the explanation of manufacturers, (Invitrogen, Carlsbad CA) have cloned from what select #2 and #3 and the 9th have taken turns set, and order-checking with TOPO TA clone test kit.From 136 sequences of taking turns acquisition from the 9th of two selections, select 130 unique sequences to be used for measuring, with the selective binding of test to zymoplasm in dot blotting screening at 1 point of zymoplasm and thrombogen.With 25 micromolar synthetic scales, by IDT (Coralville, IA) synthetic in order clone.With _γ ^-32P ATP carries out 5 ' end mark to clone's transcript, and (NJ) the rotation purifying is to remove excessive mark for Princeton Separations, Adelphia with the Centrisep post.With cumulative volume 30 μ l 1X DPBS (w/Ca ²⁺And Mg ²⁺) (Gibco, Catalog #14040, Invitrogen, Carlsbad, in CA)+/-clone of the mark of 10nM zymoplasm and 0.1mg/ml BSA incubation trace 30 minutes.Behind the incubation, association reaction adopts the dot blotting of describing among the embodiment 1A of front in conjunction with determinator.K for definite clone who selects _D, use _γ ^-32P ATP carries out 5 ' end mark to clone's transcript.Serial dilutions (according to the avidity of specific cloning to zymoplasm, scope is 1pM-1000nM) with human thrombin is measured k at dot blotting in measuring _DValue, and 1:1 RNA is described in substitution: and the formula of albumen composition, it is (fit in conjunction with ratio=amplitude * ([zymoplasm]/(K to obtain data _D+ [zymoplasm])) (KaleidaGraph v.3.51, Synergy Software, Reading, PA).

[00232] selects the 9th of #2 and #3 to take turns the sequence that obtains from DNA and be listed in the table below 6.The corresponding of each clone tabulated in table 7 hereinafter in conjunction with feature.For listing in hereinafter each sequence of table 6, each clone's district at random begins behind sequence 5 ' TCCC, in the preceding termination of GTGGCTGAGGATCGTATC3 ' (SEQ ID NO 42).Unless otherwise noted, each sequence of hereinafter listing is with 5 ' to 3 ' direction indication, and at DNA SELEX ^TMSelect under the condition, wherein all Nucleotide all are deoxynucleotides.

Table 6: the sequence of selecting the 9th clone who takes turns of #2 and #3 available from the blood coagulation enzyme dna

SEQ IDNO	Clone's title	Sequence
			63	AMX(398)_A1	TCCGATTGACGTGGTGGGTTACTGGTTTGGGTGGCTGAGGATCGATC
64	AMX(398)_A2	TCCCATTGATCTGTGGTGGTTTTGTGGTTTGGGTGGCTGAGGATCGATC
			65	AMX(398)_A4	TCCCGTAATCGAGCCTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC
66	AMX(398)_A6	TCCCATCGATTTGGGGTATGTTATGGGCTCGGGTGGGTGAGGATCGATC
			67	AMX(398)_A7	TCCCTATCGAGCTGTGGTAGTATTCTGGTTTGGGTGGCTGAGGATCGATC
68	AMX(398)_A8	TCCCATCGGTCCGGGGTAATTTACTGGGTCGGGTGGCTGAGGATCGATC
			69	AMX(398)_A9	TCCCGTCGAGCCGGGGTATGATTATGGGTGGGGTGGCTGAGGATCGATC
70	AMX(398)_A12	TCCCTGGAGATCCGGGGTAGTATACTGGTTTGGGTGGCTGAGGATCGATC
			71	AMX(398)_B1	TCCCAATCGAGCCGGGGTTTGTTTGTTCTGGGTGGCTGAGGATCGATC
72	AMX(398)_B2	TCCCGTAATCGAGCCTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC
			73	AMX(398)_B3	TCCCAGATGTGATGCGTATCCTGGTTTGGTTGGGTGGCTGAGGATCGATC
74	AMX(398)_B5	TCCCTGATCCTTAGGCTAGGTTGGGTGGGGTGGTGGCTGAGGATCGATC
			75	AMX(398)_B9	TCCCATCGAGCCGGGGATGGTTTGTTGGAGGGGTGGCTGAGGATCGATC
76	AMX(398)_B10	TCCCTCGATCTTGGGGTACTATAGTGGTGTGGGTGGCTGAGGATCGATC

SEQ IDNO	Clone's title	Sequence
			77	AMX(398)_B11	TCCCGCTCGATTTCGAAGAATGGTTGGTTTGGGTGGCTGAGGATCGATC
78	AMX(398)_B12	TCCCGATTATCCGTTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC
			79	AMX(398)_C1	TCCCAACGATCTGTGGTTTTTTTGTTCTGGGTGGCTGAGGATCGATC
80	AMX(398)_C2	TCCCAAGGATCCGGGGTAGTTAGTGGCTGAGGTGGCTGAGGATCGATC
			81	AMX(398)_C3	TCCCATGTGTTAGATCCGTGTGGTTGGACTGGGTGGCTGAGGATCGATC
82	AMX(398)_C5	TCCCCGATGTGTCAGCCTAGGGTGGTTAGGGTGGTGGCTGAGGATCGATC
			83	AMX(398)_C6	TCCCATGATTGGCCGGGGTGTCTTTTGGGTCGGGTGGCTGAGGATCGATC
84	AMX(398)_C8(ARC2027)	TCCTGAGGGATCAGGCTAGGTTGGGTAGGGTGGTGGCTGAGGATCGATC
			85	AMX(398)_C9	TCCCGATCGTTTCGTGGGGTAGTGTTGGTTGGGGTGGCTGAGGATCGATC
86	AMX(398)_C10	TCCCGAGCGATACTGCCTAGGCTGGGTAGGGTGGTGGCTGAGGATCGATC
			87	AMX(398)_C11	TCCTGTCGATCGGTACGTTTTCGTTTCTGGGTGGCTGAGGATCGATC
88	AMX(398)_C12	TCCCTGCAATCGGTGCTCGAGAGGTTGGGTGGGTGGCTGAGGATCGATC
			89	AMX(398)_D1	TCCCGATTTGAGTTTAGTAGGGTGGGTAGGATGGTGGCTGAGGATCGATC
90	AMX(398)_D3	TCCCATGATCGGGTCGGTATTTGGTCAGGGTGGCTGAGGATCGATC
			91	AMX(398)_D5	TCCCAGCGGTCCTAATGGGTAGTGTTGGTTTGGGTGGCTGAGGATCGATC
92	AMX(398)_D6(ARC2026)	TCCCGAGCGATACTGCCTAGGTTGGGTAGGGTGGTGGCTGAGGATCGATC
			93	AMX(398)_D7	TCCCTTGTCGATTCTGGTATGTTTTGGTCCGGGTGGCTGAGGATCGATC
94	AMX(398)_D9	TCCCATGAACTCAGGGTAATTTTTGGTGTGGGTGGCTGAGGATCGATC
			95	AMX(398)_E1	TCCCATCGATCCGGGGTATTCTTATTTCTGGGTGGCTGAGGATCGATC
96	AMX(398)_E2	TCCCGGTCGAGACTCGGAGTATGGCAGGGTGGGTGGCTGAGGATCGATC
			97	AMX(398)_E3	TCCCGAGTGATCCGGGGTGTTTTTTTGGGTTGGGTGGCTGAGGATCGATC
98	AMX(398)_E5	TCCCGATCGGACGTGGTGGGTTACTTCTGGGTGGCTGAGGATCGATC
			99	AMX(398)_E6	TCCCATCGAGACGGGGTGTCTTTTGTGGCTTGGGTGGCTGAGGATCGATC
100	AMX(398)_E7	TCCCTTGATCTGGGGTGCGTTATTGTGGTTCGGGTGGCTGAGGATCGATC
			101	AMX(398)_E8	TCCCTATCGACCGGGGTTCTTTCGTGGTTCGGGTGGCTGAGGATCGATC
102	AMX(398)_E11	TCCCATTGGTCCGGGGATTGGTGGCTGGGTGGGGTGGCTGAGGATCGATC
			103	AMX(398)_E12	TCCCGGATCTGTGGTAGGTTTGTTGGGTTGGGTGGCTGAGGATCGATC

SEQ IDNO	Clone's title	Sequence
			104	AMX(398)_F2	TCCCATCGAGTCGTGGTGTTTGTTGGCCTGGGTGGCTGAGGATCGATC
105	AMX(398)_F5	TCCCGATCGAGAGTGGTATTTGTTTCTGGGTGGCTGAGGATCGATC
			106	AMX(398)_F6	TCCCTTGATCCGGTGGTAGTTTTATTGGTGCGGGTGGCTGAGGATCGATC
107	AMX(398)_F8	TCCCATCGATCCGTGGTACTTTTGTGGCTAGGGTGGCTGAGGATCGATC
			108	AMX(398)_F9	TCCCGTCGATCTGGGGTGTCTATGTGGGTGGGGTGGCTGAGGATCGATC
109	AMX(398)_F12	TCCCGATCGTAGTCCTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC
			110	AMX(398)_G2	TCCCTAACGATCTGAGGTGTTTTTTTTCTGGGTGGCTGAGGATCGATC
111	AMX(398)_G6	TCCCTGTCGTTCCGTGGTGTTTTTATGGGCTGGGTGGCTGAGGATCGATC
			112	AMX(398)_G7	TCCCATCGGTCGGGGTAATTTTATTGGGTGGGGTGGCTGAGGATCGATC
113	AMX(398)_G8	TCCCTTGTTTGATCCGGGGTGTTAATGGTTGGGGTGGCTGAGGATCGATC
			114	AMX(398)_G11	TCCCTCGATGCTTATGGGTATTGTATGGGTTTGGGTGGCTGAGGATCGATC
115	AMX(398)_H1	TCCCATCGGTCCAAGGTATTTTTGTTTCTGGGTGGCTGAGGATCGATC
			116	AMX(398)_H5	TCCCATCTTCTGTAGCCTAGGTTGGGTAGGGTGGTGGCTGAGGATCGATC
117	AMX(398)_H6	TCCCTATGGATCCGGGGTACGTTAGTTCTGGGTGGCTGAGGATCGATC
			118	AMX(398)_H7	TCCCTCGGTCCTCGTCTTTTTTGGTCTGGGTGGGTGGCTGAGGATCGATC
119	AMX(398)_H8	TCCCTGCGTCGATCGTGGTATCGTTTCTGGGTGGCTGAGGATCGATC
			120	AMX(398)_H10	TCCTGAGCGATTCGGGGTGTTTTCATGGTTCGGGTGGCTGAGGATCGATC
121	AMX(399)_A2	TCCCTATCGATTGCTCCTAGGATGGGTAGGGTGGTGGCTGAGGATCGATC
			122	AMX(399)_A3	TCCCATGGATCCGAGGTGTTTTAGTGGTCCGGGTGGCTGAGGATCGATC
123	AMX(399)_A5	TCTCTGACGATCCGGTGCAAATTGTGGTGGGGTGGCTGAGGATCGATC
			124	AMX(399)_A6	TCCCGTAATTGAGCTTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC
125	AMX(399)_A7	TCCCACCGATCCGGGGTAAATGAATGGCGTGGGTGGCTGAGGATCGATC
			126	AMX(399)_A10	TCCCTCGATCAAGGTGTTTATTATGGTGTGGGTGGCTGAGGATCGATC
127	AMX(399)_A11	TCCCTTCTGATCCGAGGTGTTTTATTGGTGTGGGTGCTGAGATCGATC
			128	AMX(399)_A12	TCCCATCGAACCTTGAGGGTATTGTTGGTTTGGGTGGCTGAGGATCGATC
129	AMX(399)_B2	TCCCATCGATTCGTGGTCTTTTTATGGTGTGGGTGGCTGAGGATCGATC
			130	AMX(399)_B3	TCCCGTAATCGAGCTTGGTATTGTTGGTCTGGGTGGCTGAGGATCGATC
131	AMX(399)_B6	TCCCTCGTATTCCGGGGGATCATATTGGTCGGGGTGGCTGAGGATCGATC

SEQ IDNO	Clone's title	Sequence
			132	AMX(399)_B8	TCCCAGGACCGATCCTGGTATTGTTGGTGGGGGTGGCTGAGGATCGATC
133	AMX(399)_B9	TCCTGTCGATCCCTACGGGTAGTGTTGGTTTGGGTGGCTGAGGATCGATC
			134	AMX(399)_B10	TCCCATTGATCCGGGGTGGTTTTCTGGTTTGGGTGGCTGAGGATCGATC
135	AMX(399)_B11	TCCCGTCGATTCGGTATGGTTTCGTTTCTGGGTGGCTGAGGATCGATC
			136	AMX(399)_B12	TCCCATCGATTTGTCCTCAGAGGTTGGCGTGGGTGGCTGAGGATCGATC
137	AMX(399)_C7	TCCCGAGCGATCGGGGTGGTTTTTTGGGAGTGGGTGGCTGAGGATCGATC
			138	AMX(399)_C8	TCCCGTCGATCAGGGGTAATTTGCTGGTGGTGGGTGGCTGAGGATCGATC
139	AMX(399)_C9	TTCCTGTCGATAAGGGGTATTATAGTGGTGTGGGTGGCTGAGGATCGATC
			140	AMX(399)_C10	TCTCATTCGTTCCGGGGTATTTAGTGGGTCGGGTGGCTGAGGATCGATC
141	AMX(399)_C11	TCCCGAGGGACGACGCCTAGGTTGGGTAGGGTGGTGGCTGAGGATCGATC
			142	AMX(399)_C12	TCCCGATCTATCCGGGGTACATTTGTGGTTTGGGTGGCTGAGGATCGATC
143	AMX(399)_D2	TCCCGATCGCTGTCCTAGGATGGGTAGGGTGGTGGCTGAGGATCGATC
			144	AMX(399)_D3	TCCCGCGATCTCTGGGGTAACGTTTTGGTGTGGGTGGCTGAGGATCGATC
145	AMX(399)_D4	TCCCGATTGATTCTGGGAGGTTTGGTTCTGGGTGGCTGAGGATCGATC
			146	AMX(399)_D5	TCCCGTTCGAGTCCTGGTGTTTTATTGGCCTGGGTGGCTGAGGATCGATC
147	AMX(399)_D6	TCCCGCATTGAATAGGACTCAGGGATGGTGTGGGTGGCTGAGGATCGATC
			148	AMX(399)_D7	TCCCTCGATCTAAGGTGCTTTTAGTGGTTTGGGTGGCTGAGGATCGATC
149	AMX(399)_D8	TCTCGATCGGACGTGGTGGGTTACTGGCTTGGGTGGCTGAGGATCGATC
			150	AMX(399)_D9	TCCCAGGATCGATTCTGGTATTGTTGGTGGGGGTGGCTGAGGATCGATC
151	AMX(399)_D10	TCCCATCGATCTGTGGTGGTTTTGTGGTTTGGGTGGCTGAGGATCGATC
			152	AMX(399)_D11	TCCCAGAGAGCCGGGGTATAATTGTGGTGTGGGTGGCTGAGGATCGATC
153	AMX(399)_D12	TCCCATCGATCTGTGGTCTTTTTTGGTGTGGGTGGCTGAGGATCGATC
			154	AMX(399)_E1	TCCCACGATCCGGGGTGTCTTTCGTGGGCTGGGTGGCTGAGGATCGATC
155	AMX(399)_E3	TCCCGATTTCGATTCTGGTAGTGTTTTCTGGGTGGCTGAGGATCGATC
			156	AMX(399)_E4	TCCCATCGAACCGCGGGTAATCTTATGGGTCGGGTGGCTAGGATCGATC
157	AMX(399)_E5	TCCCATCGAGCCGGGTATGTTTCGTTGGGCTGGGTGGCTGAGGATCGATC
			158	AMX(399)_E8	TCCCATCGATCCGCGGTACTTTCGTGGCTTGGGTGGCGAGGATCGATC
159	AMX(399)_E9	TCCCATCGATACGGGGTGGAATCTTGGGGTGGGTGGCTGAGGATCGATC

SEQ IDNO	Clone's title	Sequence
				160	AMX(399)_E10	TCCCGATTGTCATAGGTGGTTTGTCTGGGTAGGGTGGCTGAGGATCGATC
161	AMX(399)_E12	TCCCGAGATCTTTATAGGGTATTGTTGGTTGGGGTGGCTGAGGATCGATC
			162	AMX(399)_F1	TCCCGTGATCTCTGGGGTAACGTCTTGGTGTGGGTGGCTGAGGATCGATC
163	AMX(399)_F2	TCCCTTGATCCTGGTACATATATTTTCTGGGTGGCTGAGGATCGATC
			164	AMX(399)_F3	TCCTTGTCGAGCCTTGGGGTAGTGTTGGTTTGGGTGGCTGAGGATCGATC
165	AMX(399)_F4	TCCCGTTCGGTCCGTATACTGGTGGTGGTTGGGTGGCTGAGGATCGATC
			166	AMX(399)_F5	TCCCTAGATCGGGTCCTGGTAGTGTTTCTGGGTGGCTGAGGATCGATC
167	AMX(399)_F6	TCCCAAGATCGATGCTGGTAGTGTTTTCTGGGTGGCTGAGGATCGATC
			168	AMX(399)_F7	TCCCGATCGGTCCCAAGGGTATTGTTGGTTTGGGTGGCTGAGGATCGATC
169	AMX(399)_F9	TCCCGCTATTCGATCTTCAATTGGGTGGTCAGGGTGGCTGAGGATCGATC
			170	AMX(399)_F10	TCCCGTCGGTCCGTTCGGTATTTTTTTCTGGGTGGCTGAGGATCGATC
171	AMX(399)_F11	TCCCTATGGATTCGGGGTACGTTAGTTCTGGGTGGCTGAGGATCGATC
			172	AMX(399)_F12	TCCCGATTGGAAAGCCTAGGATGGGTAGGGTGGTGGCTGAGGATCGATC
173	AMX(399)_G1	TCCCAGGACCGATCTTGGTATTGTTGGTGGGGGTGGCTGAGGATCGATC
			174	AMX(399)_G2	TCCCATCGTCTGTGGTATAGGAACTTCTGGGTGGCTGAGGATCGATC
175	AMX(399)_G3	TCCCATCGAACCTCGAGGGTATTGTTGGCTTGGGTGGCTGAGGATCGATC
			176	AMX(399)_G5	TCCCGGTATCGTCATGCTGGTGGAATTGGTTGGGTGGCTGAGGATCGATC
177	AMX(399)_G6	TCCCATCGATCAGTGGTGGCTTGGCTGGTTTGGGTGGCTGAGGATCGATC
			178	AMX(399)_G8	TCCCATCGATCTGTGGTGGTTTTGTGGCTTGGGTGGCTGAGGATCGATC
179	AMX(399)_G9	TCCCGTGAGAGCTGGGGTGTTTATATGGGTCGGGTGGCTGAGGATCGATC
			180	AMX(399)_G10	TCCCGATCGCTGTCCTAGGATGGGTAGGGTGGTGGCTGAGGATCGATC
181	AMX(399)_G11	TCCCCATCGATCCTGGTCTCTTTTGTTCTGTGGCTGAGGATCGATC
			182	AMX(399)_G12	TCCCGGATCCTCGTGGGTATTGTTGGGTTGGGTGGCTGAGGATCGATC
183	AMX(399)_H1	TCCCATCGAACCTCGAGGGTATTGTTGGTTTGGGTGGCTGAGGATCGATC
			184	AMX(399)_H2	TCCCGACTTTAGATCCGTGTTGGATGGCCTGGGTGGCTGAGGATCGATC
185	AMX(399)_H3	TCCCAATCGGTCCTGGTAATATATTGGTCGGGGTGGCTGAGGATCGATC
			186	AMX(399)_H4	TCCCGAGAGATTCAAAAGGGACTGGGCGGTTGGGTGGCTGAGGATCGATC
187	AMX(399)_H6	TCCCGGAGATCTGAGGTGTTTTATTGGTTTGGGTGGCTGAGGATCGATC

SEQ IDNO	Clone's title	Sequence
			188	AMX(399)_H7	TCCCGGTTGTCGATTCTGGTATTGTTGGGCTGGGTGGCTGAGGATCGATC
189	AMX(399)_H8	TCCCTGGTATCGTATCCAAAGGGGTGGTGTGGGTGGCTGAGGATCGATC
			190	AMX(399)_H9	TCCCGGAGATCCGAGGTGTTTTATTGGTTTGGGTGGCTGAGGATCGATC

Table 7: select available from the blood coagulation enzyme dna #2 and #3 the 9th clone who takes turns in conjunction with feature:

SEQID NO	The clone	During the 10nM zymoplasm in conjunction with % (screening)	During the 50nM thrombogen in conjunction with % (screening)	Kd (nM) to zymoplasm
					63	AMX(398)_A1	15.85	18.00	0.30
64	AMX(398)_A2	26.67	28.45	N/A
					65	AMX(398)_A4	45.67	47.70	1.27
66	AMX(398)_A6	31.15	31.27	N/A
					67	AMX(398)_A7	26.50	25.45	N/A
68	AMX(398)_A8	40.02	43.87	N/A
					69	AMX(398)_A9	28.26	29.71	N/A
70	AMX(398)_A12	35.36	37.47	N/A
					71	AMX(398)_B1	31.33	32.66	N/A
72	AMX(398)_B2	47.76	51.75	0.39
					73	AMX(398)_B3	17.54	16.54	N/A
74	AMX(398)_B5	12.48	8.27	N/A
					75	AMX(398)_B9	3.03	2.16	N/A
76	AMX(398)_B10	26.81	25.66	N/A
					77	AMX(398)_B11	9.76	2.08	N/A
78	AMX(398)_B12	20.11	20.21	N/A
					79	AMX(398)_C1	35.80	37.04	N/A
80	AMX(398)_C2	0.20	0.66	N/A
					81	AMX(398)_C3	10.77	3.04	N/A

SEQID NO	The clone	During the 10nM zymoplasm in conjunction with % (screening)	During the 50nM thrombogen in conjunction with % (screening)	Kd (nM) to zymoplasm
					82	AMX(398)_C5	40.83	19.23	2.20
83	AMX(398)_C6	28.01	11.60	N/A
					84	AMX(398)_C8(ARC2027) SEQ ID NO 84	49.27	48.47	0.42
85	AMX(398)_C9	20.68	20.69	N/A
					86	AMX(398)_C10	41.00	40.92	3.27
87	AMX(398)_C11	35.08	36.66	N/A
					88	AMX(398)_C12	22.80	15.47	N/A
89	AMX(398)_D1	20.66	11.77	N/A
					90	AMX(398)_D3	20.02	20.84	N/A
91	AMX(398)_D5	12.04	12.93	N/A
					92	AMX(398)_D6(ARC2026)	45.70	45.54	0.29
93	AMX(398)_D7	34.98	34.65	N/A
					94	AMX(398)_D9	40.42	41.75	5.64
95	AMX(398)_E1	23.36	20.89	N/A
					96	AMX(398)_E2	3.84	2.62	N/A
97	AMX(398)_E3	45.41	47.52	0.89
					98	AMX(398)_E5	25.59	25.39	N/A
99	AMX(398)_E6	29.52	30.31	N/A
					100	AMX(398)_E7	27.90	20.31	N/A
101	AMX(398)_E8	26.38	26.67	N/A
					102	AMX(398)_E11	13.68	16.53	N/A
103	AMX(398)_E12	40.43	39.87	N/A
					104	AMX(398)_F2	8.76	8.81	N/A
105	AMX(398)_F5	21.33	19.40	N/A
					106	AMX(398)_F6	23.90	24.63	N/A

SEQID NO	The clone	During the 10nM zymoplasm in conjunction with % (screening)	During the 50nM thrombogen in conjunction with % (screening)	Kd (nM) to zymoplasm
					107	AMX(398)_F8	2.76	3.02	N/A
108	AMX(398)_F9	27.24	30.15	N/A
					109	AMX(398)_F12	34.46	40.32	N/A
110	AMX(398)_G2	12.66	13.75	N/A
					111	AMX(398)_G6	40.34	42.14	N/A
112	AMX(398)_G7	31.31	33.60	N/A
					113	AMX(398)_G8	28.85	29.38	N/A
114	AMX(398)_G11	11.47	10.91	N/A
					115	AMX(398)_H1	4.81	5.38	N/A
116	AMX(398)_H5	40.57	42.91	1.39
					117	AMX(398)_H6	32.63	35.35	N/A
118	AMX(398)_H7	6.58	4.22	N/A
					119	AMX(398)_H8	13.01	15.64	N/A
120	AMX(398)_H10	19.00	20.62	N/A
					121	AMX(399)_A2	40.50	37.75	N/A
122	AMX(399)_A3	7.15	6.98	N/A
					123	AMX(399)_A5	9.37	8.23	N/A
124	AMX(399)_A6	31.89	34.19	N/A
					125	AMX(399)_A7	22.74	23.02	N/A
126	AMX(399)_A10	12.05	10.98	N/A
					127	AMX(399)_A11	7.08	8.82	N/A
128	AMX(399)_A12	22.50	23.64	N/A
					129	AMX(399)_B2	14.59	12.86	N/A
130	AMX(399)_B3	45.41	45.13	0.64
					131	AMX(399)_B6	25.41	25.41	N/A
132	AMX(399)_B8	2.81	2.69	N/A
					133	AMX(399)_B9	14.68	14.26	N/A

SEQID NO	The clone	During the 10nM zymoplasm in conjunction with % (screening)	During the 50nM thrombogen in conjunction with % (screening)	Kd (nM) to zymoplasm
					134	AMX(399)_B10	24.43	23.59	N/A
135	AMX(399)_B11	18.72	18.18	N/A
					136	AMX(399)_B12	24.16	15.28	N/A
137	AMX(399)_C7	6.80	6.94	N/A
					138	AMX(399)_C8	36.78	33.81	N/A
139	AMX(399)_C9	11.20	10.88	N/A
					140	AMX(399)_C10	35.36	34.26	N/A
141	AMX(399)_C11	42.77	41.62	1.74
					142	AMX(399)_C12	18.69	17.17	N/A
143	AMX(399)_D2	46.04	44.08	1.33
					144	AMX(399)_D3	21.69	25.26	N/A
145	AMX(399)_D4	10.38	9.02	N/A
					146	AMX(399)_D5	46.01	23.76	2.26
147	AMX(399)_D6	22.67	22.04	N/A
					148	AMX(399)_D7	7.59	24.88	N/A
149	AMX(399)_D8	22.16	19.57	N/A
					150	AMX(399)_D9	20.31	19.74	N/A
151	AMX(399)_D10	38.78	40.76	N/A
					152	AMX(399)_D11	41.33	39.55	N/A
153	AMX(399)_D12	32.62	32.21	N/A
					154	AMX(399)_E1	37.65	39.11	N/A
155	AMX(399)_E3	13.00	13.29	N/A
					156	AMX(399)_E4	7.50	7.29	N/A
157	AMX(399)_E5	15.03	12.53	N/A
					158	AMX(399)_E8	4.31	4.37	N/A
159	AMX(399)_E9	14.83	13.77	N/A
					160	AMX(399)_E10	29.76	28.92	N/A

SEQID NO	The clone	During the 10nM zymoplasm in conjunction with % (screening)	During the 50nM thrombogen in conjunction with % (screening)	Kd (nM) to zymoplasm
					161	AMX(399)_E12	20.31	25.11	N/A
162	AMX(399)_F1	16.73	19.39	N/A
					163	AMX(399)_F2	7.37	7.92	N/A
164	AMX(399)_F3	9.80	8.70	N/A
					165	AMX(399)_F4	28.11	25.03	N/A
166	AMX(399)_F5	49.21	49.31	2.35
					167	AMX(399)_F6	10.04	11.90	N/A
168	AMX(399)_F7	29.62	34.20	N/A
					169	AMX(399)_F9	25.18	25.97	N/A
170	AMX(399)_F10	21.33	22.09	N/A
					171	AMX(399)_F11	35.13	35.73	N/A
172	AMX(399)_F12	46.68	48.25	0.66
					173	AMX(399)_G1	4.89	2.44	N/A
174	AMX(399)_G2	18.77	7.28	N/A
					175	AMX(399)_G3	20.79	22.58	N/A
176	AMX(399)_G5	23.20	18.93	N/A
					177	AMX(399)_G6	39.69	38.60	N/A
178	AMX(399)_G8	27.64	25.94	N/A
					179	AMX(399)_G9	21.30	22.51	N/A
180	AMX(399)_G10	38.44	36.28	N/A
					181	AMX(399)_G11	12.75	11.79	N/A
182	AMX(399)_G12	40.56	41.10	N/A
					183	AMX(399)_H1	21.23	20.45	N/A
184	AMX(399)_H2	5.49	2.73	N/A
					185	AMX(399)_H3	44.82	45.52	1.93
186	AMX(399)_H4	7.70	3.66	N/A
					187	AMX(399)_H6	8.48	6.32	N/A

SEQID NO	The clone	During the 10nM zymoplasm in conjunction with % (screening)	During the 50nM thrombogen in conjunction with % (screening)	Kd (nM) to zymoplasm
					188	AMX(399)_H7	38.10	36.07	N/A
189	AMX(399)_H8	23.34	14.34	N/A
					190	AMX(399)_H9	3.86	3.16	N/A

Embodiment 2: composition and sequence optimisation and sequence

Embodiment 2A:DNA selects #2 and fit the minimizing of #3 zymoplasm

Select the minimizing of the 7th clone who takes turns of #2 and #3 from DNA

[00233] with the folding program (RNAstructure of RNA (1996-2004) David H.Mathews, Michael Zuker ﹠amp; Douglas H.Turner) determines that the 7th secondary of inferring of taking turns the clone folds described clone's K _DBe to determine according to the description of embodiment 1B above.High-affinity clones autocorrelation sequence, and based on cloning the folding of AMX (395) _ C1 (SEQ ID NO 49), design and synthetic minimized fit sequence.Serial dilutions (according to the avidity of specific cloning to zymoplasm, scope is 1pM-1000nM) with human thrombin is measured k at the dot blotting of above embodiment 1 description in measuring _DValue, and 1:1 RNA is described in substitution: and the formula of albumen composition, it is (fit in conjunction with ratio=amplitude * ([zymoplasm]/(K to obtain data _D+ [zymoplasm])) (KaleidaGraph v.3.51, Synergy Software, Reading, PA).Sequence that minimizes construct and corresponding k based on the fit AMX of parent (395) _ C1 (SEQ ID NO 49) _DList in hereinafter table 8.As directed, the 27 aggressiveness ARC 1985 that obtain that identify in the minimization process show DNA select the 7th of #2 and #3 to take turns to identify and minimized all clones in zymoplasm is had the highest binding affinity.

[00234] fit in order to minimize the DNA that describes in the table 8 hereinafter, all Nucleotide (A, T, C and G) all are deoxynucleotides.Unless otherwise noted, each sequence all be with 5 ' to 3 ' direction indication.

The sequence of table 8:AMX (395) _ C1 (SEQ ID NO 49) brachymemma construct and in conjunction with feature

SEQ IDNO	ARC#	Sequence	K D (nM)
				191	ARC1985	CCTCAGGGATGGTGTGGGTGGCTGAGG	5.7

Select the minimizing of the 9th clone who takes turns of #2 and #3 from DNA

[00235] clone who selects the 9th of #2 and #3 to take turns evaluation from DNA according to description above designs and minimizes construct, its dot blotting of describing in embodiment 1B above shows the highest binding affinity in measuring, and the PT that describes of embodiment 3A has the strongest anti-freezing ability in measuring hereinafter.Minimize the sequence of construct, with the fit hereinafter table 9 that is described in of the relevant parent of each construct.Each is minimized the functionally active of construct and fit the comparing of relevant parent during hereinafter the PT that describes of embodiment 3A measures.In the construct of the brachymemma that designs, ARC2091 (SEQ ID NO 197) demonstrates the parent who measures in (embodiment 3A vide infra) to PT and clones similar usefulness.ARC2091 (SEQ ID NO 197) select the 9th of #2 and #3 to take turns to identify from DNA and minimized all clones demonstrate best functionally active, and be to be used for the basis that doping (doped) that embodiment 2B hereinafter describes reselects.

[00236] fit in order to minimize the DNA that describes in the table 9 hereinafter, all Nucleotide (A, T, C and G) all are deoxynucleotides.Unless otherwise noted, each sequence all be with 5 ' to 3 ' direction indication.

Table 9: the sequence of the construct of the brachymemma that designs from the clone who selects the 9th of #2 and #3 to identify taking turns at the DNA of human thrombin

Minimize fit SEQ ID N0	Minimize fit title	The parent is fit (SEQ ID NO)	Minimize fit sequence
				193	Minimer 1	AMX(399)_B3(SEQ ID NO 130)	CCCTTGGTATTGTTGGTCTGGGTGGCTGAGCG
194	Minimer 2	AMX(398)_A4(SEQ ID NO 65)	CCGCCTGGTATTGTTGGTCTGGGTGGCTGAGGCGG
				195	Minimer 3	AMX(398)_D6(	GGTTGGGTAGGGTGG

Minimize fit SEQ ID NO	Minimize fit title	The parent is fit (SEQ ID NO)	Minimize fit sequence
						SEQ ID NO 92)
196	Minimer 4	AMX(398)_D6(SEQ ID NO 92)	GGTAGGGTGGTGG
				197	Minimer 5 (ARC2091)	AMX(398)_D6(SEQ ID NO 92)	GGCGATACTGCC TAGGTTGGGTAGGGTGGTGGCTGAGGATCGCC
198	Minimer 6	AMX(398)_D6(SEQ ID NO 92)	ACTGCCTAGGTTGGGTAGGGTGGT
				199	Minimer 12	AMX(398)_D6(SEQ ID NO 92)	GGCGATACTGCTTCGCAGGGTGGTGGCTGAGGATCGCC
200	Minimer 7	AMX(398)_C8(SEQ ID NO 84)	GGCCGATCAGGCTAGGTTGGGTAGGGTGGTGGCTGAGGATCGGCC
				201	Minimer 8	AMX(398)_C8(SEQ ID NO 84)	GGCGATACTGCCTTTGGTAGGGTGGTGGCTGAGGATCGCC
202	Minimer 9	AMX(398)_C8(SEQ ID NO 84)	GGCGATACTGCCCAGGTTGCGCAGGGTGGTGGCTGAGGATCGCC
				203	Minimer 10	AMX(398)_C8(SEQ ID NO 84)	GGCCGATCAGGCTGCTGAGGATCGGCC
204	Minimer 11	AMX(398)_C8(SEQ ID NO 84)	CCGGCTAGGTTGGGTAGGGTGGTGGCTGG

Embodiment 2B:ARC2091 is doping to be reselected

[00237] adopts selection, so that identify more high-affinity to zymoplasm based on the doping set of minimized human thrombin binding sequence ARC2091 (SEQID NO 197) (being described in embodiment 2A).Survey active clone or minimize fit (minimer) interior sequence requirement with doping reselecting.Use synthetic, degeneracy set to select based on single sequences Design.The degeneracy level is 70%-85% wild-type Nucleotide normally.In general, observed neutral mutation, but in some cases, sequence changes the change that can cause avidity.Can identify minimum binding motif and auxiliary optimization with multiplexed sequence information then.

The set preparation:

[00238] adopts ABI EXPEDITE ^TMDna synthesizer is synthetic to have sequence 5 ' ATGCTTTTATACCTTCGGCGATACTGCCTAGGTTGGGTAGGGTGGTGGCTGAGGAT CGCCGAATTTCCCGAGAGTTCC 3 ' (ARC2082; SEQ ID NO 205) dna profiling, and by standard method go the protection.It is the residue of pointing out that the Nucleotide that runic is represented has 85% chance, and 5% chance is one of other 3 Nucleotide.With 5 ' primer, 5 ' ATGCTTTTATACCTTCGGC 3 ' (ARC2083, SEQ IDNO 206) and 3 ' primer, 5 ' GGAACTCTCGGGAAATTCG 3 ' (ARC2084, SEQID NO 207) amplification template.After the amplification, with ethanol sedimentation PCR product, (333mM NaOH, 15min), subsequently with the HCL neutralization, and adds methane amide sample loading buffer, purifying on 10% PAGE gel then by 90 ℃ to carry out basic hydrolysis then.

Select

[00239] (Enzyme Research Labs, South Bend IN) carry out altogether 3 and take turns based on the doping of nitrocellulose post and reselect at zymoplasm.Prepare Centrex post (Schleicher ﹠amp according to the description of embodiment 1A above; Schuell, Keen, NH).Take turns since the 1st and to introduce the negative step of selecting, so that according to hereinafter from set, removing non-specific filter membrane wedding agent.Take turns for each, prepare negative filter membrane, rotate the ARC2082 (500nM gathers concentration) among the 200 μ l 1X DPBS of being dissolved in of 100 picomole, and collect according to the description of embodiment 1 above.After the negative selection step, add 20 picomole zymoplasms (100nM final concentration), 0.1mg/ml competitor tRNA and 0.1mg/ml heparin in filtering set, incubation is 1 hour under the room temperature.Introduce competitor tRNA,, and in positive selection step, add heparin with the increase selective pressure, with the outer site 2 of combination, and the outer site 2 that prevents fit bind thrombin.Every selection condition of taking turns is summarized in table 10.Take turns for each, will select the association reaction thing to add among the Centrex for preparing and rotation (2000rpm, 1 minute).Use 1 * DPBS (w/Ca then ²⁺And Mg ²⁺) (Gibco, catalog number (Cat.No.) 14040, Invitrogen, Carlsbad, CA) washing pillar, and by centrifugal rotation (2000rpm, 1 minute).After the washing, in pillar, kept 3 minutes by making system buffer liquid, with being heated to 90 ℃ 1mL elution buffer (7M urea, 300mM NaOAc, 5mM EDTA) wash-out pillar, under the 2000rpm centrifugal 1 minute then, and be collected in the Eppendorf pipe.Virahol and 1 μ l glycogen precipitation elutriant with 1 volume.Make reactant in the PCR mixture that contains 5 ' primer, 5 ' ATGCTTTTATACCTTCGGC 3 ' (ARC2083) (SEQ ID NO 206) and 3 ' primer, 5 ' GGAACTCTCGGGAAATTCG 3 ' (ARC2084) (SEQ ID NO 2084), reach 200 μ l.With following condition cycle P CR reaction: 94 ℃ of following sex change 1 minute, carry out 94 ℃ following 30 seconds, 54 ℃ of following 30 seconds and 72 ℃ of following circulations of 1 minute; Up to end product is about 10ng/ μ l, this be with 4% E-Gel (Invitrogen, Carlsbad, CA) assessment (table 10 rightmost one row in be called " PCR threshold value ").Then product is planted in the bigger PCR reaction, be used for further amplification (20 μ l add the total PCR volume of 400 μ l).After the amplification, with ethanol sedimentation PCR product, (333mM NaOH, 15min), subsequently with the HCL neutralization, and adds methane amide sample loading buffer, purifying on 10% PAGE gel then by 90 ℃ to carry out basic hydrolysis then.The product of wash-out purifying concentrates, and quantitatively, enters next round then and selects.Carry out subsequently precipitation and gel-purified according to description above.

The doping condition of reselecting of table 10:ARC2091 (SEQ ID NO 197)

Wheel	Negative	Zymoplasm (nM)	Competitor	PCR threshold value ((# circulation)
					1	Filter membrane	100nM	.1mg/ml tRNA and .1mg/ml heparin	20
2	Filter membrane	30nM	.1mg/ml tRNA and 1mg/ml heparin	20
					3	Filter membrane	30nM	.1mg/ml tRNA and 1mg/ml	20

Order-checking and screening

[00240] after three-wheel was selected, (CA) test kit was cloned doping set for Invitrogen, Carlsbad, and order-checking to use TOPO TA clone according to the recommendation of manufacturers.Shown in hereinafter table 11, identified the sequence of 75 uniquenesses altogether.Doping reselect finish before, designed and synthesized the 30 aggressiveness derivatives of ARC2091 (SEQ ID NO 197), be called ARC2169 (SEQID NO 283), it has kept all zymoplasm binding affinities of ARC2091 (SEQ ID NO 197).Comprise the interior and outer sudden change of fit Core Feature motif that the sequence of ARC2169 (SEQ ID NO 283) limits from the doping sequence of reselecting.Discard the outer sudden change of this core, the sudden change in ARC2169 (SEQ ID NO 283) sequence background in the test core.Therefore, from the sequence shown in the table 11 hereinafter, used available from the doping design data of reselecting one group of clone's (referring to table 12) based on ARC2169 (SEQ ID NO 283), to test further minimized effect and from fit function doping being reselected the most ubiquitous sudden change that obtains.Measure the influence of measurement sudden change with PTT, and be described in hereinafter embodiment 3 fit function.

[00241] fit for the DNA that describes in hereinafter table 11 and the table 12, all Nucleotide (A, T, C and G) all are deoxynucleotides.Unless otherwise noted, each sequence is with 5 ' to 3 ' direction indication.

Table 11: take turns the doping clone who reselects of ARC2091 (SEQ ID NO 197) from the 3rd

SEQID NO	Clone's title	Sequence
			208	AMX(449)_A1	ATGCTTTTATACCTTCGGCCATACTGCATAGGTTGGGTAGGGTGGTTGCTG TGGCTGGCCGAATTTCCCGAGAGTTCC
209	AMX(449)_A4	ATGCTTTTATACCTTCGGCGATATCCCTAGGTTGGGTAGGGTGGTGGTTGATGATTGTCGAATTTCCCGAGAGTTCC
			210	AMX(449)_A6	ATGCTTTTATACCTTCGGCGATACAGTCTAGGATGGGTAGGGTGGTGGCTGAGCATCGCCGAATTTCCCGAGAGTTCC
211	AMX(449)_A7	ATGCTTTTATACCTTCGGCGACATTGTCTAGGTTGGGTAGGGTGGTGGCTCAGTATTGCCGAATTTCCCGAGAGTTCC
			212	AMX(449)_A8	ATGCTTTTATACCTTCGGCCATACTGCTTAGGTTGGGTAGGGCGGTAGCTGTAGATAGCCGAATTTCCCGAGAGTTCC
213	AMX(449)_A9	ATGCTTTTATACCTTCGGCCATACATGTTAGGTTGTGTAGTGTGGGCCCTGAGGATTGCCGAATTTCCCGAGAGTTCC

SEQID NO	Clone's title	Sequence
			214	AMX(449)_A11	ATGCTTTTATACCTTCGGCGAGACTGCCTAGGTTGGGTAGGGTGGTGGCTGAGGATTGCCGAATTTCCCCAGAGTTCC
215	AMX(449)_A12	ATGCTTTTATACCTTCGGCCAAGACTGCCTAGGATGGGTAGGGTGGTGGTTTAGGGTTGCCGAATTTCCCGAGAGTTCC
			216	AMX(449)_B1	ATGCTTTTATACCTTCGGCGATAGTGCCTAGGTTGGGTAGGGTGGTGGTAGTGGATCGCCGAATTTCCCGAGAGTTCC
217	AMX(449)_B2	ATGCTTTTATACCTTCGGCGGTCGTGTCTAGGGTGGGTAGGGTGGTGACTCAGGTTTGCCGAATTTCCCGAGAGTTCC
			218	AMX(449)_B3	ATGCTTTTATACCTTCGGCCAAACTGACTAGGTTGGGTAGGGTGGTGGCTGTGGTGGGCCGAATTTCCCGAGAGTTCC
219	AMX(449)_B4	ATGCTTTTATACCTTCGGCGATAGTGCCTTAGGTTGGGTAGGGTGGTGGCTGAGGCGTGCCGAATTTCCCGAGAGTTCC
			220	AMX(449)_B5	ATGCTTTTATACCTTCGGCGACAGTGCCTAGGTTGGGTAGGGTGGTGGCTTAGGCGCGCCGAATTTCCCGAGAGTTCC
221	AMX(449)_B6	ATGCTTTTATACCTTCGGCGATGTAGACTAGGTTGGGTAGGGTGGTGGCTAAGTATTGCCGAATTTCCCGAGAGTTCC
			222	AMX(449)_B8	ATGCTTTTATACCTTCGGCTATACTGTCTAGGTTGGGTAGGGTGGTGACTTAGTGTTGCCGAATTTCCCGAGAGTTCC
223	AMX(449)_B9	ATGCTTTTATACCTTCGGCGGGATTGTTTAGGTTGGGTAGGGTGGTGGCAGAGGATCGCCGAATTTCCCGAGAGTTCC
			224	AMX(449)_B10	ATGCTTTTATACCTTCGGCGGGATGTCCTAGGTTGGGTAGGGTGGTGGCTGAGGTTTGCCGAATTTCCCGAGAGTTCC
225	AMX(449)_B11	ATGCTTTTATACCTTCGGCTATACTGCATAGGTTGGGTAGGGTGGTGGCTGAGTGTTGCCGAATTTCCCGAGAGTTCC
			226	AMX(449)_C2	ATGCTTTTATACCTTCGGCGATACTGACTAGGTTGGGTAGGGTGGTGGCTGATCTTCGCCGAATTTCCCGAGAGTTCC
227	AMX(449)_C4	ATGCTTTTATACCTTCGGCGAAAGTGCTTAGGATGGGTAGGGTGGTGGCTGCGGATCGCCGAATTTCCCGAGAGTTCC
			228	AMX(449)_C5	ATGCTTTTTATACCTTCGGCGGTAGTGCCTAGGTTGGGTAGGGTGGTGGCTCTGGATCGCCGAATTTCCCGAGAGTTCC
229	AMX(449)_C6	ATGCTTTTATACCTTCGGCGATATTGCCTAGGTTGGGTAGGGTGGTGGCTGAACTTTGCCGAATTTCCCGAGAGTTCC
			230	AMX(449)_C10	ATGCTTTTATACCTTCGGCGACACAGACTAGGATGGGTAGGGTGGTGGCTGAGGCTCGCCGAATTTCCCGAGAGTTCC
231	AMX(449)_C11	ATGCTTTTATACCTTCGGCGGACATTGGCTAGGTTGGGTAGGGTGGTGGCTGCGGATTGCCGAATTTCCCGAGAGTTCC
			232	AMX(449)_C12	ATGCTTTTATACCTTCGGCGATACTGTGTAGGTTGGGTAGGGTGGTCGTAGAGGATTGCGGAATTTCCCGAGAGTTCC
233	AMX(449)_D1	ATGCTTTTATACCTTCGGCGATAATGTCTAGGTTGGGTAGGGTGGTGGCTGTGAATTGCCGAATTTCCCGAGAGTTCC
			234	AMX(449)_D2	ATGCTTTTATACCTTCGGCGGTCCTGCCTAGGATGGGTAGGGTGGTGGCCGAGGATTGCCGAATTTCCCGAGAGTTCC
235	AMX(449)_D3	ATGCTTTTATACCTTCGGCGAAGATTGACTAGGTTGGGTAGGGTGGTGTTTTAGGATTGCCGAATTTCCCGAGAGTTCC
			236	AMX(449)_D5	ATGCTTTTATACCTTCGGCCATATTGCTTAGGTTGGGTAGGGTGGTAGCTGAGTATTGCCGAATTTCCCGAGAGTTCC
237	AMX(449)_D6	ATGCTTTTATACCTTCGGCGAGAGTGCATAGGTTGGGTAGGGTGGTTCTGTTGATCGCCGAATTTCCCGAGAGTTCC

SEQID NO	Clone's title	Sequence
			238	AMX(449)_D7	ATGCTTTTATACCTTCGGCCGATACAGGCTAGGTTGGGTAGGGTGGTGGCTGTTAATCGCCGAATTTCCCGAGAGTTCC
239	AMX(449)_D8	ATGCTTTTATACCTTCGGCGATATTGCCTAGGTTGGGTAGGGTGGTGGCTGGGGATTGCCGAATTTCCCACAGTTCC
			240	AMX(449)_D9	ATGCTTTTATACCTTCGGCCATAATAACTAGGTTGGGTAGGGTGGTGGCTGATTATCGCCGAATTTCCCGAGAGTTCC
241	AMX(449)_D10	ATGCTTTTATACCTTCGGCGATATTGCCTAGGATGGGTAGGGTGGTGGCTAAGGTTTGCCGAATTTCCCGAGAGTTCC
			242	AMX(449)_D11	ATGCTTTTATACCTTCGGCGACACAGAGTAGGTTGGGTAGGGTGGTATCTGTCGAATGCCGAATTTCCCGAGAGTTCC
243	AMX(449)_D12	ATGCTTTTATACCTTCGGCGATACTGCCTAGGTTGGGTAGGGTGGTGGCTAGGGATCGCCGAATTTCCCGAGAGTTCC
			244	AMX(449)_E1	ATGCTTTTATACCTTCGGCGACATTACCTAGGTTGGGTAGGGTGGTGGCTAAGGGTTGCCGAATTTCCCGAGAGTTCC
245	AMX(449)_E2	ATGCTTTTATACCTTCGGCGGTTCAGCCTAGGATGGGTAGGGTGGTGGGTGAGGATTGCCGAATTTCCCGAGAGTTCC
			246	AMX(449)_E4	ATGCTTTTATACCTTCGGCGACATAGGGTAGGTTGGGTAGGGTGGTGCCTGAGGATTGCCGAATTTCCCGAGAGTTCC
247	AMX(449)_E5	ATGCTTTTATACCTTCGGCGGTACTGCATAGGTTGGGTAGGGTGGTGGCTGAACATTGCCGAATTTCCCGAGAGTTCC
			248	AMX(449)_E7	ATGCTTTTATACCTTCGGCGGTAGGGTTTAGGTTGGGTAGGGTGGTGTCTGAGGATTGCCGAATTTCCCGAGAGTTCC
249	AMX(449)_E9	ATGCTTTTATACCTTCGGCCATACAGACTAGGTTGGGTAGGGTGGTGTCTGAGGATCGCCGAATTTCCCGAGAGTTCC
			250	AMX(449)_E10	ATGCTTTTATACCTTCGGCGATAGTGCTTAGGTTGGGTAGGGTGGTAGCTGATCATTGCCGAATTTCCCGAGAGTTCC
251	AMX(449)_E11	ATGCTTTTATACCTTCGGCGGTACTGCATAGGTTGGGTAGGGTGGTGGCTGAGAATCGCCGAATTTCCCGAGAGTTCC
			252	AMX(449)_E12	ATGCTTTTATACCTTCGGCGGCACTGGCTAGGATGGGTAGGGTGGTGGCTGAGCATTGCCGAATTTCCCGAGAGTTCC
253	AMX(449)_F1	ATGCTTTTATACCTTCGGCGATAACTGCCTAGGTTGGGTAGGGTGGTGGCTCACGATCGTCGAATTTCCCGAGAGTTCC
			254	AMX(449)_F3	ATGCTTTTATACCTTCGGCGATACTGCATAGGATGGGTAGGGTGGTTGCTGATGTGTGCCGAATTTCCCGAGAGTTCC
255	AMX(449)_F4	ATGCTTTTATACCTTCGGCGATGTTGCCTAGGTTGGGTAGGGTGGTGGTTGTGAGTTGCCGAATTTCCCGAGAGTTCC
			256	AMX(449)_F5	ATGCTTTTATACCTTCGGCGACACTGTATAGGTTGGGTAGGGTGGTGGCTGATGATTGCCGAATTTCCCGAGAGTTCC
257	AMX(449)_F6	ATGCTTTTATACCTTCGGCCACATTGCATAGGTTGGGTAGGGTGGTGGCAAAGTACTGCCGAATTTCCCGAGAGTTCC
			258	AMX(449)_F7	ATGCTTTTATACCTTCGGCGATACAGGTTAGGATGGGTAGGGTGGTGGCTGAGTACTGCCGAATTTCCCGAGAGTTCC
259	AMX(449)_F9	ATGCTTTTATACCTTCGGCGATAAGGGCTAGGATGGGTAGGGTGGTGACTAAAACTCGCCGAATTTCCCGAGAGTTCC
			260	AMX(449)_F10	ATGCTTTTATACCTTCGGCGAGATTGGCTAGGGTGGGTAGGGTGGTGCTAGATGATTGCCGAATTTCCCGAGAGTTCC
261	AMX(449)_F11	ATGCTTTTATACCTTCGGCGACAATGACTAGGTTGGGTAGGGTGGTGTCTTAGGATGGCCGAATTTCCCGAGAGTTCC

SEQID NO	Clone's title	Sequence
			262	AMX(449)_F12	ATGCTTTTATACCTTCGGCGGTACTGTCTAGGTTGGGTAGGGTGGTGTCAGTTGATCGCCGAATTTCCCGAGAGTTCC
263	AMX(449)_G1	ATGCTTTTATACCTTCGGCCATACAAACTAGGTTGGGTAGGGTGGTGTTTGCTGATTGCCGAATTTCCCGAGAGTTCC
			264	AMX(449)_G2	ATGCTTTTATACCTTCGGCGAAACAGTATAGGTTGGGTAGGGTGGTTGCTGATTATCGCCGAATTTCCCGAGAGTTTCC
265	AMX(449)_G3	ATGCTTTTATACCTTCGGCGATATTGCCTAGGTTGGGTAGGGTGGTGGTTGAAAATCGCCGAATTTCCCGAGAGTTCC
			266	AMX(449)_G4	ATGCTTTTATACCTTCGGCGGTACGGTTCTAGGTTGGGTAGGGTGGTGTTTGGGTGTCGCCGAATTTCCCGAGAGTTCC
267	AMX(449)_G6	ATGCTTTTATACCTTCGGCGATACTGTCTAGGTTGGGTAGGGTGGTGGCTTAGGATTGCCGAATTTCCCGAGAGTTCC
			268	AMX(449)_G8	ATGCTTTTATACCTTCGGCGGTACTGTATAGGTTGGGTAGGGTGGTTGCTGTGGATTGTCGAATTTCCCGAGAGTTCC
269	AMX(449)_G9	ATGCTTTTATACCTTCGGCGATAGGGCCTAGGTTGGGTAGGATGGTGGTCATAAATCGCCGAATTTCCCGAGAGTTCC
			270	AMX(449)_G10	ATGCTTTTATACCTTCGGCGCTACAGGCTAGGTTGGGTAGGGTGGTGGTTGGGAATCGCCGAATTTCCCGAGAGTTCC
271	AMX(449)_G11	ATGCTTTTATACCTTCGGCCATACTGTCTAGGTTGGGTAGGGTGGTGGTTGAGTATTGCCGAATTTCCCGAGAGTTCC
			272	AMX(449)_G12	ATGCTTTTATACCTTCGGCGGATACTGTCTAGGTTGGGTAGGGTGGTGACTGAGGATGGTCGAATTTCCCGAGAGTTCC
273	AMX(449)_H2	ATGCTTTTATACCTTCGGCGGTGGTCTGTAGGTTGGGTAGGGTGGTTGCTTGGAATCGCCGAATTTCCCGAGAGTTCC
			274	AMX(449)_H3	ATGCTTTTATACCTTCGGCGCGATTGCCTAGGTTGGGTAGGGTGGTGGCTTAGTATTGCCGAATTTCCCGAGAGTTCC
275	AMX(449)_H4	ATGCTTTTATAGCTTCGGCGATAGGGACTAGGTTGGGTAGGGTGGTGGCTGAGTATTGCCGAATTTCCCGAGAGTTCC
			276	AMX(449)_H5	ATGCTTTTATACCTTCGGCGACAATGGCTAGGGTGGGTAGGGTGGTGGCTTAGGATTGCCGAATTTCCCGAGAGTTCC
277	AMX(449)_H6	ATGCTTTTATACCTTCGGCGGTAGTGTGTAGGGTGGGTAGGGTGGTAGCTGAGGATCGCCGAATTTCCCGAGAGTTCC
			278	AMX(449)_H7	ATGCTTTTATACCTTCGGCGACACTGGTTAGGGTGGGTAGGGTGGTGGTTGTGGATTGCCGAATTTCCCGAGAGTTCC
279	AMX(449)_H8	ATGCTTTTATACCTTCGGCGATACTGTCTAGGTTGGGTAGGGTGGTGTTTTAGGATTGCCGAATTTCCCGAGAGTTCC
			280	AMX(449)_H9	ATGCTTTTATACCTTCGGCGGTACAGTCTAGGTTGGGTAGGGTGGTGGCTGTTGATGGCCGAATTTCCCGAGAGTTCC
281	AMX(449)_H10	ATGCTTTTATACCTTCGGCGGGTATTGCCTAGGTTGGGTAGGGTGGTGGCTCAGTCTTGCCGAATTTCCCGAGAGTTCC
			282	AMX(449)_H11	ATGCTTTTATACCTTCGGCGGCACGGTCTAGGATGGGTAGGGTGGTTGCTGATAATCGCCGAATTTCCCGAGAGTTCC

Table 12: from the doping one group of minimized construct reselecting the sudden change design that obtains of ARC2091 (SEQ ID NO 197)

SEQID NO	Clone's title	Sequence
			283	ARC2169	ACTGCCTAGGTTGGGTAGGGTGGTGGCAGT
284	ARC2169.1	ACTGCCTAGGATGGGTAGGGTGGTGGCAGT
			285	ARC2169.2	ACTGCCTAGGGTGGGTAGGGTGGTGGCAGT
286	ARC2169.3	ACTGCCTAGGTTGGGTAGTGTGGTGGCAGT
			287	ARC2169.4	ACTGCCTAGGTTGGGTAGGATGGTGGCAGT
288	ARC2169.5	ACTGCCTAGGTTGGGTAGGGCGGTGGCAGT
			289	ARC2169.6	ACTGCATAGGTTGGGTAGGGTGGTTGCAGT
290	ARC2169.7	ACTGCATAGGTTGGGTAGGGTGGTGGCAGT
			291	ARC2169.8	ACTGCATAGGTTGGGTAGGGTGGTGCAGT

[00242] adopts ARC2091 (SEQ ID NO 197) and the doping data of reselecting, further ARC2169 (SEQ ID NO 283) is minimised as the fit of 26 Nucleotide, be called ARC2172 (SEQ ID NO 294), and do not destroy binding affinity to zymoplasm, as shown in table 13 below.DNA for hereinafter table 13 description is fit, and all Nucleotide (A, T, C and G) all are deoxynucleotides.(adopt RNAstructure (1996-2004) David H.Mathews, Michael Zuker ﹠amp; Douglas H.Turner) secondary structure of the ARC2169 that infers (SEQ ID NO 283), ARC2171 (SEQ ID NO 293) and ARC2172 (SEQ ID NO 294) is shown in Fig. 5.Unless otherwise noted, each sequence is with 5 ' to 3 ' direction indication.

Table 13: based on the sequence that minimizes construct of the fit ARC2169 of parent (SEQ ID NO 283) with in conjunction with feature

SEQID NO	Clone's title	Sequence	KD (nM) to zymoplasm
				283	ARC2169	ACTGCCTAGGTTGGGTAGGGTGGTGGCAGT	0.135
292	ARC2170	GCTGCCTAGGTTGGGTAGGGTGGTGGCAGC	0.190
				293	ARC2171	CTGCCTAGGTTGGGTAGGGTGGTGGCAG	0.221
294	ARC2172	CGCCTAGGTTGGGTAGGGTGGTGGCG	0.140

[00243] adopt nitrocellulose filter that embodiment 1A above describes in conjunction with mensuration, with ARC2172 (SEQ ID) NO 294) the fit ARC183 of DNA of binding affinity and the bind thrombin of identifying in the past compare.As shown in Figure 6, ARC2172 (SEQ ID NO 294) demonstrates the remarkable improvement to the avidity of zymoplasm with respect to ARC183.

[00244] also adopt nitrocellulose filter in conjunction with mensuration, tested the anti-people of ARC2172 (SEQ IDNO 294), pig and rat zymoplasm (all from Enzyme Research Labs, SouthBend, species cross reactivity IN).As shown in Figure 7, ARC2172 (SEQ ID NO 294) and pig and rat zymoplasm and human thrombin combine.

Embodiment 2C: the optimization that minimizes clone ARC1985 and ARC2169

[00245] observed small overall downside, the minimizing of fit size reduces when attempting along with minimizing wherein to measure fit function that (referring to embodiment 3B) measure by ACT.Therefore, initial optimization is attempted relating to by adding extra base pair or poly--T tail prolongs molecule on the stem structure of inferring.The following molecule that sequence is listed in the table 14 hereinafter is based on ARC1985 (SEQ ID NO 191) and ARC2169 (SEQ ID NO 283): the ARC2173-ARC2184 of design has added 1-5 extra base pair at 5 ' or 3 ' end, and the ARC2185-ARC2196 of design has added 3 or 6 " T " at 5 ' or 3 ' end.The antithrombin fit (ARC 183) (SEQ ID NO 4) of selection was fit before ARC2183 and ARC2184 were based on, before determining in the trial of the fit ARC183 of zymoplasm of selection and any similarity between this component, the stem element of ARC1985 (at ARC2183) or ARC2169 (at ARC2184) is incorporated on the ARC183.The fit functional of these optimizations tested in single-point screening (the fit concentration of 10 μ M) in measuring with the ACT that describes among the embodiment 3B hereinafter.

[00246] DNA for hereinafter embodiment 14 descriptions is fit, and all Nucleotide (A, T, C and G) all are deoxynucleotides.Unless otherwise noted, each sequence is with 5 ' to 3 ' direction indication.

Table 14: the fit sequence that in the fs optimizing process of ARC1985 and ARC2169 (SEQ ID NO 283), produces

SEQ IDNO	Clone's title	Sequence
			295	ARC2173	ACCTCAGGGATGGTGTGGGTGGCTGAGGT
296	ARC2174	TACCTCAGGGATGGTGTGGGTGGCTGAGGTA
			297	ARC2175	CTACCTCAGGGATGGTGTGGGTGGCTGAGGTAG
298	ARC2176	ACTACCTCAGGGATGGTGTGGGTGGCTGAGGTAGT
			299	ARC2177	GACTACCTCAGGGATGGTGTGGGTGGCTGAGGTAGTC
300	ARC2178	AACTGCCTAGGTTGGGTAGGGTGGTGGCAGTT
			301	ARC2179	TAACTGCCTAGGTTGGGTAGGGTGGTGGCAGTTA
302	ARC2180	CTAACTGCCTAGGTTGGGTAGGGTGGTGGCAGTTAG
			303	ARC2181	ACTAACTGCCTAGGTTGGGTAGGGTGGTGGCAGTTAGT
304	ARC2182	GACTAACTGCCTAGGTTGGGTAGGGTGGTGGCAGTTAGTC
			305	ARC2183	CCTCAGGGTTGGTGTGGTTGGCTGAGG
306	ARC2184	ACTGCCTAGGTTGGTGTGGTTGGTGGCAGT
			307	ARC2185	CCTCAGGGATGGTGTGGGTGGCTGAGGTTT
308	ARC2186	CCTCAGGATGGTGTGGGTGGGTGAGGTTTTTT
			309	ARC2187	TTTCCTCAGGGATGGTGTGGGTGGCTGAGG
310	ARC2188	TTTTTTCCTCAGGGATGGTGTGGGTGGCTGAGG
			311	ARC2189	TTTCCTCAGGGATGGTGTGGGTGGCTGAGGTTT

SEQ IDNO	Clone's title	Sequence
			312	ARC2190	TTTTTTCCTCAGGGATGGTGTGGGTGGCTGAGGTTTTTT
313	ARC2191	CTGCCTAGGTTGGGTAGGGTGGTGGCAGTTT
			314	ARC2192	CTGCCTAGGTTGGGTAGGGTGGTGGCAGTTTTTT
315	ARC2193	TTTCTGCCTAGGTTGGGTAGGGTGGTGGCAG
			316	ARC2194	TTTTTTCTGCCTAGGTTGGGTAGGGTGGTGGCAG
317	ARC2195	TTTCTGCCTAGGTTGGGTAGGGTGGTGGCAGTTT
			318	ARC2196	TTTTTTCTGCCTAGGTTGGGTAGGGTGGTGGCAGTTTTTT

[00247] further optimize and adopt ARC2169 (SEQ ID NO 283) as base molecule, with the synthetic a series of derivatives of 1 micromole, so that with 2 '-OMe or alternative separately each base of thiophosphatephosphorothioate base.With dI (Hypoxanthine deoxyriboside) or mI (2 '-OMe) base replaces all dG (pancreatic desoxyribonuclease) base separately.Each molecule is by the PAGE gel-purified, and the employing dot blotting is in conjunction with mensuration under the condition of above embodiment 1 description, and measurement combines with zymoplasm.The sequence of these ARC2169 (SEQ ID NO 283) derivative and list in hereinafter table 15 in conjunction with feature.Based on the binding data shown in the table 15, determine that single the replacement all not have combining of significantly increase and zymoplasm.

[00248] for table 15 hereinafter describe fit, " d " represent deoxynucleotide, " m " expression 2 '-OMe Nucleotide, " I " represents inosine, " s " represents key between thiophosphatephosphorothioate Nucleotide.Unless otherwise noted, each sequence is with 5 ' to 3 ' direction indication.

The fit sequence that produces during the further optimization of table 15:ARC2169 (SEQ ID NO 283)

SEQ IDNO	Clone's title	Sequence	K D (pM)
				319	ARC2613	mAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	173
320	ARC2614	dAmCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	52
				321	ARC2615	dAdCmUdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	94
322	ARC2616	dAdCTmGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	91
				323	ARC2617	dAdCTdGmCdCTdAdGdGTTdGdGdTdAdGdGdGTdGdGTdGdGdCdAdGT		80
324	ARC2618	dAdCTdGdCmCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	121
				325	ARC2619	dAdCTdGdCdCmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	215
326	ARC2620	dAdCTdGdCdCTmAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	7100
				327	ARC2621	dAdCTdGdCdCTdAmGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	1519
328	ARC2622	dAdCTdGdCdCTdAdGmGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	38
				329	ARC2623	dAdCTdGdCdCTdAdGdGmUTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	746
330	ARC2624	dAdCTdGdCdCTdAdGdGTmUdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	NB
				331	ARC2625	dAdCTdGdCdCTdAdGdGTTmGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	568
332	ARC2626	dAdCTdGdCdCTdAdGdGTTdGmGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	1587
				333	ARC2627	dAdCTdGdCdCTdAdGdGTTdGdGmGTdAdGdGdGTdGdGTdGdGdCdAdGT	NB
334	ARC2628	dAdCTdGdCdCTdAdGdGTTdGdGdGmUdAdGdGdGTdGdGTdGdGdCdAdGT	207
				335	ARC2629	dAdCTdGdCdCTdAdGdGTTdGdGdGTmAdGdGdGTdGdGTdGdGdCdAdGT	NB
336	ARC2630	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAmGdGdGTdGdGTdGdGdCdAdGT	5244
				337	ARC2631	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGmGdGTdGdGTdGdGdCdAdGT	4957
338	ARC2632	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGmGTdGdGTdGdGdCdAdGT	NB
				339	ARC2633	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGmUdGdGTdGdGdCdAdGT	NB
340	ARC2634	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTmGdGTdGdGdCdAdGT	549

SEQ IDNO	Clone's title	Sequence	KD (pM)
				341	ARC2635	dAdCTddCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGmGTdGdGdCdAdGT	248
342	ARC2636	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUdGdGdCdAdGT	102
				343	ARC2637	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTmdGdCdAdGT	118
344	ARC2638	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGmGdCdAdGT	192
				345	ARC2639	dAdCTddCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGmCdAdGT		80
346	ARC2640	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTddGTdGdGdCmAdGT	174
				347	ARC2641	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAmGT	171
348	ARC2642	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGmU	94
				349	ARC2644	dA-s-dCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	183
350	ARC2645	dAdC-s-TdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	167
				351	ARC2646	dAdCT-s-dGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	169
352	ARC2647	dAdCTdG-s-dCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	161
				353	ARC2648	dAdCTdGdC-s-dCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	128
354	ARC2649	dAdCTdGdCdC-s-TdAdGdGTTdGdGdGTdAddGdGTdGdGTdGdGdCdAdGT	264
				355	ARC2650	dAdCTdGdCdCT-s-dAdGdGTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	230
356	ARC2651	dAdCTdGdCdCTdA-s-dGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	111
				357	ARC2652	dAdCTdGdCdCTdAdG-s-dGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	192
358	ARC2653	dAdCTdGdCdCTdAdGdG-s-TTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	66
				359	ARC2654	dAdCTdGdCdCTdAdGdGT-s-TdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	95
360	ARC2655	dAdCTdGdCdCTdAdGdGTT-s-dGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	79

SEQ IDNO	Clone's title	Sequence	KD (pM)
				361	ARC2656	dAdCTdGdCdCTdAdGdGTTdG-s-dGdGTdAdGddGTdGdGTdGdGdCdAdGT	151
362	ARC2657	dAdCTdGdCdCTdAdGdGTTdGdG-s-dGTdAdGdGdGTdGdGTdGdGdCdAdGT	219
				363	ARC2658	dAdCTdGdCdCTdAdGdGTTdGdGdG-s-TdAdGdGdGTdGdGTdGdGdCdAdGT	253
364	ARC2659	dAdCTdGdCdCTdAdGdGTTdGdGdGT-s-dAdGdGdGTdGdGTdGdGdCdAdGT	452
				365	ARC2660	dAdCTdGdCdCTdAdGdGTTdGdGdGTdA-s-dGdGdGTdGdGTdGdGdCdAdGT	230
366	ARC2661	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdG-s-dGdGTdGdGTdGdGdCdAdGT	246
				367	ARC2662	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdG-s-dGTdGdGTdGdGdCdAdGT	165
368	ARC2663	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdG-s-TdGdGTdGdGdCdAdGT	180
				369	ARC2664	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGT-s-dGdGTdGdGdCdAdGT	211
370	ARC2665	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdG-s-dGTdGdGdCdAdGT	121
				371	ARC2666	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdG-s-TdGdGdCdAdGT	992
372	ARC2667	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGT-s-dGdGdCdAdGT	459
				373	ARC2668	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdG-s-dGdCdAdGT	159
374	ARC2669	dAdCTdGdCdCTdAdGdCTTdGdGdGTdAdGdGdGTdGdGTdGdG-s-dCdAdGT	129
				375	ARC2670	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdC-s-dAdGT	160
376	ARC2671	dAdCTdGdCT1CTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdA-s-dGT	158
				377	ARC2672	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdTddTdGdGdCdAdG-s-T	141
378	ARC2673	dAdCTdIdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	207
				379	ARC2674	dAdCTdGdCdCTdAdIdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	452
380	ARC2675	dAdCTdGdCdCTdAdGdITTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	2030
				381	ARC2676	dAdCTdGdCdCTdAdGdGTTdIdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	698
382	ARC2677	dAdCTdGdCdCTdAdGdGTTdGdIdGTdAdGdGdGTdGdGTdGdGdCdAdGT	199
				383	ARC2678	dAdCTdGdCdCTdAdGdGTTdGdGdITdAdGdGdGTdGdGTdGdGdCdAdGT	1430

SEQ IDNO	Clone's title	Sequence	KD (pM)
				384	ARC2679	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdIdGdGTdGdGTdGdGdCdAdGT	355
385	ARC2680	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdIdGTdGdGTdGdGdCdAdGT	240
				386	ARC2681	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdITdGdGTdGdGdCdAdGT	334
387	ARC2682	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdIdGTdGdGdCdAdGT	1298
				388	ARC2683	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdITdGdGdCdAdGT	151
389	ARC2684	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdIdGdCdAdGT	188
				390	ARC2685	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdIdCdAdGT	226
391	ARC2686	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdTT	189
				392	ARC2687	dAdCTmIdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	220
393	ARC2688	dAdCTdGdCdCTdAmIdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	NB
				394	ARC2689	dAdCTdGdCdCTdAdGmITTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	NB
395	ARC2690	dAdCTdGdCdCTdAdGdGTTmIdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT	NB
				396	ARC2691	dAdGTdGdCdCTdAdGdGTTdGTmIdGTdAdGdGdGTdGdGTdGdCdAdGT	2279
397	ARC2692	dAdCTdGdCdCTdAdGdGTTdGdGmITdAdGdGdGTdGdGTdGdGdCdAdGT	1840
				398	ARC2693	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAmIdGdGTdGdGTdGdGdCdAdGT	NB
399	ARC2694	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGmIdGTdGdGTdGdGdCdAdGT	NB
				400	ARC2695	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGmITdGdGTdGdGdCdAdGT	2084
401	ARC2696	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTmIdGTdGdGdCdAdGT	NB
				402	ARC2697	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGmITdGdGdCdAdGT	1558
403	ARC2698	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTmIdGdCdAdGT	165
				404	ARC2699	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGmIdCdAdGT		128
405	ARC2700	dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAmIT	46

* NB=is non-binding dose

The 2nd stage of embodiment 2D:ARC2169, ARC2170, ARC2171 and ARC2172

[00249] carried out the extra optimizing phase, be mainly used in the time length (because for this compound, needing to associate rapidly/rapid dissociation curve) of regulating leading fit activity in vivo.For this reason, design a series of constructs, tolerated 2 '-OMe base in its stem district.Also change stem, made some G-C base pairs become the A-T base pair, thereby weakened base pairing, and may reduce the stability of molecule, and can faster degraded.Hereinafter adopt ARC2169 (SEQ ID NO283), ARC2170 (SEQ ID NO 292), ARC2171 (SEQ ID NO 293) and ARC2172 (SEQ ID NO 294) have summarized the sudden change that 2 '-OMe replacement and G-C change into A-T base pair form as parent's molecule.Every kind fit synthetic with the synthetic scale of 1 micromole, and use the PAGE purifying, and the dot blotting of describing by embodiment 1 is above measured then, and measurement combines with zymoplasm.

[00250] sequence of the optimization construct of this series and list in hereinafter table 16 in conjunction with feature.For table 16 hereinafter describe fit, " d " represent deoxynucleotide, " m " represent 2 '-OMe Nucleotide.Unless otherwise noted, each sequence is with 5 ' to 3 ' direction indication.

Table 16: the sequence of the ARC2169 of optimization, ARC2170, ARC2171, ARC2172 and in conjunction with feature

SEQ IDNO	Clone's title	Sequence	KD (nM)
				406	ARC2823	mAmCmUmGmCmCmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUmGdGmCmAmGmU	9.10
407	ARC2824	mAmCmUmGmCmCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTmGdGmCmAmGmU	0.73
				408	ARC2825	mAmCmUmGmCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGmCmAmGmU	1.03
409	ARC2826	dAdATdGdATTdAdGdGTTdGddGTdAdGdGdGTdGdGTdATdCdATT	0.77
				410	ARC2827	mAmAmUmGmAmUmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUmAmUmCmAmUmU	4.06
411	ARC2828	mAmAmUmGmAmUTdAdGdTTdGdGdGTdAdGdGdGTdGdGTmAmUmCmAmUmU	0.33
				412	ARC2829	mAmAmUmGmATTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdAmUmCmAmUmU	0.93
413	ARC2830	mCmUmGmCmCmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUmGdGmCmAmG	15.35
				414	ARC2831	mCmUmGmCmCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTmGdGmCmAmG	5.12
415	ARC2832	mCmUmGmCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGmCmAmG	1.88

SEQ IDNO	Clone's title	Sequence	KD (nM)
				416	ARC2833	dATdGdATTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdATdCdAT	2.16
417	ARC2834	mAmUmGmAmUmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUmAmUmCmAmU	10.31
				418	ARC2835	mAmUmGmAmUTdAdGdGTTdGdGdGTdAdGdGdGTddGTmAmUmCmAmU	1.27
419	ARC2836	mAmUmGmATTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdAmUmCmAmU	0.96
				420	ARC2837	mUmmCmCmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUmGdGmCmA	2.61
421	ARC2838	mUmGmCmCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTmGdGmCmA	0.77
				422	ARC2839	mUmGmCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGmCmA	0.58
423	ARC2840	TdGdATTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdATdCdA	0.25
				424	ARC2841	mUmGmAmUmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUmAmUmCmA	3.55
425	ARC2842	mUmGmAmUTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTmAmUmCmA	1.06
				426	ARC2843	mUmGmATTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdAmUmCmA	0.62
427	ARC2844	mGmCmCmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUmGdGmC	2.65
				428	ARC2845	mGmCmCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTmGdGmC	0.86
429	ARC2846	mGmGdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGmC	0.27
				430	ARC2847	dGdATTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdATdC	0.21
431	ARC2848	mGmAmUmUdAdGdGTTdGdGdGTdAdGdGdGTdGdGmUmAmUmC	2.09
				432	ARC2849	mGmAmUTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTmAmUmC	0.20
433	ARC2850	mGmATTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdAmUmC	0.33
				434	ARC2949	mCmGdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGmCmG	ND

* ND=undetermined

Embodiment 2E: fit-5 '-PEG conjugate synthetic

[00251] prolongs the PRELIMINARY RESULTS of optimizing trial the first time of carrying out based on above-described with stem, prepared little 5 '-PEG conjugate of fit ARC2169 of antithrombin (SEQ ID NO 283) and ARC2172 (SEQID NO 294).This notion is that little PEGs may improve fit usefulness, and active time length of function in the significant prolongation body (because for this compound, need to associate rapidly/dissociation curve) rapidly not.By at first synthetic 5 ' fit-amine-modified form, prepare fit, with the promotion chemical coupling.Program according to manufacturer recommendation, with standard available commercial DNA phosphoramidite (ChemGenes Corp.Wilmington, MA) and the synthetic 5 ' NH2-dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT 3 ' (ARC2321 of following upholder, SEQ ID NO 435) and 5 ' NH2-dCdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdG 3 ' (ARC2324, SEQ ID NO 436), described upholder is: for ARC2327 (SEQ ID NO439) and 2338 (SEQ ID NO 438), be primer upholder 200dG (CAT#17-5262-02, GE Healthcare, Uppsala, Sweden); For ARC2329 (SEQ ID NO 440) is iBuDMT pancreatic desoxyribonuclease CPG upholder (CAT# CPG60N11DGVN, Prime Synthesis, Aston, PA), for ARC2323 (SEQ ID NO 437), be DMT deoxythymidine CPG upholder (CAT# CPG60N11DTN, Prime Synthesis, Aston, PA).

[00252] (ChemGenesCorp.Wilmington MA) connects the terminal amine function with 5 '-amido modified dose amino C-6 CED of TFA phosphoramidite.After going protection, by Super Q 5PW (30) resin (Tosoh Biosciences, Montgomeryville, PA) the ion-exchange chromatogram purification oligonucleotide on, and use ethanol sedimentation.

[00253] with 5 '-amine-modified fit five equilibrium thing puts together after synthetic in peg moiety (for example 2,5 and 10kDa peg moiety).With fit water/DMSO (1:1) solution that is dissolved in, reach the concentration of 1.5-3mM.Add sodium carbonate buffer pH8.5, reach the final concentration of 100mM, make oligomer and 1.7-3 times molar excess required PEG reagent (10KDa SunbrightGL2-400NP is right-nitrophenyl carbonate (NOF Corp, Japan]) to react and spend the night, described PEG agent dissolves is in isopyknic acetonitrile.By at Super Q 5PW (30) resin (TosohBiosciences, Montgomeryville, PA) carry out ion-exchange chromatography on and Pegylation product that purifying obtains, with Amberchrom CG300-S resin (Rohm and Haas, Philadelphia, PA) the reverse-phase chromatography desalination of carrying out on, and freeze-drying.

[00254] hereinafter listed the fit sequence of the Pegylation that obtains.In people's whole blood, with multiple concentration fit in ACT measures test these are fit, and their 5 ' amine counterpart (referring to embodiment 3B).

[00255] for every kind of sequence hereinafter listing, lowercase " d " expression deoxynucleotide (is noted, all Nucleotide in the sequence of hereinafter listing all are deoxynucleotides, comprise " T ", it is expressed as " T " rather than is expressed as " dT "), and " NH " expression promotes the hexylamine of chemical coupling.

ARC2323 (SEQ ID NO 437) (ARC2169+5 '-amine+10kDa PEG)

PEG10K-nb-dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGT

It comprises following structure:

Wherein fit=dAdCTdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdAdGTARC2 338 (SEQ ID NO 438) (ARC2172+5 '-amine+2kDa PEG)

It comprises following structure PEG2K-nh-dCdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdG:

Wherein fit=dCdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdG

ARC2327 (SEQ ID NO 439) (ARC2172+5 '-amine+5kDa PEG)

PEG5K-nh-dCdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdG

It comprises following structure:

Wherein fit=dCdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdG

ARC2329 (SEQ ID NO 440) (ARC2172+5 '-amine+10kDa PEG)

PEG10K-nh-dCdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdG

It comprises following structure:

Wherein fit=dCdGdCdCTdAdGdGTTdGdGdGTdAdGdGdGTdGdGTdGdGdCdG

Embodiment 3: external functional examination

Embodiment 3A: prothrombin assay

[00256] tissue factor is the strong inductor of " external source " coagulation pathway, and it discharges at damage location.The time of blood coagulation when prothrombin time (＂ PT ＂) measurement adds blood plasma with excessive tissue factor, and the most responsive to the level of exogenous route factor VII and " jointly " approach factor I (Fibrinogen), II (thrombogen), V and X.The PT reagent that is called thromboplastin is by forming with phosphatide and calcium blended tissue factor, and they are the necessary common factors that activate some thrombin.Except the diagnostic factro defective, clinical PT is most commonly used to monitor the oral anticoagulant warfarin, promptly a kind of vitamin K antagonist.PT is not used in the clinical monitoring heparin, but to being used for the high heparin concentration sensitivity of CABG, and it (is 142% of normal control during the 1U/mL heparin for example, the PT time that described concentration is up to 5U/mL; Data not shown goes out).

[00257] PT measures and utilizes Coag-a-mate blood coagulation analyzer (Biomerieux, Durham, NC), the human plasma of freeze dried thromboplastin (Fisher Scientific), Citrated (Innovative Research, Southfield, MI) and concentration known fit.Test panel (Biomerieux, Durham, NC) in, with the blood plasma of Citrated with incubation 3 minutes in advance under fit 37 ℃ of concentration known.(Middletown is VA) (at 10mL ddH for PacificHemostasis, Fisher Diagnostics to use 200 μ l thromboplastin-D then ₂Resuspended among the O from lyophilized form) initial blood coagulation, and definite clotting time, analyze the specimen on the Coag-a-mate.Adopt the double sample, the average out to single PT time.The clotting time of measuring when not having inhibitor/fit is about 13 seconds, its clinical " normally " of 12-14 second to illumination range in.300 seconds value is the maximum value of this apparatus measures.

[00258] measuring screening with the PT that describes selects the 9th of #1 to take turns fit (referring to the embodiment 1A) minimizing or the active ability of Trombin inhibiting of evaluation from the blood coagulation enzyme dna.In the human plasma of Citrated, add rabbit thromboplastin (Pacific Hemostasis, FisherDiagnostics, Middletwon, VA), adopt Coag-A-Mate (Biomerieux, Durham NC) carries out the optical detection that fibrin polymer forms, thereby measures 3 or 10 the micromole is fit PT value when existing.Select the 9th fit PT value of taking turns the 10uM bind thrombin of evaluation of #1 to be listed in the table below 17 from DNA.Note the PT value deduction that background value is not listed from table 17.

Table 17: the PT value that zymoplasm is fit-DNA selects the 9th of #1 to take turns

SEQ ID NO	Clone's title	PT when 10uM is fit (sec)
			9	AMX(453)_A6	12.8
10	AMX(453)_A9	29.3
			11	AMX(453)_B6	300.0
12	AMX(453)_B8	11.9
			13	AMX(453)_B10	24.8
14	AMX(453)_B12	12.8
			15	AMX(453)_C10	104.3
16	AMX(453)_D12	12.7
			17	AMX(453)_E4	15.9
18	AMX(453)_E8	13.1
			19	AMX(453)_E10	11.8
20	AMX(453)_E12	12.2
			21	AMX(453)_F6	300.0

SEQ ID NO	Clone's title	PT when 10uM is fit (sec)
			22	AMX(453)_F7	28.6
23	AMX(453)_F11	65.8
			24	AMX(453)_G5	29.3
25	AMX(453)_G11	12.2
			26	AMX(453)_H11	15.6
27	AMX(454)_B7	12.2
			28	AMX(454)_B9	32.0
29	AMX(454)_B12	21.9
			30	AMX(454)_D5	13.0
31	AMX(454)_D6	11.4
			32	AMX(454)_D11	43.4
33	AMX(454)_D12	12.0
			34	AMX(454)_F2	300.0
35	AMX(454)_F7	12.7
			36	AMX(454)_F9	25.0
37	AMX(454)_G2	15.6
			38	AMX(454)_G6	12.5
39	AMX(454)_H3	35.4
			40	AMX(454)_H6	11.5
41	AMX(454)_H7	12.1

[00259] also adopt above-described PT to measure, the fit construct (referring to embodiment 2A) that minimizes of selecting the 7th of #2 and #3 to take turns the bind thrombin of evaluation with the fit screening DNA of 10 μ M reduces or the active ability of Trombin inhibiting.The PT value (comprising background) that minimizes construct ARC1985 is shown in following table 18.

Table 18: minimize the fit PT value of zymoplasm from what DNA selected that the 7th of #2 takes turns

SEQ ID NO	Clone's title	PT when 10uM is fit (sec)
			191	ARC 1985	78

[00260] also adopts 10 μ M fit, in above-described PT measures, screened fit (referring to the embodiment 2A) high binding affinity, that select the 9th of #2 and #3 to take turns the bind thrombin of evaluation at DNA that show zymoplasm and reduced or the active ability of Trombin inhibiting.The results are shown in hereinafter table 19.Notice that the ＂ N/A ＂ in the table 19 hereinafter represents not measure the PT value.

Table 19: the fit PT value (comprising background) of the 9th zymoplasm of taking turns of selecting #2 and #3 from DNA

SEQ IDNO	Clone's title	PT when 10uM is fit (sec)
			63	AMX(398)_A1	N/A
64	AMX(398)_A2	N/A
			65	AMX(398)_A4	11.0
66	AMX(398)_A6	N/A
			67	AMX(398)_A7	N/A
68	AMX(398)_A8	11.2
			69	AMX(398)_A9	N/A
70	AMX(398)_A12	12.0
			71	AMX(398)_B1	N/A
72	AMX(398)_B2	11.0
			73	AMX(398)_B3	N/A
74	AMX(398)_B5	N/A
			75	AMX(398)_B9	N/A
76	AMX(398)_B10	N/A
			77	AMX(398)_B11	N/A

SEQ IDNO	Clone's title	PT when 10uM is fit (sec)
			78	AMX(398)_B12	N/A
79	AMX(398)_C1	11.4
			80	AMX(398)_C2	N/A
81	AMX(398)_C3	N/A
			82	AMX(398)_C5	64.7
83	AMX(398)_C6	N/A
			84	AMX(398)_C8	300.0
85	AMX(398)_C9	N/A
			86	AMX(398)_C10	58.8
87	AMX(398)_C11	11.3
			88	AMX(398)_C12	N/A
89	AMX(398)_D1	N/A
			90	AMX(398)_D3	N/A
91	AMX(398)_D5	N/A
			92	AMX(398)_D6	300.0
93	AMX(398)_D7	11.4
			94	AMX(398)_D9	80，8
95	AMX(398)_E1	N/A
			96	AMX(398)_E2	N/A
97	AMX(398)_E3	11.1
			98	AMX(398)_E5	N/A
99	AMX(398)_E6	N/A
			100	AMX(398)_E7	N/A
101	AMX(398)_E8	N/A
			102	AMX(398)_E11	N/A
103	AMX(398)_E12	10.7
			104	AMX(398)_F2	N/A
105	AMX(398)_F5	N/A

SEQ IDNO	Clone's title	PT when 10uM is fit (sec)
			106	AMX(398)_F6	N/A
107	AMX(398)_F8	N/A
			108	AMX(398)_F9	N/A
109	AMX(398)_F12	10.8
			110	AMX(398)_G2	N/A
111	AMX(398)_G6	10.7
			112	AMX(398)_G7	N/A
113	AMX(398)_G8	N/A
			114	AMX(398)_G11	N/A
115	AMX(398)_H1	N/A
			116	AMX(398)_H5	71.0
117	AMX(398)_H6	11.0
			118	AMX(398)_H7	N/A
119	AMX(398)_H8	N/A
			120	AMX(398)_H10	N/A
121	AMX(399)_A2	11.3
			122	AMX(399)_A3	N/A
123	AMX(399)_A5	N/A
			124	AMX(399)_A6	N/A
125	AMX(399)_A7	N/A
			126	AMX(399)_A10	N/A
127	AMX(399)_A11	N/A
			128	AMX(399)_A12	N/A
129	AMX(399)_B2	N/A
			130	AMX(399)_B3	10.9
131	AMX(399)_B6	N/A
			132	AMX(399)_B8	N/A
133	AMX(399)_B9	N/A

SEQ IDNO	Clone's title	PT when 10uM is fit (sec)
			134	MX(399)_B10	N/A
135	AMX(399)_B11	N/A
			136	AMX(399)_B12	N/A
137	AMX(399)_C7	N/A
			138	AMX(399)_C8	10.7
139	AMX(399)_C9	N/A
			140	AMX(399)_C10	10.9
141	AMX(399)_C11	52.6
			142	AMX(399)_C12	N/A
143	AMX(399)_D2	12.5
			144	AMX(399)_D3	N/A
145	AMX(399)_D4	N/A
			146	AMX(399)_D5	10.5
147	AMX(399)_D6	N/A
			148	AMX(399)_D7	N/A
149	AMX(399)_D8	N/A
			150	AMX(399)_D9	N/A
151	AMX(399)_D10	10.7
			152	AMX(399)_D11	13.2
153	AMX(399)_D12	N/A
			154	AMX(399)_E1	10.8
155	AMX(399)_E3	N/A
			156	AMX(399)_E4	N/A
157	AMX(399)_E5	N/A
			158	AMX(399)_E8	N/A
159	AMX(399)_E9	N/A
			160	AMX(399)_E10	N/A
161	AMX(399)_E12	N/A

SEQ IDNO	Clone's title	PT when 10uM is fit (sec)
			162	AMX(399)_F1	N/A
163	AMX(399)_F2	N/A
			164	AMX(399)_F3	N/A
165	AMX(399)_F4	N/A
			166	AMX(399)_F5	11.0
167	AMX(399)_F6	N/A
			168	AMX(399)_F7	N/A
169	AMX(399)_F9	N/A
			170	AMX(399)_F10	N/A
171	AMX(399)_F11	11.2
			172	AMX(399)_F12	74.9
173	AMX(399)_G1	N/A
			174	AMX(399)_G2	N/A
175	AMX(399)_G3	N/A
			176	AMX(399)_G5	N/A
177	AMX(399)_G6	11.1
			178	AMX(399)_G8	N/A
179	AMX(399)_G9	N/A
			180	AMX(399)_G10	18.8
181	AMX(399)_G11	N/A
			182	AMX(399)_G12	13.4
183	AMX(399)_H1	N/A
			184	AMX(399)_H2	N/A
185	AMX(399)_H3	10.9
			186	AMX(399)_H4	N/A
187	AMX(399)_H6	N/A
			188	AMX(399)_H7	10.9
189	AMX(399)_H8	N/A

SEQ IDNO	Clone's title	PT when 10uM is fit (sec)
			190	AMX(399)_H9	N/A

[00261] also adopts 10 μ M fit, in above-described PT measures, screened the fit construct (referring to embodiment 2A) that minimizes of height zymoplasm specificity of selecting the 9th of #2 and #3 to take turns evaluation at DNA and reduced or the active ability of Trombin inhibiting.These minimize and fitly relatively are listed in the table below 20 with respect to obtaining the described fit PT value (comprising background) of parent that minimizes construct.

The 9th of table 20:DNA SELEX #2 and #3 takes turns: minimize fit and the fit PT value of comparing of parent separately during PT measures

Minimize fit SEQ ID NO	Minimize fit title	The parent is fit (SEQ ID NO)	10uM minimizes the PT (sec) when fit	PT when the 10uM parent is fit
					193	Minimer 1	AMX(399)_B3 (SEQ ID NO 130)	11.5	10.9
194	Minimer 2	AMX(398)_A4 (SEQ ID NO 65)	12.2	11.0
					195	Minimer 3	AMX(398)_D6(ARC2026) SEQ ID NO 92	25.8	300.0
196	Minimer 4	AMX(398)_D6(ARC2026 SEQ ID NO 92	11.4	300.0
					197	Minimer 5	AMX(398)_D6(ARC2026) SEQ ID NO 92	300.0	300.0
198	Minimer 6	AMX(398)_D6(ARC2026) SEQ ID NO 92	12.2	300.0

Minimize fit SEQ ID NO	Minimize fit title	The parent is fit (SEQ ID NO)	10uM minimizes the PT (sec) when fit	PT when the 10uM parent is fit
					199	Minimer 12	AMX(398)_D6(ARC2026) SEQ ID NO 92	10.3	300.0
200	Minimer 7	AMX(398)_C8 (SEQ ID NO 84)	83.3	300.0
					201	Minimer 8	AMX(398)_C8(ARC2027) (ARC2027)	10.1	300.0
202	Minimer 9	AMX(398)_C8(ARC2027) SEQ ID NO 84	10.6	300.0
					203	Minimer 10	AMX(398)_C8(ARC2027) SEQ ID NO 84	11.0	300.0
204	Minimer 11	AMX(398)_C8 (ARC2027) SEQ ID NO 84	27.9	300.0

[00262] also having screened the construct that minimizes that designs based on doping reselecting in above-described PT measures reduces or the active ability of Trombin inhibiting.The results are shown in following table 21.

Table 21: from ARC2091 (SEQ ID NO 197) doping reselect minimize the fit PT value (comprising background) of zymoplasm

SEQID NO	Clone's title	PT when 10uM is fit (sec)
			283	ARC2169	300
284	ARC2169.1	300
			285	ARC2169.2	300

SEQID NO	Clone's title	PT when 10uM is fit (sec)
			286	ARC2169.3	11
287	ARC2169.4	53.8
			288	ARC2169.5	12.8
289	ARC2169.6	300
			290	ARC2169.7	300
291	ARC2169.8	28.7
			292	ARC2170	300
293	ARC2171	300
			294	ARC2172	300

[00263] adopt above-described PT to measure, screening ARC2172 (SEQ ID NO 294) compares with ARC183 and reduces or the active ability of Trombin inhibiting.As shown in Figure 8, under identical volumetric molar concentration, ARC2172 (SEQ ID NO 294) is more effective than ARC183.

Embodiment 3B: activated coagulation time test

Clotting time when [00264] ACT measure to add endogenous pathway activation agent in the non-Citrated whole blood.ACT is more insensitive to heparin with respect to apTT (to be 181% of normal control during the 1U/mL heparin for example, the ACT time; Data not shown goes out), therefore, ACT is usually as the other test of bed, is used to monitor the high heparin dosage during the CABG.Different with other blood coagulation test, ACT does not carry out stdn, and therefore, the activator type that ACT result depends on use is with detection method and different.For this instrument, the disclosed target clotting time for the anticoagulant heparin in the by-pass operation is〉420 seconds, corresponding to the concentration of 3-5U/mL.

[00265] utilizing the blood coagulation analyzer of optical detection (Hemochron Jr., ITC Med, Edison NJ) upward to adopt ACT+ cuvette (ITC Med, Edison NJ) to carry out following measurement.Adopt ACT to measure, screened and show the high binding affinity of zymoplasm or in PT measures, show the fit minimizing or the active ability of Trombin inhibiting of the selection of description among the embodiment 1 and 2 of splendid PT value.In brief, with the fit incubation in advance 70 μ l fresh whole bloods of selection of concentration known scope (0-10 μ M), added in the blood 30 seconds with 7 μ l volumes under the described fit room temperature.Immediately in blood/fit mixture, add 30 μ l 25mM CaCl ₂, then the sample adding is preheating to 37 ℃ ACT+ cuvette (Hemochron Jr., ITC Med, Edison NJ), be used in Hemochron Jr blood coagulation analyzer (Hemochron Jr., ITC Med, Edison NJ), analyzing.The time of 125-150 second of measuring is thought the background that ACT measures.That selects fitly the results are shown in following table 22 in ACT measures.Note not deduction from the ACT value that following table 22 is listed of background value.

Table 22:ARC1985, ARC2026, ARC2027, ARC2091, the ACT value of ARC2169 and ARC2171

Fit concentration	ACT value (sec) ARC1985 (SEQ ID NO 191)	ACT value (sec) ARC2026 (SEQ IDNO 92)	ACT value (sec) ARC2027 (SEQ ID NO 84)	ACT value (sec) ARC2091 (SEQ ID NO 197)	ACT value (sec) ARC2169 (SEQ ID NO 283)	ACT value (see) ARC2171 (SEQ IDNO 293)
							0uM	128	133	140	140	141	128
.1uM	N/A	152	160	140	N/A	N/A
							25uM	N/A	183	151	155	186	N/A
.5uM	169	224	221	184	201	140
							1uM	196	414	429	388	399	198
2.5uM	322	441	426	472	410	379
							5uM	406	515	458	463	454	392
10uM	401	574	500	515	479	426

[00266] also measure with above-described ACT, measured with the fit ARC183 of blood coagulation enzyme dna and compared, ARC2172 (SEQ ID NO 294) reduces or the active ability of Trombin inhibiting.As shown in Figure 9, ARC2172 (SEQ ID NO 294) has produced relevant prolongation of concentration of ACT, needs 〉=2 μ M is fit to reach〉target clotting time of 400 seconds.In the concentration range of 2-10 μ M, ARC2172 (SEQ ID NO 294) demonstrates the 183 remarkable higher effectiveness than ARC.

[00267] the fit of optimization of embodiment 2C description reduces or the active ability of Trombin inhibiting when the fit concentration of 10 μ M also to adopt above-described ACT mensuration to screen above.These the results are shown in hereinafter table 23.

[00268] the ring district of ARC2169 and ARC1985 suddenlys change, and with the sequence of corresponding A RC183, obtains ARC2183 and ARC2184 respectively.These molecules are no longer effective than ARC 183, as shown in table 23 below.

Table 23: optimize the fit ACT value of identifying in the trial (comprising background) in the 1st stage

SEQ ID NO	Clone's title	ACT during 10uM (sec)
			4	ARC183	349
295	ARC2173	415
			296	ARC2174	416
297	ARC2175	392
			298	ARC2176	394
299	ARC2177	401
			300	ARC2178	429
301	ARC2179	462
			302	ARC2180	516
303	ARC2181	478
			304	ARC2182	518
305	ARC2183	354
			306	ARC2184	368
307	ARC2185	384
			308	ARC2186	408
309	ARC2187	435
			310	ARC2188	426
311	ARC2189	410

SEQ ID NO	Clone's title	ACT during 10uM (sec)
			312	ARC2190	389
313	ARC2191	453
			314	ARC2192	423
315	ARC2193	545
			316	ARC2194	462
317	ARC2195	438
			318	ARC2196	441

[00269] Pegylation of also in above-described ACT measures, above describing among the embodiment 2E with the fit measurement of finite concentration scope (0-10uM) fit with their 5 '-the ACT value of the intermediate that amine is puted together.The results are shown in following table 24.

Table 24: the Pegylation of a subgroup is fit and separately 5 '-the ACT value (comprising background) of amine intermediate

Fit (uM)	ACT value (sec) ARC2321 (SEQ ID NO435)	ACT value (sec) ARC2324 (SEQ ID NO436)	ACT value (sec) ARC2323 (SEQ ID NO437)	ACT value (sec) ARC2329 (SEQ ID NO440)
					10	440.5	424.5	514.5	664
5	418	400	536	558.5
					2.5	402.5	376.5	477.5	507.5
1	348	234	250.5	260
					0.5	162	138.5	144.5	136
0	139	139	139	139

Embodiment 3C: activated partial thromboplastin time (aPTT)

[00270] with contacting of electronegative surface (as glass, silicon-dioxide, collagen protein) " endogenous " coagulation pathway is activated.APTT measures the time that adds blood coagulation behind the electronegative activator in blood plasma, and to Factor IX, IX, XI, XII, prekallikrein, high molecular weight kininogen and common pathway composition sensitivity.With the blood plasma of Citrated in advance incubation comprise the aPTT reagent (activation step) of phosphatide (part thromboplastin) and activator, then by adding CaCl ₂Initial blood coagulation.Because heparin (compound with antithrombin) target is decided some factors in intrinsic pathway and the common pathway, aPTT to heparin than PT remarkable more responsive (for example the aPTT time during the 1U/mL heparin is normal control〉1000%, data not shown goes out), and can be used to monitor the therapeutic heparin of low dosage.

[00271] substantially according to the description of measuring for PT, with Coag-a-Mate instrument (Biomerieux, Durham NC) measures the influence that ARC2172 (SEQ ID NO 294) and ARC183 in the human plasma compare aPTT, and difference points out it is to add 100 μ L 20mM CaCl ₂(Middletown VA) makes blood plasma/inhibitor mixed thing activate 3 minutes for Pacific Hemostasis, FisherDiagnostics with 100 μ L aPTT-LS reagent before the initial blood coagulation.There is not about 20 seconds clotting time of measuring when fit, is in the clinical normal range (20-40 second).

[00272] as shown in figure 10, with respect to PT, aPTT reduces to a certain extent to the susceptibility of ARC2172 (SEQ ID NO 294); But, the anticoagulating active significant prolongation of ARC2172 (SEQ ID NO 294) clotting time of aPTT in measuring.In addition, prove that once more ARC2172 (SEQ ID NO 294) is significantly more effective than ARC 183 in aPTT measures.

Embodiment 3D: the blood coagulation of static blood

[00273] compare according to hereinafter measuring with ARC 183, ARC2172 (SEQ ID NO 294) keeps anticoagulation in capacity in the time, to prevent the anticoagulation of the blood coagulation in the static blood.

Under [00274] 37 ℃ in people's whole blood maximum 1.5 hours of the ARC2172 (SEQ ID NO 294) of volumetric molar concentration (5 μ M) such as incubation or ARC183, monitor the activation of coagulation cascade in the sample in time.Add tissue plasminogen activator (5kU/mL),, and keep sample flow, make and to obtain time point with the fibrinous decomposition of promotion polymeric.In the thrombin generation of each time point, as coagulation cascade activated mark by the ELISA mensuration of thrombogen proteolytic fragments 1.2.In brief, the direct adding of sample wrapped in advance quilt

TAT trace ELISA (Dade Behring; Deerfield, Illinois; Cat.# OWMG15) hole.Finish ELISA according to the program of manufacturers subsequently.In order to obtain the indication that anti-freezing is renderd a service under these conditions.When incubation begins, measure ACTs according to the description of embodiment 3B above, the clotting time of observing every kind of compound respectively is 388 and 266 seconds.

[00275] as shown in figure 11, the ARC2172 of 5 μ M (SEQ ID NO 294) prevents that the coagulation cascade in the static blood from activating, and continues 30 minutes.This effect representative is with respect to the remarkable improvement of ARC 183, and under simulated condition, the anti-freezing time length of ARC 183 only is about 10 minutes, and this effect is basically parallel to the improved effectiveness that the ACT value prolongs measured ARC2172 (SEQ IDNO 294).

Embodiment 4: pharmacokinetics and pharmacokinetic study

[00276] in embodiment 4 and 5, all only represent the molecular weight of fit oligonucleotide part based on the fit concentration data of quality, and do not consider that PEG puts together the quality of being given.

Embodiment 4A: the rat IV that antithrombin is fit injects research

[00277] IV inject be applied to the Sprague-Dawley rat after, according to fit (above embodiment 1 and 2 ARC2949s (SEQ ID NO 434) that describe of anti-freezing pharmacokinetics feature to the bind thrombin of 10 kinds of vitro characteristics with needs, ARC2172 (SEQ ID NO 294), ARC2324 (SEQ ID NO 436), ARC2327 (SEQ ID NO 439), ARC2338 (SEQID NO 438), ARC2329 (SEQ ID NO 440), ARC2840 (SEQ ID NO 423), ARC2321 (SEQ ID NO 435), ARC2323 (SEQ ID NO 437), ARC2828 (SEQID NO 411)) sort, and compare with ARC183.Prepare the fit drug solns of giving by the following method in advance: with freeze dried fit being dissolved in the physiological saline, regulate concentration to drug solns up to the concentration of determining by the spectrophotometer analysis to reach correct with physiological saline, by 0.22 μ m filter membrane the solution that obtains is aseptically filled in the sterile sampling phial, then-20 ℃ freezing up to use down.The phial that will thaw during administration is placed on and wets on ice, when being not used in administration, the phial that uses is stored down at 4 ℃.

[00278] except that ARC 183, all are fit all to be dosed administration with 1.5 micromoles/kg, and this dosage generation scope is the 300-700 maximum ACTs of second.ARC183 is with the dosed administration of 6.35 micromoles/kg.By the jugular vein conduit of keeping somewhere, use fit in the conscious male not contacted antigenic Sprague-Dawley rat vein to femoral vein and jugular vein intubate.At the preset time point (before the administration; After the administration 0.83,1.83,2.83,5,10,15,20,30,40,50 and 60 minute; If also do not reach baseline ACT in 60 minutes after the administration, then also adopt extra time point, promptly after the administration 90 and 120 minutes) gather out 300 μ l blood samples from femoral venous catheter.ACT with above embodiment 3B description measures, and determines ACTs in real time.

[00279] research and design and result are summarized in Figure 12.ARC2949 (SEQ ID NO 434), ARC2172 (SEQ ID NO 294) and ARC2321 (SEQ ID NO 435) (are the 38-48% of the mg/kg of ARC183 at remarkable lower dosage, mole/kg 24%) more effective than ARC183, they are respectively the not Pegylation forms of the ARC2169 (SEQ ID NO283) that forms of 24,26 or 30 oligonucleotide.When based on relatively these three kinds when fit of sizes, noticed by maximum ACT measure towards the strong trend of rendeing a service increase.Big or small increase and the fit active prolongation that reaches 170 seconds ACT time display have also been noticed.Show by maximum ACT, compare that ARC2172 (SEQ ID NO 294) demonstrates to render a service to be increased with ARC2949 (SEQ ID NO 434).

[00280] find the ARC2840 (SEQTD NO 423) that is rich in 2 of AU '-OMe stem preparation with reduction, promptly a kind of 26 aggressiveness sample ARC2172 (SEQ ID NO 294) be new fit in effectiveness minimum.Find the ARC2828 (SEQ IDNO 411) that is rich in 2 of AT '-OMe stem preparation with reduction, promptly the 30 aggressiveness forms of ARC2321 (SEQ ID NO 435) can not be distinguished with ARC2321 (SEQ ID NO 435).All the other of test are fit to be the modified forms of ARC2172 (SEQ ID NO294) and ARC2321 (SEQ ID NO 435) above, its adding 5 ' amine joint ± 2-10K PEG group.These modifications have produced the appropriateness of rendeing a service to be increased, and has also increased the prolongation (referring to Figure 13) of pharmacokinetics effect.

[00281] therefore, 10 kinds of fit pharmacokinetic properties that show certain limit of test, the dependency that size increase and PD effect prolong between (measuring by ACT) is passed through towards the trend balance of rendeing a service increase.Compare with ARC 183, ARC2172 (SEQ ID NO 294) shows higher effectiveness.

Intravenous push in the embodiment 4B:Sprague-Dawley rat is used

[00282] the jugular vein conduit of the indwelling of describing in the research and design by Figure 14 displaying, intravenously (IV) is used ARC2172 (SEQ ID NO 294) and ARC 183.Except IV injects, carry out false kidney ligation for these rats, as the part of research, be used for determining the kidney removing of these compounds; Sham-operation and the results are described in hereinafter embodiment 4C at the PK/PD of kidney ligation effect.Gather blood by the femoral venous catheter of keeping somewhere, be used for time point definite after injection,, carry out ACT and measure up to 2 hours.Has ACT (+) cuvette with what embodiment 3B above described

Jr Signature+ apparatus measures ACT value.

[00283] use ARC2172 (SEQ ID NO 294) and the influence of 183 couples of ACT of ARC and be shown in Figure 15, correlation parameter is summarized in Figure 16.Inject by IV and to use ARC2172 (SEQ IDNO 294), the average maximum ACT value of generation is 418.(4.2 times mole/kg) dosage is used ARC 183, causes lower average maximum ACT, promptly 328 seconds with 2.5 times of mg/kg of ARC2172 (SEQ ID NO 294) dosage.The speed of dissociating of ARC 183 is fast, and be respectively 2.7 and 4.1 minutes mean time that reaches 200 or 170 seconds ACT.Be respectively 9.5 and 12.2 minutes the mean time that ARC2172 (SEQ ID NO 294) reaches 200 or 170 seconds ACT.In a word, the IV of sham-operation rat inject use after, find that ARC2172 (SEQ ID NO 294) is more effective than ARC 183.

Embodiment 4C: ARC2172 and ARC183 in kidney ligation and the sham-operation Sprague-Dawley rat

[00284] purpose of this research is to determine and relatively kidney ligation and sham-operation male Sprague-Dawley rat middle kidney is removed and to the active influence of pharmacokinetics of ARC2172 (SEQ ID NO 294) and ARC183.Inject the male Sprague-Dawley rat that gives holonephros ligation operation or sham-operation by IV and use ARC 183 and ARC2172 (SEQ ID NO294).Research and design is shown in Figure 17.

[00285] before administration, gathers blood, be used to carry out ACT and measure and ARC2172 (SEQ ID NO 294) or ARC183 concentration analysis with the fixed time point.ACT is measured in description according to embodiment 3B.Adopt the lower limit of quantitation (LLOQ) of 0.05 μ g/mL and 0.16 μ g/mL respectively, analyze the plasma concentration of determining ARC2172 (SEQ ID NO 294) and ARC 183 by HPLC.Adopt WinNonlin ^TM, 5.1 editions (Pharsight Corporation, Mountainview CA), respectively by non-compartment and Emax model, carry out PK and PK/PD analysis (E=E0+ (Emax-E0) * (C γ/(C γ+EC50 γ)) with each plasma concentration-time curve.One-way analysis of variance (ANOVA, α=0.05) statistical study is used for the C of kidney ligation and sham-operation rat _Max, AUC _LastAnd MRT _Last

[00286] pharmacokinetic curve (ACT) of ARC2172 of kidney ligation and sham operated rats (SEQ ID NO 294) and ARC183 is shown in Figure 18 and Figure 19 respectively.The average maximum ACTs that is reached by ARC2172 (SEQ ID NO 294) in sham-operation and kidney ligation rat is respectively 422 seconds and 419 seconds, and for ARC 183, average maximum ACTs is respectively 325 seconds and 363 seconds.The average A CT of ARC2172 (SEQ ID NO 294) was reduced to 170 seconds from maximum value in 15 minutes, and for ARC 183, average A CT was reduced in 5-10 minute 170 seconds.When with the sham-operation rat relatively the time, the overall PD curve of ARC2172 (SEQ ID NO 294) and ARC183 is not subjected to the remarkably influenced of rat middle kidney ligation (P〉0.05, adopt Mann-Whitney to check).But, time point (is respectively t=5-20 and t=0.83-5 minute for ARC2172 (SEQ ID NO 294) and ARC 183) in early days, compare with the sham-operation rat, the ligation of rat middle kidney has little but still is statistics remarkable influence (the Mann-Whitney check is adopted in P＜0.05).

[00287] after IV used in kidney ligation and sham-operation rat, plasma concentration-time curve of ARC2172 (SEQ ID NO294) and ARC 183 all was a two-phase.The kidney ligation group of two kinds of compounds all shows with sham operated rats to be compared, and the plasma concentration in most of sample times increases.Find C among ARC2172 (SEQ ID NO 294) and the ARC 183 _MaxAnd AUC _0-lastIncrease be that statistics is significant, P＜0.05.

[00288] in general, compare with the sham-operation rat, the overall PD curve of ARC2172 (SEQ ID NO 294) and ARC 183 is not subjected to the remarkably influenced of rat middle kidney ligation (P〉0.05, adopt the Mann-Whitney check).But, time point (is respectively t=5-20 and t=0.83-5 minute for ARC2172 (SEQ IDNO 294) and ARC 183) is compared with the sham-operation rat in early days, and the kidney ligation in the rat has little, but statistics remarkable influence (the Mann-Whitney check is adopted in P＜0.05).Compare with the sham-operation rat, after the single IV of kidney ligation rat injects, the total exposure of ARC2172 (SEQ ID NO 294) and ARC 183 is all had little, but the statistics remarkable influence.For ARC2172 (SEQ ID NO 294), the average C in the kidney ligation rat _MaxAnd AUC _0-lastValue is higher about 1.5 times and 2 times than sham-operation rat.For ARC 183, the average C in the kidney ligation rat _MaxAnd AUC _0-lastValue is compared high about 2.4 times and 2.9 times of sham-operation rat.Statistical analysis shows, for ARC 183 and ARC2172 (SEQ ID NO294), the MRT of kidney ligation rat _0-lastComparing with the sham-operation rat does not all have significant difference.This data presentation is in the kidney ligation rat model of the injury of the kidney of severe form, and the influence of the pharmacokinetics of ARC2172 is subjected to minimum influence.Although without wishing to be bound by theory, as if because the rat model Chinese medicine that ARC2172 shows the minimum change of its pharmacokinetics reversibility (getting back to the time of 200 seconds average A CT value) and damages (bilateral ligation) in this representative severe renal is for only moderate change of kinetics, it is not the main mechanism of removing ARC2172 that kidney is removed.In addition,, take all factors into consideration these data, show that in having the patient of injury of the kidney for ARC2172 (SEQ ID NO 294), dosage is regulated not necessarily although without wishing to be bound by theory.

Embodiment 4D: be used for injecting research to the monkey IV of the fit ordering of antithrombin

[00289] injects in the research in the rat studies that assessment embodiment 4A describes 4 kinds of (ARC2172 (SEQ ID NO 294) in relatively bind thrombin fit at the IV of monkey, ARC2949 (SEQ ID NO 434), ARC2169 (SEQ ID NO 283) and ARC2840 (SEQ ED NO423)).(ARC2169 (SEQ ID NO 283) is the form of 30 oligonucleotide of the ARC2321 (SEQ ID NO435) that do not contain 5 ' amine).Prepare the fit drug solns of giving by the following method: freeze dried fit or peptide is dissolved in the physiological saline, regulate concentration to drug solns up to the concentration of determining by the spectrophotometer analysis to reach correct with physiological saline, by 0.22 μ m filter membrane the solution that obtains is aseptically filled in the sterile sampling phial, then-20 ℃ freezing up to use down.The phial that will thaw during administration is placed on and wets on ice, when being not used in administration, the phial that uses is stored down at 4 ℃.

[00290] the following IV in macaque injects in the research, and all are fit all with the dosed administration of 0.46 micromole/kg.The IV conduit is placed the cephalic vein of the macaque of anesthesia, be used to inject use fit.Speed with about 5-10mL/kg/hr provides newborn acidifying RingerShi liquid by this cephalic vein conduit, keeps and catheter patency so that fluid to be provided.After injecting, from the blood vessel entry port, get blood, totally 1 hour (cumulative volume=about 3mL) according to definite time point that is described in above.Fit for all, time point be before the administration and administration after 0.83,1.83,2.83,5,10,15,20,30,45,60 minute; Under the situation of ARC2169 (SEQ ID NO 283), also adopted 90 and 120 minutes some extra time after the administration.According to the above description of embodiment 3B, adopt ACT+ (ITC Med, Edison NJ) cartridge case, determine activated ACTs in real time with Hemachron Jr Signature+ instrument (ITC Med, Edison NJ).

[00291] Figure 20 and 21 has summarized the result.Compare with the result (embodiment 4A) who injects model available from the IV in the rat, all are fit to show that the effectiveness in the monkey increases, and this is by 31% of the mole/kg dosage that uses in the employing rat in monkey, proves with regard to having reached maximum ACTs.ARC2840 (SEQ ID NO 423) promptly has 26 aggressiveness that are rich in 2 ' of AU-OMe stem, shows that effectiveness is minimum, maximum ACT only 223.3 seconds, and the time that reaches 170 seconds ACT is 2.2 minutes.ARC2949 (SEQ ED NO 434) has reached 402.7 seconds maximum ACT, and the time that reaches 170 seconds ACT is 14.9 minutes.The maximum ACTs of ARC2172 (SEQ ID NO 294) and ARC2169 (SEQ ID NO 283) closely similar (being respectively 526.8 and 541.7 seconds), but ARC2169 (SEQ ED NO 283) reaches the twice that the time of 170 seconds ACT almost is ARC2172 (SEQ ID NO 294) (54.6 minutes and 24.9 minutes).

Embodiment 4E:ARC2172 and the ARC183 intravenous push+infusion in macaque is used

[00292] in macaque, injects+continuous 1 hour IV infusion studies assessment ARC2172 (SEQ ID NO 294) and ARC183 in order to following single IV.Inject for macaque IV and use ARC2172 (SEQ ID NO 294) or ARC 183, immediately began continuous infusion 1 hour, shown in the research and design among Figure 22.

[00293] according to above describing, gets blood,, adopt ACT+ (ITC Med, Edison NJ) cartridge case, measure the ACT value with Hemachron Jr Signature+ instrument (ITC Med, Edison NJ) according to the above description of embodiment 3B from the blood vessel entry port.

[00294] by IV inject+1 hour infusion uses the effect that the ACT behind ARC2172 (SEQ ID NO 294) or the ARC183 measures and is shown in Figure 23, correlation parameter is summarized in Figure 24.By IV inject+infusion was used ARC2172 (SEQ ID NO 294) in 1 hour, the plasma concentration of the fixed 5 μ M of target, this has produced 397 seconds average maximum ACT value, and the time that reaches 200 or 170 seconds ACT value is respectively 22.2 and 26.5 minutes.Increase the dosage of ARC2172 (SEQ ID NO294), to reach the target plasma concentration of 7.5 μ M, this makes average maximum ACT be increased to 414 seconds, and be respectively 13.9 and 18.0 minutes (two temporal differences in back are in experimental error between two kinds of ARC2172 (SEQ ID NO 294) medication) mean time that reaches 200 or 170 seconds ACT value.When IV inject+1 hour infusion uses ARC 183 when reaching the plasma concentration of 15 μ M, causing average maximum ACT is 343 seconds, be respectively 4.9 and 7.3 minutes mean time that reaches 200 or 170 seconds ACT value.Therefore, the result of ARC 183 relatively and use ARC2172 (SEQ ID NO 294) than the low dosage scheme observed as a result the time (total dose that wherein gives be use ARC 183 mg/kg dosage 7%), can produce stable ACT about 400 seconds in the infusion process with ARC2172 (SEQID NO 294) processing.Slow about 4 times of the speed of dissociating of ARC2172 (SEQ ID NO 294) than ARC183.

Embodiment 4F: pharmacokinetics drug interaction

ARC2172 is to the influence of platelet aggregation.

[00295] except producing scleroproein, zymoplasm further stimulates blood clot to form by activating thrombocyte.External,, comprise zymoplasm, collagen protein and ADP and activate thrombocyte by multiple agonist.In case activate, thrombocyte carries out the remarkable change of the factor of form, expression of receptor and release.In some cases, these change induced platelet assembles, and this gathering does not rely on the existence of other cell.Hematoblastic blood plasma (PRP) is rich in low-speed centrifugal generation by whole blood.In PRP, add platelet agonist, can activate and gathering by induced platelet.Platelet aggregation and being precipitated out from solution, normal muddy RPR clarifies gradually, can monitor platelet aggregation among the PRP by absorbancy.The purpose of this research is the influence of assessment ARC2172 (SEQ ID NO 294) to the platelet aggregation among the people PRP.

[00296] the ARC2172 of various concentration (SEQ ID NO 294) exist or non-existent condition under, (0.25 unit/mL) or ADP (10 μ M) mix with PRP and α-zymoplasm.Assemble with optics thrombocyte meter evaluate platelet.ARC2172 (SEQ ID NO 294) Trombin inhibiting rather than ADP inductive platelet aggregation (being activated receptor GPIIb/IIIa) are (Figure 25).These digital proofs ARC2172 (SEQ ID NO 294) is the zymoplasm antagonist with the high-affinity bind thrombin.

ARC2172 is to the active external influence of acetylsalicylic acid and Integrilin

[00297] external, use multiple agonist, comprise that zymoplasm, collagen protein and ADP activate thrombocyte, or with multiple antagonist such as acetylsalicylic acid or thrombocyte IIb/IIa inhibitor inhibition thrombocyte.The purpose of this research seven peptide IIb/IIa inhibitor Integrilin that to be assessment ARC2172 (SEQ ID NO 294) connect acetylsalicylic acid or disulfide linkage are to the active influence of platelet aggregation among the people PRP.

[00298] under the room temperature, exists and or do not have acetylsalicylic acid (6mg/L) and exist and do not exist under the condition of ARC2172 (SEQ ID NO 294) of various concentration with Integrilin (1 μ M) incubation PRP20 minute in advance.With the thrombocyte mixture be preheating to 37 ℃ 3 minutes, adopt optics thrombocyte meter to assemble then by ADP (3 μ M) evaluate platelet.Acetylsalicylic acid reduces ADP inductive platelet aggregation among the people PRP, and Integrilin blocks ADP inductive platelet aggregation among the people PRP fully under being with or without the condition of acetylsalicylic acid.ARC2172 (SEQ ID NO 294) does not reduce or suppresses the activity (Figure 26) of acetylsalicylic acid or Integrilin.

Embodiment 5: functional zooscopy

Embodiment 5A: the ARC2172 in open, the non-heparin bonded bypass loop

[00299] adopt open, non-heparin bonded bypass loop in Pigs Hearts blood vessel bypass model, to assess ARC2172 (SEQ ID NO 294).By inject or inject+infusion handles animal with salt solution (n=2), heparin (n=5) and ARC2172 (SEQ ID NO 294) (n=5, animal 38 and 39 is not included in the statistical study) so that before bypass begins 400 seconds target ACT of acquisition.The 3rd treated animal (n=2) is not accepted antithrombotics and is handled, and does not carry out heart paralysis and aorta cross-clamp.Research and design is described in Figure 27.

[00300] load with 202mmol/g synthesizes ARC2172 (SEQ ID NO 294) on PrimerSupport 200.The standard synthesis cycle utilizes 1.8 normal amidite and 3 normal oxygenants.Synthesize back base washing with 20% diethylamine that is dissolved in acetonitrile, go protection to spend the night, be prepared SAX-HPLC then with ammoniacal liquor.Freeze-drying subsequently is fit, and the concentration with 20.0mg/ml is resuspended in Sterile Saline then.Use from the heparin sodium of pig pancreas preparation in this research.

Pig bypass model

[00301] according to the description of Figure 27, boar and sow are divided into a plurality of treatment groups at random.Animal 38 and 39 is not included in the statistical study.

[00302] before operation is prepared, uses coromegine SO4/Telazol

/ Xylazine (being respectively 0.04mg/kg/4-6mg/kg/2mg/kg intramuscular [IM]) is anesthetized animal in advance.Give the animal intubate then, suck in the narcotic at isoflurane and keep, pass to realize that sucker by volume-adjustment send.

[00303] after the anesthesia beginning, gives femoral artery and venous cannula, to monitor blood pressure respectively and to obtain blood sample.Instil or opening by infusion ARC2172 (SEQ IO NO 294) Maintenance Unit's ductus venosus with slow salt solution.

[00304] on the length of breastbone, carries out skin incision.Cut breastbone subsequently, open the thoracic cavity.Iron the probe hemostasis with the Bovi electricity.Open pericardium, be provided to the inlet of heart.Dissection separates paraaortic tissue, carries out the pocket tension suture with 5.0 polyester sutures in the aorta ascendens of heart far-end 4cm.Similarly, in right auricle of heart, carry out the pocket tension suture with 5.0 polyester sutures.After sewing up, handle animal with heparin or ARC2172 (SEQ ID NO 294).Repeatedly IV injects and uses heparin (40,000-60,000 unit), to realize being higher than 400 and test cuvette (ITC Med with the ACT+ that has that embodiment 3b describes by the ACT that ACTPlus system (Medtronic, Minneapolis MN) is measured, Edison, NJ) the little Blood coagulation instrument of Hemochron Junior Signature+ (ITC Med, Edison, NJ) about 1000 of measurement.Usually needed 10-20 minute to regulate heparin dosage, and guarantee that ACT is in correct scope.By inject+continuously intravenous infusion (0.139) is used ARC2172 (SEQ ID NO 294), the ACT+ that has that obtains embodiment 3b description tests cuvette (ITC Med, Edison, NJ) the little Blood coagulation instrument of Hemochron Junior Signature+ (ITC Med, Edison NJ) goes up the about 400 seconds ACT (referring to Figure 27) that measures.Usually needed 10-20 minute to come drug administration, and guarantee that ACT is in correct scope.

[00305] use the antithrombotics of suitable dose after, place artery and ductus venosus.The aorta conduit is connected in the preprepared artery line of the heart/lung instrument rapidly, carefully fills ductus arteriosus and artery line with salt solution, so that before connection, eliminate bubble.Clamp the artery line rapidly.(Minneapolis MN), is connected in conduit the intravenous line of the heart/lung instrument then for 29/37 liang of stage ductus venosus, Medtronic to place and sew up ductus venosus with similar techniques in right auricle of heart.Complete bypass loop comprise non-heparin bonded composition (affine CVR cardiotomy/vein holder and have the film oxygenator of blood plasma resistance fiber, Medtronic, Minneapolis, MN).Subsequently, animal is placed on the cardiopulmonary bypass and continues 3 hours.The artery of the heart/lung instrument and intravenous line have the animal of being connected and instrument intermediary ultrasonic Doppler transducer, with existing of monitoring embolus.The direct blood pressure of monitoring in program, and in bypass, keep blood pressure by the following method: a) regulate the bypass blood flow rate, b) use intravenous fluid, and c) use multiple medicine by intravenous injection, comprise that synephrine, Dopamine HCL, suprarenin and calcium work.By adjusting isoflurane atomizer flow velocity, and use the IV phenylethyl barbituric acid as required once in a while and inject, make animal maintain the operation level of anesthesia.

[00306] finish bypass in 3 hours after, make animal leave bypass, when blood pressure stabilization, remove conduit, then by handling (heparin treatment group) with protamine or stopping anticoagulating active by stopping fit infusion (ARC2172 treatment group).After stagnating infusion of drug, animal was kept extra 1 hour.With the combination of IV synephrine and/or IV fluid administration, after bypass, keep blood pressure.The general introduction of CPB research approach is shown in Figure 28.

The inspection in ACT mensuration and cardiopulmonary bypass loop is used to show big blood clot or fibrin deposition

[00307] obtains fresh whole blood at the sampling time of plan point, the ACT+ that has that describes with embodiment 3B tests cuvette (ITC Med immediately, Edison, NJ) the little Blood coagulation instrument of Hemochron JuniorSignature+ (ITC Med, Edison, NJ) and ACT Plus system (Medtronic, Minneapolis MN) measure.After finishing each experiment,, check holder, oxygenator film and artery filter, be used to check that big blood clot forms and takes pictures with normal saline washing cardiopulmonary bypass loop.

[00308] control animal ACT value keeps constant relatively in the process, but gradually change after the bypass (Figure 29).After the beginning bypass, can in bypass loop, see big blood clot in 15 minutes, and bypass becomes very big after 3 hours, make almost to be blocked by flowing of bypass loop.

[00309] use heparin after, the animal in this treatment group has very high ACT value, it is usually away from arm's length standard (above 1000 seconds) (referring to Figure 30).Repeat to inject, ACT is maintained the level of this rising to animal.When experiment finishes, use protamine, cause the ACT value to get back to baseline.In bypass loop, do not see big blood clot.

[00310] by inject+animal that infusion ARC2172 (SEQ ID NO 294) handles in, ACT maintains in the narrow relatively scope in by-pass procedure, in stopping to use ARC2172 (SEQ ID NO 294) 20 minutes, ACT gets back to baseline (Figure 31).In bypass loop, do not see big blood clot.Relatively being shown among Figure 32 of ACT value in the by-pass procedure when adopting every kind of antithrombotics.

Dependency between whole blood ACT and T/ATIII mixture form

[00311] in the by-pass procedure, collects the sample of Citrated blood plasma, be used to monitor the existence of zymoplasm/Antithrombin III (TAT) mixture, as coagulation cascade activated indirect measurement.In brief, undiluted plasma sample is directly added Enzygnost

Little ELISA (the DadeBehring of TAT; Deerfield, Illinois; Catalog number (Cat.No.) OWMG15) in the hole of wrapping quilt in advance.Finish ELISA according to the scheme of manufacturers subsequently.Adopt the dull and stereotyped washer (Bio-Tek of automatization; Winooski, Vermont; Catalog number (Cat.No.) ELx405 Magna MVR) finishes all washing steps.With Versamax Tunable microtitration plate reader (Molecular Devices; Sunnyvale California) detects absorbance.In all animals, baseline blood plasma TAT complex concentration observed value is less than 10ng/ml.In the control animal of not handling with antithrombotics, in several minutes, the TAT mixture begins to accumulate in blood plasma after being positioned over bypass, before bypass is about to stop, reach 150+/-maximum value of 87ng/ml.In the observation stage after bypass, the concentration of blood plasma TAT mixture reduces in these animals, but never gets back to baseline (referring to Figure 33).On the contrary, heparin is handled the activation suppressed coagulation cascade during the bypass, and this is (＜50ng/ml) (referring to the Figure 34) that is shown by low relatively blood plasma TAT complex concentration.Effects of heparin in the endogenous coagulation cascade than the activity of a plurality of thrombin of upstream, and the activity of Trombin inhibiting.

[00312] although ARC2172 (SEQ ID NO 294) prevents in the bypass loop formation of big blood clot, it is the activation of inhibition of coagulation cascade not, and this begins back blood plasma TAT complex concentration by bypass and increases sharply and show (referring to Figure 35).But the TAT complex concentration does not have in the control animal so high.Although without wishing to be bound by theory, this outcome expectancy is the activity that ARC2172 (SEQ ID NO 294) only reduces zymoplasm, rather than in the intrinsic coagulation cascade than the activity of other activated thrombin of upstream.

[00313] in general, adopt open, non-heparin bonded bypass loop in Pigs Hearts lung bypass model, to assess ARC2172 (SEQ ID NO 294).With salt solution (n=2), heparin (n=5) and ARC2172 (SEQ ID NO 294) (n=5) by inject or inject+infusion handles animal, so that obtained 400 seconds target ACT (by Hemachron Jr. apparatus measures) before the beginning bypass.The average A CT value of each group was 123+/-39 second (contrasts) during these were organized during the bypass, 950+/-158 second (heparin) and 433+/-61 second (ARC2172 (SEQ ID NO 294)).The formation of big blood clot during heparin and ARC2172 (SEQ ID NO 294) the minimizing bypass.In addition, the accumulation of TAT mixture that during bypass, only effects of heparin arranged.Although without wishing to be bound by theory, think that this shows that other processing does not suppress the activation of intrinsic coagulation cascade.

[00314] described the present invention by written explanation and embodiment, the technology of the present invention personnel can recognize and can implement the present invention with numerous embodiments, and specification sheets above and embodiment are in order to illustrate, rather than the restriction claim.

Claims (39)

1. the bind thrombin target is fit, the wherein blood coagulation of this fit minimizing or Trombin inhibiting mediation, and this fit ARC2172 of being (SEQ ID NO 294) or have ability fit of the blood coagulation of essentially identical minimizing or Trombin inhibiting mediation with ARC2172 (SEQ ID NO294), wherein this is fit with the K less than 1nM _DIn conjunction with human thrombin, and described fit length is 55 Nucleotide or still less.

2. the bind thrombin target is fit, the wherein blood coagulation of this fit minimizing or Trombin inhibiting mediation, and this fit ARC2172 of being (SEQ ID NO 294) or have ability fit of the blood coagulation of essentially identical minimizing or Trombin inhibiting mediation with ARC2172 (SEQ ID NO294), and this fit most of thymidines or uridine do not comprise the 5-bromouracil deoxyribose modification.

3. aforementioned each claim is fit, and wherein the ability of the blood coagulation of this fit minimizing or Trombin inhibiting mediation is to assess by the ability of measuring this fit minimizing or inhibition activated clotting time or prothrombin time.

4. claim 3 is fit, wherein the blood coagulation of this fit minimizing in vivo or Trombin inhibiting mediation.

5. claim 4 is fit, wherein this fit minimizing in people experimenter or the blood coagulation of Trombin inhibiting mediation.

6. bind thrombin is fit, and this is fit to be selected from: SEQ ID NOs 9-41,43-191,193-204,208-304,307-329,331-332,334,336-337,340-392,396-397,400 and 402-440.

7. bind thrombin and comprise the fit of following nucleotide sequence: CCTAGGTTGGGTAGGGTGGTGG.

8. aforementioned each claim is fit, wherein this fit nucleotide sequence that is selected from down group that comprises:

ACTGCCTAGGTTGGGTAGGGTGGTGGCAGT(ARC2169(SEQ ID NO 283))

GCTGCCTAGGTTGGGTAGGGTGGTGGCAGC(ARC2170(SEQ ID NO 292))

CTGCCTAGGTTGGGTAGGGTGGTGGCAG (ARC2171 (SEQ ID NO 293)) and,

CGCCTAGGTTGGGTAGGGTGGTGGCG(ARC2172(SEQ ID NO 294))。

9. comprise the fit of following nucleotide sequence:

N ₁N ₂N ₃TAGGTTGGGTAGGGTGGTN′ ₃N′ ₂N′ ₁，

N wherein ₁, N ₂Or N ₃Be respectively with N ' ₁, N ' ₂Or N ' ₃Form any Nucleotide of base pair, wherein N ₁, N ₂And N ₃Nucleotide that can be respectively identical naturally or different Nucleotide, and the blood coagulation of this fit minimizing or Trombin inhibiting mediation.

10. claim 9 is fit, wherein N ₁, N ₂Or N ₃It is deoxynucleotide.

11. claim 9 is fit, wherein N ₁, N ₂Or N ₃In at least two comprise 2 ' OMe and modify.

12. claim 9,10 or 11 fit, further comprise sequence

N ₁N ₂N ₃N ₄N ₅N ₆TAGGTTGGGTAGGGTGGT N′ ₆N′ ₅N ₄′N′ ₃N′ ₂N′ ₁，

N wherein ₁, N ₂, N ₃, N ₄, N ₅Or N ₆Be respectively with N ' ₁, N ' ₂, N ' ₃, N ' ₄, N ' ₅Or N ' ₆Form any Nucleotide of base pair, wherein N ₁, N ₂, N ₃, N ₄, N ₅Or N ₆Nucleotide that can be respectively identical naturally or different Nucleotide, and the blood coagulation of this fit minimizing or Trombin inhibiting mediation.

13. claim 9,10,11 or 12 fit, wherein N is guanosine or cytidine nucleotide residue.

14. each of claim 7-13 is fit, wherein this is fit with the K less than 1nM _DBind thrombin.

15. each of claim 7-14 is fit, wherein this fit ability that has the blood coagulation of essentially identical minimizing or Trombin inhibiting mediation at least with ARC2172 (SEQ ID NO 294).

16. aforementioned each claim is fit, wherein the zymoplasm target is a human thrombin.

17. aforementioned each claim is fit, wherein this fit be thymus nucleic acid.

18. aforementioned each claim is fit, wherein this fit be single stranded deoxyribonucleic acid.

19. aforementioned each claim is fit, wherein this fitly comprises at least one chemically modified.

20. claim 19 is fit, wherein this modification is selected from: the chemistry in the sugared position of nucleic acid replaces; The chemistry of phosphoric acid position replaces; Replace with the chemistry of base position.

21. claim 19 or 20 is fit, wherein this modification is selected from: mix the Nucleotide of modification, 3 ' add cap, and with the puting together of high molecular, non-immunogenic compound, with puting together of lipophilic compound.

22. claim 19 is fit, wherein puting together of this modification right and wrong immunogenicity, high-molecular weight compounds, wherein this compound is a polyalkylene glycol.

23. claim 22 is fit, wherein this polyalkylene glycol is a polyoxyethylene glycol.

24. each of claim 1-3 and 5-23 is fit, wherein this fit blood coagulation in external minimizing or Trombin inhibiting mediation.

25. a method comprises to experimenter or extracorporeal circulation and uses the fit of aforementioned each claim, its amount effectively reduces or suppresses the blood coagulation of the thrombin-mediated among the experimenter.

26. the method for claim 25, wherein this experimenter is the people.

27. a composition, it comprises effective minimizing or suppresses each fit or its salt and pharmaceutically acceptable carrier or the thinner of the claim 1-26 of the amount of the blood coagulation of thrombin-mediated among the experimenter.

28. a method comprises the composition of using claim 27 to the experimenter that needs are arranged.

29. the method for claim 28, wherein this experimenter is the people.

30. claim 25,26,28 or 29 method, wherein this people experimenter is that kidney is impaired, and is used for the fit of this method and does not put together in PEG.

31. claim 25,26,28,29 or 30 method, wherein this people experimenter has heparin-induced thrombocytopenia.

32. claim 25,26,28,29,30 or 31 method, wherein this people experimenter is the heparin resistance.

33. claim 25,26,28,29,30,31 or 32 method, wherein this experimenter has impaired liver function.

34. claim 25,26,28,29,30,31,32 or 33 method, wherein before experimenter's the operative procedure, during, afterwards or its arbitrary combination, use fit to the experimenter.

35. the method for claim 34, wherein operative procedure is selected from: cardiopulmonary bypass surgery, coronary artery bypass graft surgery, percutaneous coronary intervention, angioplasty, cardiovascular and peripheral blood vessel open and blood vessel in operation, support place operation, heart valve replacement operation, be used for the treatment of coronary artery disease and/or vein or artery vascular disease operation and be used for the treatment of the operation of peripheral arterial occlusion disease.

36. claim 25,26,28,29,30,31,32,33,34 or 35 each method, wherein this fit be ARC2172 (SEQ ID NO 294).

37. the method for claim 35, wherein this fit be ARC2172 (SEQ ID NO 294), and operative procedure is a coronary artery bypass graft surgery.

38. the method for claim 35, wherein this fit be ARC2172 (SEQ ID NO 294), and operative procedure is that percutaneous coronary is got involved.

39. the method for claim 35, wherein this operative procedure is a cardiopulmonary bypass surgery, and uses open, non-heparin bonded loop in the surgical procedure.

Images