ES2351784T3 - MODULATORS OF PHARMACOLOGICAL AGENTS. - Google Patents

Abstract

An oligonucleotide modulator that hybridizes under physiological conditions with an aptamer against coagulation factors, where said aptamer is a single stranded nucleic acid that binds to a coagulation factor, to specifically and rapidly reverse the anticoagulant and antithrombotic effects of said aptamer against factors. of coagulation that is directed to components of the coagulation pathway.

Description

Modulators of pharmacological agents.

This request claims priority of the U.S. Provisional Application No. 60 / 293,231, filed on May 25, 2001, and U.S. Provisional Application No. 60 / 331,037, filed on November 7, 2001.

Technical field

The present invention relates, in general, to an oligonucleotide modulator that reverses activity Pharmacological of an aptamer against clotting factors.

Background

Conventionally it has been thought that nucleic acids mainly perform an informative task in biological processes. Through a method known as Systematic Evolution of Exponential Enrichment Ligands, called SELEX, it has become clear that nucleic acids have three-dimensional structural diversity not unlike proteins. SELEX is a method for in vitro synthesis and the selection of nucleic acid molecules with highly specific binding to target molecules. The SELEX process was first described by Gold and Tuerk in U.S. Patent Application No. Ser. 07 / 536,428, filed June 11, 1990, now U.S. Patent No. 5,475,096, and then in the application US Patent No. Ser. 07 / 931,473, filed on August 17, 1992, entitled "Methods for Identifying Nucleic Acid Ligands", now US Patent No. 5,270,163 (see also WO 91/19813). See also Tuerk et al ., Science 249: 505-10 (1990).

The nucleic acid ligands or aptamers are non-coding single stranded nucleic acids (DNA or RNA) that have the property of specifically binding to a compound or desired target molecule, and that have sufficient capacity to form a diversity of bi and three-dimensional structures and sufficient chemical versatility available within its monomers to act as ligands (form specific binding pairs) with almost any chemical compound, be it monomeric or polymeric. Molecules of any size or composition can serve as targets. The SELEX method involves the selection between a mixture of Candidate oligonucleotides and iterations by binding stages, separation and amplification, using the same selection scheme general, to achieve almost any desired affinity criteria and binding selectivity. Starting from a mixture of acids nucleic, preferably composed of sequence segments randomized, the SELEX method includes the steps of putting in contact the mixture with the target in favorable conditions for binding, separate unbound nucleic acids from those acids nucleic acids that have specifically bound to target molecules, dissociate the nucleic acid-target complexes, amplify dissociated nucleic acids from acid complexes nucleicide target to produce a mixture of acids nucleicides enriched with ligand, then reiterate the stages of union, separation, dissociation and amplification through all cycles that are desired to produce nucleic acid ligands of High affinity highly specific for the target molecule.

Nucleic acid ligands have several characteristics that can make them useful as therapeutic agents. They can be prepared as relatively small synthetic compounds (for example, from 8 kDa to 15 kDa) and can be selected to have high affinity and specificity for target molecules (equilibrium dissociation constants varying from, for example, 0.05-10 nM ). Aptamers encompass both the affinity properties of monoclonal antibodies and single chain antibodies (scFv) and the ease of manufacturing similar to that of a small peptide. Initial studies demonstrated the in vitro use of aptamers to study protein function, and more recent studies have confirmed the usefulness of these compounds to study protein function in vivo (Floege et al ., Am J Pathol 154: 169-179 (1999 ), Ostendorf et al ., J Clin Invest 104: 913-923, (1999)). In addition, animal studies to date have shown that aptamers and compounds of similar composition are well tolerated, show low or no immunogenicity, and are therefore suitable for repeated administration as therapeutic compounds (Floege et al ., Am J Pathol 154 : 169-179 (1999), Ostendorf et al ., J Clin Invest 104: 913-923 (1999), Griffin et al ., Blood 81: 3271-3276 (1993), Hicke et al ., J Clin Invest 106: 923-928 (2000)).

As synthetic compounds, site specific modifications (insertions or deletions) can be made to aptamers to rationally alter their bioavailability and mode of disposal. For example, it has been found that aptamers modified with 2'-fluoro pyrimidine in the size range of 10 kDa to 12 kDa have a short half-life (~ 10 minutes) after intravenous administration in embolate but that a simple chemical modification of the aptamer or conjugation of the aptamer with a high molecular weight carrier molecule (eg, PEG) increases the half-life in circulation substantially (6-12 hours) (Willis et al ., Bioconjug Chem 9: 573-582 (1998) , Tucker et al ., J Chromatogr Biomed Sci Appl 732: 203-212 (1999), Watson et al ., Antisense Nucleic Acid Drug Dev 10: 63-75 (2000)). Bioactive and nuclease resistant single stranded nucleic acid ligands comprising L-nucleotides have been described (Williams et al ., Proc. Natl. Acad. Sci. 94: 11285 (1997); USP 5,780,221; Leva et al ., Chem. Biol. 9: 351 (2002)). These "L-aptamers" are reportedly stable under conditions where aptamers comprising natural chirality nucleotides (D-nucleotides) (ie, "D-aptamers") are subject to degradation.

       \ newpage
    

Several third parties have applied for and obtained patents that cover the identification, manufacture and use of aptamers. As indicated above, Larry Gold and Craig Tuerk are generally credited with the first development of the SELEX method for isolating aptamers, and their method is described in several United States patents including those mentioned above and United States Patents No. 5,670,637 , 5,696,249, 5,843,653, 6,110,900, and 5,270,163, as well as others described in the Detailed Description of the Invention. Thomas Bruice et al . reported a process for producing aptamers in U.S. Patent No. 5,686,242, which differs from the original SELEX process filed by Tuerk and Gold because it employs strictly random oligonucleotides during the scanning sequence. The oligonucleotides explored in the '242 patent process lack the oligonucleotide primers that are present in oligonucleotides explored in the SELEX process.

Several patents of Gold et al . they refer to the aptamers themselves. For example, U.S. Patent No. 6,114,120 refers to an aptamer that binds to a cellular macromolecule. U.S. Patent No. 5,670,637 refers to aptamers that bind to proteins. US Patent No. 5,696,249 refers to an aptamer produced by the SELEX process.

Other patents have been issued that refer to aptamers against specific biological targets, and methods to identify these aptamers. U.S. Patent No. 5,756,291 and 5,582,981 to O'Toole, for example, describe a method of detecting thrombin using a labeled aptamer comprising a defined six nucleotide sequence. U.S. Patent Nos. 5,527,894 and 5,637,461 to Gold et al . they refer to methods to identify aptamers against tat protein. Other patents describing aptamers directed against specific biological targets include U.S. Patent Nos. 5,496,938 (HIV reverse transcriptase), 5,476,766 (thrombin), 5,459,015 (fibroblast growth factor), 5,472,841 (elastase of neutrophils), 5,849,479 (vascular endothelial growth factor), 5,726,017 (HIV GAG), 5,731,144 (TGFβ), 5,827,456 (chorionic gonadotropin hormone), 5,780,228 (lectins), 5,766,853 (selectins), 5,674,685 (platelet-derived growth factor), 5,763,173 (DNA polymerases), 6,140,490 (complement system proteins), and 5,869,641 (CD4).

Sullenger, Rusconi, Kontos and White in WO 0226932 A2 describe RNA aptamers that bind coagulation factors, transcription factors of the E2F family, Ang1, Ang2, and fragments or peptides thereof, transcription factors, antibodies Autoimmune and cell surface receptors useful in the modulation of hemostasis and other biological events. (See also Rusconi et al ., Thrombosis and Haemostasis 83: 841-848 (2000), White et al ., J. Clin Invest 106: 929-34 (2000), Ishizaki et al ., Nat Med 2: 1386-1389 (1996), and Lee et al ., Nat Biotechnol 15: 41-45 (1997)).

Several patents have also been issued that refer to specific uses of aptamers. For example, Bruice et al . in US Patent No. 6,022,691 describe the use of aptamers identified by a SELEX type process to detect drugs and other molecules in biological fluids. Gold et al . in U.S. Patent No. 5,843,653 they provide a diagnostic method using aptamers. US Patent No. 6,110,900 describes a diagnostic composition containing an aptamer. US Patent No. 5,789,163 describes a sandwich assay that employs aptamers as capture and / or detection ligand. US Patent No. 6,147,204 describes the use of lipophilic aptamers / complexes to deliver therapeutic and diagnostic aptamers to intracellular locations in vivo . U.S. Patent Nos. 5,705,337, 5,962,219, 5,763,595 and 5,998,142 describe aptamers that are chemically modified to covalently bind to target proteins.

Several methods have been developed that modify the basic SELEX process to obtain aptamers that meet objectives in addition to showing high binding affinity towards a target molecule. For example, several patents describe the use of modified nucleotides in the SELEX process to obtain aptamers that show improved properties. US Patent No. 5,660,985, for example, refers to SELEX using 2'-modified nucleotides that exhibit enhanced stability in vivo . US Patent No. 6,083,696 describes a "combined" SELEX process in which oligonucleotides covalently linked to non-nucleic acid functional units are screened for their ability to bind to a target molecule. Other patents describe post-SELEX modifications to aptamers to decrease their size, increase their stability, or increase the binding affinity to the target. See, for example, U.S. Patent Nos. 5,817,785 and 5,648,214.

Other patents describe SELEX processes unique. For example, U.S. Patent Nos. 5,763,566 and 6,114,120 describe processes for generating aptamers using the SELEX process with complete biological tissue as target, for identify aptamers that have binding affinity to tissues Biological and components thereof. U.S. Patent No. 5,580,737 describes a modification to the SELEX process that produces aptamers that can discriminate between two or more compounds. The US Patent No. 5,567,588 describes the method "SELEX in solution "in which the mixture of candidate nucleic acids explored in solution to preferentially amplify the higher affinity aptamer.

Kauffman has obtained patents that describe the generation of large protein libraries from large combinations of shape-generated oligonucleotide vectors Stochastic See U.S. Patents No. 5,814,476 and 5,723,323.

Weis et al . describe in US Patent No. 5,245,022 an oligonucleotide of approximately 12-25 bases that is substituted at the end by a polyalkylene glycol. It has been reported that these modified oligonucleotides are resistant to exonuclease activity.

U.S. Patent Nos. 5,670,633 and 6,005,087 to Cook et al . describe thermally stable 2'-fluoro oligonucleotides that are complementary to a basic RNA or DNA sequence. U.S. Patent Nos. 6,222,025 and 5,760,202 to Cook et al . describe the synthesis of substituted 2'-O pyrimidines and oligomers containing the modified pyrimidines. EP 0 593 901 B1 describes oligonucleotide and ribozyme analogs with 3 ', 3'- and 5', 5'-terminal nucleoside bonds. U.S. Patent No. 6,011,020 to Gold et al . describes an aptamer modified by polyethylene glycol.

Several US patents have been issued describing large-scale manufacturing methods that can be used to produce aptamers. Caruthers et al ., For example, describe in US Pat. Nos. 4,973,679; 4,668,777; and 4,415,732 a class of phosphoramidite compounds that are useful in the manufacture of oligonucleotides. In another series of patents, Caruthers et al . describe a method for synthesizing oligonucleotides using an inorganic polymeric support. See, for example, U.S. Patent Nos. 4,500,707, 4,458,066 and 5,153,319. In another series of patents, Caruthers et al . describe a class of nucleoside phosphorodithioates that can be used to make oligonucleotides. See, for example, U.S. Patent Nos. 5,278,302, 5,453,496 and 5,602,244. Reports of aptamers designed to join other aptamers include: Aldaz-Carroll L, Tallet B, Dausse E, Yurchenko L, Toulme JX; Apical loop-internal loop interactions: a new RNA-RNA recognition motif identified through in vitro selection against RNA hairpins of the hepatitis C virus mRNA; Biochemistry May 7, 2002; 41 (18): 5883-93; Darfeuille F, Cazenave C, Gryaznov S, Duconge F, Di Primo C, Toulme JJ .; RNA and N3 '\ rightarrowP5' kissing aptamers targeted to the trans-activation responsive (TAR) RNA of the human immunodeficiency virus-1, Nucleosides Nucleotides Nucleic Acids. April-July 2001; 20 (4-7): 441-9; Collin D, van Heijenoort C, Boiziau C, Toulme JJ, Guittet E., NMR characterization of a kissing complex formed between the TAR RNA element of HIV-1 and a DNA aptamer. Nucleic Acids Res. September 1, 2000; 28 (17): 3386-91; Duconge F, Di Primo C, Toulme JJ., Is a closing "GA pair" a rule for stable loop-loop RNA complexes? J Biol Chem. July 14, 2000; 275 (28): 21287-94; Duconge F, Toulme JJ. In vitro selection identifies key determinants for loop-loop interactions: RNA aptamers selective for the TAR RNA element of HIV-1, RNA. December 1999; 5 (12): 1605-14; Boiziau C, Dausse E, Yurchenko L, Toulme JJ., DNA aptamers selected against the HIV-1 trans-activation-responsive RNA element form RNA-DNA kissing complexes; J Biol Chem. April 30, 1999; 274 (18): 12730-7; and Le Tinevez R, Mishra RK, Toulme JJ., Selective inhibition of cell-free translation by oligonucleotides targeted to a mRNA hairpin structure; Nucleic Acids Res. May 15, 1998; 26 (10): 2273-8.

Currently, many drugs cause medical complications such as side effects and undesirable or uncontrollable consequences. Treat the medical complications caused by side effects It leads to additional healthcare costs. The recent identification of this range of nucleic acid ligands useful in medical therapy It has opened new avenues for research and development. Although they have made progress in this area, there is still a strong need of providing methods and compositions to improve the way in which these ligands are used and to increase their effectiveness, to control better the therapy process, and to provide therapies that have diminished side effects on therapeutic methods Traditional The present invention provides modulators oligonucleotides to improve the process to use an aptamer against coagulation factors in medical therapy. Focus provided by the present invention allows more control over The therapeutic effect, pharmacokinetics and duration of activity of an aptamer against coagulation factors.

Summary of the invention

It has been found that the anticoagulant and antithrombotic effects of aptamers against coagulation factors that are directed to blood clotting pathway components can be reversed specifically and rapidly in vivo to produce a desired biological effect. These aptamers are single stranded nucleic acids that bind to a clotting factor. This can be achieved through the administration of an oligonucleotide modulator, which hybridizes under physiological conditions with said aptamer, that changes the attachment of the aptamer against coagulation factors with its target or that degrades or otherwise cleaves, metabolizes or decomposes the aptamer against coagulation factors while the aptamer against coagulation factors is still exerting its effect. The modulators of the present invention can be administered in real time as necessary based on various factors, including patient progress, as well as the physician's criteria on how to achieve optimal therapy. Therefore, this invention provides for the first time an adjustable therapeutic regimen in the course of aptamer therapy against coagulation factors.

From now on references to a "ligand of nucleic acid "or" ligand "will mean an" aptamer against clotting factors "which is a nucleic acid single chain that binds to a clotting factor. From now references to a "modulator" will mean a "modulator oligonucleotide that hybridizes under physiological conditions with a aptamer against coagulation factors ".

This adjustable therapeutic regimen controls the drug action by introducing a modulator that is easy to use, can be independent of the patient's health status, has a uniform mode of action, and does not require continuous infusion of drug. In one example, an antidote that is designed is provided rationally to deactivate the aptamer's activity when The doctor wants it.

The modulator is an oligonucleotide, or a bound product of any of these. For example, the modulator may be an oligonucleotide that is complementary to at least a part of the nucleic acid ligand. In another embodiment, the modulator may be a ribozyme or ADNzyme that is directed to the nucleic acid ligand. In a further embodiment, the modulator can be a nucleic acid peptide (PNA), a morpholino nucleic acid (MNA), a closed nucleic acid (LNA) or pseudocyclic oligonucleobases (PCO) that include a sequence that is complementary to or hybridizes with at least a part of the nucleic acid ligand. A typical nucleic acid ligand has some secondary structure - its active tertiary structure depends on the formation of the appropriate stable secondary structure. Therefore, although the mechanism of formation of a duplex between a complementary oligonucleotide modulator of the invention and a nucleic acid ligand is the same as between two short linear oligoribonucleotides, the standards for designing said interactions and the formation kinetics of said product they are affected by the intramolecular structure of the aptamer. The nucleation velocity is important for the formation of the final stable duplex, and the velocity of this stage is greatly enhanced by directing the oligonucleotide modulator to single stranded loops and / or 3 'or 5' end strands present in the nucleic acid ligand. For intermolecular duplex formation to occur, the intermolecular duplex formation free energy has to be favorable with respect to the formation of intramolecular duplexes existing within the nucleic acid ligand labeled as
Diana.

In an alternative embodiment of the invention, The modulator itself is an aptamer. In this embodiment, first generates a nucleic acid ligand that binds to the therapeutic agent wanted. In a second stage, a second ligand of nucleic acid that binds to the first nucleic acid ligand using the SELEX process described in this document or other process, and modulates the interaction between the nucleic acid ligand Therapeutic and the target. In one embodiment, the second ligand of nucleic acid deactivates the effect of the first acid ligand nucleic. "Modular" or "regular" in the context of this document means "reverse specifically and quick. "

In other alternative embodiments, the aptamer that binds to the target can be a PNA, MNA, LNA or PCO and the Modulator is a nucleic acid ligand. As an alternative, the aptamer that binds to the target is a PNA, MNA, LNA or PCO, and the Modulator is a PNA. Alternatively, the aptamer that binds to the Target is a PNA, MNA, LNA or PCO, and the modulator is an MNA. How Alternatively, the aptamer that binds to the target is a PNA, MNA, LNA or PCO, and the modulator is an LNA. Alternatively, the aptamer who Binds to the target is a PNA, MNA, LNA or PCO, and the modulator is PCO. Any of these can be used, as desired, in the stereochemistry of natural origin or in stereochemistry of non-origin natural or a mixture thereof. For example, in one embodiment preferred, the nucleic acid ligand is in D configuration, and in an alternative embodiment, the nucleic acid ligand is in L. configuration

In a reference aspect methods are provided for identifying nucleic acid ligand modulators. Modulators can be identified in general, through binding assays, molecular modeling, or in vivo or in vitro assays that measure the modification of biological function. In one aspect, the binding of a modulator to a nucleic acid is determined by a gel displacement assay. In another aspect, the binding of a modulator to a nucleic acid ligand is determined by a Biacore assay. Other appropriate tests are described in the Detailed Description of the Invention.

In another aspect, the binding or interaction of the modulator with the nucleic acid ligand is measured by evaluating the effect of the nucleic acid ligand with and without the modulator under appropriate biological conditions. As an example, modulators of the invention that regulate antithrombotic and anticoagulant aptamers can be identified. The effectiveness of the modulator can be evaluated in vitro or in vivo through a coagulation test bioassay such as the activated coagulation time test, the activated partial thromboplastin test, the bleeding time test, the prothrombin time test , or the thrombin coagulation time test. Using an identified regimen, an anticoagulant nucleic acid ligand can be administered to a patient and then given the antidote when it is the appropriate time to resume normal coagulant action. This regimen is useful, for example, during cardiovascular and vascular surgery, percutaneous coronary interventions (angioplasty), orthopedic surgery, and treatment of acute myocardial infarction. In a non-limiting illustrative example, the modulators of the present invention can bind to nucleic acid ligands that are directed to the enzyme complexes of tissue factor (TF) / factor VIIa (FVIIa), factor VIIIa (FIBA) / factor IXa (FIXa ), factor Va (FVa) / factor Xa (FXa) and platelet receptors such as gpIIbIIIa and gpIbIX and modulate the effects of the nucleic acid ligand. This invention also provides platelet, antithrombotic and fibrinolytic inhibitors controlled with antidote.

In one embodiment, the modulator is an oligonucleotide that binds to an aptamer against Factor IXa (eg, Aptomer 9.3 or Atamer 9.3t) that is directed to Coagulation Factor IXa. The oligonucleotide antidote may be complementary to at least a part of the aptamer against Factor IXa. Specifically, the 2'-O-methyl oligonucleotide antidote may consist of the following sequences, 5'AUGGGGAGGCAGCAUUA3 ', 5'CAUGGGGAGGCAG
CAUUA3 ', 5'CAUGGGGAGGCAGCA3', 5'CAUGGGGAGGCA3 ', 5'GCAUUACGCGGUAUAGUCCCCUA3',
5'CGCGGUAUAGUCCCCUA3 ', 5'CGC GGU AUA GUC CCC AU3'. And modifications or derivatives thereof in which a desired degree of hybridization is maintained.

In another embodiment, the modulator is an oligonucleotide that binds to an aptamer against Factor Xa (for example, Atamer 11F7t) that is directed to Coagulation Factor Xa. The oligonucleotide antidote may be complementary to at least a part of the aptamer against Factor Xa. Specifically, the oligonucleotide antidote may consist of the following sequences, 5'CUCGCUGGGGCUCUC3 ', 5'UAUUAUCUCGCUGGG3', 5'AAGAGCGGGGC
CAAG3 ', 5'GGGCCAAGUAUUAU3', 5'CAAGAGCGGGGCCAAG3 ', 5'CGAGUAUUAUCUUG3' or any modification or derivative thereof in which a desired degree of hybridization is maintained.

In another embodiment, the modulators oligonucleotides include nucleic acid sequences that are substantially homologous to and having substantially the same activity to bind nucleic acid ligands, which oligonucleotide modulators identified in this document.

In another embodiment, the modulators of the invention can also be used to reverse the binding of nucleic acid ligands that house radioactive or cytotoxic moieties to target tissue (e.g., neoplastic tissue) and thereby, for example, facilitate removal of said remains of a patient's system. Also, the modulators of the invention can be used to reverse the binding of labeled nucleic acid ligands with detectable moieties (used, for example, in imaging or isolation or cell sorting) to target cells or tissues (Hicke et al ., J Clin. Invest. 106: 923 (2000); Ringquist et al ., Cytometry 33: 394 (1998)). This reversal can be used to accelerate the removal of the detectable rest from a patient's system.

In a reference aspect, the modulators of the invention can also be used in in vitro environments to enhance or inhibit the effect of a nucleic acid ligand (eg, aptamer) on a target molecule. For example, modulators can be used in target validation studies. Using modulators of the invention, it is possible to confirm that a response observed after inhibiting a target molecule (with a nucleic acid ligand) is due to the specific inhibition of that molecule.

The modulators of the invention can formulated in pharmaceutical compositions that may also include  of the modulator, a vehicle, diluent or excipient pharmaceutically acceptable. The precise nature of the composition will depend, at least in part, on the nature of the modulator and the route of administration. The dosage regimens can be easily established by a specialist in the art and may vary with the modulator, the patient and the effect sought. Generally, the modulator can be administered IV, IM, IP, SC, or by topical route, as appropriate.

As an alternative, and in view of the specificity of the modulators of the invention, a subsequent treatment can involve the administration of additional nucleic acid ligands that are the same or different from the acid pair ligand original oligonucleotide nucleic / antidote administered first place.

Finally, an optional aspect is the identification and selection of modulators and regulators that show cross reactivity of relevant species to increase utility of preclinical studies in animals.

The objects and advantages of the present invention They will be clear from the following description:

Brief description of the drawings

Figure 1 shows the aptamer against FIXa 9.3t (SEQ ID No. 1). All purines are 2'-hydroxyl nucleotides and all pyrimidines are 2'-fluoro nucleotides.

Figure 2 shows the anticoagulant activity of aptamer 9.3t. The increase in clotting time is normalized at baseline coagulation time in the absence of aptamer.

Figure 3 shows the change of the pig ACT after aptamer injection. The data is normalized to the initial measure prior to injection.

Figure 4 shows the change in the time of pig coagulation after aptamer injection.

Figures 5A-5C show the in vitro inhibitory activity of the cholesterol modified aptamer, 9.3tC. Fig. 5 A. The addition of cholesterol has a moderate effect on the affinity of aptamer 9.3tC for FIXa. A competitive binding assay is used to measure the affinity of 9.3tC for FIXa. Fig. 5B. In vitro anti-coagulant activity of aptamer 9.3tC in human plasma. Fig. 5C. In vitro anticoagulant activity of aptamer 9.3tC in pig plasma.

Figures 6A-6C show the in vivo anticoagulant activity of aptamer 9.3tC. Fig. 6A. In vivo anticoagulant activity of aptamer 9.3tC in pigs after IV injection in stroke, ACT assays (the dotted line is the ACT data of 9.3 to 0.5 mg / ml in Fig. 3). Fig. 6B. In vivo anticoagulant activity of aptamer 9.3tC in pigs after IV injection in stroke, APTT and PT tests (0.5 mg / kg 9.3t of Fig. 4). Fig. 6C. In vivo plasma concentration of 9.3tC versus 9.3t in time after IV injection in stroke. Concentrations were calculated by interpolation from in vitro dose response curves of APTT assays for each aptamer.

Figure 7 shows the alignment of aptamers against the minimum FIXa (SEQ ID No. 2 - SEQ ID No. 17). The sequences in lowercase letters derive from the fixed region of the library used in the SELEX process and the sequences in uppercase letters derive from the random region of the library used in the SELEX process. S = trunk,
L = loop.

Figure 8 shows the native gel analysis of the binding of the oligonucleotide antidote to aptamer 9.3t. The ability of the oligonucleotide antidote to bind to and denaturing aptamer 9.3t was evaluated by gel electrophoresis native. In summary, radiolabelled 9.3t (125 nM) was incubated at 37 ° C for 15 minutes with (from left to right) a molar excess of factor 8, factor 4, factor 2 or equimolar amounts of the antidote (A.S.) or senseless oligonucleotide (N.S.). The native 9.3t migrates faster than 9.3t bound to antidote in this gel system (compare lanes 1 and 2).

Figures 9A and 9B show the reversal by the oligonucleotide antidote of the anticoagulant activity of aptamer 9.3t in human plasma. Fig. 9A. Change in time of coagulation versus oligonucleotide antidote concentration or senseless oligonucleotide. A value of 1.0 indicates absence of change in coagulation time over baseline. 9.3tM is a mutant version of aptamer 9.3t that has no activity anticoagulant. Fig. 9B. Fraction of the anticoagulant activity of aptamer 9.3t reversed against the molar excess of antidote oligonucleotide

Figures 10A-10C show the specificity of oligonucleotide antidotes. Fig. 10A. Structure minimum secondary of aptamer 9.20t (SEQ ID NO. 18). Fig. 10B. Anticoagulant activity of 9.20t. Fig. 10C. Specificity of oligonucleotide antidote Anti D1.

Figure 11 shows the secondary structure of the aptamer with a final section 9.3t-3NT (SEQ ID NO. 19). Oligonucleotide antidotes are also shown (SEQ ID No. 20 - SEQ ID NO. 22).

Figures 12A and 12B show the activity of aptamer 9.3t-3NT. Fig. 12A. Competitive union data. Fig. 12B. In vitro anticoagulant data.

Figures 13A and 13B show the in vitro reversal of the anticoagulant activity of aptamer 9.3t-3NT. Fig. 13A. Reversal of anticoagulant activity against oligonucleotide antidote concentration. Fig. 13B. Reversal of anticoagulant activity against the molar excess of the antidote on the aptamer.

Figures 14A and 14B show the impact of the adding a final section to the aptamer against FIXa 9.3t on the ability to reverse anticoagulant activity.

Figure 15. The oligonucleotide antidote 5-2C but not a mixed version of this antidote oligonucleotide, 5-2C scr, reverse form Effective activity of aptamers 9.3t and Peg-9.3t in human plasma

Figure 16. Kinetics of antidote activity in human plasma, as described in Example 6.

Figure 17. Duration of antidote activity in vitro , as described in Example 6.

Figures 18A and 18B. Fig. 18A. Structure predicted secondary of aptamer 11F7t (SEQ ID No. 23), which joins the human coagulation factor Xa with a KD of 11.5 nM. Fig. 18B. Predicted secondary structure of a mutant version of the aptamer 11F7t, called 11F7tM (SEQ ID NO: 24).

Figures 19A and 19B. The 11F7t aptamer is a potent anticoagulant of human plasma. Variable concentrations of aptamer 11F7t were added to human plasma in vitro , and then the coagulation time was measured in a PT test (Fig. 19A) or APTT (Fig. 19B). All data is normalized to the initial measurement for that day, so that a value of 1 is equivalent to the absence of change in the coagulation time.

Figure 20. 11F7t sequences for which the oligonucleotide antidotes are complementary.

Figures 21A and 21B. Fig. 21A. The antidotes oligonucleotides effectively reverse the activity of 11F7t aptamer in human plasma. Fig. 21B. Characterization of the activity of the antidote 5-2 over a range of largest concentration of antidote 5-2, and comparison with the activity of the antidote of a version of mixed sequence of antidote 5-2, 5-2 scr.

Figure 22. Kinetics of antidote activity in human plasma. Aptamer 11F7t was added to human plasma in vitro at a final concentration of 125 nM, and allowed to incubate for 5 minutes at 37 ° C. Then oligonucleotide antidote 5-2 was added to a 1: 1 or 5: 1 molar excess or no antidote was added, and plasma coagulation activity was determined by measuring the coagulation time in a PT test at the times indicated below. of the addition of antidote. The remaining residual anticoagulant activity% was calculated by comparing the difference over the initial measurement between the coagulation time in the presence of an antidote with the difference over the initial measurement in the absence of an antidote at each specific time. Data collected at a 5: 1 molar excess of antidote 5-2 for aptamer 11F7t are not shown, since the reversal of anticoagulant activity was complete at the first point (1 minute).

Figure 23. Duration of antidote activity in vitro . The duration of inactivation of the anticoagulant activity of aptamer 11F7t by oligonucleotide antidote 5-2 was measured in vitro in human plasma. In summary, 11F7t was added to human plasma at a final 125 nM concentration and allowed to incubate for 5 minutes. Then oligonucleotide antidote 5-2 was added to a molar excess of factor 4, or in a parallel experiment buffer was added only in place of the oligonucleotide antidote, and the coagulation time was measured in a PT test at various time points after antidote addition. All data is normalized to the initial measurement for that day, so that a value of 1 = no change in coagulation time. It was found that after 5 hours of incubation at 37 ° C, the PT of the untreated plasma began to increase, indicating loss of plasma clotting activity, and the experiment therefore stopped at 5 hours.

Figure 24. Aptamers 9.3t and 11F7t and their respective antidotes work independently of each other in human plasma Apt1 = 9.3t (30 nM), Apt2 = 11F7t (100 nM), AD1 = AO 5-2c (300 nM), AD2 = AO5-2 (500 nM) - the final plasma concentrations are in (). They were added the human plasma aptamers at 37 ° C as indicated, and left incubate for 5 minutes. Then the antidotes were added as indicated, and coagulation activity was measured 10 minutes later of the addition of antidote in APTT assays. In all trials, the aptamer or antidote was replaced by buffer only in cases where which only added an aptamer or an antidote to the plasma. All data is normalized to the initial measurement for that day, so that a value of 1 = no change in the time of coagulation.

Figures 25A-25F. Anticoagulation Plasma antidote control of patients with thrombocytopenia Heparin induced. Fig. 25A-25C. Activity of the Peg-9.3t aptamer and the antidote 5-2 was tested in plasma of patients dependent on hemodialysis diagnosed with HIT. Fig. 25D-25F. The activity of the Peg-9.3t aptamer and the antidote 5-2 was tested in plasma of patients suffering from thromboembolic complications of HIT. The plasma samples are treated as indicated: aptamer, Peg-9.3t 125 nM; antidote, AO 5-2 1.25 µM; mutant aptamer, 9.3tM 125 nM. The experiments were performed as described in the Example 2, Figure 9. The data is presented in seconds (s) and is the average ± range of duplicate measurements.

Figures 26A and B. Controlled anticoagulation with plasma antidote of patients with thrombocytopenia induced by Heparin The activity of aptamer 11F7t and the antidote 5-2 was tested in the plasma of a dependent patient of hemodialysis diagnosed with HIT and of a patient suffering from thromboembolic complications of HIT. For patient 3, the Plasma samples were treated as indicated: aptamer, 11F7t 250 nM; antidote, AO 5-2 1.0 µM; mutant aptamer, 9.3tM 250 nM. The experiments were performed as described in the Example 2, Figure 9. For patient 6, plasma samples are treated as indicated: aptamer, 11F7t 125 nM; antidote, AO 5-2 250 nM; mutant aptamer, 9.3tM 125 nM. The data is presented in seconds (s) and is the average ± interval of duplicate measurements.

Detailed description of the invention

The present invention generally relates to modulators of pharmacological agents, including therapeutic and diagnostic agents. The invention further relates to methods for enhancing or inhibiting the efficacy of pharmacological agents by administering modulators of the invention to a subject (eg, a human being) who needs it. In addition, the invention relates to methods for using modulators of the invention to evaluate the activity of nucleic acid ligands, in vivo and in vitro .

The present invention relates to reversal specific and rapid activity of an acid ligand nucleic, for example, altering its conformation and therefore its function. According to the invention, the modulator can be put into contact with the nucleic acid ligand labeled as a target in conditions such that it binds to the nucleic acid ligand and modify the interaction between the nucleic acid ligand and its target molecule The modification of that interaction may be caused by the modification of the structure of the acid ligand nucleic as a result of binding by the modulator. The modulator can bind the free nucleic acid ligand and / or the ligand of nucleic acid bound to its target molecule.

The modulators of the invention may be designed so that they bind to any nucleic acid ligand particular with a high degree of specificity and a desired degree of affinity The modulators are designed so that, after of the binding, the structure of the nucleic acid ligand is modified in a less active way. For example, the modulator may be designed so that after binding to the acid ligand nucleic marked as a target, the three-dimensional structure of that nucleic acid ligand is altered so that the acid ligand nucleic can no longer bind to its target molecule or join its target molecule with less affinity.

The modulator is an oligonucleotide. He oligonucleotide can be a sequence that is complementary to the minus a part of the nucleic acid ligand. In another embodiment, The modulator is a ribozyme or ADNzyme that is directed at the ligand of nucleic acid In a further embodiment, the modulator can be, for example, a nucleic acid peptide or morpholino acid nucleic that includes a sequence that is complementary to or hybridizes with at least a part of the nucleic acid ligand. A modulator can hybridize specifically with the acid ligand nucleic when the binding of the modulator to the nucleic acid ligand interferes sufficiently with normal ligand function of nucleic acid to cause a change in biological activity of the nucleic acid ligand, under physiological conditions. In a alternative embodiment, there is a sufficient degree of bonding not of Watson and Crick from the modulator to the nucleic acid ligand for affect the activity of the nucleic acid ligand.

A reference aspect also includes methods to identify modulators of nucleic acid ligands. In one aspect, the binding of a modulator to a nucleic acid is determined by any assay that measures binding affinity, such as a gel displacement test. In another aspect, the union from a modulator to a nucleic acid ligand is determined by a Biacore essay. Other tests are described below. copies.

In another aspect, the binding or interaction of the modulator with the nucleic acid ligand is measured by evaluating the effect of the ligand with and without the regulator under appropriate biological conditions. For example, modulators that modify the antithrombotic or anticoagulant activity of the nucleic acid ligand can be identified in vitro or in vivo through a coagulation test bioassay such as the activated coagulation time test, the activated partial thromboplastin test, the hemorrhage time test, prothrombin time test, or thrombin coagulation time test.

The present invention further includes the use of said modulators in a variety of indications so which control of the activity of the acid ligand is desired nucleic. Modulators can act by inhibiting the activity of nucleic acid ligand as an antidote to reverse the actions of the nucleic acid ligand. In addition, an aspect of reference provides methods for using modulators of the invention  to evaluate the activity of nucleic acid ligands. An aspect reference refers to methods to inhibit the effectiveness of nucleic acid ligands administering modulators of the invention to human or non-human mammals.

In another embodiment, the modulators of the invention can also be used to reverse the binding of nucleic acid ligands that house radioactive or cytotoxic moieties to target tissue and therefore, for example, facilitates the removal of said moieties from a patient's system. Also, the modulators of the invention can be used to reverse the binding of labeled nucleic acid ligands with detectable moieties (used, for example, in imaging or isolation or cell sorting) to target cells or tissues (Hicke et al ., J Clin. Invest. 106: 923 (2000); Ringquist et al ., Cytometry 33: 394 (1998)). This reversal can be used to accelerate the removal of the detectable rest from a patient's system.

In a reference aspect the modulators can also be used in in vitro environments to enhance or inhibit the effect of a nucleic acid ligand (eg, aptamer) on a target molecule. For example, modulators can be used in target validation studies. Using the modulators, it is possible to confirm that a response observed after inhibiting a target molecule (with a nucleic acid ligand) is due to the specific inhibition of that molecule.

The modulators of the invention can formulated in pharmaceutical compositions that may also include  of the modulator, a vehicle, diluent or excipient pharmaceutically acceptable. The precise nature of the composition will depend, at least in part, on the nature of the modulator and the route of administration. The dosage regimens optimal can be easily established by a specialist in technique and may vary with the modulator, the patient and the effect wanted. Generally, the modulator is administered IV, IM, IP, SC, orally or topically, as appropriate.

In another embodiment, the acid ligand nucleic or its regulator can covalently bind to a compound lipophilic such as cholesterol, dialkylglycerol, diacylglycerol, or a high non-immunogenic molecular weight compound or polymer such as polyethylene glycol (PEG). In these cases, the properties Pharmacokinetics of the nucleic acid ligand or modulator may empower In yet other embodiments, the acid ligand nucleic or the modulator may be composed, for example, of a nucleic acid or PNA or MNA encapsulated inside a liposome, and enhanced intracellular uptake is observed on the oligonucleotide or modulator not complexed. The lipophilic compound or high non-immunogenic molecular weight compound can bind covalently or associate through non-covalent interactions with the ligand (s) or modulator (s). In embodiments in which the lipophilic compound is cholesterol, dialkylglycerol, diacylglycerol, or the high weight compound Non-immunogenic molecular is PEG, an association is preferred covalent with the modulator (s) oligonucleotide (s). In embodiments in which the lipophilic compound is a cationic liposome or in which the oligonucleotide modulators are encapsulated within the liposome, a non-covalent association with the (the) is preferred oligonucleotide modulator (s). In realizations in which covalent bonding is used, the lipophilic compound or high non-immunogenic molecular weight compound can bind covalently to a variety of positions in the modulator oligonucleotide, such as an exocyclic amino group at the base, position 5 of a pyrimidine nucleotide, position 8 of a purine nucleotide, the phosphate hydroxyl group, or a group hydroxyl or other group at the 5 'or 3' end of the modulator oligonucleotide Preferably, however, it joins the group 5 'or 3' hydroxyl thereof. The modulator union oligonucleotide to other components of the complex can be made directly or with the use of linkers or spacers. He lipophilic compound or high molecular weight compound no immunogenic can be associated through non-covalent interactions with the modulator (s) oligonucleotide (s). For example, in an embodiment of the present invention, the oligonucleotide modulator is encapsulated inside the internal compartment of the lipophilic compound. In other embodiment of the present invention, the modulator oligonucleotide is associated with the lipophilic compound through electrostatic interactions For example, you can associate a cationic liposome with an anionic oligonucleotide modulator. Another example of a non-covalent interaction through forces Ionic attraction is one in which a part of the modulator oligonucleotide hybridized through base pairing of Watson and Crick or triple helix base mating with a oligonucleotide that is associated with a lipophilic compound or high non-immunogenic molecular weight compound.

       \ vskip1.000000 \ baselineskip
    

I. Definitions

It is believed that the following terms have the meanings well recognized in the art. However, they are exposed the following definitions to facilitate the explanation of the invention.

It is understood that the terms "binding activity" and "binding affinity" refer to the tendency of a ligand molecule to bind or not to bind to a target. The energy of such interactions is significant in "binding activity" and "binding affinity" because it defines the necessary concentrations of the interaction partners, the rates at which these partners are able to associate, and the relative concentrations of molecules united and free in a solution. The energy is characterized by, among other ways, the determination of a dissociation constant, K_ {d}. Preferably, the K d is established using a double filter nitrocellulose filter binding assay such as that described by Wong and Lohman, 1993, Proc. Natl Acad. Set 'USA 90, 5428-5432. "Specific binding oligonucleotides,""nucleic acid ligands" or "aptamers" in one embodiment of the invention are oligonucleotides that have specific binding regions that are capable of complexing with an intended target molecule. The specificity of the binding is defined in terms of the comparative dissociation constants (K d) of a modulator of a nucleic acid ligand compared to the dissociation constant with respect to other materials in the environment or unrelated molecules in general. The K d for a modulator of a nucleic acid ligand may be 2 times, preferably 5 times, more preferably 10 times less than the K d with respect to the modulator and the unrelated material or adjacent material in the environment. Even more preferably, the K d will be 50 times lower, more preferably 100 times lower, and more preferably 200 times lower.

Kd can be determined directly by well-known methods, and can be calculated even for complex mixtures by methods such as, for example, those set forth in Caceci, M., et al., Byte (1984) 9: 340-362. It has been observed, however, that for some small oligonucleotides, direct determination of K d is difficult, and may lead to erroneously elevated results. In these circumstances, a competitive binding assay for the target molecule or other candidate substance may be performed with respect to substances known to bind to the target or candidate. The value of the concentration at which a 50% inhibition occurs (K_) is, ideally, equivalent to K_ {d}. However, in no case will K_ {i} be less than K_ {d}. Therefore, the determination of K_ {i}, in an alternative, sets a maximum value for the value of K_ {d}. In those circumstances where technical difficulties rule out the precise measurement of K_ {d}, the measurement of K_ {i} can be conveniently substituted to provide an upper limit for K_ {d}. A value of Ki can also be used to confirm that a modulator binds to a nucleic acid ligand.

How specificity is defined in terms of K_ {d} as set forth above, in certain embodiments of the present invention it is preferred to exclude from the categories of unrelated materials and materials adjacent to the target in the target environment those materials that are sufficiently related to the target that are cross-reactive immunologically with it. By "cross-reactive" immunologically "it is understood that antibodies created with regarding the target they react in a cross way under conditions of Conventional testing with the candidate material. Generally for antibodies cross-react in assays Conventional antibody binding affinities for cross-reactivity materials compared to targets they should be in the range of 5 times to 100 times, usually about 10 times

In the context of this invention, "hybridization" means hydrogen bond, which can be hydrogen bond of Watson and Crick, Hoogsteen or reverse Hoogsteen, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases that mate through the formation of hydrogen bonds. "Complementary" as used herein, refers to the ability of precise pairing between two nucleotides. For example, if a nucleotide in a certain position of an oligonucleotide is capable of forming hydrogen bonds with a nucleotide in the same position of a DNA or RNA molecule, then the oligonucleotide and the DNA or RNA are considered complementary to each other in that position. The oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule is occupied by nucleotides that can form hydrogen bonds with each other. Therefore, "which can specifically hybridize" and "complementary" are expressions that are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the target DNA or RNA. It is understood in the art that the sequence of the compound does not have to be 100% complementary to that of its target nucleic acid so that it can specifically hybridize. A compound can specifically hybridize when binding of the compound to the target nucleic acid molecule prevents normal function of the target nucleic acid to cause a change in usefulness, and there is a sufficient degree of complementarity to avoid non-specific binding of the compound with sequences. non-target under conditions in which a specific binding is desired, that is, under physiological conditions in the case of in vivo tests or therapeutic treatment, and in the case of in vitro tests, under conditions in which the tests are performed.

"Oligomers" or "oligonucleotides" include RNA or DNA sequences or mixtures or analogs thereof, of more than one nucleotide in the form of a single chain or duplex e specifically include short sequences such as dimers and trimers, in the form of a simple chain or duplex, which can be intermediates in the production of binding oligonucleotides specific. The "modified" forms used in combinations Candidates contain at least one non-native remainder.

It is understood that the expression "analog of RNA "refers to a polymer molecule that can contain one or more nucleotides that have a non-hydrogen substituent different from a hydroxyl group in the 2 'position, and for example, It may contain at least one of the following: 2'-deoxy, 2'-halo (including 2'-fluoro), 2'-amino (preferably unsubstituted or mono or disubstituted), 2'-mono-, di- or tri-halomethyl, 2'-O-alkyl (including 2'-O-methyl u O-ethyl), alkyl 2'-O-halo-substituted, 2'-alkyl, azido, phosphorothioate, sulfhydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine, 2,6-diaminopurine, 2-hydroxy-6-mercaptopurine  and pyrimidine bases substituted in position 6 with sulfur or the position 5 with halo or C 1-5 alkyl groups, basic linkers, 3'-deoxyadenosine as well as other analogs "chain terminators" or "non-extensible"  available (at the 3 'end of the RNA), or markers such as 32 P, 33 P and the like. All of the above can be incorporated in an RNA using the conventional synthesis techniques described in this document.

As used herein, a "target" or "target molecule" refers to a biomolecule that is the objective of a therapeutic drug strategy or trial of diagnosis, including, without limitation, enzymes, inhibitors enzymatic, hormones, glycoproteins, lipids, phospholipids, acids nucleic, intracellular, extracellular proteins, and of cell surface, peptides, carbohydrates, including glycosaminoglycans, lipids, including glycolipids and certain oligonucleotides, and generally, any biomolecule capable of activate or deactivate a biochemical pathway or modulate it, or that is involved in a predictable biological response. The targets can be free in solution, such as thrombin, or associated with cells or virus, as in receptors or envelope proteins. Any molecule that is of sufficient size to recognize specifically by a nucleic acid ligand it can be used as Diana. Therefore, membrane structures, receptors, organelles, and the like as complexation targets.

An "RNA aptamer" is an aptamer that It comprises ribonucleoside units. It is also understood that "RNA aptamer" encompasses RNA analogs as defined earlier in this document.

It is understood that the expression "aptamer against coagulation factors "refers to a nucleic acid single chain that binds to a clotting factor and modulates its function. It is understood that the expression "coagulation factor" refers to a factor that acts in the coagulation cascade intrinsic or extrinsic or both.

As used in this document, "sequence consensus "refers to a nucleotide sequence or region (which  it can be composed or not of contiguous nucleotides) that found in one or more regions of at least two acid sequences nucleic. A consensus sequence can be as short as three nucleotides in length. It can also be composed of one or more non-contiguous sequences, with nucleotide or polymer sequences up to hundreds of bases of length interspersed between consensus sequences Consensus sequences can be identified by sequence comparisons between nucleic acid species individual, these comparisons being assisted by computer programs and others, tools for modeling the secondary or tertiary structure based on information from sequence. Generally, the consensus sequence will contain at least approximately 3 to 20 nucleotides, more commonly 6 to 10 nucleotides

It is understood that the expressions "disease cardiovascular "and" cardiovascular diseases "are refer to any cardiovascular disease as you would understand a specialist in the technique. Non-limiting examples of Particularly contemplated cardiovascular diseases include, although without limitation, atherosclerosis, thrombophilia, embolisms, heart attack (for example, myocardial infarction), thrombosis, angina, stroke, septic shock, hypertension, hypercholesterolemia, restenosis and diabetes.

It is understood that the term "approximately", as used in this document when it is done reference to a measurable value such as an amount of weight, time, dose etc., covers variations of ± 20% or ± pm 10%, more preferably ± 5%, even more preferably ± 1%, and even more preferably ± 0.1% of the amount specified, since such variations are appropriate to perform The described method.

The compounds of the present invention that they have a chiral center they can exist in and isolate themselves in forms optically active and racemic. Some compounds may show polymorphism. The present invention encompasses racemic forms, optically active, polymorphic, or stereoisomeric, or mixtures of the same, of a compound of the invention, which have the Useful properties described in this document. The forms optically active can be prepared, for example, by resolution of the racemic form by recrystallization techniques, by synthesis from optically active starting materials, by synthesis chiral, or by chromatographic separation using a phase stationary chiral or by enzymatic resolution. In one embodiment Preferably, the compounds are used in naturally occurring forms. Without However, as an alternative, the compounds can be used in a form of unnatural origin.

       \ vskip1.000000 \ baselineskip
    

II. Nucleic Acid Ligands

A "nucleic acid ligand" as used in this document it is an aptamer against coagulation factors as defined above. A desirable action includes, although without limitation, the binding of the target, the catalytic change of the target, the reaction with the target in a way that modifies the target or functional activity of the target, covalent binding to the target as in a suicide inhibitor, or the facilitation of reaction between the target and another molecule. In the realization preferred, the action is specific binding with affinity for a target molecule, said target molecule being a chemical structure three-dimensional, where the nucleic acid ligand is not an acid nucleic that has the known physiological function of joining by the target molecule In one embodiment of the invention, the ligands of Nucleic acid are identified using the SELEX methodology. The nucleic acid ligands include nucleic acids that are identify from a mixture of acid candidates nucleic acids, where the nucleic acid ligand is a ligand of a given target, by the method comprising a) contacting the mixture of candidates with the target, where the nucleic acids that they have an increased affinity for the target in relation to the mixture of candidates can be separated from the rest of the mix of candidates; b) separate the increased affinity nucleic acids from the rest of the candidate mix; and c) amplify acids increased affinity nuclei to produce a mixture of acids Nucleic enriched with ligand. As used in this document, nucleic acid ligand or aptamer refers to sequences both singular as plural nucleic acids that are capable of bind to a protein or other molecule, and whereby the function of the protein or other molecule.

Nucleic acid ligands can be prepared with nucleotides that harbor stoichiometry D or L, or a mixture of the same. Nucleosides of natural origin are in configuration D. Aptamers have been prepared from L-nucleotides, and they are called L-aptamers. The nucleic acid ligands used for therapeutic purposes they are typically in D configuration, but they can show any configuration that provides the desired effect Typically, when nucleic acid ligands which comprise L-nucleotides are the target of a oligonucleotide modulator, the modulator also comprises L-nucleotides (see, for example, the USP document 5,780,221).

The nucleic acid ligands preferably they comprise about 10 to about 100 nucleotides, preferably from about 15 to about 40 nucleotides, more preferably about 20 to approximately 40 nucleotides, since oligonucleotides of a length that is within these intervals are easily prepared by conventional techniques. In one embodiment, the aptamers or oligonucleotide modulators may comprise a minimum of about 6 nucleotides, preferably 10, and more preferably 14 or 15 nucleotides, which are necessary for perform the specific union. The only apparent limitations on the binding specificity of the target / oligonucleotide pairs of the invention refer to a sequence sufficient to be distinctive in the binding oligonucleotide and sufficient ability to binding of the target substance to obtain the necessary interaction. Aptamers against binding regions containing more sequences short than 10, for example, 6 units, are possible if you can obtain the appropriate interaction in the context of the environment in the That the target is located. Therefore, if there is little interference by other materials, less specificity and less may be required bond strength

Nucleic acid ligands and methods for their production and use are described, for example, in the following United States patents. Any of the nucleic acid ligands described in the patents listed below or other patents, or any nucleic acid ligand described in the publications as well as other desired nucleic acid ligands used in medical therapy can be modulated or regulated in accordance with the present invention. . US Patent No. 6,387,635, entitled 2'-fiuoropyrimidine anti-calf intestinal phosphatase nucleic acid ligands; U.S. Patent No. 6,387,620, entitled Transcription-free selex; United States Patent No. 6,379,900, entitled Compositions and methods of use of 8-nitroguanine; US Patent No. 6,376,474, entitled Systematic evolution of ligands by exponential enrichment: tissue SELEX; US Patent No. 6,376,190, entitled Modified SELEX processes without purified protein; United States Patent No. 6,355,787, entitled Purine nucleoside modifications by palladium catalyzed methods and compounds produced; U.S. Patent No. 6,355,431, entitled Detection of nucleic acid amplification reactions using bead arrays; U.S. Patent No. 6,346,611, entitled High affinity TGF? nucleic acid ligands and inhibitors; US Patent No. 6,344,321, entitled Nucleic acid ligands which bind to hepatocyte growth factor / scatter factor (HGF / SF) or its c-met receptor; US Patent No. 6,344,318, entitled Methods of producing nucleic acid ligands; US Patent No. 6,331,398, entitled Nucleic acid ligands; U.S. Patent No. 6,331,394, entitled Nucleic acid ligands to integrins; U.S. Patent No. 6,329,145, entitled Determining non-nucleic acid molecule binding to target by competition with nucleic acid ligand; US Patent No. 6,306,598, entitled Nucleic acid-coupled colorimetric analyte detectors; U.S. Patent No. 6,303,316, entitled Organic semiconductor recognition complex and system; US Patent No. 6,300,074, entitled Systematic evolution of ligands by exponential enrichment: Chemi-SELEX; U.S. Patent No. 6,291,184, entitled Systematic evolution of ligands by exponential enrichment: photoselection of nucleic acid ligands and solution selex; US Patent No. 6,287,765, entitled Methods for detecting and identifying single molecules; US Patent No. 6,280,943, entitled 2'-fluoropyrimidine anti-calf intestinal phosphatase nucleic acid ligands; US Patent No. 6,280,932, entitled High affinity nucleic acid ligands to lectins; U.S. Patent No. 6,264,825, entitled Binding acceleration techniques for the detection of analytes; U.S. Patent No. 6,261,783, entitled Homogeneous detection of a target through nucleic acid ligand-ligand beacon interaction; U.S. Patent No. 6,261,774, entitled Truncation selex method; US Patent No. 6,242,246, entitled Nucleic acid ligand diagnostic Biochip; U.S. Patent No. 6,232,071, entitled Tenascin-C nucleic acid ligands; US Patent No. 6,229,002, entitled Platelet derived growth factor (PDGF) nucleic acid ligand complexes; U.S. Patent No. 6,225,063, entitled RNA channels in biological membranes; United States Patent No. 6,207,816, entitled High affinity oligonucleotide ligands to growth factors; US Patent No. 6,207,388, entitled Compositions, methods, kits and apparatus for determining the presence or absence of target molecules; US Patent No. 6,184,364, entitled High affinity nucleic acid ligands containing modified nucleotides; US Patent No. 6,183,967, entitled Nucleic acid ligand inhibitors to DNA polymerases; U.S. Patent No. 6,180,348, entitled Method of isolating target specific oligonucleotide ligands; US Patent No. 6,177,557, entitled High affinity ligands of basic fibroblast growth factor and thrombin; US Patent No. 6,177,555, entitled Homogeneous detection of a target through nucleic acid ligand-ligand beacon interaction; U.S. Patent No. 6,171,795, entitled Nucleic acid ligands to CD40 ligand; United States Patent No. 6,168,778, entitled Vascular endothelial growth factor (VEGF) Nucleic Acid Ligand Complexes; United States Patent No. 6,147,204, entitled Nucleic acid ligand complexes; United States Patent No. 6,140,490, entitled High affinity nucleic acid ligands of complement system proteins; U.S. Patent No. 6,127,119, entitled Nucleic acid ligands of tissue target; U.S. Patent No. 6,124,449, entitled High affinity TGF? nucleic acid ligands and inhibitors; U.S. Patent No. 6,114,120, entitled Systematic evolution of ligands by exponential enrichment: tissue selex; U.S. Patent No. 6,110,900, entitled Nucleic acid ligands; US Patent No. 6,083,696, entitled Systematic evolution of ligands exponential enrichment: blended selex; U.S. Patent No. 6,080,585, entitled Methods for discovering ligands; US Patent No. 6,051,698, entitled Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes; United States Patent No. 6,048,698, entitled Parallel SELEX; United States Patent No. 6,030,776, entitled Parallel SELEX; U.S. Patent No. 6,028,186, entitled High affinity nucleic acid ligands of cytokines; U.S. Patent No. 6,022,691, entitled Determination of oligonucleotides for therapeutics, diagnostics and research reagents; US Patent No. 6,020,483, entitled Nucleoside modifications by palladium catalyzed methods; US Patent No. 6,020,130, entitled Nucleic acid ligands that bind to and inhibit DNA polymerases; US Patent No. 6,013,443, entitled Systematic evolution of ligands by exponential enrichment: tissue SELEX; U.S. Patent No. 6,011,020, entitled Nucleic acid ligand complexes; US Patent No. 6,001,988, entitled High affinity nucleic acid ligands to lectins; U.S. Patent No. 6,001,577, entitled Systematic evolution of ligands by exponential enrichment: photoselection of nucleic acid ligands and solution selex; US Patent No. 6,001,570, entitled Compositions, methods, kits and apparatus for determining the presence or absence of target molecules; U.S. Patent No. 5,998,142, entitled Systematic evolution of ligands by exponential enrichment: chemi-SELEX; U.S. Patent No. 5,989,823, entitled Homogeneous detection of a target through nucleic acid ligand-ligand beacon interaction; United States Patent No. 5,972,599, entitled High affinity nucleic acid ligands of cytokines; U.S. Patent No. 5,962,219, entitled Systematic evolution of ligands by exponential enrichment: chemi-selex; US Patent No. 5,958,691, entitled High affinity nucleic acid ligands containing modified nucleotides; US Patent No. 5,874,557, entitled Nucleic acid ligand inhibitors to DNA polymerases; U.S. Patent No. 5,874,218, entitled Method for detecting a target compound in a substance using a nucleic acid ligand; US Patent No. 5,871,924, entitled Method for the production of ligands capable of facilitating aminoacyl-RNA synthesis; U.S. Patent No. 5,869,641, entitled High affinity nucleic acid ligands of CD4; U.S. Patent No. 5,864,026, entitled Systematic evolution of ligands by exponential enrichment: tissue selex; U.S. Patent No. 5,861,254, entitled Flow cell SELEX; US Patent No. 5,859,228, entitled Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes; U.S. Patent No. 5,858,660, entitled Parallel selex; U.S. Patent No. 5,853,984, entitled Use of nucleic acid ligands in flow cytometry; US Patent No. 5,849,890, entitled High affinity oligonucleotide ligands to chorionic gonadotropin hormone and related glycoprotein hormones; US Patent No. 5,849,479, entitled High-affinity oligonucleotide ligands to vascular endothelial growth factor (VEGF); U.S. Patent No. 5,846,713, entitled High affinity HKGF nucleic acid ligands and inhibitors; U.S. Patent No. 5,843,653, entitled Method for detecting a target molecule in a sample using a nucleic acid ligand; U.S. Patent No. 5,837,834, entitled High affinity HKGF nucleic acid ligands and inhibitors; US Patent No. 5,837,456, entitled High affinity oligonucleotide ligands to chorionic gonadotropin hormone and related glycoprotein hormones; U.S. Patent No. 5,834,199, entitled Methods of identifying transition metal complexes that selectively cleave regulatory elements of mRNA and uses thereof; U.S. Patent No. 5,817,785, entitled Methods of producing nucleic acid ligands; US Patent No. 5,811,533, entitled High-affinity oligonucleotide ligands to vascular endothelial growth factor (VEGF); U.S. Patent No. 5,795,721, entitled High affinity nucleic acid ligands of ICP4; United States Patent No. 5,789,163, entitled Enzyme linked oligonucleotide assays (ELONAS); US Patent No. 5,789,160, entitled Parallel selex; U.S. Patent No. 5,789,157, entitled Systematic evolution of ligands by exponential enrichment: tissue selex; US Patent No. 5,786,462, entitled High affinity ssDNA ligands of HIV-1 reverse transcriptase; U.S. Patent No. 5,780,228, entitled High affinity nucleic acid ligands to lectins; U.S. Patent No. 5,773,598, entitled Systematic evolution of ligands by exponential enrichment: chimeric selex; U.S. Patent No. 5,766,853, entitled Method for identification of high affinity nucleic acid ligands to selectins; U.S. Patent No. 5,763,595, entitled Systematic evolution of ligands by exponential enrichment: Chemi-SELEX; U.S. Patent No. 5,763,566, entitled Systematic evolution of ligands by exponential enrichment: tissue SELEX; U.S. Patent No. 5,763,177, entitled Systematic evolution of ligands by exponential enrichment: photoselection of nucleic acid ligands and solution selex; US Patent No. 5,763,173, entitled Nucleic acid ligand inhibitors to DNA polymerases; US Patent No. 5,756,287, entitled High affinity HIV integrase inhibitors; U.S. Patent No. 5,750,342, entitled Nucleic acid ligands of tissue target; U.S. Patent No. 5,734,034, entitled Nucleic acid ligand inhibitors of human neutrophil elastase; U.S. Patent No. 5,731,424, entitled High affinity TGF? nucleic acid ligands and inhibitors; US Patent No. 5,731,144, entitled High affinity TGF? nucleic acid ligands; U.S. Patent No. 5,726,017, entitled High affinity HIV-1 gag nucleic acid ligands; U.S. Patent No. 5,723,594, entitled High affinity PDGF nucleic acid ligands; U.S. Patent No. 5,723,592, entitled Parallel selex; U.S. Patent No. 5,723,289, entitled Parallel selex; U.S. Patent No. 5,712,375, entitled Systematic evolution of ligands by exponential enrichment: tissue selex; US Patent No. 5,707,796, entitled Method for selecting nucleic acids on the basis of structure; U.S. Patent No. 5,705,337, entitled Systematic evolution of ligands by exponential enrichment: chemi-SELEX; US Patent No. 5,696,249, entitled Nucleic acid ligands; U.S. Patent No. 5,693,502, entitled Nucleic acid ligand inhibitors to DNA polymerases; United States Patent No. 5,688,935, entitled Nucleic acid ligands of tissue target; US Patent No. 5,686,592, entitled High-affinity oligonucleotide ligands to immunoglobulin E (IgE); U.S. Patent No. 5,686,242, entitled Determination of oligonucleotides for therapeutics, diagnostics and research reagents; U.S. Patent No. 5,683,867, entitled Systematic evolution of ligands by exponential enrichment: blended SELEX; U.S. Patent No. 5,674,685, entitled High affinity PDGF nucleic acid ligands; US Patent No. 5,670,637, entitled Nucleic acid ligands; U.S. Patent No. 5,668,264, entitled High affinity PDGF nucleic acid ligands; U.S. Patent No. 5,663,064, entitled Ribozymes with RNA protein binding site; US Patent No. 5,660,985, entitled High affinity nucleic acid ligands containing modified nucleotides; US Patent No. 5,654,151, entitled High affinity HIV Nucleocapsid nucleic acid ligands; U.S. Patent No. 5,650,275, entitled Target detection method using spectroscopically detectable nucleic acid ligands; US Patent No. 5,648,214, entitled High-affinity oligonucleotide ligands to the tachykinin substance P; U.S. Patent No. 5,641,629, entitled Spectroscopically detectable nucleic acid ligands; US Patent No. 5,639,868, entitled High-affinity RNA ligands for basic fibroblast growth factor; US Patent No. 5,637,682, entitled High-affinity oligonucleotide ligands to the tachykinin substance P; U.S. Patent No. 5,637,461, entitled Ligands of HIV-1 TAT protein; U.S. Patent No. 5,637,459, entitled Systematic evolution of ligands by exponential enrichment: chimeric selex; US Patent No. 5,635,615, entitled High affinity HIV nucleocapsid nucleic acid ligands; US Patent No. 5,629,155, entitled High-affinity oligonucleotide ligands to immunoglobulin E (IgE); US Patent No. 5,622,828, entitled High-affinity oligonucleotide ligands to secretory phospholipase A2 (sPLA.sub.2); US Patent No. 5,595,877, entitled Methods of producing nucleic acid ligands; US Patent No. 5,587,468, entitled High affinity nucleic acid ligands to HIV integrase; US Patent No. 5,580,737, entitled High-affinity nucleic acid ligands that discriminate between theophylline and caffeine; U.S. Patent No. 5,567,588, entitled Systematic evolution of ligands by exponential enrichment: Solution SELEX; U.S. Patent No. 5,543,293, entitled DNA ligands of thrombin; U.S. Patent No. 5,527,894, entitled Ligands of HIV-1 tat protein; United States Patent No. 5,475,096, entitled Nucleic acid ligands; U.S. Patent No. 5,866,334, entitled Determination and identification of active compounds in a compound library; U.S. Patent No. 5,864,026, entitled Systematic evolution of ligands by exponential enrichment: tissue selex; U.S. Patent No. 5,861,254, entitled Flow cell SELEX; US Patent No. 5,859,228, entitled Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes; U.S. Patent No. 5,858,660, entitled Parallel selex; U.S. Patent No. 5,853,984, entitled Use of nucleic acid ligands in flow cytometry; US Patent No. 5,849,890, entitled High affinity oligonucleotide ligands to chorionic gonadotropin hormone and related glycoprotein hormones; US Patent No. 5,849,479, entitled High-affinity oligonucleotide ligands to vascular endothelial growth factor (VEGF); U.S. Patent No. 5,846,713, entitled High affinity HKGF nucleic acid ligands and inhibitors; U.S. Patent No. 5,843,732, entitled Method and apparatus for determining consensus secondary structures for nucleic acid sequences; U.S. Patent No. 5,843,653, entitled Method for detecting a target molecule in a sample using a nucleic acid ligand; U.S. Patent No. 5,840,867, entitled Aptamer analogs specific for biomolecules; U.S. Patent No. 5,840,580, entitled Phenotypic characterization of the hematopoietic stem cell; U.S. Patent No. 5,837,838, entitled Bax inhibitor proteins; U.S. Patent No. 5,837,834, entitled High affinity HKGF nucleic acid ligands and inhibitors; US Patent No. 5,837,456, entitled High affinity oligonucleotide ligands to chorionic gonadotropin hormone and related glycoprotein hormones; U.S. Patent No. 5,834,199, entitled Methods of identifying transition metal complexes that selectively cleave regulatory elements of mRNA and uses thereof; U.S. Patent No. 5,834,184, entitled In vivo selection of RNA-binding peptides; U.S. Patent No. 5,817,785, entitled Methods of producing nucleic acid ligands; US Patent No. 5,811,533, entitled High-affinity oligonucleotide ligands to vascular endothelial growth factor (VEGF); US Patent No. 5,804,390, entitled Use of nuclear magnetic resonance to identify ligands to target biomolecules; U.S. Patent No. 5,795,721, entitled High affinity nucleic acid ligands of ICP4; United States Patent No. 5,789,163, entitled Enzyme linked oligonucleotide assays (ELONAS); US Patent No. 5,789,160, entitled Parallel selex; U.S. Patent No. 5,789,157, entitled Systematic evolution of ligands by exponential enrichment: tissue selex; US Patent No. 5,786,462, entitled High affinity ssDNA ligands of HIV-1 reverse transcriptase; US Patent No. 5,786,203, entitled Isolated nucleic acid encoding corticotropin-releasing factor.sub.2 receptors; US Patent No. 5,786,145, entitled Oligonucleotide competitors for binding of HIV RRE to REV protein and assays for screening inhibitors of this binding; U.S. Patent No. 5,783,566, entitled "Method for increasing or decreasing transfection efficiency;" U.S. Patent No. 5,780,610, entitled Reduction of nonspecific hybridization by using novel base-pairing schemes; U.S. Patent No. 5,780,228, entitled High affinity nucleic acid ligands to lectins; U.S. Patent No. 5,773,598, entitled Systematic evolution of ligands by exponential enrichment: chimeric selex; U.S. Patent No. 5,770,434, entitled Soluble peptides having constrained, secondary conformation in solution and method of making same; U.S. Patent No. 5,766,853, entitled Method for identification of high affinity nucleic acid ligands to selectins; U.S. Patent No. 5,763,595, entitled Systematic evolution of ligands by exponential enrichment: Chemi-SELEX; U.S. Patent No. 5,763,566, entitled Systematic evolution of ligands by exponential enrichment: tissue SELEX; U.S. Patent No. 5,763,177, entitled Systematic evolution of ligands by exponential enrichment: photoselection of nucleic acid ligands and solution selex; US Patent No. 5,763,173, entitled Nucleic acid ligand inhibitors to DNA polymerases; U.S. Patent No. 5,756,296, entitled Nucleotide-directed assembly of bimolecular and multimolecular drugs and devices; US Patent No. 5,756,291, entitled Aptamers specific for biomolecules and methods of making; US Patent No. 5,756,287, entitled High affinity HIV integrase inhibitors; U.S. Patent No. 5,750,342, entitled Nucleic acid ligands of tissue target; U.S. Patent No. 5,739,305, entitled Nucleotide-directed assembly of bimolecular and multimolecular drugs and devices; U.S. Patent No. 5,734,034, entitled Nucleic acid ligand inhibitors of human neutrophil elastase; US Patent No. 5,733,732, entitled Methods for detecting primary adhalinopathy; U.S. Patent No. 5,731,424, entitled High affinity TGF.beta. nucleic acid ligands and inhibitors; U.S. Patent No. 5,731,144, entitled High affinity TGF.beta. nucleic acid ligands; U.S. Patent No. 5,726,017, entitled High affinity HIV-1 gag nucleic acid ligands; U.S. Patent No. 5,726,014, entitled Screening assay for the detection of DNA-binding molecules; U.S. Patent No. 5,723,594, entitled High affinity PDGF nucleic acid ligands; U.S. Patent No. 5,723,592, entitled Parallel selex; U.S. Patent No. 5,723,289, entitled Parallel selex; U.S. Patent No. 5,712,375, entitled Systematic evolution of ligands by exponential enrichment: tissue selex; US Patent No. 5,707,796, entitled Method for selecting nucleic acids on the basis of structure; U.S. Patent No. 5,705,337, entitled Systematic evolution of ligands by exponential enrichment: chemi-SELEX; US Patent No. 5,698,442, entitled DNA encoding an 18 Kd CDK6 inhibiting protein; US Patent No. 5,698,426, entitled Surface expression libraries of heteromeric receptors; US Patent No. 5,698,401, entitled Use of nuclear magnetic resonance to identify ligands to target biomolecules; U.S. Patent No. 5,693,502, entitled Nucleic acid ligand inhibitors to DNA polymerases; United States Patent No. 5,688,935, entitled Nucleic acid ligands of tissue target; U.S. Patent No. 5,688,670, entitled Self-modifying RNA molecules and methods of making; US Patent No. 5,686,592, entitled High-affinity oligonucleotide ligands to immunoglobulin E (IgE); U.S. Patent No. 5,683,867, entitled Systematic evolution of ligands by exponential enrichment: blended SELEX; U.S. Patent No. 5,681,702, entitled Reduction of nonspecific hybridization by using novel base-pairing schemes; U.S. Patent No. 5,674,685, entitled High affinity PDGF nucleic acid ligands; US Patent No. 5,670,637, entitled Nucleic acid ligands; United States Patent No. 5,668,265, entitled Bi-directional oligonucleotides that bind thrombin; U.S. Patent No. 5,668,264, entitled High affinity PDGF nucleic acid ligands; US Patent No. 5,660,985, entitled High affinity nucleic acid ligands containing modified nucleotides; US Patent No. 5,660,855, entitled Lipid constructs for targeting to vascular smooth muscle tissue; U.S. Patent No. 5,658,738 entitled Bi-directional oligonucleotides that bind thrombin; US Patent No. 5,656,739 entitled Nucleotide-directed assembly of bimolecular and multimolecular drugs and devices; US Patent No. 5,656,467, entitled Methods and materials for producing gene libraries; US Patent No. 5,654,151, entitled High affinity HIV Nucleocapsid nucleic acid ligands; U.S. Patent No. 5,650,275, entitled Target detection method using spectroscopically detectable nucleic acid ligands; US Patent No. 5,648,214, entitled High-affinity oligonucleotide ligands to the tachykinin substance P; U.S. Patent No. 5,641,629, entitled Spectroscopically detectable nucleic acid ligands; US Patent No. 5,639,868, entitled High-affinity RNA ligands for basic fibroblast growth factor; US Patent No. 5,639,428, entitled Method and apparatus for fully automated nucleic acid amplification, nucleic acid assay and immunoassay; US Patent No. 5,637,682, entitled High-affinity oligonucleotide ligands to the tachykinin substance P; U.S. Patent No. 5,637,459, entitled Systematic evolution of ligands by exponential enrichment: chimeric selex; US Patent No. 5,635,615, entitled High affinity HIV nucleocapsid nucleic acid ligands; US Patent No. 5,631,156, entitled DNA encoding and 18 KD CDK6 inhibiting protein; U.S. Patent No. 5,631,146, entitled DNA aptamers and catalysts that bind adenosine or adenosine-5'-phosphates and methods for isolation thereof; US Patent No. 5,629,407, entitled DNA encoding an 18 KD CDK6 inhibiting protein and antibodies thereto; US Patent No. 5,629,155, entitled High-affinity oligonucleotide ligands to immunoglobulin E (IgE); US Patent No. 5,622,828, entitled High-affinity oligonucleotide ligands to secretory phospholipase A2 (sPLA.sub.2); US Patent No. 5,621,082, entitled DNA encoding an 18 Kd CDK6 inhibiting protein; US Patent No. 5,599,917, entitled Inhibition of interferon-gamma with oligonucleotides; US Patent No. 5,597,696, entitled Covalent cyanine dye oligonucleotide conjugates; US Patent No. 5,587,468, entitled High affinity nucleic acid ligands to HIV integrase; US Patent No. 5,585,269, entitled Isolated DNA encoding c-mer protooncogene; US Patent No. 5,580,737, entitled High-affinity nucleic acid ligands that discriminate between theophylline and caffeine; U.S. Patent No. 5,567,588, entitled Systematic evolution of ligands by exponential enrichment: Solution SELEX; U.S. Patent No. 5,565,327, entitled "Methods of diagnosing parasitic infections and of testing drug susceptibility of parasites;" U.S. Patent No. 5,527,894, entitled Ligands of HIV-1 tat protein; US Patent No. 5,512,462, entitled Methods and reagents for the polymerase chain reaction amplification of long DNA sequences; US Patent No. 5,503,978, entitled Method for identification of high affinity DNA ligands of HIV-1 reverse transcriptase; US Patent No. 5,472,841, entitled Methods for identifying nucleic acid ligands of human neutrophil elastase; Y
U.S. Patent No. 5,459,015, entitled High-affinity RNA ligands of basic fibroblast growth factor.

III. Types of Modulators

The modulators (i.e. regulators) of the invention are pharmaceutically oligonucleotide modulators acceptable that can bind to a nucleic acid ligand and modify the interaction between that ligand and its target molecule (by example, modifying the aptamer structure) as described previously, or that degrades, metabolizes, cleaves or alters chemically otherwise the nucleic acid ligand for Modify its biological effect as described above. Examples of modulators include (A) oligonucleotides or analogs thereof that are complementary to at least one part of the aptamer sequence (including ribozymes or ADNzymes or, for example, nucleic peptide acids (PNA), mofolin acids nucleic acids (MNA), or closed nucleic acids (LNA)), and (E) Chimeras, fusion products, or other combinations of any of the above.

In an alternative embodiment of the invention, The modulator itself is an aptamer. In this embodiment, first generates a nucleic acid ligand that binds to the therapeutic agent wanted. In a second stage, a second aptamer is generated that is join the first aptamer using the SELEX process described in this document or other process, and modulates the interaction between the aptamer Therapeutic and the target.

In other alternative embodiments, the ligand of nucleic acid that binds to the target is a PNA, MNA, LNA or PCO and The modulator is an aptamer. Alternatively, the acid ligand nucleic that binds to the target is a PNA, MNA, LNA or PCO, and the Modulator is an MNA. Alternatively, the nucleic acid ligand that joins the target is a PNA, MNA, LNA or PCO, and the modulator is an LNA. Alternatively, the nucleic acid ligand that binds to The target is a PNA, MNA, LNA or PCO, and the modulator is PCO.

       \ vskip1.000000 \ baselineskip
    

Oligonucleotides and Same Analogs 1. Polynucleic Acid

The modulator of the invention is a oligonucleotide comprising a sequence complementary to al minus a part of the nucleic acid ligand sequence marked as target. For example, the oligonucleotide modulator may comprise a sequence complementary to 6-25 nucleotides of the target labeled nucleic acid ligand, typically, 8-20 nucleotides, more typically, 10-15 nucleotides Advantageously, the modulator oligonucleotide is complementary to 6-25 Consecutive nucleotides of the nucleic acid ligand, or 8-20 or 10-15 nucleotides consecutive. The length of the oligonucleotide modulator can easily optimized taking into account the acid ligand nucleic marked as target and the desired effect. Typically the oligonucleotide modulator is 5-80 nucleotides in length, more typically, 10-30 and much more typically 15-20 nucleotides (for example, 15-17). The oligonucleotide can be prepared with nucleotides that harbor stoichiometry D or L, or a mixture of same. Nucleosides of natural origin are in configuration D.

Duplex formation by the binding of complementary pairs of short oligonucleotides is a fairly rapid reaction with constants of second order association rate generally between 1x10 6 and 3x10 5 M 1 s 1 . The initial phase of the binding reaction involves the formation of a duplex of two to three base pairs, called "nucleation." After nucleation, the mating proceeds along the entire length of the complementary sequence at a very fast rate - approximately 10 6 bases per second at 20 ° C. Therefore, the modulating effect on a nucleic acid ligand by the formation of a duplex with a complementary oligonucleotide is rapid. The stability of short duplexes is very dependent on the length and base composition of the duplex. The thermodynamic parameters for the formation of short nucleic acid duplexes have been rigorously measured, producing the rules of the closest contiguous for all possible base pairs so that accurate predictions of free energy, T m {and} can be calculated both the half-life of a given oligoribonucleotide duplex (for example, Xia et al ., Biochem. 37: 14719 (1998) (see also Eguchi et al . Antigensis RNA, Annu. Rev. Biochem. 60: 631 (1991)).

The oligonucleotide modulators of the invention are advantageously directed to single chain regions of the nucleic acid ligand. This facilitates nucleation and, therefore therefore, the speed of modulation of ligand activity of nucleic acid, and also, generally leads to duplex intermolecular containing more base pairs than the ligand of nucleic acid labeled as target.

Various strategies can be used to determine the optimal site for oligonucleotide binding to a nucleic acid ligand labeled as target. One can be used empirical strategy in which oligonucleotides are "traversed" complementary throughout the aptamer. A travel experiment It may involve two experiments performed sequentially. May produce a new mix of candidates in which each of the members of the candidate mix have an acid region fixed nucleic corresponding to an oligonucleotide modulator of interest. Each member of the candidate mix also contains a randomized region of sequences. According to this method it is possible to identify what is known as acid ligands "extended" nucleic, which contain regions that can bind to more than one binding domain of a nucleic acid ligand. According to this approach, they can be used 2'-O-methyl oligonucleotides (for example, 2'-O-methyl oligonucleotides) approximately 15 nucleotides in length that are staggered in approximately 5 nucleotides in the aptamer (for example, nucleotide-complementary oligonucleotides 1-15, 6-20, 11-25, etc. of aptamer 9.3t). An empirical strategy can be particularly effective because the impact of the tertiary structure of the aptamer on hybridization efficacy can be difficult to predict. Assays described in the following may be used Examples to assess the ability of different oligonucleotides hybridize with a nucleic acid ligand specific, with particular emphasis on the molar excess of oligonucleotide required to achieve complete binding of the nucleic acid ligand. The capacity of the different oligonucleotide modulators increase the speed of dissociation of the nucleic acid ligand from, or the association of nucleic acid ligand with, its target molecule can also determined by conducting conventional kinetic studies using, for example, BIACORE trials. Oligonucleotide modulators can be selected so that a molar excess of oligonucleotide factor 5-50, or less, for modify the interaction between the nucleic acid ligand and its target molecule as desired.

Alternatively, the nucleic acid ligand marked as target can be modified to include a stretch single-chain final (3 'or 5') to promote association with a oligonucleotide modulator. The appropriate final sections can comprise 1 to 20 nucleotides, preferably, 1-10 nucleotides, more preferably, 1-5 nucleotides and, much more preferably, 3-5 nucleotides (for example, nucleotides modified such as sequences 2'-O-methyl). Acid ligands Nucleic with final stretches can be tested in binding assays and bioassays (for example, as described in the following Examples) to verify that the addition of the final tranche single chain does not alter the active structure of the acid ligand nucleic. A series of oligonucleotides can be designed (by example, 2'-O-methyl oligonucleotides) that can form, for example, 1, 3 or 5 pairs of bases with the sequence of the final section and tested for its capacity of associating with the aptamer with final tranche alone, as well as its ability to increase the rate of dissociation of the ligand from nucleic acid of, or the association of the aptamer with, its molecule Diana. Mixed sequence controls can be used to verify that the effects are due to duplex formation and not to non-specific effects The native gel assay can be used described in the following Examples to measure the speed of dissociation / association of an oligonucleotide modulator of / with a target aptamer.

The present invention provides modulators that reverse the effects specifically and quickly anticoagulants and antithrombotic nucleic acid ligands which are directed to the components of the coagulation pathway, particularly antagonist nucleic acid ligands of enzymatic complexes of tissue factor (TF) / factor VIIa (FVIIa), factor VIIIa (FVIIIa) / factor IXa (FIXa), factor Va (FVa) / factor Xa (Fxa) and platelet receptors such as gpIIbIIIa, gpIbIX, gpVI, factors involved in the promotion of platelet activation such as Gas6, factors involved in the promotion or maintenance of fibrin clot formation such as PAI-1 (plasminogen activator 1 inhibitor) or coagulation factor XIIIa (FXIIIa), and additional factors involved in the promotion or prevention of clot formation of fibrin such as ATIII (anti-thrombin III), thrombin or coagulation factor XIa (FXIa). According to this embodiment, modulators are administered (in this case, inhibitors, advantageously, oligonucleotide inhibitors) that reverse the nucleic acid ligand activity.

In specific embodiments, the modulators of nucleic acid ligand activity according to the present invention are nucleic acids selected from the group consisting of, but not limited to, the following sequences; 5'AUGGGGAGGCAGCAUUA3 '(SEQ ID No. 25), 5'CAUGGGGAGGCAGCAUUA3' (SEQ ID No. 26), 5'CAUGGGGAGGCAGCA3 '(SEQ ID No. 27), 5'CAUGGGGAGGCA3' (SEQ ID No. 28), 5'GCAUUACGCG
GUAUAGUCCCCUA3 '(SEQ ID No. 29), 5'CGCGGUAUAGUCCCCUA3' (SEQ ID No. 30), 5'CUCGCUGGGG
CUCUC3 '(SEQ ID No. 31), 5'UAUUAUCUCGCUGGG3' (SEQ ID No. 32), 5'AAGAGCGGGGCCAAG3 '(SEQ ID No. 33), 5'GGGCCAAGUAUUAU3' (SEQ ID No. 34), 5'CAAGAGCGGGGCCAAG3 '(SEQ ID NO. 35), 5'CGA
GUAUUAUCUUG3 '(SEQ ID No. 36), 5'CGCGGUAUAGUCCCCAU3' (SEQ ID No. 41), or any modification or derivative thereof in which hybridization is maintained or is optionally at least 95% homologous to the sequence.

For example, the inhibitor of a nucleic acid ligand for Factor IXa of the present invention may be an antisense oligonucleotide. The antisense oligonucleotide hybridizes with the nucleic acid ligand in vivo and blocks the binding of the nucleic acid ligand to factor IXa.

The oligonucleotide modulators of the invention comprise a sequence complementary to at least one part of a nucleic acid ligand. However, it is not required. absolute complementarity. A sequence "complementary to minus a part of a nucleic acid ligand, "mentioned in this document means a sequence that has enough complementarity to be able to hybridize with the acid ligand nucleic. The ability to hybridize can depend so much on the degree of complementarity as of the length of the nucleic acid antisense Generally, the larger the oligonucleotide is hybridization, plus base mismatch with a ligand of target nucleic acid may contain and still form a stable duplex (or triple helix as may be the case). A specialist in technique can establish a tolerable degree of disappearance by the use of conventional procedures to determine the point of fusion of the hybridized complex. In specific aspects, the oligonucleotide can be at least 5 or at least 10 nucleotides, at least 15 or 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides The oligonucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions of same, single chain.

Antisense techniques are analyzed, for example, in Okano, J., Neurochein. 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). The methods are based on the binding of a polynucleotide to a DNA or complementary RNA.

The oligonucleotides of the invention can be modified in the rest of the base, the rest of the sugar, or the structure  phosphate, for example, to improve the stability of the molecule, hybridization, etc. The oligonucleotide may include other groups. attached. For this purpose, the oligonucleotide can be conjugated with another molecule, for example, a peptide, crosslinking agent hybridization activated, transport agent, cleavage agent activated by hybridization, etc. The oligonucleotide may comprise at least one modified base residue that is selected from the group that includes, but is not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylkeosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2α-thiouracil, beta-D-mannosylkeosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil oxiacetic acid (v), wybutoxosine, pseudouracil, cheosin, 2-thiocytosine, 5-methyl thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, acid methyl ester uracil-5-oxyacetic acid, uracil acid oxyacetic (v), 5-methyl thiouracil, 3- (3-amino-3-N-carboxypropyl) and 2,6-diaminopurine.

An oligonucleotide modulator of the invention it can also comprise at least one modified sugar residue selected from the group that includes, but is not limited to, arabinose, 2-fluoroarabinous, xylose, and hexose.

       \ newpage
    

In yet another embodiment, a modulator oligonucleotide may comprise at least one phosphate structure modified selected from the group that includes, but without limitation, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphorodiamidate, a methylphosphonate, an alkyl phosphotriester, and a acetal or analog form thereof.

Oligonucleotide modulators can be prepared having desired characteristics, such as improved stability in vivo and / or improved delivery characteristics. Examples of such modifications include chemical substitutions at sugar positions and / or structure and / or base. The oligonucleotide modulators may contain nucleotide derivatives modified at the 5 and 2 'positions of pyrimidines, for example, the nucleotides may be modified with 2'-amino, 2'-fluoro and / or 2'-O-methyl. Modifications of the modulation oligonucleotides of the invention may include those that provide other chemical groups that incorporate charge, polarization, hydrophobicity, hydrogen bond formation and / or additional electrostatic interaction. Such modifications include, but are not limited to, modifications of sugar in the 2 'position, closed nucleic acids, modifications of pyrimidine in position 5, purine modifications in position 8, modification in exocyclic amines, substitution of 4-thiouridine, substitution of 5-Bromo or 5-iodo-uracil, structure modifications, phosphorothioate or alkyl phosphate modifications, methylations, combinations of unusual base pairs such as isocytidine and isoguanidine isobases, etc. Modifications may also include 3 'and 5' modifications, such as coating. (See also Manoharan, Biochem. Biophys. Acta 1489: 117 (1999); Herdewija, Antisense Nucleic Acid Drug Development 10: 297 (2000); Maier et al ., Organic Letters 2: 1819 (2000)).

The oligonucleotides of the invention can synthesized by conventional methods known in the art, by example by the use of an automatic DNA synthesizer (such as those that are available in the market at Biosearch, Applied Biosystems, etc.).

Using the instructions provided in this document, a specialist in the art can implement easily the invention to regulate any nucleic acid therapeutic by the timely administration of a nucleic acid complementary to interrupt or otherwise modify the activity of the therapeutic ligand. This technique can be used, for example, with respect to any of the nucleic acid ligands described or mentioned in the cited patent documents previously.

       \ vskip1.000000 \ baselineskip
    

2. Ribozymes and ADNzymes

Also, using the instructions provided in this document, a specialist in the art you can easily practice the invention to regulate any therapeutic nucleic acid ligand by the Timely administration of a ribozyme or a DNAzyme.

Enzymatic nucleic acids act by first binding to a target RNA (or DNA, see Cech United States Patent No. 5,180,818). Said binding occurs through the target binding part of an enzymatic nucleic acid that is maintained in close proximity to an enzymatic part of the molecule that acts by cleaving the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds to a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically by cutting the target RNA. Excision of said target RNA will destroy its ability to direct the synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target it is released from that RNA to search for another target and can repeatedly bind and cleave new targets thereby allowing the inactivation of RNA aptamers. There are at least five kinds of ribozymes that each have a different type of specificity. For example, Group I Introns are ~ 300 to> 1000 nucleotides in size and require a U in the target sequence immediately 5 'from the cleavage site and bind 4-6 nucleotides on the 5' side of the cleavage site . There are more than 75 known members of this class, found in the rRNA of Tetrahymena thermophila , fungal mitochondria, chloroplasts, phage T4, blue-green algae, and others.

Another class are RNasaP RNA (M1 RNA), which are of 2290 to 400 nucleotides in size. They are the RNA part of a Ribonucleoproteic enzyme and cleaved tRNA precursors to form the mature tRNA. There are almost 10 known members of this group and All are of bacterial origin. A third example is ribozymes. hammerhead, which are from sim30 to 40 nucleotides of size. They require the UH target sequence immediately 5 'from the site cleavage and bind to nucleotides of variable number in both sides of the cleavage site. There are at least 14 known members of this class found in various plant pathogens (virusoids) that use RNA as an infectious agent. A fourth class they are hairpin ribozymes, which are? 50 nucleotides of size. They require the GUC target sequence immediately 3 'from the site cleavage and bind to 4 nucleotides on the 5 'side of the site of cleavage and a variable amount on the 3 'side of the site of cleavage. They are found in a plant pathogen (satellite RNA of tobacco ring spot virus) that uses RNA as an agent infectious. The fifth group are Hepatitis Virus ribozymes Delta (HDV), which are ~ 60 nucleotides in size.

The enzymatic nature of a ribozyme can be advantageous over other technologies, such as technology antisense, in certain applications since the effective concentration of ribozyme necessary to perform a therapeutic treatment It may be less than that of an antisense oligonucleotide. This advantage reflects the ability of the ribozyme to act enzymatically Therefore, a single ribozyme molecule is capable of cleaving many molecules of target RNA aptamers. Besides, the Ribozyme is a highly specific inhibitor, depending on the specificity of inhibition not only of the binding mechanism of base pairing, but also the mechanism by which the molecule inhibits the expression of the RNA to which it binds. That is, the inhibition is caused by excision of the RNA target and by both the specificity is defined and the proportion of the RNA cleavage rate marked as target on velocity RNA cleavage not labeled as target. This mechanism of excision depends on additional factors to those involved in the base pairing. Therefore, the specificity of the action of a ribozyme, in certain circumstances, may be greater than that of an antisense oligonucleotide that binds to the same RNA site.

Another class of catalytic molecules are called "ADNzymes." The ADNzymes are single stranded, and cleave both RNA and DNA. A general model for the ADNzyme has been proposed, and is known as the "10-23" model. The DNAzymes that follow the "10-23" model, also referred to simply as "DNAzymes 10-23", have a catalytic domain of 15 deoxyribonucleotides, flanked by two substrate recognition domains of seven to nine deoxyribonucleotides each. In vitro analyzes show that this type of ADNzyme can effectively cleave its substrate RNA into purine: pyrimidine bonds under physiological conditions. As used herein, "ADNzyme" means a DNA molecule that specifically recognizes and cleaves a distinct target nucleic acid sequence, which may be DNA or RNA.

Ribozymes and DNAzymes comprise both substrate binding domains as catalytic domains. The rules for the optimal design of regulatory ribozymes can found in Methods in Molecular Biology Volume 74 "Ribozyme Protocols "edited by Philip C. Turner (Humana Press, Totowa, NJ, 1997). Strategies for identifying sites are also described. reagents for ribozymes within a nucleic acid labeled as target in this volume. Using these conventional standards, they can specifically designed hammerhead ribozymes, hairpin ribozymes, hepatitis delta virus ribozymes and ribozymes derived from group I introns to bind to and cleave a target nucleic acid ligand. The capacity of said ribozymes or DNNAs cleaving the nucleic acid ligand Target can be determined in any of several assays. By example, after incubation of a ribozyme or ADNzyme with a unlabeled or labeled target nucleic acid ligand (e.g., 32 P) under conditions that favor the reaction, may target nucleic acid analyzed by gel electrophoresis denaturing to determine if ribozyme or ADNzyme cleaves the structure of the target nucleic acid ligand. As an alternative, resonance energy transfer from fluorescence, or the change in fluorescence intensity to measure the cleavage of a nucleic acid ligand properly marked.

       \ vskip1.000000 \ baselineskip
    

3. Polynucleic Acid Analogs (Peptide Acids Nucleic (PNA), Nucleic Morpholino Acids (MNA), Nucleic Acids Closed (LNA)), and Pseudo-Cyclic Oligonucleotides (PCO)

The nucleobases of the oligonucleotide modulators of the invention can be connected via linkages between nucleobases, for example, peptidyl bonds (as in the case of nucleic peptide acids (PNA); Nielsen et al . (1991) Science 254, 1497 and the US Pat. No. 5,539,082) and morpholino bonds (Qin et al ., Antisense Nucleic Acid Drug Dev. 10, 11 (2000); Summerton, Antisense Nucleic Acid Drug Dev. 7, 187 (1997); Summerton et al ., Antisense Nucleic Acid Drug Dev. 7, 63 (1997); Taylor et al ., J Biol Chem. 271, 17445 (1996); Partridge et al ., Antisense Nucleic Acid Drug Dev. 6, 169 (1996)), or by any other natural or modified link. The oligonucleobases can also be closed nucleic acids (LNA). Nielsen et al ., J Biomol Struct Dyn 17, 175 (1999); Petersen et al ., J Mol Recognit 13, 44 (2000); Nielsen et al ., Bioconjug Chem 11, 228 (2000).

PNAs are compounds that are analogous to oligonucleotides, but differ in composition. In PNAs, the oligonucleotide deoxyribose structure is replaced with a peptide structure. Each subunit of the peptide structure is linked to a nucleobase of natural or unnatural origin. PNA often has an aquiral polyamide structure consisting of N- (2-aminoethyl) glycine units. The purine or pyrimidine bases are linked to each unit by a methylenecarbonyl linker (1-3) to direct the complementary nucleic acid. The PNA binds to complementary RNA or DNA in a parallel or antiparallel orientation following the base pairing standards of Watson and Crick. The uncharged nature of PNA oligomers enhances the stability of PNA / DNA (RNA) hybrid duplexes compared to natural homoduplexes. The unnatural nature of PNA makes PNA oligomers highly resistant to attacks by proteases and nucleases. These properties of PNA oligomers allow them to serve as effective antisense molecules or modulators of nucleic acid ligand activity. In fact, nucleic peptide acids have been applied to block the expression of transcriptional and translational proteins, and microinjected PNA oligomers demonstrate a strong antisense effect on intact cells. See www.bioscience.org/1999/v4/d/soomets/fulltext.htm ; and Frontiers in Bioscience, 4, d782-786 (November 1, 1999) for details on recent successes in the application of antisense PNA, especially those related to the supply to cells or whole tissue of the PNA. See also Nielsen, PE, Egholm. M., Berg, RH and Buchardt, O. (1993) Peptide nucleic acids (PNA). DNA analogues with a polyamide backbone. In " Antisense Research and Application " Crook, S. & Lebleu, B. (eds.) CRC Press, Boca Raton, p. 363-373.

PNAs bind to both DNA and RNA and form PNA / DNA or PNA / RNA duplex. Duplexes resulting from PNA / DNA or PNA / RNA bind stronger than corresponding duplexes of DNA / DNA or DNA / RNA as evidenced by its temperatures of higher fusion (T m). This high thermal stability of The duplex PNA / DNA (RNA) has been attributed to neutrality of the structure of the NAP, which causes the elimination of repulsion of charges that are present in duplex DNA / DNA or RNA / RNA. Other advantage of the PNA / DNA (RNA) duplexes is that the T m is practically independent of the salt concentration. Duplexes DNA / DNA, on the other hand, are highly dependent on strength ionic

As PNAs are DNA analogs in which the structure is a pseudopeptide instead of a sugar, mimic the DNA behavior and bind to nucleic acid chains complementary. Nucleobases may also not be incorporated natural, such as pseudoisocytosine, 5-methylcytosine and 2,6-diaminopurine, among many others, in syntheses of PNA. PNAs are synthesized more usually from monomers (PNA syntheses) protected from according to the protection strategy with t-Boc / benzyl, in which the amino group of the growing polymer structure is protected with the group t-butyloxycarbonyl (t-Boc) and exocyclic amino groups of nucleobases, if present, will they protect with the benzyloxycarbonyl (benzyl) group. The feelings of Protected NAPs using the t-Boc / benzyl strategy They are now available in the market.

The PNA is both biologically and chemically stable and is readily available by automatic synthesis ((Hyrup, B., Egholm, M., Rolland, M., Nielsen, PE, Berg, RH & Buchardt, O. (1993) Modification of the binding affinity of peptide nucleic acids (PNA) .PNA with extended backbones consisting of 2-Aminoethyl-Alanine or 3-Aminopropylglicine units. J. Chem. Soc. Chem. Commun . 518-519); Demidov, V., Frank-Kamenetskii , MD, Egholm, M., Buchardt, O. and Nielsen, PE (1993) Sequence selective double strand DNA cleavage by PNA targeting using nuclease S1. Nucleic Acids Res . 21, 2103-2107). These properties have made PNA a very good example for antisense gene therapy drugs, and in vitro studies have further supported the antisense potential (Nielsen, PE "Peptide Nucleic Acid (PNA) A model structure for the primordial genetic material" Origins of Life 1993, 23 , 323-327; Egholm, M., Behrens, C, Christensen, L., Berg, RH, Nielsen, PE and Buchardt, O. "Peptide nucleic acids containing adenine or guanine recognize thymine and cytosine in complementary DNA sequences " J. Chem. Soc. Chem. Commun . 1993, 800-801; Kim, SK, Nielsen, PE, Egholm, M., Buchardt, O., Berg, RH and Norden, B." Right-handed triplex formed between peptide nucleic acid PNA-T 8 and poly (dA) shown by linear and circular dichroism spectroscopy " J. Amer. Chem. Soc . 1993, 115 , 6477-6481; Egholm, M., Buchardt, O., Christensen, L., Behrens, C., Freier, SM, Driver, DA, Berg, RH, Kim, SK, Norden, B. and Nielsen, PE "PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrog in bonding rules " Nature 1993, 365 , 556-568; Buchardt, O., Egholm, M., Berg, R. and Nielsen, PE "Peptide Nucleic Acids (PNA) and their potential applications in medicine and biotechnology" Trends Biotechnology , 1993, 11 , 384-386).

It seems that PNAs are very useful for several special applications When they are directed against sequences all purine rare, PNAs can block translation in any part in an mRNA forming a double clamp structure. With such rare RNA sequences a segment of the PNA binds to the target sequence by unions of Watson and Crick and the other segment of the PNA joins the groove major sites of the duplex resulting from PNA / RNA. Probably because of its central structure very flexible, PNAs also easily form triple structures helix with rare duplex DNA sequences comprising mainly purines in a chain and mainly pyrimidines In the other chain. Finally, in low salinity conditions in cell-free systems PNAs have been shown to achieve a sequence-specific invasion of duplex DNA sequences, causing the inhibition of duplex transcription invaded

Recent studies by several groups have shown that coupling the PNA with different vehicles can improve its uptake into cells. Among these, "cell uptake peptides", fatty acids or DNA, especially several peptide sequences have been shown to be able to transport PNA oligomers through cell membranes. Vector-PNA peptide conjugates have been shown to cross the membrane of neurons and suppress mRNA labeled as target (Aldrian-Herrada, G. et al . (1998) Nucleic Acid Res. 26: 4920). It has been reported that a biotinylated PNA bound to a conjugate of steptavidin and the murine monoclonal antibody OX26 against the rat transferrin receptor crosses the blood-brain barrier of rats in vivo (Pardridge, W. et al . 1995 PNAS 92: 5592-5596). Chinnery, PF et al . they bound the presequence peptide of subunit VIII of the human cytochrome c oxidase (COX) encoded in the nucleus to biotinylated PNA that had been successfully imported into in vitro isolated mitochondria (Chinnery, PF et al . 1999 Gene Ther. 6: 1919 -28). The delivery of the biotinylated peptide-PNA to mitochondria in intact cells was confirmed by confocal microscopy. In addition, a short hydrophobic peptide with the biotinyl-FLFL sequence coupled to a PNA trimer has been shown to internalize in human erythrocytes and Namalwa cells (Scarfi, S., A. Gasparini, G. Damonte and U. Benatti: Synthesis, uptake, and intracellular metabolism of a hydrophobic tetrapeptide-peptide nucleic acid (PNA) -biotin molecule. Biochem Biophys Res Commun 1997, 236, 323-326). Basu and Wickström (Synthesis and characterization of a peptide nucleic acid conjugated to a D-peptide analog of insulin-like growth factor 1 for increased cellular uptake. Bioconjugate Chem 1997, 8, 481-488) showed that a PNA conjugated to a peptide that mimics insulin-like growth factor 1 (IGF-1) all of D-amino acids were specifically captured by cells expressing the IGF1 receptor, although no antisense activity was described.

For some examples of other works, see Nielsen, PE, M. Egholm, RH Berg and O. Buchardt: Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science 254, 1497-1500 (1991); Egholm, M., O. Buchart, PE Nielsen and RH Berg: Peptide nucleic acids (PNA). Oligonucleotide analogues with an achiral peptide backbone. J Am Chem Soc 114, 1895-1897 (1992); Nielsen, PE, M. Egholm and O. Buchardt: Peptide nucleic acid (PNA). A DNA mimic with a peptide backbone. Bioconjugate Chemistry 5, 3-7 (1994); Egholm, M., PE Nielsen, O. Buchardt and RH Berg: Recognition of guanine and adenine in DNA by cytosine and thymine containing peptide nucleic acid. J Am Chem Soc 114, 9677-9678 (1992); Egholm, M., O. Buchardt, L. Christensen, C. Behrens, SM Freier, DA Driver, RH Berg, SK Kim, B. Norden and PE Nielsen: PNA hybridizes to complementary oligonucleotides obeying the Watson-Crick hydrogen-bonding rules [see comments]. Nature 365, 566-568 (1993); Wittung, P., PE Nielsen, O. Buchardt, M. Egholm and B. Nordén: DNA-like double helix formed by peptide nucleic acid. Nature 368, 561-563 (1994); Brown, SC, SA Thomson, JM Veal and DG Davis: NMR solution structure of a peptide nucleic acid complexed with RNA. Science 265, 777-780 (1994); Demidov, VV, VN Potaman, MD Frank-Kamenetskii, M. Egholm, O. Buchard, SH Sönnichsen and PE Nielsen: Stability of peptide nucleic acids in human serum and cellular extracts. Biochemical Pharmacology 48, 1310-1313 (1994); Peffer, NJ, JC Hanvey, JE Bisi, SA Thomson, CF Hassman, SA Noble and LE Babiss: Strand-invasion of duplex DNA by peptide nucleic acid oligomers. Proc Nat Acad Sci USA 90, 10648-10652 (1993).

U.S. Patent No. 6,046,307 to Shay et al . describes PNAs that inhibit telomerase activity in mammalian cells. U.S. Patent No. 5,789,573 to Baker et al . describes compositions and methods for inhibiting the translation of mRNAs labeled as target coated using PNA. US Patent No. 6,165,720 describes the labeling of the PNA complex.

You can easily prepare a PNA or MNA that is complementary at least in part to a nucleic acid ligand using the same complementarity standards and pairing of Watson and Crick bases that are used in the preparation of molecules conventional oligonucleotide antisense.

The morpholino nucleic acids are called that because they are assembled from morpholino subunits, each of which contains one of the four genetic bases (adenine, cytosine, guanine, and thymine) attached to a morpholine ring of 6 members. They join eighteen to twenty-five subunits of these four types of subunits in a specific order by links nonionic phosphorodiamidate between subunits to give an oligo morpholino These morpholino oligos, with their structural remains of 6-member morpholine joined by non-ionic bonds, produce antisense properties substantially better than RNA, DNA, and its analogs that have structural remains of ribose or 5-member deoxyribose bound by ionic bonds (see www.gene-tools.com/Morpholinos/body_morpholinos.HTML).

The morpholinos, devised by Summerton in 1985, they constitute a radical redesign of natural nucleic acids, with the potential advantages of low cost starting materials and economic assembly Like PNAs, morpholinos are completely resistant to nucleases and seems to be free of most or all of the non-antisense effects observed with S-DNA. In contrast to PNA, most of the Morpholinos show excellent aqueous solubility. Morpholinos they also have much greater RNA binding affinities than S-DNA, although not as high as PNAs. Probably as a result of their RNA binding affinities Substantial, long morpholinos (25 units) provide predictable addressing and very high efficiency. Morpholinos Most notable provide good sequence specificity. The same underlying factors to its exceptional specificity of sequence also make them unsuitable for addressing point mutations.

U.S. Patent No. 6,153,737 to Manoharan et al . refers to derivatized oligonucleotides in which bound nucleosides are functionalized with peptides, proteins, water-soluble vitamins or fat-soluble vitamins. This description was directed to antisense therapeutic agents by oligonucleotide modification with a peptide or protein sequence that aids the selective entry of the complex into the nuclear envelope. Likewise, water-soluble and fat-soluble vitamins can be used to aid in the transfer of the antisense therapeutic agent or diagnostic agent through cell membranes.

The efficient and sequence-specific binding to RNA or DNA combined with very high biological stability makes PNA and MNA extremely attractive examples for the development of modulators of the present invention. Nucleic peptide acids that can be conjugated to vehicles are distinguished in U.S. Patent No. 5,864,010 entitled Peptide Nucleic Acid Combinatorial Libraries and Improved Methods of Synthesis, developed by ISIS Pharmaceuticals, which is hereby incorporated by reference. In addition, nucleic peptide acids that can be conjugated to the carriers of the present invention are distinguished in US Patent No. 5,986,053 entitled Peptide nucleic acids complexes of two peptide nucleic acid strands and one nucleic acid
strand.

The LNA is a new class of DNA analogs that has some characteristics that make it an excellent candidate for modulators of the invention. LNA monomers are bicyclic compounds structurally similar to RNA monomers. The LNA shares most of the chemical properties of DNA and RNA, is soluble in water, can be separated by gel electrophoresis, precipitated in ethanol etc. (Tetrahedron, 54, 3607-3630 (1998)). However, the introduction of LNA monomers in DNA or RNA oligos causes high thermal stability of the duplexes with complementary DNA or RNA, while, at the same time, the base pairing standards of Watson and Crick are met. This high thermal stability of duplexes formed with LNA oligomers together with the finding that primers containing 3 'localized LNAs are substrates for enzymatic extensions, for example the PCR reaction, is used in the present invention to significantly increase the specificity of the detection of variant nucleic acids in the in vitro assays described in the application. The amplification processes of individual alleles happen in a highly discriminatory way (cross reactions are not visible) and several reactions can take place in the same vessel. See, for example, United States Patent
No. 6,316,198.

       \ newpage
    

Pseudocyclic oligonucleobases (PCO) can also be used as a modulator in the present invention (see U.S. Patent No. 6,383,752). The PCOs contain two oligonucleotide segments linked through their 3'-3 'or 5'-5' ends. One of the segments (the "functional segment") of the PCO has some functionality (for example, an antisense oligonucleotide complementary to a target mRNA). Another segment (the "protective segment") is complementary to the 3 'or 5'-terminal end of the functional segment (depending on the end through which it is attached to the functional segment). As a result of the complementarity between the functional and protective segments, PCOs form intramolecular pseudocyclic structures in the absence of the target nucleic acids (eg, RNA). PCOs are more stable than conventional antisense oligonucleotides because of the presence of 3'-3 'or 5'-5' bonds and the formation of intramolecular pseudocyclic structures. Studies of pharmacokinetics, tissue distribution, and stability in mice suggest that PCOs have greater stability in vivo than and, pharmacokinetic and tissue distribution profiles similar to those of PS oligonucleotides in general, but are rapidly removed from selected tissues. When a fluorophore and inactivating molecules are properly attached to the PCOs of the present invention, the molecule will emit fluorescence when in a linear configuration, but the fluorescence is inactivated in cyclic conformation.

       \ vskip1.000000 \ baselineskip
    

E. Chimeras, Fusion Products and United Materials of Another way

The oligonucleotides or analogs thereof (including ribozymes or ADNzymes or nucleic acid peptide (PNA)) or mofolin nucleic acids (MNA)), can be combined covalently or not covalently to provide a combination regulator as desired. In one example, an oligonucleotide, PNA, can be attached. or MNA to a peptide or protein to provide properties or a desired therapeutic effect. Alternatively, you can join a oligonucleotide or analogue thereof to a small molecule for Enhance its properties. These materials can be joined directly or join by a spacer group as you know well The specialists in the art. In one embodiment, the molecule small includes a radioligand or other detectable agent that can Controlled using conventional techniques. In this way, you can monitor the progress and location of the regulator. How alternatively, the small molecule is a therapeutic agent that the regulator leads to the therapy site, and then is cleaved optionally to provide its therapeutic effect in the appropriate location In a third embodiment, the molecule small is a chelator that joins two biological materials together to produce a combined effect

Chimeras, fusion products or regulators multicomposites can otherwise be identified and evaluated for therapeutic efficacy as described below with detail.

       \ vskip1.000000 \ baselineskip
    

III. Modulator Identification and Selection

Conventional binding assays can be used. to identify and select modulators of the invention. Non-limiting examples are gel displacement assays and BIACORE trials. That is, the test modulators can be put in contact with the nucleic acid ligands to be labeled as target under test conditions or typical physiological conditions and makes a determination as to whether the test modulator of In fact it binds to the nucleic acid ligand. Test modulators which is found to bind the nucleic acid ligand after can be analyzed in an appropriate bioassay (which will vary depending of the aptamer and its target molecule, for example, tests of coagulation) to determine if the test modulator can affect the biological effect caused by the nucleic acid ligand on its target molecule.

The gel displacement test is a technique used to evaluate the binding capacity. For example, a DNA fragment containing the test sequence is incubated first with the test protein or a mixture containing putative binding proteins, and then separated on a gel by electrophoresis If the DNA fragment is bound by the protein, it will be larger in size and its migration will therefore be delayed with relation to that of the free fragment. For example, a method for a mobility shift test in electrophoretic gel can be (a) contact in a mixture a binding protein to nucleic acid with a form-labeled nucleic acid molecule non-radioactive or radioactive comprising a molecular probe in suitable conditions to promote binding interactions specific between the protein and the probe to form a complex, wherein said probe is selected from the group consisting of dsDNAs, ADNss, and RNA; (b) electrophoresis the mixture; (C) transfer, using smear transfer by positive pressure or capillary transfer, the complex to a membrane, where the membrane is positively charged nylon; and (d) detect the complex attached to the membrane detecting the non-radioactive marker or radioactive in the complex.

Biacore technology measures events of bonding on the surface of a detector chip, so that the element of interaction bound to the surface determines the specificity of the analysis. The test of the specificity of an interaction implies simply analyze if different molecules can bind to interaction element immobilized. The union gives a change intermediate in the surface plasmon resonance signal (SPR), so it is directly evident if an interaction takes place or not. SPR-based biodetectors control interactions measuring the mass concentration of biomolecules near a surface. The surface is made specific by joining one of the interaction partners The sample that contains the other or others companions flows over the surface: when the molecules of the Sample bind to the interaction element attached to the surface, the local concentration changes and a SPR response is measured. The response is directly proportional to the mass of molecules that are They bind to the surface.

       \ newpage
    

SPR arises when light is reflected in certain conditions from a conductive film on the surface of contact between two media of different index of refraction. In the Biacore technology, the media is the sample and the chip glass detector, and the conductive film is a thin layer of gold on the chip surface SPR causes a reduction in the intensity of the light reflected at a specific angle of reflection. This angle varies with the refractive index close to the surface on the side opposite of the reflected light. When the sample molecules are bind to the surface of the detector, the concentration and therefore the refractive index on the surface changes and a SPR response. The representation of the response against the time during the course of an interaction provides a quantitative measure of the progress of the interaction. The technology Biacore measures the minimum angle of intensity of reflected light. The light It is not absorbed by the sample: instead the light energy is dissipates through the SPR in the gold movie. The values of SPR response are expressed in resonance units (UR). An UR represents a change of 0.0001º in the intensity angle minimum. For most proteins, this is almost equivalent to  a change in concentration of approximately 1 pg / mm2 on the surface of the detector. The exact conversion factor between UR and surface concentration depends on the properties of the surface of the detector and the nature of the molecule responsible for the change of concentration.

There are several different essays that can determine if an oligonucleotide or analog thereof can bind to the nucleic acid ligand in such a way that the interaction with The target is modified. For example, tests of electrophoretic mobility shift (EMSA), calorimetry of titration, scintillation proximity tests, sedimentation equilibrium using analytical ultracentrifugation (see for example www.cores.utah.edu/interaction), essays on fluorescence polarization, anisotropy assays of fluorescence, fluorescence intensity assays, fluorescent resonance energy transfer (FRET), assays of union in filters of nitrocellulose, ELISA, ELONA (see, for example, USP 5,789,163), RIA, or dialysis assays in balance to assess the ability of an agent to join a nucleic acid ligand. Direct tests can be performed on that the interaction between the agent and the agent is determined directly nucleic acid ligand, or assays of competition or displacement where capacity is determined of the agent displacing the nucleic acid ligand from its target (for example, see Green, Bell and Janjic, Biotechniques 30 (5), 2001, p. 1094 and USP 6,306,598). A Once a candidate modulating agent has been identified, its ability to modulate the activity of a nucleic acid ligand by his target in a bioassay. Alternatively, if a agent that can modulate the interaction of an acid ligand nucleic with its target, said binding assays can be used to verify that the agent is interacting directly with the nucleic acid ligand and the affinity of said can be measured interaction.

In another embodiment, mass spectrometry can be used for the identification of a regulator that binds to a nucleic acid ligand, the site or sites of interaction between the regulator and the nucleic acid ligand, and the relative binding affinity of the agents. by the nucleic acid ligand (see, for example, US Patent No. 6,329,146, Crooke et al .). Such mass spectrometry methods can also be used to explore chemical mixtures or libraries, especially combinatorial libraries, for individual compounds that bind to a selected target nucleic acid ligand that can be used as modulators of the nucleic acid ligand. In addition, mass spectrometry techniques can be used to explore multiple target nucleic acid ligands simultaneously against, for example, a combinatorial library of compounds. In addition, mass spectrometry techniques can be used to identify the interaction between a plurality of molecular species, especially "small" molecules and a molecular interaction site in a target nucleic acid ligand.

In vivo or in vitro assays that evaluate the efficacy of a regulator to modify the interaction between a nucleic acid ligand and a target are specific to the disorder being treated. There are abundant conventional assays for biological properties that are well known and can be used. Examples of biological tests are provided in the patents cited in this application describing certain nucleic acid ligands for specific applications.

As a non-limiting example, they can be performed coagulation assays as bioassays in clinical laboratories. These tests are generally tests of assessment criteria functional, in which a patient sample is incubated (plasma or whole blood) with exogenous reagents that activate the cascade of coagulation, and the time to clot formation is measured. Then the coagulation time of the sample of the patient with plasma or whole blood clotting time normal combined to provide a standard state measurement hemostatic of the patient. As described below, said coagulation assays are commonly used as tests of exploration that evaluate the operation of the systems both intrinsic and extrinsic coagulation of the patient.

The Activated Coagulation Time Test (ACT) is an exploration test that resembles the test of activated partial thromboplastin time (APTT), but is performed using recent whole blood samples. The ACT can be used to control the coagulation state of a patient in relation with clinical procedures, such as those involving administration of high doses of heparin (for example, CPB and PTCA).

The Partial Thromboplastin Time Trial Activated (APTT) is a common central laboratory test. APTT It is used to evaluate the intrinsic coagulation pathway, which includes factors I, II, V, VIII, IX, X, XI, and XII. The test is performed using a plasma sample, in which the intrinsic pathway is activated by the addition of phospholipid, an activator (ellagic acid, kaolin, or micronized silica), and Ca 2+. The formation of the complexes of Xase and prothrombinase on the surface of the phospholipid allows prothrombin to become thrombin, with the subsequent clot formation. The result of the APTT test is the time (in seconds) required for this reaction. APTT can be used to assess the overall competence of the system coagulation of a patient, such as a screening test preoperative for bleeding tendencies, and as a trial Routine to control heparin therapies. Another example of APTT is performed as follows. First, plasma is collected blood after subjecting blood to separation by centrifugation, and then actin is added thereto. Also I know add calcium chloride. The period of time is measured until it is coagulation form. More in detail, blood plasma is stored in a refrigerator after being obtained through separation by blood centrifugation 0.1 ml of agent is poured activation, which had been heated in a water bath that had a temperature of 37 ° C for one minute, in a test tube that It contained 0.1 ml of plasma. The mixture is allowed to stand in a bath of water at 37 ° C for two minutes. Then this mixture is added to pressure 0.1 ml of 0.02 M CaCl2, which had been placed in a water bath that had a temperature 37 ° C. At this moment it Turn on a stopwatch. The test tube is heated in the bath 37 ° C water for 25 seconds. The test tube is removed, and if Watch coagulation, stopwatch goes off. This is a way in which Blood clotting time can be measured.

The bleeding time test can be used For the diagnosis of hemostatic dysfunction, von disease Willebrand, and vascular disorders. It can also be used for explore platelet abnormalities before surgery. The essay is performed by making a small incision in the forearm and dissipating the blood from the site of the wound. The time it takes is recorded bleeding in stopping and in control subjects is approximately 3.5 minutes A prolongation of the time of hemorrhage is indicative of qualitative platelet defects or Quantitative

The Prothrombin Time Tests (PT), which first described by Quick in 1935, it measures the time of Coagulation induced by tissue factor of blood or plasma. Be used as an exploration test to assess the integrity of the pathway of extrinsic coagulation, and is sensitive to the factors of coagulation I, II, V, VII, and X. The assay can be performed adding thromboplastin and Ca 2+ to a patient's sample and measuring the time for clot formation. A time of Prolonged coagulation suggests the presence of an inhibitor of, or a deficiency in one or more of the coagulation factors of the extrinsic pathway But PT coagulation time can also be prolonged in patients on warfarin therapy, or in those with vitamin K deficiency or liver dysfunction. He PT test can provide an evaluation of the pathway of extrinsic coagulation, and is widely used to control therapies of oral anticoagulation.

The Thrombin Coagulation Time Test (TCT) measures the rate of clot formation of a patient in comparison with that of a normal plasma control. The essay can be performed by adding a conventional amount of thrombin to the plasma of a patient who has been devoid of platelets, and measuring the time required for a clot to form. This essay has been used as an aid in the diagnosis of intravascular coagulation disseminated (DIC) and liver disease.

There are also several trials that can be used in the diagnosis of the coagulation state of a patient. These They fall into two categories: complex trials, some of which They are based on the screening tests shown previously, and immunoassays. Complex trials include specific factor tests based on laboratory tests, such as the APTT, PT, and TCT assays. An essay measures the level of activation peptide factor IXa or the complex factor IXa-antithrombin III. These measurements are used to determine complex levels of factor IXa or factor VII tissue mediated. Assays for protein C resistance activated, antithrombin, protein C deficiency, and deficiency of S protein are also part of this group. Individuals asymptomatic who have heterogeneous C and protein deficiencies S, and resistance to activated protein C, have levels significantly elevated prothrombin fragment F1.2 in Comparison with controls.

       \ vskip1.000000 \ baselineskip
    

V. Method for Regulating Acid Ligand Therapy Nucleic

A method is provided to modulate the biological activity that includes (i) administering to a patient who it needs a nucleic acid ligand that binds to a target to produce a therapeutic effect, and then at the time selected or desired, (ii) administer to the patient a modulator that modifies the therapeutic effect. In one case, the modulator Deactivate the therapeutic effect. In another embodiment, the modulator reduces or minimizes but does not interrupt the therapeutic effect.

The basic therapeutic effect is determined by the target and the nucleic acid ligand. The modification of Therapeutic effect is determined by the modulator. May regulate any known nucleic acid ligand or developed in accordance with this invention.

In one embodiment, the method comprises: (a) administer to a patient, including any vertebrate of warm blood that needs it, an effective amount of a ligand of nucleic acid or DNA aptamer that selectively binds to a coagulation pathway factor, the RNA aptamer having a dissociation constant for the clotting pathway factor of approximately 20 nM or less; (b) modulate biological activity of the clotting pathway factor in the blood vertebrate hot through the administration of the RNA aptamer of the stage (a); and (c) provide an antidote to reverse the effects of the aptamer by the administration of a modulator. For example, the modulators of the present invention can bind ligands of nucleic acid that are targeted at the enzyme complexes of tissue factor (TF) / factor VIIa (FVIIa), factor VIIIa (FVIIIa) / factor IXa (FIXa), factor Va (FVa) / factor Xa (FXa) and platelet receptors such as gpIIbIIIa and gpIbIX and modulate the Nucleic acid ligand effects. This invention also provides control with platelet inhibitor antidote, antithrombotic and fibrinolytic.

There are at least three clinical scenarios in the that the ability to rapidly reverse activity is desirable of an antithrombotic or anticoagulant nucleic acid ligand. He First case is when anticoagulant treatment or antithrombotic leads to bleeding, including bleeding intracranial or gastrointestinal. Although the identification of Safer target proteins can reduce this risk, the potential of morbidity or mortality from this type of event Hemorrhagic is such that the risk cannot be overlooked. He second case is when urgent surgery is required for patients who have received antithrombotic treatment. This clinical situation arises in a low percentage of patients who require grafts of urgent coronary artery bypass while experiencing percutaneous coronary intervention under inhibitor coverage of GPIIb / IIIa. The current practice in this situation is to let it remove the compound (for such small molecule antagonists as eptifibatide), which can take 2-4 hours, or platelet infusion (for treatment with Abciximab). The third case is when an anticoagulant nucleic acid ligand is used during a cardiopulmonary bypass procedure. The bypass patients are predisposed to hemorrhage post-operative In each case, an acute reversal of the anticoagulant effects of a compound by an antidote (for example, an oligonucleotide modulator of the invention directed against an anticoagulant nucleic acid ligand or antithrombotic) allows for improved medical control, and probably safer, of the anticoagulant or antithrombotic compound.

In a method to treat diseases cardiovascular in patients, the method includes administering a effective amount of an RNA aptamer that selectively binds to a clotting pathway factor, the RNA aptamer having a dissociation constant for the clotting pathway factor of approximately 20 nM or less, to a vertebrate subject suffering from a cardiovascular disease, which is why the disease is treated cardiovascular in the vertebrate subject, then provide a antidote to reverse the effects of the aptamer by the administration of a modulator.

The patient treated in the present invention in his many embodiments is desirably a human patient, although it should be understood that the principles of the invention indicate that the invention is effective with respect to all vertebrate species, including warm-blooded vertebrates (for example, birds and mammals), which are intended to be included in the term "patient". In this context, it is understood that a mammal includes any species of mammal in which the treatment of cardiovascular disease, particularly agricultural and domestic mammal species.

The treatment of mammals is contemplated like humans, as well as those mammals of importance because they are in danger of extinction (such as the tiger Siberian), of economic importance (farm-raised animals for human consumption) and / or of social importance (animals kept as pets or in zoos) for beings humans, for example, carnivores other than humans (such as cats and dogs), pigs (pigs, boars, and wild boars), ruminants (such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels), and horses. Too the treatment of birds is contemplated, including the treatment of those types of birds that are in danger of extinction, kept in zoos, as well as game birds, and more particularly birds of domesticated game, that is, poultry, such as turkeys, chickens, ducks, geese, crabs, and the like, since they are also of economic importance for human beings.

The present method to treat diseases cardiovascular in a tissue contemplates contacting a tissue in which cardiovascular disease is happening, or is in risk of happening, with a composition comprising an amount therapeutically effective of an RNA aptamer capable of binding to a coagulation factor as well as providing an antidote for reverse the effects of the aptamer by administering a modulator Therefore, the method comprises administering to a patient. a therapeutically effective amount of a composition physiologically tolerable that contains the RNA aptamer as well as a method to provide an antidote to reverse the effects of the aptamer by the administration of a modulator.

Dosage intervals for Modulator administration depends on the form of the modulator, and its potency, as further described in this document, and they are large enough quantities to produce the effect wanted. For situations where coagulation is modulated, which can correspondingly improve cardiovascular disease and the symptoms of cardiovascular disease, the dosage does not must be large enough to cause adverse side effects, such as hyperviscosity syndromes, pulmonary edema, failure congestive heart, and the like. Generally, the dosage will vary with age, condition, sex and degree of disease in the patient and can be determined by a specialist in the art. He doctor in the case of any complication can also adjust the dosage.

A therapeutically effective amount is an amount of a modulator sufficient to produce a measurable modulation of the effects of the nucleic acid ligand, including, but not limited to, a coagulation modulating amount. Coagulation modulation can be measured in situ by immunohistochemistry by methods described in the Examples, or by other methods known to a person skilled in the art.

A preferred modulator has the ability to substantially bind to a nucleic acid ligand in solution at modulator concentrations of less than one (1) micromolar (µM), preferably less than 0.1 µM, and more preferably less than 0.01 µM. By "substantially" it understands that there is at least a 50 percent reduction in the target biological activity by modulation in the presence of the target, and the 50% reduction is mentioned in this document as the IC_ {50} value.

Preferred modes of administration of the materials of the present invention to a mammalian host are parenteral, intravenous, intradermal, intra-articular, intrasynovial, intrathecal, intra-arterial, intracardiac, intramuscular, subcutaneous, intraorbital, intracapsular, intramedullary, intrasternal. , topically, by transdermal patch, by rectal, vaginal or urethral suppository, peritoneal, percutaneous route, nasal spray, surgical implant, internal surgical implant, infusion pump or by catheter. In one embodiment, the agent and the vehicle are administered in a slow release formulation such as an implant, bolus, microparticle, microsphere, nanoparticle or nanosphere. For conventional information on pharmaceutical formulations, see Ansel, et al., Pharmaceutical Dosage Forms and Drug Delivery Systems , Sixth Edition, Williams & Wilkins (1995).

The modulators of the present invention can preferably be administered parenterally by injection or by gradual infusion over time. Although the tissue to be treated can typically be accessed in the body by systemic administration and therefore is often treated by intravenous administration of therapeutic compositions, other tissues and delivery techniques are provided where there is a probability that the tissue labeled as a target contains the target molecule Thus, the modulators of the present invention are typically administered orally, topically to a vascular tissue, intravenously, intraperitoneally, intramuscularly, subcutaneously, into a cavity, transdermally, and can be delivered by peristaltic techniques. . As indicated above, pharmaceutical compositions can be provided to the individual by a variety of routes such as oral, topical to a vascular, intravenous, intraperitoneal, intramuscular, subcutaneous tissue, into a cavity, transdermal, and can be supplied by peristaltic techniques. . Representative non-limiting approaches for topical administration to a vascular tissue include (1) coating or impregnating a blood vessel tissue with a gel comprising a nucleic acid ligand, for in vivo delivery, for example, by implantation of the coated vessel or impregnated in the place of a tissue segment of the damaged or diseased vessel that was removed or derived; (2) supply through a catheter to a vessel in which the supply is desired; (3) pumping a nucleic acid ligand composition into a vessel that has to be implanted in a patient. Alternatively, the nucleic acid ligand can be introduced into the cells by microinjection, or by encapsulation in liposomes. Advantageously, the nucleic acid ligands of the present invention can be administered in a single daily dose, or the total daily dosage can be administered in several divided doses. After that, the modulator is provided by any suitable means to alter the effect of the nucleic acid ligand by administration of the modulator.

The compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount. The amount to be administered depends on the subject to be treated, the ability of the subject's system to use the active ingredient, and the desired degree of therapeutic effect. The precise amounts of active ingredient required to administer depend on the physician's criteria and are peculiar to each individual. However, suitable dosage ranges for systemic application are described in this document and depend on the route of administration. Suitable regimens for administration are also variable, but are typified by an initial administration followed by repeated doses at intervals of one or more hours by a subsequent injection or other administration. Alternatively, sufficient continuous intravenous infusion is contemplated to maintain blood concentrations at the intervals specified for in vivo therapies.

As used in this document, the expressions "pharmaceutically acceptable", "physiologically tolerable ", and grammatical variations thereof, which refer to compositions, vehicles, diluents and reagents, are used interchangeably and represent that the materials are they can administer without substantial toxic side effects or debilitating

Pharmaceutically useful compositions comprising a modulator of the present invention can be formulated according to known methods such as by mixing a pharmaceutically acceptable carrier. Examples of such vehicles and formulation methods can be found in Remington's Pharmaceutical Sciences . To form a pharmaceutically acceptable composition suitable for effective administration, said compositions will contain an effective amount of the aptamer. Such compositions may contain mixtures of more than one modulator.

The effective amount may vary according to a variety of factors such as the individual's status, their weight, sex, age and amount of nucleic acid ligand managed. Other factors include the mode of administration. Generally, the compositions will be administered in dosages adjusted for body weight, for example, dosages that vary from about 1 µg / kg body weight to approximately 100 mg / kg body weight, preferably 1 mg / kg body weight to 50 mg / kg body weight.

The nucleic acid ligand modulators they can be particularly useful for the treatment of diseases in which it is beneficial to inhibit coagulation, or prevent such activity from happening. Pharmaceutical compositions they are administered in therapeutically effective amounts, that is, in sufficient quantities to generate a modulating response of the coagulation activity, or in amounts prophylactically effective, that is, in sufficient quantities to prevent a coagulation factor act in a coagulation cascade. The therapeutically effective amount and the amount prophylactically Effective may vary according to the type of modulator. The Pharmaceutical composition can be administered in single doses or multiple.

Generally, oligonucleotide modulators of the invention can be administered using established protocols used in antisense therapy. The data presented in Example 6 indicate that the activity of a nucleic acid ligand Therapeutic can be modulated by intravenous infusion of antidotes oligonucleotides in a human being or other animal. Also, like the Modulator activity is long lasting, once the desired level of modulation of the nucleic acid ligand by the modulator, modulator infusion can be interrupted, allowing the residual modulator to be removed from the human being or animal. This allows subsequent re-treatment. with the nucleic acid ligand as necessary. How alternative, and in view of the specificity of the modulators of the invention, subsequent treatment may involve the use of a second pair of nucleic acid ligand / modulator (for example, oligonucleotide) different.

The synthesized or identified modulators of according to the methods described in this document can be used only at appropriate dosages defined by routine testing to obtain the optimal modulation of ligand activity of coagulation nucleic acid, minimizing at the same time Any potential toxicity. In addition, it may be desirable to co-administration or sequential administration of other agents. For combination therapy with more than one active agent, where active agents are in different dosage formulations, active agents can be administered concurrently, or each can be administered at staggered times separately.

The dosage regimen using the Modulators of the present invention are selected according to a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to try; the route of administration; renal and hepatic function of patient; and the particular modulator used. A doctor Technician can easily determine and prescribe the effective amount of the aptamer required to prevent, counteract or stop the progress of the condition. Precision optimal to achieve modulator concentrations within the interval that produces efficacy without toxicity requires a regimen based on the kinetics of modulator availability for target sites. This implies a consideration of the distribution, balance, and elimination of the modulator.

In the use of the present invention, the modulators described in this document in detail may form the active ingredient, and are typically administered in admixture with suitable diluents, excipients or pharmaceutical vehicles (collectively mentioned in this document as materials of "vehicle") properly selected with respect to the intended form of administration, that is, oral tablets, capsules, elixirs, syrups, suppositories, gels and the like, and consistent with conventional pharmaceutical practices.

For example, for oral administration in form of a tablet or capsule, the active drug component can combine with an inert, pharmaceutically acceptable vehicle, not toxic, oral such as ethanol, glycerol, water and the like. Further, when desired or necessary, they can also be incorporated binders, lubricants, disintegrating agents and agents suitable dyes in the mixture. The appropriate binders include without limitation, starch, gelatin, natural sugars such as glucose or beta-lactose, sweeteners of corn, natural and synthetic gums such as gum arabic, gum tragacanth or sodium alginate, carboxymethyl cellulose, polyethylene glycol, waxes and the like. The lubricants used in these Dosage forms include, without limitation, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, acetate sodium, sodium chloride and the like. Disintegrants include, without limitation, starch, methylcellulose, agar gum, bentonite, gum Xanthan and the like.

For liquid forms, the drug component active can be combined in suspending or dispersing agents suitably flavored such as synthetic gums and natural, for example, gum tragacanth, gum arabic, methylcellulose and the like. Other dispersing agents that may employed include glycerin and the like. For administration parenteral, suspensions and sterile solutions are desired. Be they use isotonic preparations that generally contain suitable preservatives when administration is desired intravenous

Topical preparations containing the active drug component can be mixed with a variety of vehicle materials well known in the art, such as, by example, alcohols, aloe vera gel, allantoin, glycerin, oils of vitamin A and E, mineral oil, myristyl PPG2 propionate, and similar, to form, for example, alcoholic solutions, topical cleansers, cleansing creams, skin gels, lotions skin, and shampoos in cream or gel formulation.

The compounds of the present invention also can be administered in the form of delivery systems of liposomes, such as small unilamellar vesicles, vesicles large unilamellar and multilamellar vesicles. Liposomes they can be formed from a variety of phospholipids, such such as cholesterol, stearylamine or phosphatidylcholines.

The compounds of the present invention also can be coupled with soluble polymers as drug carriers airships Such polymers may include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl methacrylamide, polyhydroxy-ethylaspartamidaphenol, or polyethylene oxide polylysine substituted with palmitoyl moieties. In addition, the compounds of the present invention can be coupled. (preferably through a covalent bond) to a class of biodegradable polymers useful for release controlled drug, for example, polyethylene glycol (PEG), polylactic acid, polypropylene caprolactone, acid polyhydroxybutyric, polyorthoesters, polyacetals, polydihydropyran, polycyanoacrylates and block copolymers crosslinked or amphipathic hydrogels. You can join cholesterol and aptamer-like molecules to increase and prolong the bioavailability

Oligonucleotide modulators can administered directly (for example, alone or in a formulation liposomal or in complex with a vehicle (for example, PEG)) (see, for example, documents USP 6.147.204, USP 6,011,020).

The nucleic acid ligand or modulator may be composed of an oligonucleotide modulator attached to a high non-immunogenic molecular weight compound such as polyethylene glycol (PEG). In this embodiment, the pharmacokinetic properties of the complex are improved relative to the nucleic acid ligand alone. As discussed above , the association could be through covalent bonds or non-covalent interactions. In one embodiment, the modulator is associated with the PEG molecule through covalent bonds. Also, as discussed above , when covalent binding is employed, PEG can covalently bind in a variety of positions in the oligonucleotide modulator. In the preferred embodiment, an oligonucleotide modulator is attached to the 5 'thiol through a maleimide or vinylsulfone functionality. In one embodiment, a plurality of modulators can be associated with a single PEG molecule. The modulator can be for the same target or a different one. In embodiments where there are multiple modulators for the same nucleic acid ligand, there is an increase in avidity due to multiple binding interactions with the ligand. In a further embodiment, a plurality of PEG molecules can be linked together. In this embodiment, one or more modulators can be associated with the same target or different targets with each PEG molecule. This also causes an increase in the avidity of each modulator for its target. In embodiments in which multiple specific modulators are joined by the same target to PEG, there is the possibility of putting the same targets in close proximity to each other to generate specific interactions between the same targets. When multiple specific modulators are joined for different PEG targets, there is the possibility of putting the different targets in close proximity to each other to generate specific interactions between the targets. In addition, in embodiments where there are modulators for the same target or different targets associated with PEG, a drug can also be associated with PEG. Thus the complex would provide a targeted supply of the drug, serving PEG as a linker.

A problem encountered in the therapeutic use and in vivo diagnosis of nucleic acids is that oligonucleotides in their phosphodiester form can be rapidly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifested. Certain chemical modifications of the nucleic acid can be made to increase the in vivo stability of the nucleic acid or to enhance or mediate the supply of the nucleic acid. Modifications of the nucleic acid ligands contemplated in this invention include, but are not limited to, those provided by other chemical groups that incorporate additional charge, polarization capacity, hydrophobicity, hydrogen bonds, electrostatic interaction, and stereochemical flexibility to the acid bases. nucleic or nucleic acid as a whole. Such modifications include, but are not limited to, modifications of sugar in the 2 'position, modifications of the pyrimidine in position 5, modifications of the purine in position 8, modifications in exocyclic amines, substitution of 4-thiouridine, substitution of 5- bromine or 5-iodo-uracil; structure modifications, phosphorothioate or alkyl phosphate modifications, methylations, combinations of unusual base pairs such as isocytidine and isoguanidine isobases and the like. Modifications may also include 3 'and 5' modifications such as coating.

Lipophilic compounds and compounds of high non-immunogenic molecular weight with which they can the modulators of the invention be formulated for use in the present invention can be prepared by any of several techniques currently known in the art or developed later. Typically, they are prepared from a phospholipid, for example, diestearoyl phosphatidylcholine, and can include other materials such as neutral lipids, for example, cholesterol, and also surfactants such as charged compounds positively (for example, stearylamine or aminomanose or derivatives cholesterol aminomanitol) or negatively charged (for example, diacetyl phosphate, phosphatidyl glycerol). Liposomes may form multilamellar by conventional technique, that is, by depositing a selected lipid on the side wall of a container or suitable container dissolving the lipid in a solvent appropriate, and then evaporating the solvent to leave a thin film on the inside of the container or drying by spray. Then an aqueous phase is added to the container with a swirl or vortex movement that causes the formation of VML. VU can then be formed by homogenization, sonication or extrusion (through filters) of VML. In addition, VU can be formed by detergent removal techniques. In certain embodiments of In this invention, the complex comprises a liposome with one or more addressing nucleic acid ligands associated with the liposome surface and a therapeutic or diagnostic agent encapsulated Preformed liposomes can be modified to Associate with nucleic acid ligands. For example, a cationic liposome is associated through interactions electrostatic with nucleic acid. Alternatively, you can adding a nucleic acid bound to a lipophilic compound, such as cholesterol, to preformed liposomes whereby cholesterol reaches to be associated with the liposomal membrane. As an alternative, the acid nucleic may be associated with the liposome during the formulation of the liposome Preferably, the nucleic acid is associated with the Liposome by loading it in preformed liposomes.

Alternatively, oligonucleotide modulators of the invention can be produced in vivo after administration of a construct comprising a sequence encoding the oligonucleotide. Available techniques can be used to perform intracellular delivery of RNA modulators of gene expression (see generally, Sullenger et al ., Mol. Cell Biol. 10: 6512 (1990)).

Certain aspects of the invention may described in greater detail in the following Examples no limiting

       \ vskip1.000000 \ baselineskip
    

Example 1 Aptamer Against Factor IXa

Modified aptamers were generated with Nuclease-resistant 2'-fluoro pyrimidine against Human coagulation factor IXa as described in the WO 0226932 A2. Eight iterative cycles of selection, producing a family of 16 aptamers with high affinity for FIXa; varying the K_ {D} of ~ 0.6-15 nM in physiological salinity and pH at 37 ° C The comparative sequence analysis made it possible to predict and synthesize the minimized version of the highest affinity aptamer, called RNA 9.3t ("t" per truncated), shown in Fig. 1. This 34 nucleotide aptamer has a molecular weight of 11.5 kDa and joins FIXa with essentially the same affinity as the full length sequence (K_ {0.6 nM). As a control, it synthesized a mutant version of RNA 9.3t called 9.3tM in which the absolutely conserved A in the inner loop mutated in G (Fig. 1). This aptamer binds to FIXa with a K_ {D}> 5 µM determined by competitive union trials. In all trials of activity, RNA 9.3tM is used as a control to measure any non-specific effect caused by an aptamer of this composition. Aptamer 9.3t blocks the activation of FX by FVIIIa / FIXa / lipids, and also partially blocks hydrolysis of the synthetic substrate by FIXa.

To examine the specificity of the aptamer for FIXa against structurally similar coagulation factors, affinity of 9.3t for FIX, FVIIa, FXa, FXIa and APC was measured in direct binding assays as previously described (Rusconi et al ., Thrombosis and Haemostasis 83: 841-848 (2000)). The aptamer binds to FIX only? 5-50 times less strongly than FIXa. It failed to show significant binding at protein concentrations of up to 5 µM (RNA of the bound fraction <10%) to any other protein tested. Therefore, the specificity of aptamer 9.3t by FIXa versus FVIIa, FXa, FXIa or APC is> 5000 times.

To determine the anticoagulant potency of RNA 9.3t, the capacity of 9.3t to prolong the human plasma coagulation time in coagulation assays of the activated partial thromboplastin time (APTT) and the time of prothrombin (PT). The 9.3t aptamer, but not the control aptamer 9.3tM, was able to prolong plasma coagulation time human in a dose-dependent manner (Fig. 2). No aptamer had an effect on the PT, which demonstrates the functional specificity of aptamer 9.3t by FIXa and what proves that this type of oligonucleotide, at concentrations of up to 1 µM, does not increase by Non-specific form of human plasma coagulation time. By therefore, RNA 9.3 is a potent anticoagulant, with an effect maximum on APTT similar to that observed in plasma deficient in FIX Similar experiments have been performed in porcine plasma, and similar potency and specificity have been observed.

To determine whether this molecule is capable of inhibiting the activity of FIX / FIXa in vivo , the ability of this aptamer to systemically test small pigs (1.5-4 kg) after intravenous injection in embolate was tested. For these experiments, an intravenous catheter was placed in the femoral vein for injection of the sample and an arterial catheter was placed in a femoral artery of the animal for the serial extraction of blood samples. A blood sample was taken prior to the injection, and the time of ACT at the site was measured to establish a baseline complete blood clotting time for the animal. Then the aptamer 9.3ta dose of 0.5 mg / kg (n = 4) and 1.0 mg / kg (n = 4), the aptamer 9.3tM at 1.0 mg / kg (n = 3) or vehicle (n = 3) by intravenous injection in embolada. Blood samples were taken at various times after injection, and ACT was determined immediately. Additional blood was taken for the determination of APTT at different times after injection. As shown in Fig. 3, aptamer 9.3t, but not the 9.3tM control aptamer or vehicle, was able to inhibit FIXa activity in vivo as evidenced by a significant dose-dependent increase in ACT. of the animal after the injection. As shown in Fig. 4, aptamer 9.3 specifically prolonged the APTT, but not the PT of the animals in a dose-dependent manner. Using the in vitro dose response curves of the APTT experiments, the change in plasma concentration of 9.3t in the time after injection can be estimated.

In an attempt to increase the bioavailability of 9.3t, a version of this aptamer was synthesized with a 5 'cholesterol moiety, called 9.3tC. The cholesterol modified aptamer retained the high binding affinity to FIXa (Fig. 5A) and the potent anticoagulant activity (Fig. 5B and 5C). The in vivo effects of this modification on the circulating half-life of 9.3tC versus 9.3t (n = 2 animals for each aptamer) have been tested using the systemic pig anticoagulation model. After the injection of 0.5 mg / kg of 9.3tC, the ACT of the animal increased ~ 1.4 times and was maintained at this level for 1 hour after the injection (Fig. 6A). Fig. 6B shows the analysis of the APTT and the PT of the animals from this experiment. Although the anticoagulant potency of the two aptamers is similar, the duration of the 9.3 tC anticoagulant effect is significantly longer (Fig. 6C).

       \ vskip1.000000 \ baselineskip
    

Example 2 Oligonucleotide that Reverses the Interaction of the Atamer against the FIXa with the FIXa of Coagulation

The secondary structure model of 9.3t is shown in Fig. 1 and was developed from comparative sequence analysis of the related sequences of the aptamer against FIXa shown in Fig. 7. These data strongly support the formation of the structure of the trunk-loop represented in Fig. 1. In addition, the mutational analysis of aptamer 9.3t showed that the alteration of the trunk 1 or the trunk 2 caused a loss greater than 1000 times of the affinity for FIXa. Therefore, an oligonucleotide of 17 residues all 2'O-methyl was designed (sequence 5 'auggg
gaggcagcauua 3 ') (Anti-D1) complementary to the 3' half of aptamer 9.3t starting at the 5 'end of loop 2 (L2 in Fig. 7) and extending to the 3' end of the aptamer. This design allows the nucleation of an intermolecular duplex between the oligonucleotide and the loop 2 of the aptamer. In addition, intermolecular duplex formation is thermodynamically favored due to both the length and the base composition of the complementary oligonucleotide. A ribonucleotide duplex of this sequence has a calculated free energy of -26.03 kcal / mol and a predicted T m of 75.4 ° C. The half-life of said duplex at 37 ° C would greatly exceed 24 hours.

To determine if this oligonucleotide could denaturing aptamer 9.3t, aptamer 9.3t was incubated radiolabeled (125 nM) with increasing concentrations of oligonucleotide "antidote" (from equimolar to molar excess of factor 8) at 37 ° C for 15 minutes (-heat Fig. 8), and visualized the amount of intermolecular duplex formed by native gel electrophoresis (12% acrylamide, 150 mM NaCl, 2 mM CaCl2, processed in 1Xtris-borate buffer + 2 mM CaCl2) followed by phosphorus imaging (Fig. 8). To generate a complex oligonucleotide-aptamer as a control of mobility in the gel, the oligonucleotide hybridized with the aptamer 9.3t by heating the aptamer and a molar excess of factor 8 of the oligonucleotide at 95 ° C for 5 minutes before incubation at 37 ° C (+ heat Fig. 8). The same series of experiments was performed with a senseless oligonucleotide of the same base composition as the oligonucleotide antidote (N.S. in Fig. 8). How can observed in Fig. 8, the oligonucleotide antidote denatures easily aptamer 9.3t as evidenced by the formation almost complete oligonucleotide-aptamer complex when the oligonucleotide was present at a molar excess of factor 8 to the aptamer. In addition, this interaction is very specific, since that no complex is observed, with or without heating, between the aptamer and the senseless control oligonucleotide.

To determine if this antidote oligonucleotide could reverse the anticoagulant activity of aptamer 9.3t, the combined human plasma APTT was measured in presence of 9.3t 50 nM and increasing concentrations of the antidote oligonucleotide (Fig. 9A and 9B). In this experiment, it was pre-incubated the aptamer 9.3t 5 minutes in plasma before the addition of oligonucleotide antidote to generate complexes aptamer-FIX, then the antidote or the senseless oligonucleotide, and incubation was continued for 10 additional minutes before adding CaCl_ {2} to start the clot formation As shown in Figs. 9A and 9B, the oligonucleotide antidote is able to reverse effectively approximately 80% of the anticoagulant activity of the aptamer 9.3t. However, the molar excess of the oligonucleotide antidote required to achieve this effect is substantially greater than the amount required to effectively denature the aptamer in the absence of protein.

       \ vskip1.000000 \ baselineskip
    

Example 3 Specificity of Oligonucleotide Antidotes

To evaluate the specificity of an antidote oligonucleotide, aptamer 9.20t was prepared (see Fig. 10A). The trunk 1 of 9.20t is identical to the trunk 1 of the aptamer 9.3t, as is the 3 'half of the trunk 2. The differences main between 9.20t and 9.3t are in loop 2 and the loop 3 (compare Fig. 1 with Fig. 10A).

Aptamer 9.20t binds to FIXa with a K_D comparable to that of 9.3t. APTT assays were used to measure the coagulation time of human plasma as a function of the concentration of aptamer 9.20t. Its in vitro anticoagulant potency in human plasma was comparable to that of 9.3t (Fig. 10B). Aptamer 9.20ta human plasma was added at a 50 nM concentration and allowed to bind to plasma FIX for 5 minutes. Variable concentrations of the anti-D1 oligonucleotide antidote were then added, and the APTT was measured 10 minutes after the antidote was added to the plasma. The relative change in coagulation time caused by the addition of 9.20t to the plasma was not affected by the addition of this complementary oligonucleotide antidote to aptamer 9.3t (Fig. 10C).

Example 4 Aptámero 9.3t with Final Section

To determine if a "final stretch" single chain added to the end of an aptamer promotes the association of an oligonucleotide "antidote" with the aptamer, a final section 3 'was added to aptamer 9.3t, denominating the aptamer with final section 9.3t-3NT (Fig. 11). He 3 'final stretch of 9.3t-3NT is an RNA stretch Modified 3'O-methyl nucleotides. This final sequence was chosen to reduce the probability of affecting aptamer activity, and to reduce structures secondary potentials within the oligonucleotide antidote complementary.

The aptamer's affinity 9.3t-3NT was compared with 9.3t in binding assays competitive (Fig. 12A). The aptamer's affinity 9.3t-3NT by FIXa was comparable to that of 9.3t (K_ {1.5 nM or less). APTT assays were used to measure the human plasma coagulation time as a function of the concentration of aptamers 9.3t-3NT and 9.3t (Fig. 12B). The anticoagulant activities of aptamers were similar, and both aptamers were able to completely inhibit FIX activity in human plasma.

Aptamer 9.3t-3NT was added to human plasma at a concentration of 50 nM (increase of sim3 times in APTT) and allowed to bind to plasma FIX for 5 minutes. Then varying concentrations of the antidotes were added oligonucleotides (see Fig. 11), and APTT was measured at 10 minutes after the addition of antidote to plasma (Fig. 13A). The fraction of the anticoagulant activity reversed by the antidote oligonucleotide is the difference between APTT in the presence of aptamer alone and the APTT in the presence of aptamer + antidote divided by the change in APTT over the initial measure in presence of aptamer alone (0 = no effect, 1 = reversal complete). Each of the oligonucleotide antidotes Complementary tested was able to reverse> 90% of the 9.3t-3NT aptamer anticoagulant activity in 10 minutes from the addition in human plasma, demonstrating with AS3NT-3 the most potent reversal activity (Fig. 13B). This reversal activity is comparable to the ability to the protamine reverse the increase in APTT after the addition from heparin to human plasma.

Reversal of the anticoagulant activity of 9.3t-3NT by the oligonucleotide antidote AS3NT-3 was compared with activity reversal 9.3t anticoagulant by the oligonucleotide antidote Anti D1. The adding the final stretch to the aptamer increases the effectiveness of the reversal by an oligonucleotide antidote with sequences complementary to the final section 3 'of the aptamer (Fig. 14A and 14B).

In addition to the above, the following oligonucleotide modulators have been produced that are directed to aptamer 9.3t, and are effective in reversing their anticoagulant activity in human plasma in vitro (all are 2'O-methyl oligonucleotides):

Anti D T1:

5 'cau ggg gag gca gca uua 3'

ACE 9.3t-2:

5 'cau ggg gag gca gca 3 '

ACE 9.3t-3:

5 'cau ggg gag gca 3 '.

       \ vskip1.000000 \ baselineskip
    

The following oligonucleotide modulators are directed to aptamers 9.3t and 9.3t-3NT, and are effective in reversing their anticoagulant activity in human plasma in vitro (all are 2'O-methyl oligonucleotides):

ACE 5-1:

5 'gca uua cgc ggu aua guc ccc ua 3 '

ACE 5-2:

5 'cgc ggu aua guc ccc ua 3 '.

       \ vskip1.000000 \ baselineskip
    

The following oligonucleotide modulators are directed to aptamer 9.3t or aptamer 9.3t-3NT, and are designed mutant oligonucleotides to test specific aspects of oligonucleotide design modulators for these aptamers (all are 2'O-methyl oligonucleotides):

ACE 9.3t-M:

5 'cau ggg gaa gca 3 '(SEQ ID No. 37)

ACE 9.3t-3NOH:

5 'aug ggg agg ca 3 '(SEQ ID No. 38)

ACE 3NT-3M:

5 'gac aug ggg aag ca 3 '(SEQ ID No. 39)

AS 3NT-3 MT:

5 'here aug ggg agg ca 3' (SEQ ID NO. 40).

       \ vskip1.000000 \ baselineskip
    

Example 5 Oligonucleotide Antidote for Aptomer 9.3t

The oligonucleotide antidote 5-2C (5 'CGC GGU AUA GUC CCC AU) but not a mixed version of this oligonucleotide antidote, 5-2C scr, has been shown to effectively reverse the activity of aptamers 9.3ty Peg-9.3t in vitro in human plasma Peg-9.3t is 9.3t with a 40 KDa polyethylene glycol attached to its 5 'end by a linker.

In these experiments, the aptamer was added to the plasma (9.3t 50 nM, Peg-9.3t 125 nM) and left incubate for 5 minutes. Then the antidotes were added oligonucleotides, and APTT assays were started 10 minutes after the addition of the antidote. The results are shown in the Figure 15

       \ vskip1.000000 \ baselineskip
    

Example 6 Speed and Durability of the Aptámero Control 9.3t by Antidote Oligonucleotide

Aptamers 9.3to Peg-9.3ta human plasma were added in vitro at a final concentration of 50 nM to 9.3to 125 nM for Peg-9.3t, and allowed to incubate for 5 minutes at 37 ° C. The oligonucleotide antidote 5-2C was then added to the indicated molar excess to the aptamer, and the residual activity of the aptamer was determined by measuring the coagulation time in APTT assays at the times indicated after the addition of the antidote. The% residual anticoagulant activity is equal to 1 - the proportion of (T_ {aptamer} alone - T_ {aptamer} + antidote) to (T_ {aptamer} only - T_ {baseline}) X 100, where T = coagulation time of APTT.

The duration of inactivation of the anticoagulant activity of Peg-9.3t by the oligonucleotide antidote 5-2C was measured in vitro in human plasma. In summary, Peg-9.3ta human plasma was added to a final 125 nM concentration and allowed to incubate for 5 minutes. The oligonucleotide antidote 5-2C was then added to a molar excess of factor 10, or in a parallel experiment buffer was added only in place of the oligonucleotide antidote, and the clotting time in APTT assays was measured at various point points after Addition of the antidote. The% residual anticoagulant activity was determined as above. The APTT of untreated human plasma was also measured in parallel to establish a basal coagulation time at each point in time. It was found that after 5 hours of incubation at 37 ° C, the APTT of the untreated plasma began to increase, indicating the loss of the plasma clotting activity, and therefore the experiment stopped at 5 hours.

The data presented in Figures 16 and 17 demonstrate the ability to quickly and permanently control the anticoagulant activity of the antagonist aptamer of FIXa 9.3t, and its derivatives, using oligonucleotide antidotes. Together these data show that the appearance of the action of the antidote is fast, that the time necessary for the antidote to act is at less partly dependent on the concentration of antidote, and that Once the antidote has inactivated the aptamer, this effect is long lasting.

       \ vskip1.000000 \ baselineskip
    

Example 7 Oligonucleotide Antidote to the Aptomer Against Factor Xa coagulation

An aptamer (called 11F7t) against coagulation factor Xa is represented in Figure 18A which is a potent in vitro anticoagulant in human plasma. A mutant version of the 11F7t aptamer, named 11F7tM, is depicted in Figure 18B. Alterations of the identity of the positions shown in Fig. 18B lead to a loss of> 1300 times in the affinity of the mutant aptamer by the coagulation FXa. Variable concentrations of aptamers 11F7t and 11F7tM were added to human plasma in vitro , and then the clotting time was measured in a PT test (Fig. 19A) or APTT (Fig. 19B). In Figure 19, the dotted lines indicate the relative change in coagulation time of plasmas containing 10% or less than 1% of the normal plasma level of FX, demonstrating the potent anticoagulant effects of aptamer 11F7t. All data is normalized to the initial measurement for that day, so that a value of 1 = no change in coagulation time. The 11F7t aptamer is also a potent anticoagulant of human plasma when tested in PT coagulation assays, as would be expected for an FXa inhibitor. The mutant aptamer, 11F7tM, showed no anticoagulant activity either in the PT test or in the APTT test.

The following oligonucleotide antidotes were explored for the ability to reverse the anticoagulant activity of the 11F7t aptamer in vitro in human plasma:

AO 5-1:

5 'CUC GCU GGG GCU 3 'CUC

AO 5-2:

5 'UAU UAU CUC GCU 3 'GGG

AO 3-1:

5 'AAG AGC GGG GCC AAG 3 '

AO 3-3:

5 'GGG CCA AGU AUU AU 3 '.

       \ vskip1.000000 \ baselineskip
    

Figure 20 shows the 11F7t sequences for which these oligonucleotide antidotes are complementary.  As shown in Figure 21A, oligonucleotide antidotes effectively reverse the activity of aptamer 11F7t in plasma human. In these experiments, the aptamer was added to the plasma (final concentration 125 nM) and allowed to incubate for 5 minutes. The oligonucleotide antidotes were then added, and APTT assays started 10 minutes after the addition of antidote. In addition to the oligonucleotide antidotes described previously, it was also discovered that the following sequences They have antidote activity against aptamer 11F7t:

AO 3-2:

5 'CAA GAG CGG GGC CAA G 3 '

AO 5-3:

5 'CGA GUA UUA UCU UG 3 '.

       \ vskip1.000000 \ baselineskip
    

Figure 21B shows the characterization of the activity of the antidote 5-2 over a range of higher concentration of antidote 5-2, and the comparison with the antidote activity of a sequence version mixed of the antidote 5-2, 5-2scr. Data demonstrate potent antidote reversal activity 5-2, and specificity of antidote activity oligonucleotide demonstrated by the absence of activity of reversal of AO 5-2scr.

       \ newpage
    

Figures 22 and 23 refer to capacity to quickly and lastingly control anticoagulant activity of the FXa 11F7t antagonist aptamer, and its derivatives, using oligonucleotide antidotes. Together, these data demonstrate that the appearance of the action of the antidote is rapid (Fig. 22), that the time needed for the antidote to act is at least in part dependent on the concentration of antidote (Fig. 22), and that a Once the antidote has inactivated the aptamer, this effect is durable (Fig. 23). Together, these data indicate that the antidotes oligonucleotides can be infused intravenously into a being human or other animal, which would be a potential method to use oligonucleotide antidotes to modulate the activity of a therapeutic aptamer. Also, as the activity of the antidote is durable, once the desired level of modulation has been achieved of the aptamer by the antidote, the infusion of the antidote, allowing the residual antidote to be removed from the being human or animal This allows re-treatment. posterior of the human or animal with the aptamer as necessary.

       \ vskip1.000000 \ baselineskip
    

Example 8 Independent Peer Operation Aptámero Antidoto

To show that the pairs aptamer-antidote (aptamer 9.3t and its antidote AO5-2c and aptamer 11F7t and its antidote AO5-2) work independently of each other, it they added the aptamers to human plasma at 37 ° C, as indicated in Figure 24, and allowed to incubate for 5 minutes. Later the antidotes were added and coagulation activity was measured 10 minutes after the addition of the antidote in APTT assays. In all trials, the aptamer or antidote was replaced by buffer only in cases where only one aptamer or one was added plasma antidote. All data was standardized to size initial for that day, so that a value of 1 = no change in the coagulation time.

Comparing the sample Apt 1 and 2 + AD1 with Apt 1 alone and the sample Apt 1 and 2 + AD2 with Apt 2 only (see Fig. 24), it is clear that the antidote reversal activity is specific for the aptamer marked as target (for example, there was no loss of the Apt 2 activity in the presence of AD1 and vice versa), and the antidote activity did not effectively change by presence of the second aptamer.

These results have two important implications The first demonstrates the ability to dose a patient a ligand of nucleic acid 1 (for example, 9.3t), reverse that nucleic acid ligand with its antidote corresponding, and then re-treat the patient with a second nucleic acid ligand. The second, the results demonstrate the usefulness of acid ligand pairs nucleicide-antidote for the validation of targets, and the study of biochemical pathways. The antidote makes it possible to determine that the response observed after inhibiting a target protein with a nucleic acid ligand is due to specific inhibition of that protein. In addition, the antidote makes it possible to determine if the binding of the nucleic acid ligand with the target protein leads to protein renewal For example, if after the addition of the antidote the complete protein activity is restored, he maintains that there was no net change in protein concentration as result of nucleic acid ligand binding.

       \ vskip1.000000 \ baselineskip
    

Example 9 Function of the PEG-9.3t Aptomer and the Antidote 5-2C in Plasma of Patients with Thrombocytopenia Heparin Induced (HIT)

The ability to control the anticoagulant activity of heparin with protamine enables safer treatment of patients undergoing procedures that require a high level of anticoagulation, in which the risk of bleeding after the procedure is high. However, ~ 3-5% of patients receiving heparin develop an immune response induced by the drug called heparin-induced thrombocytopenia (HIT), which contraindicates the additional treatment of these patients with heparin (Warkentin et al., Thromb Haemost 79: 1-7. (1998)). This disorder is characterized by a decrease in platelet count and an increased risk of a new or recurring life-threatening thromboembolism and a limb (Warkentin et al., Thromb Haemost 79: 1-7. (1998)). Several alternative anticoagulants are available, but none of these anticoagulants can be controlled by a reversal agent. This significantly limits treatment options for patients with HIT, and hemorrhagic complications and recurrent thromboembolisms are common even if they undergo treatment (Greinacher et al., Circulation 99: 73-80. (1999), Lewis et al., Circulation 103: 1838-1843. (2001)). Therefore, the ability of the Peg-9.3t aptamer and the 5-2C antidote to serve as an anticoagulant-antidote pair in plasma samples of six patients with HIT, three with end-stage renal disease requiring hemodialysis and therefore repeated anticoagulation was investigated. , and three with thromboembolic complications that required anticoagulant therapy. (Serological criteria included a positive test for platelet aggregation induced by heparin (Ortel et al., Thromb Haemost 67: 292-296. (1992)) and / or high levels of antibodies against heparin / platelet factor 4 detected by ELISA (GTI , Inc., Brookfield, WI) Five patients met both clinical and serological criteria; one patient met the clinical criteria but had negative serological studies.) The PEG-9.3t aptamer prolonged the APTT coagulation times of the six plasma patients, and the antidote 5-2 was able to effectively reverse this anticoagulant activity to the initial measurement prior to the treatment of each patient (Fig. 25). Importantly, two patients who were receiving anticoagulant therapy at the time the samples were taken (patient 3 with danaparoid sodium and patient 6 with warfarin), and the addition of PEG-9.3t to the plasma of these patients increased the Coagulation time on the initial treatment measure and the 5-2C antidote reversed this response back to the initial treatment measure, demonstrating that in the patient's plasma this drug-antidote pair can function independently of a "charged" anticoagulant. . In addition, the treatment of these plasma samples of the patients with the 9.3tM control aptamer and the 5-2C antidote did not cause an increase in coagulation time, which further indicates that the oligonucleotides of the aptamer or antidote composition do not have inherently significant anticoagulant activity.

The capacity of aptamer 11F7t was investigated and its corresponding antidote 5-2 to serve as a pair anticoagulant-antidote in plasma samples of 2 patients with HIT, one with end-stage renal disease that required hemodialysis and therefore repeated anticoagulation, and one with thromboembolic complications that required therapy anticoagulant. The 11F7t aptamer extended the times of APTT coagulation of the plasma of both patients, and the antidote 5-2 was able to effectively reverse this anticoagulant activity to the initial pre-treatment measure of each patient (Fig. 26). Importantly, these two patients they were receiving anticoagulant therapy at the time they they took the samples (patient 3 with danaparoid sodium and the patient 6 with warfarin), and the addition of 11F7t to the plasma of these patients increased coagulation time over the initial measurement  of treatment and the antidote 5-2 reversed this response back to the initial treatment measure, which shows that in the patients' plasma this pair drug-antidote can function independently of a "charged" anticoagulant. In addition, the treatment of these plasma samples of patients with the aptamer of 9.3tM control and the 5-2 antidote produced no increase at coagulation time, which additionally indicates that oligonucleotides of the aptamer or antidote composition not inherently have anticoagulant activity significant.

Claims (30)

1. An oligonucleotide modulator that hybridizes to physiological conditions with an aptamer against factors of coagulation, where said aptamer is a single stranded nucleic acid that binds to a clotting factor, to reverse specific and rapid anticoagulant and antithrombotic effects of said aptamer against coagulation factors that is directed to components of the coagulation pathway. 2. The oligonucleotide modulator according to claim 1, wherein the modulator binds to the aptamer against Free coagulation factors present in the host. 3. The oligonucleotide modulator according to claim 1, wherein the modulator binds to the aptamer against coagulation factors present in the host in association with the component of the blood clotting pathway. 4. The oligonucleotide modulator according to claim 1, wherein the modulator is complementary to the aptamer against coagulation factors. 5. The oligonucleotide modulator according to claim 4, wherein the modulator comprises a sequence complementary to 6-25 nucleotides of the aptamer against clotting factors. 6. The oligonucleotide modulator according to claim 5, wherein the modulator comprises a sequence complementary to 8-20 nucleotides of the aptamer against clotting factors. 7. The oligonucleotide modulator according to claim 6, wherein the modulator comprises a sequence complementary to 10-15 nucleotides of the aptamer against clotting factors. 8. The oligonucleotide modulator according to claim 4, wherein the modulator comprises 5-80 nucleotides 9. The oligonucleotide modulator according to claim 8, wherein the modulator comprises 10-30 nucleotides 10. The oligonucleotide modulator according with claim 9, wherein the modulator comprises 15-20 nucleotides 11. The oligonucleotide modulator according with claim 4, wherein the modulator houses a replacement chemistry. 12. The oligonucleotide modulator according with claim 11, wherein the modulator comprises a substituted pyrimidine in the 5 'position or a substituted sugar in the 2 'position. 13. The oligonucleotide modulator according with claim 12, wherein the modulator comprises a 2'-amino, 2'-fluoro or substitution 2'-O-methyl. 14. The oligonucleotide modulator according with claim 4, wherein the modulator comprises an acid closed nucleic. 15. The oligonucleotide modulator according with claim 4, wherein the modulator is complementary to a single chain region of said aptamer against factors of coagulation. 16. The oligonucleotide modulator according with claim 15, wherein the modulator is complementary to a single-chain region of the aptamer against coagulation factors and a double stranded region of the aptamer against factors of coagulation. 17. The oligonucleotide modulator according with claim 4, wherein the aptamer against factors of Coagulation has a single stranded final stretch. 18. The oligonucleotide modulator according with claim 17, wherein the modulator is complementary to final single-strand section of the aptamer against factors of coagulation. 19. The oligonucleotide modulator according with claim 4, wherein the aptamer against factors of coagulation and modulator comprise β-D-nucleotides. 20. The oligonucleotide modulator according with claim 4, wherein the modulator is produced in the host after administration to the host of a construction comprising a sequence encoding the modulator 21. The oligonucleotide modulator according with claim 1, wherein the aptamer against factors of coagulation is an aptamer against coagulation factors anticoagulant or antithrombotic. 22. The oligonucleotide modulator according with claim 21, wherein the pathway component of Blood coagulation is an enzymatic complex of tissue factor (TF) / factor VIIa (FVIIa), factor VIIIa enzyme complex (FVIIIa) / factor IXa (FIXa), enzyme complex of factor Va (FVa) / factor Xa (FXa), gpIIbIIIa, gpIbIX, gpVI, Gas6, PAI-1 (plasminogen activator inhibitor I), coagulation factor XIIIa (FXIIIa), ATIII (anti-thrombin III), coagulation factor IXa (FIXa), thrombin or coagulation factor XIa (FXIa). 23. The oligonucleotide modulator according with claim 1, wherein the aptamer against factors of Coagulation houses a marker. 24. The oligonucleotide modulator according with claim 23, wherein the marker is a marker cytotoxic 25. The oligonucleotide modulator according with claim 23, wherein the marker is a marker radioactive 26. The oligonucleotide modulator according with claim 23, wherein the marker is a marker detectable 27. The oligonucleotide modulator according with claim 1 or 23, wherein the host is a being human. 28. The oligonucleotide modulator according with claim 1 or 23, wherein the host is a mammal not human. 29. The oligonucleotide modulator of the claim 21, wherein the coagulation pathway component of the blood is a factor VIIIa (FVIIIa) / factor IXa complex (FIXa). 30. The oligonucleotide modulator of the claim 21, wherein the coagulation pathway component of The blood is Factor IXa.