CN101497886A - Polypeptide of fungal thioredoxin, coding sequence, preparation and use - Google Patents
Polypeptide of fungal thioredoxin, coding sequence, preparation and use Download PDFInfo
- Publication number
- CN101497886A CN101497886A CNA2009100608730A CN200910060873A CN101497886A CN 101497886 A CN101497886 A CN 101497886A CN A2009100608730 A CNA2009100608730 A CN A2009100608730A CN 200910060873 A CN200910060873 A CN 200910060873A CN 101497886 A CN101497886 A CN 101497886A
- Authority
- CN
- China
- Prior art keywords
- brig
- sing
- trx
- polypeptide
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses polypeptide and coded sequences of fungal thioredoxin and a preparation method and application thereof. The coded sequences of the isolated polypeptide are a nucleotide sequence as shown in SEQ ID NO.1 and an amino acid sequence as shown in SEQ ID NO.2. The preparation method comprises the following steps: firstly, the total RNAs of agrocybe aegeritas are extracted as templates, cDNA first chains are obtained by RT-PCR as templates, and PCR products are obtained by PCR amplification; secondly, PCR products and prokaryotic expression carriers are obtained by enzyme digestion so as to construct and recombine the expression carriers; thirdly, the obtained recombined expression carriers are used for transforming colon bacillus host cells so as to obtain recombined cells expressing the agrocybe aegerita thioredoxin; fourthly, the inducing culture is carried out on the recombined cells, staying over so as to obtain saturated culture; fifthly, proteins are purified and separated by Ni<2+> affinity chromatography, and the polypeptides expressed in the recombined cells are purified. The polypeptides can be applied to the application of medicaments for treating or preventing tumor disease. The related proteins have antitumor activity. The invention has great application value in the development of antitumor medicaments.
Description
Technical field
The present invention relates to the genetically engineered field, specifically, the present invention relates to fungi Agrocybe aegerita (Brig) Sing (Agrocybeaegerita) thioredoxin gene sequence.The invention still further relates to preparation method, also relate to the application of polypeptide in medicine, antitumor drug simultaneously by this nucleotide sequence coded polypeptide.
Background technology
Agrocybe aegerita (Brig) Sing (Agrocybe aegerita) is under the jurisdiction of Mycophyta, Basidiomycetes, Agaricales, excrement rust umbrella section, field mushroom genus.Have another name called Agroeybe cylindracea mycelia, Agrocybe aegerita (Brig) Sing, chaxingu mushroom, Liu Songrong etc.Be rich in eight seed amino acids of needed by human, wherein Methionin is up to 1.75%, its nutritive value surpasses other edible mushroomss such as mushroom, needle mushroom, has simultaneously unique pharmaceutical use again, among the peoplely be usually used in anticancer, step-down, the treatment stomach is cold, ephritis, oedema etc. have unique curative effect, and the good reputation of the refreshing mushroom ＂ of ＂ China is arranged, but pharmaceutical component wherein is also indeterminate, and the Agrocybe aegerita (Brig) Sing Trx that relates among the present invention is the valuable pharmacological composition that we find first.
(thioredoxin reductase is the dimer selenium enzyme that comprises the FAD structural domain that a kind of NADPH relies on TrxR) to thioredoxin reductase, belongs to pyridine nucleotide-disulphide oxydo-reductase family member.Its major function be catalyzing N ADPH with Trx (thioredoxin, on Trx)-S
2Be reduced into (SH)
2Reaction, promptly keep the reduced form of Trx, and Trx has vital role in redox modulating and anti-oxidative defense.The Substratspezifitaet of TrxR is not strong, and many endogenous and external compound except that Trx as vitamin K3, Thioctic Acid, DTNB and tetraoxypyrimidine, phospholipid hydroperoxide etc., all can be reduced by TrxR.TrxR participates in body various biological activity, and relevant with human numerous disease, as tumour, acquired immune deficiency syndrome (AIDS), autoimmune disorder etc.
TrxR expression amount in tumour cell is 10 times of healthy tissues.Measure location and the expression of TrxR in the former hair-cream gland cancer of people, thyroid carcinoma, prostate cancer, colorectal carcinoma and malignant melanoma with immunocytochemical method, the result shows, the tumour overexpression TrxR that invasiveness is strong, its proliferative ability is strong, apoptosis rate is low, metastatic capacity is high, therefore, TrxR plays an important role in the formation of cancer and tumour, can be used as the target spot of anticancer therapy.
A kind of Trx of originated from fungus is provided among the present invention, has anti-tumor activity, may be as the inhibitor inducing apoptosis of tumour cell of TrxR.
Summary of the invention
One object of the present invention is to provide a kind of polypeptide nucleotide sequence, this sequence above-mentioned Agrocybe aegerita (Brig) Sing Trx peptide sequence of encoding.The nucleotides sequence of 1-327 position is shown at least 70% homology among this sequence and the SEQ ID N0.1; Perhaps described nucleotide sequence can be under the rigorous condition of moderate with SEQ ID NO.1 in the nucleotide sequence hybridization of 1-327 position.70% homologous gene can suddenly change by the sudden change test kit, and perhaps by inserting, genetic manipulations such as disappearance obtain.Preferably at least 80%, at least 90% nucleotide sequence more preferably, best, this sequence has the aminoacid sequence shown in the nucleotide sequence coded SEQID of the having NO.2 in 1-327 position among the SEQ ID NO.1.This sequence is to clone first, can design primer according to this sequence, and this nucleotide sequence that increases in a large number of the method by PCR or RT-PCR is connected in expression vector, produces the Agrocybe aegerita (Brig) Sing Trx.
Another object of the present invention is to provide the aminoacid sequence shown in a kind of polypeptide (SEQ ID NO.2) of fungal thioredoxin, and this polypeptide has various active: anti-tumor activity pharmaceutically is being with a wide range of applications.
The invention still further relates to a kind of preparation method of Agrocybe aegerita (Brig) Sing Trx polypeptide, this method is to make up prokaryotic expression carrier, utilizes affinity chromatography method purifying Agrocybe aegerita (Brig) Sing Trx, and this method is easy, and is with low cost.
The invention still further relates to the aminoacid sequence shown in the active polypeptide of a kind of fungal thioredoxin (SEQ ID NO.2) as the application in the kinds of tumors disease medicaments such as preparation treatment or prevention cervical cancer, cancer of the stomach, mammary cancer, the rectum cancer, prostate cancer, liver cancer.It can suppress the growth of kinds of tumor cells, and the kill tumor cell is better than or is similar to the chemotherapeutics Zorubicin effect of clinical application to the restraining effect of tumour cell, and this Trx has the potentiality that are developed to antitumor drug.
For realizing above-mentioned task, the present invention adopts following technical measures:
An object of the present invention is to provide a kind of new nucleotide sequence, a kind of new Agrocybe aegerita (Brig) Sing Trx of this sequence encoding.In the present invention, the eDNA nucleotide sequence of fungi Agrocybe aegerita (Brig) Sing Trx is to be template with total RNA of Agrocybe aegerita (Brig) Sing or mRNA, obtains by the RT-PCR method.Concrete grammar is as follows: cultivar Ag21 (the edible mushrooms journal that the Agrocybe aegerita (Brig) Sing bacterial classification is provided for Sanming City, Fujian Province fungal studies, 1999,6 (3): 1-7), get the fresh mycelia or the sporophore of Agrocybe aegerita (Brig) Sing, extracting total RNA or mRNA is template (commercially available extraction RNA and mRNA test kit, as Clontech, Promega, company's products such as Stratagene, operation to specifications), synthetic reverse transcriptase primer 5 ' gac cac gcg tat cga tgt cga ct16 (a/c/g) 3 ' carries out reverse transcription and obtains cDNA first chain.According to Agrocybe aegerita (Brig) Sing Trx cDNA sequence, design primer 5 ' atggttgtcaaagctatcacct3 ' is a forward primer, with 5 ' gacaagggtggccgcctccttg3 ' is reverse primer, with above-mentioned cDNA first chain is template, carry out PCR, obtain about 350bp purpose fragment,, obtain the cDNA nucleotide sequence of SEQ ID NO.1 this fragment cloning order-checking.
Required for protection and the above-mentioned cDNA sequence of the present invention has at least the gene of 70% homology can lead to insertion, and genetic manipulations such as disappearance, sudden change obtain.As can on the nucleotide sequence basis that SEQ ID NO.1 provides, inserting arbitrarily when designing the PCR primer, the primer of disappearance and sudden change is synthetic, carries out PCR with this primer, then can obtain having at least the gene of 70% homology.Preferably, described sequence encoding one polypeptide, this polypeptide has the aminoacid sequence shown in the SEQ ID NO.2.Preferably at least 80%, at least 90% nucleotide sequence more preferably, best, this sequence has the nucleotide sequence of 1-327 position among the SEQ ID NO.1.According to the nucleotide sequence of SEQ ID NO.11-327 position, design primer, primer be generally comprise 1-20 position nucleotide sequence and with 307-327 complementary nucleotide sequences, this nucleotide sequence that increases in a large number of the method by PCR or RT-PCR.
The claimed active polypeptide of Agrocybe aegerita (Brig) Sing Trx of the present invention can be produced with the following method.This method comprises: following concrete operation is according to the normal experiment condition, and the condition described in " molecular cloning laboratory manual " (third edition) [J. Sa nurse Brooker etc. is write, 2003, Beijing: Science Press] is carried out.
A kind of preparation method of Agrocybe aegerita (Brig) Sing Trx polypeptide, it comprises the following steps:
1) the total RNA or the mRNA of extraction Agrocybe aegerita (Brig) Sing are template, obtain cDNA first chain by RT-PCR, are pcr template with this chain, and it is the Nucleotide full length sequence shown in the SEQ ID NO.1 that amplification obtains sequence;
2) acquisition and cDNA have the gene order of 70% homology at least: on the 1-327 nucleotide sequence basis of SEQ ID NO.1, as required, (be generally 20-40bp with wherein any one section nucleotide sequence, also can reach 100bp) be the PCR primer, the autotelic insertion of when primer is synthetic, introducing base, disappearance and sudden change, two terminal sequences (1-20 sequences with design restriction enzyme site among this primer and the SEQ ID NO.1,307-327 sequences, or 307-327 complementary sequence, or or 1-20 complementary sequences) be a pair of primer, carry out pcr amplification can be in former sequence the insertion of autotelic introducing base, lack and sudden change, obtain having at least the gene order of 70% homology with cDNA.
3) make up recombinant expression vector: nucleotide sequence that obtains in the step 2 and prokaryotic expression carrier pET28b are (commercially available, Novagen company, also can be with the various expression vectors of commercially available other) carry out enzyme and cut, cDNA sequence after ligase enzyme is cut and expression vector pET28b make up recombinant expression vector pET28-Agrocybe aegerita (Brig) Sing Trx;
4) with the recombinant expression vector transformed into escherichia coli host cell BL21 that obtains in the step 3 (commercially available, Novagen company can select the host cell of coupling according to used expression vector), form the reconstitution cell of expressing the Agrocybe aegerita (Brig) Sing Trx;
5) reconstitution cell that obtains in the step 4 is obtained saturated culture 37 ℃ of overnight incubation; 50 μ L saturated culture are inoculated in 5mL contain in the substratum of penbritin 100 μ g/mL, cultivated 2 hours in 37 ℃.Getting the 1mL culture is transferred in the Eppendorf tube.Add isopropylthiogalactoside IPTG to final concentration be 1m mol/L, culture is induced, induced 8-10 hour.
6) utilize Ni
2+The affinity chromatography purifying protein separates the polypeptide of the aminoacid sequence shown in abduction delivering has in reconstitution cell in the purification step 5.This polypeptide is the aminoacid sequence shown in the SEQ ID NO.2.
Purity detecting can detect with the SDS-PAGE method.
The resulting polypeptide of the present invention is the aminoacid sequence shown in the SEQ ID NO.2, and this aminoacid sequence can suppress the growth of cervical cancer, cancer of the stomach, mammary cancer, the rectum cancer, prostate cancer, liver cancer tumour cell, kill tumor cell.Substantially this pure Trx polypeptide or its variant form can be separately or are added the antitumor drug that other antitumor drugs form oral, intravenous injection or intratumor injection with different ratios.
In the present invention, " isolating ", " purifying " or " pure substantially " DNA refer to, this DNA or fragment have been arranged in the sequence of its both sides and have separated under native state, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and with cell in the protein followed separate.
In the present invention, refer to encode has the nucleotide sequence of the active polypeptide of Agrocybe aegerita (Brig) Sing Trx to term " Agrocybe aegerita (Brig) Sing Trx (or polypeptide) encoding sequence ", as 1-327 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.1.This degenerate sequence is meant, is arranged in the encoder block 1-327 position Nucleotide of SEQ ID NO.1 sequence, and having one or more codons to be encoded, the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, thus with SEQ ID NO.1 in 1-327 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence aminoacid sequence shown in the SEQ ID NO.2 of also encoding out.This term also comprises can be under the rigorous condition of moderate, more preferably under highly rigorous condition can with the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 1-327 position among the SEQ ID NO.1.In addition, this term also comprise with SEQ ID NO.1 in from Nucleotide 1-327 position homology of nucleotide sequence at least 70%, preferably at least 80%, at least 90% nucleotide sequence more preferably.
This term also comprises the variant form of open reading frame sequence in the nucleotide sequence shown in the SEQ ID NO.1 with Agrocybe aegerita (Brig) Sing Trx functional protein of encoding.These variant forms comprise (but being not limited to): several (are generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and add several (in usually with 120 at 5 ' and/or 3 ' end, preferably being in 30, more preferably is in 10, is in 5 best) Nucleotide.
In the present invention, " pure substantially " protein or polypeptide are meant that it accounts at least 20% of the total material of sample, preferably at least 50%, more preferably at least 80%, and at least 90% (by dry weight or weight in wet base) best.Purity can be measured with any suitable method, as measure the purity of polypeptide with column chromatography, PAGE or HPLC method.
In the present invention, term " Agrocybe aegerita (Brig) Sing Trx polypeptide " refers to have the aminoacid sequence shown in the active SEQ ID of the Agrocybe aegerita (Brig) Sing Trx NO.2, and this term also comprises the variant form that has with aminoacid sequence Agrocybe aegerita (Brig) Sing Trx identical function, shown in the SEQ ID NO.2.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 40, preferably being in 20, more preferably is in 10) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic function usually.This term also comprises the active fragments and the reactive derivative of Agrocybe aegerita (Brig) Sing Trx.
The variant form of this polypeptide comprises: homologous sequence, allelic variant, natural mutation, induced mutation body, under high or low rigorous degree condition can with the coded albumen of the DNA of Agrocybe aegerita (Brig) Sing Trx DNA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-Agrocybe aegerita (Brig) Sing Trx polypeptide to obtain.The present invention also provides other polypeptide, as comprises the soluble fragments of Agrocybe aegerita (Brig) Sing Trx polypeptide.Usually, this fragment have Agrocybe aegerita (Brig) Sing Trx peptide sequence at least about 10 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
The present invention also provides the analogue of Agrocybe aegerita (Brig) Sing Trx or polypeptide.The difference of these analogues and natural Agrocybe aegerita (Brig) Sing Trx polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise natural or the inductive genetic variant.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, can also pass through site-directed mutagenesis method or other molecular biological technology.Analogue also comprises having the analogue that is different from natural L-amino acid whose residue (as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, γ-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external, in the synthetic of polypeptide and the further procedure of processing of processing neutralization, carry out glycosylation modified and polypeptide that produce as those.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises the sequence of phosphorylated amino acid residue (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
The present invention also comprises the antisense sequences of Agrocybe aegerita (Brig) Sing Trx polypeptid coding sequence.This antisense sequences can be used to suppress the expression of Agrocybe aegerita (Brig) Sing Trx in the cell.
The present invention also comprises a kind of nucleic acid molecule that can be used as probe, and this molecule has 8-100 of Agrocybe aegerita (Brig) Sing Trx polypeptid coding sequence, preferably 15-50 continuous nucleotide usually.This probe can be used for whether existing in the test sample nucleic acid molecule of coding Agrocybe aegerita (Brig) Sing Trx.
The present invention also comprises the method that detects Agrocybe aegerita (Brig) Sing Trx nucleotide sequence, it comprises with above-mentioned probe and sample and hybridizing, whether detection probes combination has taken place then, preferably, this sample is the product behind the pcr amplification, wherein the pcr amplification primer is corresponding to the encoding sequence of Agrocybe aegerita (Brig) Sing Trx polypeptide, and can be positioned at the both sides or the centre of this encoding sequence, and primer length is generally 20-50 Nucleotide.
On the other hand, the present invention also comprises the Agrocybe aegerita (Brig) Sing Trx or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into Agrocybe aegerita (Brig) Sing thioredoxin gene product or fragment.Preferably, refer to those can combine with Agrocybe aegerita (Brig) Sing thioredoxin gene product or fragment but nonrecognition and in conjunction with the antibody of other irrelevant antigen molecules.Among the present invention antibody comprise those can in conjunction with and suppress the molecule of Agrocybe aegerita (Brig) Sing Trx, comprise that also those do not influence the antibody of Agrocybe aegerita (Brig) Sing Trx.The present invention also comprise those can with modify or without the Agrocybe aegerita (Brig) Sing thioredoxin gene product bonded antibody of modified forms.
The present invention not only comprises complete mono-clonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; The strand Fv molecule that genetic process is transformed; Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.
Antibody of the present invention can be prepared by the known various technology of those skilled in that art.For example, the Agrocybe aegerita (Brig) Sing thioredoxin gene product of purifying or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Antibody of the present invention also can be monoclonal antibody, can utilize hybridoma technology to prepare.Each antibody-like of the present invention can utilize the fragment or the functional zone of Agrocybe aegerita (Brig) Sing thioredoxin gene product, obtains by the routine immunization technology.These fragments or functional zone can utilize recombinant methods or utilize Peptide synthesizer synthetic.
Advantage of the present invention and effect:
Agrocybe aegerita (Brig) Sing Trx nucleotide sequence that provides among the present invention and protein sequence are a kind of gene and protein sequences of new Trx, do not appear in the newspapers.Therefore, advantage of the present invention is " newly "---the present invention is a kind of new, has the Trx of anti-tumor activity, can be applied in field of medicaments.
The Agrocybe aegerita (Brig) Sing Trx albumen that relates among the present invention has very strong anti-tumor activity.Under identical concentration, inhibition effect to HeLa (cervical cancer cell), HepG2 (liver cancer cell), MCF-7 (breast cancer cell) is better than the chemotherapeutics Zorubicin of clinical use, and is suitable to inhibition effect and the Zorubicin of Colo 320 (rectum cancer cell), PC-3 (prostate cancer cell) and SGC-7901 (stomach cancer cell).The osteosarcomatous mouse of lotus S180 being treated, can be prolonged the survival time of mouse, is 34.6% to the inhibiting rate of tumor growth.Therefore, this albumen and gene thereof will have very big using value aspect developing anti-tumor medicaments.
Description of drawings
Fig. 1 is a kind of structure synoptic diagram of pET28-Agrocybe aegerita (Brig) Sing Trx.TRX is the gene of Agrocybe aegerita (Brig) Sing Trx among the figure, and pGEM-TRX is the preservation plasmid of TRX.At first design contains the upstream and downstream primer of Nco I and Xho I restriction enzyme site, with plasmid pGEM-Agrocybe aegerita (Brig) Sing Trx is template, carry out PCR, must arrive two ends and contain the PCR product of Nco I and Xho I restriction enzyme site, digest PCR product and pET28b plasmid respectively with Nco I and Xho I enzyme, carry out ligation according to the amount that reclaims, make the multiple clone site of TRX insertion pET28b, finish the structure of pET28-Agrocybe aegerita (Brig) Sing Trx (pET28b-TRX) expression vector.
Embodiment
Below in conjunction with specific embodiment, further illustrate the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to the normal experiment condition, " molecular cloning laboratory manual " (third edition) [J. Sa nurse Brooker etc. writes 2003, Beijing: Science Press] described in condition carry out or the condition of advising according to manufacturer.
The preparation method of coding Agrocybe aegerita (Brig) Sing Trx nucleotide sequence, Agrocybe aegerita (Brig) Sing Trx polypeptide preparation method, and active embodiment, Antibody Preparation embodiment, antitumor embodiment.
Embodiment 1
The cDNA clone and the order-checking of Agrocybe aegerita (Brig) Sing Trx: obtaining a new cDNA sequence in the present embodiment, is that forefathers did not report.
1. primer amplification
With the total RNA of Agrocybe aegerita (Brig) Sing is template, use oligonucleotide A:5 ' gac cac gcg tat cga tgtcga ct16 (a/c/g) 3 ' to carry out reverse transcription for reverse transcriptase primer, obtain first chain of cDNA, with oligonucleotide B:5 ' atggttgtcaaagctatcacct3 ' is forward primer, oligonucleotide C:5 ' gacaagggtggccgcctccttg3 ' is a reverse primer, carry out PCR, the PCR condition is 95 ℃ of initial 10min, enter three steps circulation (95 ℃ of 1min, 53 ℃ of 1min, 72 ℃ of 2min totally 30 circulations), last 72 ℃ are extended 10min.20 μ L reaction systems comprise: 1 μ gcDNA, 0.2mM dNTP, 20pM forward primer and reverse primer, 2 μ L, 10 * buffer, 1 μ L Taq enzyme and 1.5mM MgCl
2The PCR product is an about 327bp purpose fragment.
2. cloning and sequencing
Operational manual according to pGEM-T easy carrier (Promega company product), this amplified fragments is connected on the pGEM-T easy carrier, make up plasmid pGEM-TRX (pGEM-Agrocybe aegerita (Brig) Sing Trx), check order, detailed sequence is seen SEQ ID NO.1, and wherein 1-327 is the open reading frame sequence of encoding amino acid sequence.
Translate the aminoacid sequence of Agrocybe aegerita (Brig) Sing Trx according to the cDNA sequence that obtains, totally 109 amino-acid residues, its aminoacid sequence sees SEQ ID NO.2 for details.
Embodiment 2
Expression, the purifying of Agrocybe aegerita (Brig) Sing Trx in intestinal bacteria: the protein example that can obtain great expression, purifying in the present embodiment.
At first design contains the upstream and downstream primer of Nco I and Xho I restriction enzyme site, with plasmid pGEM-Agrocybe aegerita (Brig) Sing Trx is template, carry out PCR, must arrive two ends and contain the PCR product of Nco I and Xho I restriction enzyme site, digest PCR product and pET28b plasmid respectively with Nco I and Xho I enzyme, reclaim Agrocybe aegerita (Brig) Sing Trx fragment and purpose plasmid, carry out ligation according to the amount that reclaims, pET28b-Agrocybe aegerita (Brig) Sing Trx (pET28b-TRX) (Fig. 1) to make up prokaryotic expression carrier.With prokaryotic expression carrier transformed into escherichia coli host cell BL21 (commercially available, Novagen company can select the host cell of coupling according to used expression vector), form the reconstitution cell of expressing the Agrocybe aegerita (Brig) Sing Trx.
According to aforesaid prokaryotic expression method, according to the result of different time abduction delivering reorganization Agrocybe aegerita (Brig) Sing Trx, abduction delivering 8-10 hour, great expression.Utilize Ni column purification reorganization Agrocybe aegerita (Brig) Sing Trx, expression amount is about 4-8mg/L.
Embodiment 3
The preparation of Agrocybe aegerita (Brig) Sing Trx antibody: this embodiment can obtain the polyclonal antibody of Agrocybe aegerita (Brig) Sing Trx, is used to detect the Agrocybe aegerita (Brig) Sing Trx.
The recombinant protein that obtains among native protein and the embodiment 2 is used for immune animal to produce antibody, and concrete grammar is as follows.It is standby that recombinant protein separates the back with chromatography, and also available SDS-PAGE gel electrophoresis separates, electrophoretic band is downcut from gel, and with isopyknic complete Freund ' s adjuvant emulsion.With the albumen of 50-100ug/0.2mL emulsification, mouse is carried out subcutaneous injection.After 14 days,, mouse is carried out subcutaneous injection with booster immunization with the dosage of 50-100ug/0.2mL with the same antigen of non-complete Freund ' s adjuvant emulsion.Carried out booster immunization one time every 14 days, carry out at least 3 times.The sero-fast specific reaction that obtains is active is assessed (Western method) with it in external ability in conjunction with Agrocybe aegerita (Brig) Sing thioredoxin gene translation product.
Embodiment 4
The Agrocybe aegerita (Brig) Sing Trx is to the restraining effect of tumour cell and tumor-bearing mice tumor tissues: the Agrocybe aegerita (Brig) Sing Trx suppresses 7 kinds of tumor cell lines detecting in the present embodiment, confirms that the Agrocybe aegerita (Brig) Sing Trx has the broad-spectrum antitumor action; The tumor tissue growth that suppresses lotus S-180 sarcoma mouse, the survival time that prolongs tumor-bearing mice confirms that the Agrocybe aegerita (Brig) Sing Trx is woven with the growth effect that suppresses to the tumor group of tumor animal.
1. the Agrocybe aegerita (Brig) Sing Trx is in external restraining effect to tumor cell line:
Present embodiment has detected the inhibition activity of Agrocybe aegerita (Brig) Sing Trx to 7 kinds of tumor cell lines (SW480, HeLa, SGC-7901, MGC80-3, BGC-823, HL-60 and S-180) growth.The application of described a kind of isolated polypeptide in preparation treatment or prevention cervical cancer medicine; The application of described a kind of isolated polypeptide in preparation treatment or prevention cancer of the stomach medicine; The application of described a kind of isolated polypeptide in preparation treatment or Breast Cancer Prevention medicine; The application of described a kind of isolated polypeptide in preparation treatment or prevention rectum cancer medicine; The application of described a kind of isolated polypeptide in preparation treatment or prevention prostate cancer medicine; The application of described a kind of isolated polypeptide in preparation treatment or prevention liver-cancer medicine.All tumor cell lines are cultivated in RPMI1640 substratum (wherein comprising 10% foetal calf serum, the penicillin of 100mg/mL Streptomycin sulphate and 100U/mL).(be mixed with 5,10,50 with substratum, 100ug/mL) add in the tumour cell, incubation detected the restraining effect of Agrocybe aegerita (Brig) Sing Trx to growth of tumour cell with the MTT method after 24 hours with the Agrocybe aegerita (Brig) Sing Trx of different concns.Detected result is as shown in table 2.The Agrocybe aegerita (Brig) Sing Trx has the good restraining effect to the tumor cell line that is detected, to HeLa, MCF-7, HepG2 cell inhibiting effect is better than the chemotherapeutics Zorubicin, at Colo320, show with the chemotherapeutics Zorubicin in SGC-7901 and the kinds of tumor cells such as PC-3 and under identical concentration, have similar inhibiting rate.
Table 2 Agrocybe aegerita (Brig) Sing Trx (TRX) is in external restraining effect to tumour cell
2. the Agrocybe aegerita (Brig) Sing Trx is to the restraining effect of tumor-bearing mice tumor tissue growth
In the present embodiment, adopt BALB/c mouse (7 weeks, 20 grams), at armpit subcutaneous vaccination 0.1mL murine osteosarcoma oncocyte S-180 (1.18 * 10
8Cells/mL), inoculate after 3 days intratumor injection Agrocybe aegerita (Brig) Sing Trx (with physiological saline solution 1.67mg/mL, an injection 0.06mL) 0.1mg/ mouse, contrast injecting normal saline.After this, injection every other day.Put to death mouse at inoculated tumour after 20 days.The cutting-out tumour is weighed, and calculates inhibiting rate.Inhibiting rate (%)=[(C-T)/C] * 100% (C is a control group average tumor weight, and T is the weight in average of treatment group tumour).The result is as shown in table 3.The Agrocybe aegerita (Brig) Sing Trx can reach 36.36% to the inhibiting rate of the tumour of the mouse of processing, and has prolonged the life-span of tumor-bearing mice.
Table 3 Agrocybe aegerita (Brig) Sing Trx is to the restraining effect of lotus S-180 knurl mouse tumor
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition and reading after the present invention divides above-mentioned teachings that those skilled in the art can make various changes or modifications the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
SEQUENCE?LISTING
＜110〉Wuhan University
＜120〉a kind of polypeptide of fungal thioredoxin, encoding sequence and preparation method and application
＜130〉a kind of polypeptide of fungal thioredoxin, encoding sequence and preparation method and application
<160>2
<170>PatentIn?version?3.1
<210>1
<211>327
<212>DNA
＜213〉Agrocybe aegerita (Brig) Sing
<400>1
<210>2
<211>109
<212>PRT
＜213〉Agrocybe aegerita (Brig) Sing
<400>2
Claims (9)
1, a kind of nucleotide sequence of separated coding fungal thioredoxin, its sequence are nucleotide sequence shown in the SEQ ID NO.1.
2, a kind of isolated polypeptide, its sequence are the aminoacid sequence shown in the SEQ ID NO.2.
3, the polypeptide preparation method of the described a kind of fungal thioredoxin of claim 2, it comprises the following steps:
The total RNA or the mRNA of A, extraction Agrocybe aegerita (Brig) Sing are template, obtain cDNA first chain by RT-PCR, are pcr template with this chain, and it is the full length sequence shown in the SEQ ID NO.1 that amplification obtains sequence;
B. enzyme is cut sequence and the prokaryotic expression carrier that steps A obtains, and makes up recombinant expression vector;
C, with the recombinant expression vector transformed into escherichia coli host cell that obtains among the step B, form to express the reconstitution cell of Agrocybe aegerita (Brig) Sing Trx;
D, the reconstitution cell that obtains among the step C is obtained saturated culture 37 ℃ of overnight incubation, 50 μ L saturated culture are inoculated in 5mL to be contained in the substratum of penbritin 100 μ g/mL, cultivated 2 hours in 37 ℃, getting the 1mL culture is transferred in the Eppendorf tube, add isopropylthiogalactoside IPTG to final concentration be 1mmol/L, culture is induced, induced 10 hours;
E, utilize Ni
2+The affinity chromatography purifying protein separates, among the purification step D in reconstitution cell polypeptide expressed.
4, the application of the described a kind of isolated polypeptide of claim 2 in preparation treatment or prevention cervical cancer medicine.
5, the application of the described a kind of isolated polypeptide of claim 2 in preparation treatment or prevention cancer of the stomach medicine.
6, the application of the described a kind of isolated polypeptide of claim 2 in preparation treatment or Breast Cancer Prevention medicine.
7, the application of the described a kind of isolated polypeptide of claim 2 in preparation treatment or prevention rectum cancer medicine.
8, the application of the described a kind of isolated polypeptide of claim 2 in preparation treatment or prevention prostate cancer medicine.
9, the application of the described a kind of isolated polypeptide of claim 2 in preparation treatment or prevention liver-cancer medicine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100608730A CN101497886B (en) | 2009-02-27 | 2009-02-27 | Polypeptide of fungal thioredoxin, coding sequence, preparation and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100608730A CN101497886B (en) | 2009-02-27 | 2009-02-27 | Polypeptide of fungal thioredoxin, coding sequence, preparation and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101497886A true CN101497886A (en) | 2009-08-05 |
| CN101497886B CN101497886B (en) | 2010-12-29 |
Family
ID=40945158
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100608730A Expired - Fee Related CN101497886B (en) | 2009-02-27 | 2009-02-27 | Polypeptide of fungal thioredoxin, coding sequence, preparation and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101497886B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102911261A (en) * | 2011-08-01 | 2013-02-06 | 武汉奥力生物科技有限公司 | Agrocybe aegerita lectin AAL-2 and coding gene thereof, preparation method and application thereof |
| CN107267475A (en) * | 2017-08-11 | 2017-10-20 | 浙江福斯特新材料研究院有限公司 | A kind of method that metal chelate affinity chromatography purifies thioredoxin |
| CN109438557A (en) * | 2018-09-18 | 2019-03-08 | 华中农业大学 | A kind of Agroeybe cylindracea mycelia anti-oxidation peptide and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1189539A (en) * | 1997-01-31 | 1998-08-05 | 中国人民解放军军事医学科学院生物工程研究所 | Soluble expression carrier and its fusion protein of novel thioredoxin |
| IL137177A0 (en) * | 1998-01-30 | 2001-07-24 | Genesense Technologies Inc | Oligonucleotide sequences complementary to thioredoxin or thioredoxin reductase genes and methods of using same to modulate cell growth |
| CN1110561C (en) * | 1999-01-05 | 2003-06-04 | 南京大学 | Designing of bacterium coli solubility expression carrier and its application |
-
2009
- 2009-02-27 CN CN2009100608730A patent/CN101497886B/en not_active Expired - Fee Related
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102911261A (en) * | 2011-08-01 | 2013-02-06 | 武汉奥力生物科技有限公司 | Agrocybe aegerita lectin AAL-2 and coding gene thereof, preparation method and application thereof |
| CN102911261B (en) * | 2011-08-01 | 2014-06-18 | 武汉奥力生物科技有限公司 | Agrocybe aegerita lectin AAL-2 and coding gene thereof, preparation method and application thereof |
| CN107267475A (en) * | 2017-08-11 | 2017-10-20 | 浙江福斯特新材料研究院有限公司 | A kind of method that metal chelate affinity chromatography purifies thioredoxin |
| CN109438557A (en) * | 2018-09-18 | 2019-03-08 | 华中农业大学 | A kind of Agroeybe cylindracea mycelia anti-oxidation peptide and application thereof |
| CN109438557B (en) * | 2018-09-18 | 2021-09-10 | 华中农业大学 | Agrocybe cylindracea antioxidant peptide and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101497886B (en) | 2010-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2479275B1 (en) | HLA-A*1101-restricted WT1 peptide and pharmaceutical composition comprising the same | |
| CN103237808B (en) | Anticancer fusion protein | |
| PH12012502372B1 (en) | Hla-a*3303-restricted wt1 peptide and pharmaceutical composition comprising the same | |
| US9757473B2 (en) | Cell-penetrating peptide and conjugate comprising same | |
| CN110099694A (en) | Hypothermia improver | |
| EP2589605B1 (en) | Telomerase activity inhibiting peptide and manufacturing method and application thereof | |
| CN101497886B (en) | Polypeptide of fungal thioredoxin, coding sequence, preparation and use | |
| CN101942017B (en) | Tumor marker | |
| CN113179631A (en) | Covalent protein drugs developed by proximity-enabling response therapy | |
| CN101524529B (en) | Treatment on human malignant solid tumor by HNF4 alpha inducement and differentiation | |
| HU225738B1 (en) | Recombinant mistletoe lectin | |
| CN1332030C (en) | Polypeptide, its coding sequence and preparation method and application of fungus galactose agglutinin protein activity | |
| CN100549175C (en) | A kind of recombinant protein and encoding gene and application with cancer suppressing action | |
| CN110713546A (en) | survivin-XIAP compound-targeted antitumor polypeptide Sur-X and application thereof | |
| CN102348796A (en) | Novel cancer antigen eEF2 | |
| EP2740739B1 (en) | Agrocybe aegerita lectin aal-2, and encoding gene thereof, preparation method therefor and application thereof | |
| CN101928335B (en) | Fungus antitumor polypeptide nucleotide sequence, and preparation method and applications thereof | |
| CN101392262B (en) | Polypeptide of fungal ubuquitin-conjugating enzyme, coding sequence thereof and preparation method and application | |
| Yang et al. | Molecular structure and functional characterization of the gamma-interferon-inducible lysosomal thiol reductase (GILT) gene in largemouth bass (Microptenus salmoides) | |
| CN116003626A (en) | Biosynthesis method of protein heterogeneous cable hydrocarbon based on mechanical coupling and application thereof | |
| CN101144081B (en) | Nucleic acid molecule TRAIL and application in preparation of anti-tumour pharmaceutical | |
| JP5393661B2 (en) | Preprocalcitonin antigen T epitope | |
| CN100480264C (en) | Earthworm protein suppressing cancer cell accretion by road spectrum and coding sequence thereof | |
| CN113272016A (en) | Compositions and methods relating to engineered and non-engineered γ δ -T cells for treatment of solid tumors | |
| KR20160000881A (en) | Composition for inhibiting myeloid-derived suppressor cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101229 Termination date: 20140227 |