CN113179631A - Covalent protein drugs developed by proximity-enabling response therapy - Google Patents

Abstract

A proximity-enabled response therapy method for generating a covalent protein drug is disclosed. The potential biologically reactive amino acid FSY is incorporated into human programmed death protein 1(PD-1), which upon binding selectively reacts with the proximal histidine of human PD-L1, such that PD-1 binds irreversibly to PD-L1 on cancer cells in vitro and in tumors in mice. When administered in a humanized mouse model, covalent PD-1(FSY) exhibits a potent anti-tumor effect over wild-type, achieving a therapeutic effect comparable to the FDA-approved therapeutic monoclonal antibody atelizumab. Such proximity-enabling reaction patterns should provide a versatile method for converting interacting proteins into covalent protein drugs to achieve high therapeutic efficacy.

Description

Covalent protein drugs developed by proximity-enabling response therapy

Sequence listing

This application is filed with a sequence listing in electronic form. The entire contents of the sequence listing are incorporated herein by reference.

Technical Field

The present application relates generally to proximity-enabled response therapy methods for generating covalent protein drugs, and to proteins comprising a potentially bioreactive unnatural amino acid (Uaa) mutein useful for covalent protein drugs developed by such proximity-enabled response therapy (proximities-enabled reactive therapeutics). More specifically, the present application relates to a mutated PD-1 comprising o-fluorosulfate-L-tyrosine (FSY), a method for the preparation thereof, and the use of said mutated PD-1.

Background

Small molecule drugs covalently bind to their targets and although deliberately avoided by pharmaceutical researchers and industry historically, have been re-emerged with great success in recent years^1,2,3. Covalent bonding between a drug and a target provides a variety of desirable properties over non-covalent interactions of conventional drugs, including increased biochemical potency and efficacy, prolonged duration of action that persists pharmacokinetics, improved therapeutic index with reduced dose and dosing frequency, complete inactivation of the target, opportunity to inhibit poorly curable targets^3,4. To date, nearly 30% of commercially available enzyme-targeted drugs work through covalent mechanisms, and targeted covalent inhibition is increasingly being applied to a wider range of targets challenging for non-covalent drugs^5,4。

Small molecule covalent drugs offer a variety of desirable therapeutic properties relative to non-covalent drugs for treatment-challenging diseases. However, since proteins cannot covalently bind to the targetThe potential of covalent protein drugs has yet to be largely unexplored. In contrast to the successful development of small molecule covalent drugs, the therapeutic potential of covalent protein drugs remains largely unexplored. Protein drugs are more amenable to covalent modes of action than small molecule drugs. One major problem with small molecule covalent drugs is off-target reactivity¹Off-target reactivity can be minimized in covalent protein drugs because proteins have larger sizes and generally have higher target specificity than small molecules. The key to the development of covalent small molecule drugs is to adopt a suitable balance between reactivity and selectivity⁴. The challenges in developing covalent protein drugs are as follows: native proteins interact primarily through non-covalent interactions and lack covalent reactivity with native amino acid residues on the target. In addition, the widespread presence of amino acids in proteins, cells and in vivo poses a significant obstacle to achieving selectivity of the response against the target.

Accordingly, there is a continuing need in the art for the development of muteins that are capable of interacting through covalent interaction with a natural amino acid on a target protein expressed on diseased cells, such as tumor cells.

Disclosure of Invention

The object of the present invention is to produce muteins capable of interacting by covalent interaction with the natural amino acids of a target protein expressed on a tumor. The muteins can be used to develop covalent protein pharmaceuticals.

The present application discloses herein a proximity-enabling response therapy strategy for the development of covalent protein drugs (figure 1). By amplifying the genetic code^6,7A potentially biologically reactive unnatural amino acid (Uaa) is introduced into protein drugs, which Uaa has low chemical reactivity and remains inert within proteins and in cells. Upon binding of the protein drug to its target, the biologically reactive Uaa will facilitate selective reaction with the target's native residues through proximity enabling reactions⁸Forming a covalent bond between the drug and the target. In one embodimentThe inventors genetically modified the potential bioreactive Uaa, i.e. o-fluorosulfuric acid-L-tyrosine (FSY)⁹Incorporated into human programmed death protein 1(PD-1) and showed that the resulting PD-1(FSY) was covalently bound in vitro to its natural ligand PD-L1 on the cell surface and in vivo in tumor tissue. Compared with PD-1(WT), PD-1(FSY) was found to enhance the functional activity of human naive T cells and inhibit tumor growth with significantly higher efficacy in humanized mouse models, showing an anti-tumor effect comparable to that of the therapeutic anti-PD-L1 monoclonal antibody, highlighting the therapeutic effect promoted by covalent bonds.

In one aspect, the present disclosure relates to a proximity-enabled response therapy method to generate a covalent protein drug, the method comprising: incorporating a potentially biologically reactive unnatural amino acid (Uaa) into a protein drug to produce a mutein drug, wherein the mutein drug reacts upon drug-target binding by proximity enabling reaction with a target natural residue of its target protein, thereby enabling covalent binding of the protein drug to its target.

In one embodiment, the Uaa is genetically incorporated into the protein drug, for example by introducing an amber stop codon (TAG) at a desired site in the nucleotide sequence of a wild-type protein encoding the protein drug by means of a mutated aminoacyl-tRNA synthetase (aaRS) specific for Uaa, which has evolved to incorporate Uaa in response to the TAG codon.

In one embodiment, the Uaa is FSY (o-fluorosulfate-L-tyrosine) with the aid of a tRNA for orthogonality^PylA gene of the/FSYRS pair genetically introduced into a protein drug by introducing an amber stop codon (TAG) at a desired site in a nucleotide sequence of a wild-type protein encoding said protein drug for an orthogonal tRNA^PylThe genes of the/FSYRS pair were evolved to incorporate FSY in response to TAG codons.

In one embodiment, the protein drug may be one member of an immune checkpoint and its target, i.e., another member of an immune checkpoint, may be a protein expressed on the surface of a tumor cell.

In one embodiment, the immune checkpoint may be selected from, but is not limited to, PD-1/PD-L1, CTLA-4/CD80(CD86), 4-1 BB/ligand, OX 40/ligand, GITR/ligand, LAG-3/ligand, TIM-3/ligand, and the like.

In one embodiment, the mutein drug is a mutated PD-1(FSY) containing one FSY (o-fluorosulfate-L-tyrosine) in its amino acid sequence, wherein said mutated PD-1(FSY) is capable of specifically reacting with a target native amino acid residue selected from Tyr, His or Lys in its target PD-L1 by click chemistry sulfur-fluoride exchange (SuFEx).

In one aspect, the disclosure relates to human PD-1(FSY) comprising a mutation of FSY (o-fluorosulfate-L-tyrosine) in its amino acid sequence.

In one embodiment, said FSY residue in said mutated PD-1(FSY) is capable of specifically reacting with a proximal one of its target native amino acid residues selected from Tyr, His or Lys in PD-L1 by click chemistry sulfur-fluoride exchange (SuFEx). The use of FSY will create a covalent bond between PD-1(FSY) and PD-L1, forming an irreversible antagonist with a very large affinity that cannot be achieved with any high affinity mutant evolved by mutagenesis of the natural amino acids.

In one embodiment, the FSY is introduced into human PD-1 at one of the following sites: 75. 77 or 129 (numbering according to the amino acid sequence of wild-type human PD-1 (i.e., NCBI accession No.: NP-005009.2)), targeted to Lys124, Lys124 and His69, respectively, of PD-L1.

In one embodiment, the FSY is introduced into human PD-1 at position 75 or 129, preferably at position 129.

In one embodiment, the FSY residue is associated with a PD-1 gene for an orthogonal tRNA by expressing in a host cell a PD-1 gene that comprises an amber stop codon (TAG) introduced at a desired site^PylGenes of the/FSYRS pair incorporated into the extracellular domain of human PD-1 for orthogonal tRNA^PylGene quilt of/FSYRS pairEvolution was the incorporation of FSY in response to TAG codon.

In one embodiment, the host cell may be selected from, but is not limited to, an escherichia coli (e.coli) cell, a yeast cell, a mammalian cell (e.g., CHO cell), or an insect cell.

In one embodiment, the mutated human PD-1(FSY) may specifically covalently bind to human PD-L1 in vitro, to human PD-L1 that is physiologically expressed on the surface of living cancer cells, and to human PD-L1 in tumor tissue in vivo. However, the mutant human PD-1(FSY) showed no covalent cross-linking with mouse PD-L1, although human PD-1 is known to cross-bind with mouse PD-L1. Thus, the mutated human PD-1(FSY) has high target specificity and low off-target effects.

In one embodiment, the mutant human PD-1(FSY) can significantly enhance T cell activation by blocking the PD-1/PD-L1 interaction. The T cell activation effect of human PD-1(FSY) was comparable to that of altlizumab applied at the same molar concentration.

In one embodiment, the mutated human PD-1(FSY) may achieve the same anti-tumor effect as the same molar amount of alemtuzumab administered, but requires a mass amount of PD-1(FSY) that is one tenth of the mass amount of alemtuzumab.

In one aspect, the disclosure relates to a method of genetically incorporating FSY into PD-1, the method comprising:

expressing in a host cell, in cell culture medium comprising synthetic FSY and an agent for inducing expression of a protein:

(i) a PD-1 gene comprising an amber stop codon (TAG) introduced at a desired site; and

(ii) genes for orthogonal tRNAPY/FSYRS pairs.

In one embodiment, the host cell is e.coli and the agent for inducing protein expression is IPTG.

In one embodiment, the PD-1 is human PD-1.

In one embodiment, the amber stop codon (TAG) is introduced at a position selected from one of positions 75, 77 or 129 of human PD-1.

In one embodiment, the PD-1 gene comprising an amber stop codon (TAG) is as set forth in any one of SEQ ID NOS: 16-18.

In one embodiment, the tRNA^PylShown as SEQ ID NO. 19.

In one embodiment, the FSYRS is a mutated pyrrolysinyl-tRNA synthetase (PylRS) specific for FSY. FSYRS is shown in SEQ ID NO:20 and is a mutant Methanococcus equina (Methanosarcina mazei) PylRS.

In one aspect, the present disclosure relates to a pharmaceutical composition comprising an effective amount of a mutein comprising a potentially biologically reactive unnatural amino acid (Uaa) and a pharmaceutically acceptable carrier and/or excipient.

In one embodiment, the present disclosure relates to a pharmaceutical composition comprising an effective amount of mutated PD-1(FSY) and a pharmaceutically acceptable carrier and/or excipient.

In one embodiment, in the mutated PD-1(FSY), the FSY is introduced into PD-1 at one of the following sites: 75. 77 or 129 (numbering of the positions being according to the amino acid sequence of wild-type PD-1).

In one embodiment, the FSY is introduced into PD-1 at position 75 or 129, preferably at position 129.

When a pharmaceutical composition comprising a mutated PD-1(FSY) is administered to a subject in need thereof, a covalent bond will be formed between PD-1(FSY) and PD-L1, forming an irreversible antagonist with a very large affinity that cannot be achieved with any high affinity mutant evolved by natural amino acid mutagenesis.

In one embodiment, the pharmaceutical composition is used to prevent and/or treat PD-L1-associated diseases, for example, melanoma, renal cell carcinoma, head and neck cancer, cervical cancer, glioblastoma, bladder cancer, esophageal cancer, breast cancer, hepatocellular carcinoma, hodgkin's lymphoma, and mediastinal large B-cell lymphoma.

In one aspect, the present disclosure relates to the use of a mutein comprising potentially biologically reactive unnatural amino acids (Uaa) for the manufacture of a pharmaceutical composition for the prevention and/or treatment of diseases, including cancer.

In one embodiment, the disclosure relates to the use of mutant PD-1(FSY) in the manufacture of a pharmaceutical composition for the prevention and/or treatment of PD-L1-associated diseases, such as melanoma, renal cell carcinoma, head and neck cancer, cervical cancer, glioblastoma, bladder cancer, esophageal cancer, breast cancer, hepatocellular carcinoma, hodgkin's lymphoma, and mediastinal B-cell lymphoma.

In one embodiment, the pharmaceutical composition is packaged as a kit.

In one aspect, the present disclosure relates to a kit comprising an effective amount of a mutein comprising a potentially bioreactive unnatural amino acid (Uaa) and a pharmaceutically acceptable carrier and/or excipient.

In one embodiment, the kit comprises an effective amount of mutated PD-1(FSY) and a pharmaceutically acceptable carrier and/or excipient.

In one aspect, the present disclosure relates to a method of preventing and/or treating a disease, including cancer, in a subject, the method comprising: administering to the subject a pharmaceutical composition comprising an effective amount of a mutein comprising a potentially biologically reactive unnatural amino acid (Uaa) and a pharmaceutically acceptable carrier and/or excipient.

In one embodiment, the present disclosure relates to a method of preventing and/or treating a PD-L1-associated disease in a subject, the method comprising: administering to the subject a pharmaceutical composition comprising an effective amount of mutated PD-1(FSY) and a pharmaceutically acceptable carrier and/or excipient.

Compared with the prior art, the method has the following advantages:

(1) proximity-enabling response strategies can be used to develop covalent protein drugs with improved efficacy and half-life in vivo;

(2) proximity enabling reactions can be used to develop covalent protein drugs from small protein molecules;

(3) the covalent protein drug has low dose and low frequency due to its improved efficacy and half-life in vivo; and

(4) the proximity-enabling response strategy is used to modify one member of an immune checkpoint such as PD-1/PD-L1, CTLA-4/CD80(CD86), 4-1 BB/ligand, OX 40/ligand, GITR/ligand, LAG-3/ligand, TIM-3/ligand, etc., and thus, the modified protein (e.g., PD-1) can specifically bind its target ligand (e.g., PD-L1) expressed on the surface of tumor cells.

The foregoing is a summary and thus contains, by necessity, simplifications, generalizations, and omissions of detail; consequently, those skilled in the art will appreciate that the summary is illustrative only and is not intended to be in any way limiting. Other aspects, features and advantages of the methods, compositions and/or devices described herein and/or other subject matter will be apparent in the teachings provided herein. This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the detailed description. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter. In addition, the contents of all references, patents, and published patent applications cited throughout this application are hereby incorporated by reference in their entirety.

Drawings

FIG. 1 illustrates the principle of the development of covalent protein drugs using proximity-enabled reactions. The potentially biologically reactive Uaa is genetically incorporated into a protein drug, and upon drug-target binding, Uaa reacts with the target native residue of the target protein via a proximity enabling reaction, thereby covalently binding the protein drug to its target.

FIG. 2 shows the genetic incorporation of potentially biologically reactive Uaa FSY into PD-1.

(A) The structure of the potentially biologically reactive Uaa FSY and its reaction with His via SuFEx.

(B) Crystal structure of human PD-1/PD-L1 complex. The positions A129, Q75 and D77 of PD-L selected for FSY incorporation and their His69 and Lys124 of the target native residue PD-L1 are shown as rods. PDB encodes 4 ZQK.

(C) Western blot analysis of cell lysates of e.coli cells under the indicated different expression conditions. IPTG was used to induce expression of the PD-1 gene and arabinose was used to induce expression of the FSYRS gene. The PD-1 IgV domain is expressed when FSY is added to the growth medium and migrates at the same position as the PD-1(WT) IgV domain. Without the addition of FSY in the growth medium, translation was terminated at the 129TAG codon, and thus the PD-1 IgV domain at the desired position was not expressed.

(D) SDS-PAGE analysis of PD-1(WT) and PD-1(A129FSY) expression and purification. Purified and refolded PD-1(A129FSY) migrated at the same position as PD-1 (WT).

(E) Tandem mass spectrum of PD-1(A129 FSY). A series of b and y ions clearly indicated that FSY was incorporated at the 129 position designated by TAG of PD-1. U represents FSY.

FIG. 3 shows the covalent bonding between PD-1(FSY) and its ligand PD-L1 via proximity enabling reaction of a potentially biologically reactive Uaa FSY.

(A) Analysis of binding of purified PD-1 mutants to PD-L1 in vitro using SDS-PAGE and Western blotting. The covalent complex of PD-1/PD-L1 is indicated by a red arrow.

(B) The mutation of His69 to Ala in PD-L1 abolished its covalent binding to PD-1(A129 FSY).

(C) Tandem mass spectrometry clearly indicated that FSY129 in PD-1 was covalently crosslinked to His69 of PD-L1. U represents FSY.

(D) PD-1(A129FSY) was labeled PD-1(FSY) and was covalently bound to PD-L1 on the surface of cancer cells in a dose-dependent manner.

(E) PD-1(A129FSY) is labeled PD-1(FSY) and is covalently bound to PD-L1 on the tumor in vivo.

FIG. 4 shows that PD-1(FSY) is not covalently cross-linked to mouse PD-L1 expressed on mouse thymus and spleen cells.

(A) PD-1(WT) and PD-1(FSY) were incubated with mouse cells separately, samples were lysed and analyzed by western blotting using a primary antibody specific for mouse PD-L1.

(B) Sequence alignment of the extracellular IgV domains of human PD-L1 and mouse PD-L1. The red box emphasizes that His69 in human PD-L1 corresponds to Ala69 in mouse PD-L1. FSY reacts with His but not Ala by proximity enabling the reaction. Thus, PD-1(FSY) is covalently crosslinked to human PD-L1, but not to mouse PD-L1.

FIG. 5 shows that PD-1(FSY) increases T cell proliferation and INF- γ production in vitro after allogeneic stimulation.

(A) FACS analysis traces of T cell proliferation obtained by measuring CFSE staining intensity.

(B) T cell proliferation measured by the percentage of dividing T cells (dividing T cells have lower CFSE intensity than the parental population). n is 4; p < 0.05; p < 0.0001; one-way ANOVA followed by Tukey multiple comparison test.

(C) INF- γ released by T cells in MLR. n is 8; ns, not significant; p < 0.05; p < 0.0001; one-way ANOVA followed by Tukey multiple comparison test.

FIG. 6 shows that PD-1(FSY) inhibits tumor growth more effectively than PD-1(WT) in a PBMC-tumor xenograft mouse model.

(A) A schematic diagram illustrating the experimental design is shown.

(B-C) growth curves of transplanted tumors are shown as single tumors (B) or as combined data (C). Error bars are expressed as s.e.m. (standard error), n is 8/group. For the vehicle PBS control, n-6. P < 0.01; p < 0.0001; two-way ANOVA followed by Tukey multiple comparison test.

(D) Photographs of tumors excised from mice sacrificed at day 44.

(E) Weight comparison of excised tumors. Error bars are expressed as s.e.m. (standard error), n-8/group (except PBS group, n-6). ns, not significant; p < 0.01; p < 0.001; one-way ANOVA followed by Tukey multiple comparison test.

Figure 7 shows the phenotypic characteristics of mature human dendritic cells derived from monocytes. Increased expression of CD83, CD86, HLA-DC and PD-L1 on mature DCs differentiated from monocytes induced with GM-CSF and IL-4 and activated with TNF- α and LPS. Unstained CD83, CD86, HLA-DR and PD-L1 were used as controls.

FIG. 8 shows that PD-1(FSY) increases T cell proliferation in vitro after allogeneic stimulation. Measuring and comparing CD3 being treated with indicated agents⁺Mean Fluorescence Intensity (MFI) of CFSE in T cells. A decrease in CFSE fluorescence intensity indicates cell division and proliferation. PD-1(FSY) showed a more pronounced enhancement of T cell proliferation than PD-1(WT) at concentrations of 50nM and 250nM, reaching the same enhancement level as the antibody atelizumab. n is 4; ns, not significant; p<0.0001; one-way ANOVA followed by Tukey multiple comparison test.

Detailed Description

While this disclosure may be embodied in many different forms, there are disclosed herein specific illustrative embodiments thereof which illustrate the principles of the disclosure. It should be emphasized that this disclosure is not limited to the particular embodiments illustrated. Moreover, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. More specifically, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a protein" includes a plurality of proteins; reference to "a cell" includes mixtures of cells, and the like. In this application, the use of "or" means "and/or" unless otherwise indicated. Furthermore, the use of the term "including" as well as other forms such as "includes and including" is non-limiting. Further, the ranges provided in the specification and the appended claims include both endpoints and all points between the endpoints.

Generally, the terms and their techniques used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. Unless otherwise indicated, the methods and techniques of the present disclosure are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, e.g., Abbas et al, Cellular and Molecular Immunology, 6 th edition, w.b. saunders Company (2010); sambrook J. & Russell D. molecular Cloning A Laboratory Manual, 3 rd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2000); ausubel et al, Short Protocols in Molecular Biology A Complex of Methods from Current Protocols in Molecular Biology, Wiley, John & Sons, Inc. (2002); harlow and Lane use Antibodies A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1998); and Coligan et al, Short Protocols in Protein Science, Wiley, John & Sons, Inc. (2003). The terms used in connection with analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein, and their laboratory procedures and techniques, are well known and commonly used in the art. Moreover, any section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

Definition of

For a better understanding of the present disclosure, the definitions and explanations of the relevant terms are provided below.

The term "covalent protein drug" as used herein refers to a therapeutic protein capable of interacting with its target by covalent bonding.

The term "unnatural amino acid (Uaa)" refers to an amino acid that is different from any of the 20 natural amino acids. Uaa can be a modified natural amino acid, e.g., o-fluorosulfate-L-tyrosine (FSY) is a modified tyrosine.

The term "proximity-enabling response therapy" refers to a mutein drug comprising potentially biologically reactive unnatural amino acids (Uaa), wherein the Uaa in the mutein drug can specifically react with one target natural residue of a target protein of the mutein drug such that the protein drug forms a covalent binding to its target.

The term "programmed death 1 (PD-1)", an immune checkpoint protein, is a type I transmembrane protein that is part of the Ig gene superfamily (Agata et al (1996) bit Immunol 8:765-72) and is an inhibitory member of the immunoglobulin superfamily that shares homology with CD 28. It is expressed on T cells, activated B cells and myeloid cells (Agata et al, supra; Okazaki et al (2002) curr. Opin. Immunol.14: 391779-82; Bennett et al (2003) J Immunol 170:711-8) and has a pivotal role in regulating stimulatory and inhibitory signals of the immune system (Okazaki, Taku et al 2007International Immunology 19: 813-824). PD-1 was found by screening for differential expression in apoptotic cells (Ishida et al (1992) EMBO J11: 3887-95). Alternative names or synonyms for PD-1 include PDCD1, PD1, CD279, SLEB2, and the like. A representative amino acid sequence of human PD-1 is disclosed by NCBI accession No. NP-005009.2, and a representative nucleic acid sequence encoding human PD-1 is shown by NCBI accession No. NM-005018.2.

As used herein, the term "PD-L1" refers to programmed cell death ligand 1(PD-L1, see, e.g., Freeman et al (2000) j.exp.med.192: 1027). Alternative names or synonyms of PD-L1 include PDCD1L1, PDL1, B7H1, CD274, and B7-H, among others. Representative amino acid sequences of human PD-L1 are disclosed under NCBI accession No. NP-054862.1, and representative nucleic acid sequences encoding human PD-L1 are shown under NCBI accession No. NM-014143.3. PD-L1 is expressed in placenta, spleen, lymph nodes, thymus, heart, fetal liver, and is also found in many tumor or cancer cells. PD-L1 binds to its receptor PD-1 or B7-1, and PD-1 or B7-1 is expressed on activated T cells, B cells, and myeloid cells. The binding of PD-L1 and its receptor induces signal transduction to inhibit TCR-mediated activation of cytokine production and T cell proliferation. Thus, PD-L1 has a major role in suppressing the immune system during specific events (such as pregnancy, autoimmune diseases, tissue allografts) and is believed to force tumor or cancer cells to bypass immune checkpoints and evade immune responses.

The interaction between PD-1 expressed on activated T cells and PD-L1 expressed on tumor cells negatively regulates the immune response and limits anti-tumor immunity. PD-L1 is abundantly present in a variety of human cancers (Dong et al (2002) nat. Med 8: 787-9).

As used herein, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide may be inserted. When the vector allows the expression of a protein encoded by a polynucleotide inserted therein, the vector is referred to as an expression vector. The vector may carry the genetic material elements for expression in the host cell by transformation, transduction, or transfection into the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids, phages, cosmids, artificial chromosomes such as Yeast Artificial Chromosomes (YACs), Bacterial Artificial Chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages such as lambda phage or M13 phage, and animal viruses. Animal viruses that may be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, papova viruses (such as SV 40). The vector may include a number of elements for controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector may comprise an origin of replication.

As used herein, the term "host cell" refers to a cellular system that can be engineered to produce a protein, protein fragment, or peptide of interest. Host cells include, but are not limited to, cultured cells, e.g., mammalian cultured cells derived from rodents (rats, mice, guinea pigs, or hamsters), such as CHO, BHK, NSO, SP2/0, YB 2/0; or human tissue or hybridoma cells, yeast cells, and insect cells, as well as cells contained within transgenic animals or cultured tissues. The term encompasses not only the particular subject cell, but also the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not be identical to the parent cell, but are still included within the scope of the term "host cell".

The term "subject" includes any human or non-human animal, preferably a human.

As used herein, the term "cancer" refers to any of a solid tumor or a non-solid tumor (such as leukemia) mediated by tumor or malignant cell growth, proliferation, or metastasis, and causes a medical condition.

The term "treatment" as used herein, in the context of treating a condition, generally with respect to treatment and therapy, whether human or animal, wherein some desired therapeutic effect is achieved, e.g., inhibiting the progression of the condition, and includes a decrease in the rate of progression, cessation of the rate of progression, regression of the condition, amelioration of the condition, and cure of the condition. Treatment as a prophylactic measure (i.e., prophylactic, preventative) is also included. For cancer, "treating" may refer to suppressing or slowing tumor or malignant cell growth, proliferation or metastasis, or some combination thereof. For a tumor, "treating" includes removing all or a portion of the tumor, inhibiting or slowing tumor growth and metastasis, preventing or delaying the development of the tumor, or some combination thereof.

As used herein, the term "effective amount" refers to an amount of an active compound or material, composition or dosage form comprising an active compound that is effective, when administered according to a desired treatment regimen, to produce some desired therapeutic effect commensurate with a reasonable benefit/risk ratio.

The term "preventing" as used herein with respect to a particular disease in a mammal means preventing or slowing the onset of the disease, or preventing its clinical manifestations or subclinical symptoms

As used herein, the term "pharmaceutically acceptable" means vehicles, diluents, excipients, and/or salts thereof that are chemically and/or physically compatible with the other ingredients of the formulation and physiologically compatible with the recipient.

As used herein, the term "pharmaceutically acceptable carrier and/or excipient" refers to carriers and/or excipients that are pharmacologically and/or physiologically compatible with the subject and active agent, which are well known in the art (see, e.g., Remington's Pharmaceutical sciences, gennaro AR, 19 th edition, Pennsylvania: Mack Publishing Company,1995), and include, but are not limited to, pH adjusting agents, surfactants, adjuvants, and ionic strength enhancers. For example, pH adjusting agents include, but are not limited to, phosphate buffers; surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, e.g., Tween-80; ionic strength enhancers include, but are not limited to, sodium chloride.

Summary of sequence listing

The present application is accompanied by a sequence listing, including some amino acid sequences and nucleotide sequences. Table a below provides an overview of the included sequences.

TABLE A

Examples

The disclosure thus generally described will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended to be limiting of the present disclosure. The examples are not intended to indicate that the experiments below are all or only capable of being performed.

Information on the commercial materials used in the examples is provided in table 1. Unless otherwise specified, reagents and other materials used in the experiments are commercially available.

Example 1

Cloning of human PD-1 and PD-L1 extracellular IgV domains

Protein stability was aided by the substitution of the human PD-1(hPD-1) IgV domain encoding gene (residues 32-160, Cys93 for Ser (C93S)²⁸) Cloning into pET-26b vector with a carboxy-terminal 6 × histidine tag yielded plasmid pET-26b-PD1(WT) (SEQ ID NOS: 15 and 22). Briefly, DNA of hPD-1 IgV domain (32-160, C93S) was amplified from plasmid pUC57-Kan-hPD-1 IgV domain (32-160, C93S) by Q5 high fidelity DNA polymerase (NEB, cat. No. M0491) using the following primer pair PD-1 WT-F and PD-1 WT-RCodon optimization and synthesis by GENEWIZ (China, Suzhou) was performed. The PCR product was digested with NdeI-HF and XhoI-HF, and ligated into the precut pET-26b vector using T4 DNA ligase (NEB, Cat. No. M0202L).

PD-1 WT-F:GTTAGACTcatatgTGGAATCCGCCGACCTTTAGC(SEQ ID NO:1)

PD-1 WT-R:ACTGctcgagCGGACTAGGACTCGGATGTGCG(SEQ ID NO:2)

To introduce the TAG codon at position D77 or A129, overlap PCR was performed using Q5 high fidelity DNA polymerase and plasmid pET-26b-PD1(WT) as template using the following primer pairs, respectively. The amplified PCR product was digested with NdeI-HF and XhoI-HF, and ligated to a precut pET-26b vector to obtain plasmid pET-26b-PD-1(D77TAG) or pET-26b-PD-1(A129 TAG).

D77-F1:CCTCATATGTGGAATCCGCCGACCTTTAGC(SEQ ID NO:3)

D77-R1:GGTCTGGTTGCTCGGGCTCATGC(SEQ ID NO:4)

D77-F2:CCCGAGCAACCAGACCTAGAAACTGGCCGCCTTTCC(SEQ ID NO:5)

D77-R2: TTAGCAGCCGGATCTCAGTGGTGG (SEQ ID NO:6) A129-F1 (same as D77-F1) CCTCATATGTGGAATCCGCCGACCTTTAGC (SEQ ID NO:3)

A129-R1:TGCAGGCTAATGGCGCCGCACAGATAG(SEQ ID NO:7)

A129-F2:GGCGCCATTAGCCTGTAGCCGAAAGCCCAGATTAAG(SEQ ID NO:8)

A129-R2 (same as D77-R2) TTAGCAGCCGGATCTCAGTGGTGG (SEQ ID NO:6)

To introduce the TAG codon at position Q75, site-directed mutagenesis was performed on plasmid pET-26b-PD1(WT) using the following primer pair using the Rapid site-directed mutagenesis kit (Tiangen, KM 101).

Q75F:TCGCATGAGCCCGAGCAACAGACCGATAAACTG(SEQ ID NO:9)

Q75R:GTTGCTCGGGCTCATGCGATACCAATTCAG(SEQ ID NO:10)

Plasmid pET-26b-PD-L1(WT) was generated by cloning the gene encoding the IgV domain of human PD-L1 (residues 19-134) into plasmid pET-26 b. Briefly, the hPD-L1 IgV domain (19-134) was amplified from plasmid pUC57-Kan-hPD-L1 IgV domain (19-134) using the following primer pair, which was codon optimized and synthesized by GENEWIZ (China, Suzhou). The PCR product was digested with NdeI-HF and XhoI-HF, and ligated into the precut pET-26b vector.

PD-L1-F:TTCCATATGTTTACCGTTACCGTG(SEQ ID NO:11)

PD-L1-R:GAACTCGAGGTACGGGGCAT(SEQ ID NO:12)

Site-directed mutagenesis was performed on plasmid pET-26b-PD-L1(WT) using the following primer pair and a rapid site-directed mutagenesis kit (Tiangen, KM101) to generate plasmid pET-26b-PD-L1 (H69A).

H69A-F:CATTCAGTTTGTGGCCGGCGAAGAAGATCTG(SEQ ID NO:13)

H69A-R:CAGATCTTCTTCGCCGGCCACAAACTGAATG(SEQ ID NO:14)

Example 2

Expression and purification of human PD-1 IgV Domain and PD-L1 IgV Domain

Plasmids pET-26b-PD1(WT), pET-26b-PD-L1(WT) and pET-26b-PD-L1(H69A) were transformed individually into E.coli BL21(DE3) electrocompetent cells. Plasmids pET-26b-PD-1(Q75TAG), pET-26b-PD-1(D77TAG) or pET-26b-PD-1(A129TAG) are each present with the plasmid pEvol-FSYRS²⁹Co-transformation into E.coli BL21(DE3) electrocompetent cells.

For the expression of PD-1(WT), PD-L1(WT) and PD-L1(H69A), the transformed bacteria were cultured at 37 ℃ in 2XYT medium containing 50. mu.g/mL kanamycin, and when OD was used₆₀₀Induction with 1mM IPTG reached 0.8. For FSY incorporation into proteins, the transformed bacteria were cultured at 37 ℃ in 2XYT medium containing 50. mu.g/mL kanamycin and 34. mu.g/mL chloramphenicol, and when OD was reached₆₀₀Induction was achieved with 1mM IPTG, 0.2% arabinose and 1mM FSY when 0.8 was reached.

After 12 hours of induced expression, bacteria were collected by centrifugation at 7000rpm for 5min at 4 ℃. The cell pellet was resuspended in 10mL lysis buffer (20mM Tris-HCl, pH 8.0,200mM NaCl, 0.5% TritonX-100, lysozyme 1mg/mL, DNase 0.1mg/mL and protease inhibitor) per gram wet weight of bacteria. The cell suspension was lysed by shaking at 4 ℃ for 30 min. Sonication was then performed in an ice-water bath using a sonicator (Fisher Scientific, 30% output, 3min,1 second off, 1 second on). By making thinThe inclusion bodies were recovered from the cell lysate by centrifugation at 20,000g for 20min at 4 ℃ and then resuspended in inclusion body first wash buffer (20mM Tris-HCl, pH 8.0,200mM NaCl,10mM EDTA). The resuspended solution was centrifuged again at 20,000g for 20min at 4 ℃ and resuspended in inclusion body second wash buffer (20mM Tris-HCl, pH 8.0,200mM NaCl). The resuspended solution was then centrifuged at 20,000g for 20min at 4 ℃ and resuspended in inclusion body solubilization buffer (20mM Tris-HCl, pH 8.0,200mM NaCl,8M urea) followed by stirring overnight at 4 ℃. The dissolved fraction was clarified by centrifugation at 30,000g for 30min at 4 ℃. An appropriate volume of Ni-NTA agarose beads (QIAGEN, Cat. No. 30210) was added to the supernatant and incubated at 4 ℃ for 30min with shaking. The mixture was loaded onto the column and washed with 10 column volumes of wash buffer (20mM Tris-HCl, pH 8.0,200mM NaCl,8M Urea, 4mM imidazole). Proteins were eluted with elution buffer (20mM Tris-HCl, pH 8.0,200mM NaCl,8M Urea, 300mM imidazole and diluted to less than 0.1mg/mL with dilution buffer (20mM Tris-HCl, pH 8.0,200mM NaCl,8M Urea.) the diluted protein solution was loaded into dialysis bags (MD44-1500-01, MWCO ═ 1.5kDa) for dialysis and proteins were refolded by gradient reduction of urea concentration (6M, 4M,2M,0M in order) in buffer containing 20mM Tris-HCl, pH 8.0,200mM NaCl at each urea concentration, dialysis was performed by stirring at 4 ℃ for 6 hours³⁰. The refolded protein solution in 0M urea buffer was loaded into ultrafiltration centrifuge tubes (Millipore, catalog No. UFC900324, MWCO ═ 3kDa) for concentration and the buffer was exchanged three times into PBS (pH 7.3) (for cell and animal experiments) or 20mM Tris-HCl, pH 8.0,200mM NaCl (for in vitro protein cross-linking experiments).

Protein concentration was measured by nanodrop (thermo fisher) based on the molecular weight and extinction coefficient of the protein. For PD-1(WT), the molecular weight is 15.57kDa and the extinction coefficient is 14.11. For PD-L1(WT), the molecular weight was 14.41kDa and the extinction coefficient was 17.55. Refolded proteins were stored at-80 ℃.

Results

Generation of FSY-incorporated PD-1 by genetic code expansion techniques

The potential bioresponse Uaa can be extended by means of the genetic codeGenetically incorporated into proteins that specifically react with proximal target natural amino acid residues^8,10. In particular, potentially biologically reactive Uaa FSY is not toxic to cells and remains inert after incorporation into proteins⁹. FSY is able to react with the proximal native amino acid residues Tyr, His and Lys by click chemistry sulfur-fluoride exchange (SuFEx) (fig. 2A). The inventors conclude that the introduction of such potentially biologically reactive Uaa into a protein drug at the binding interface will enable the protein drug to covalently bind to its target. The PD-1/PD-L1 immune checkpoint was chosen to test this idea. PD-1 is a transmembrane receptor that regulates T cell activity. PD-L1 is a ligand for PD-1 and is usually overexpressed in different tumors¹¹. The PD-1/PD-L1 interaction inhibits T-lymphocyte proliferation, cytokine release and cytotoxicity, leading to exhaustion and apoptosis of tumor-specific T cells^12,13. Thus, blocking the PD-1/PD-L1 interaction can reverse the hindered anti-tumor immune response, and several monoclonal antibodies have been generated to target the PD-1/PD-L1 axis to treat cancer^14,15,16,17. However, antibodies have inherent limitations, including poor tissue/tumor penetration and adverse Fc-effector function (depleting immune cells), and for each cancer tested, a certain percentage of patients do not respond to existing PD-1/PD-L1 antibody treatments^18,19. Thus, alternative non-antibody therapeutics with smaller molecular weights are sought^20,21. For example, the extracellular domain of PD-1 has been engineered to have high affinity for PD-L1 and to act as a competitive antagonist of PD-L1^19,22. These high affinity PD-1 antagonists only show juxtapose results in syngeneic mouse models and require additional Ig domains for in vivo half-life and efficacy. The use of FSY will form a covalent bond between PD-1 and PD-L1, forming an irreversible antagonist with a very large affinity that cannot be achieved with any high affinity mutants evolved by natural amino acid mutagenesis.

Crystal structure based on human PD-1/PD-L1 complex²³The inventors decided to incorporate Gln75, Asp77 or Ala129 at PD-1 aloneFSY, targeted Lys124, Lys124 and His69 of PD-L1, respectively (fig. 2B). Expression of PD-1 Gene comprising an amber stop codon (TAG) introduced at the desired site in E.coli cells with a tRNA for orthogonality^PylGenes of the/FSYRS pair, incorporating FSY into the extracellular domain of human PD-1, for orthogonal tRNA^PylThe genes of the/FSYRS pair were evolved to incorporate FSY in response to TAG codon⁹. The PD-1 mutein was purified and refolded using affinity chromatography (fig. 2C, 2D). Mass spectrometric analysis of the mutant proteins confirmed the incorporation of FSY into PD-1 at the TAG-designated position with high fidelity (FIG. 2E).

Example 3

Cross-linking of PD-1(FSY) with PD-L1

3.1 in vitro crosslinking of PD-1(FSY) with PD-L1

Purified and refolded PD-1(WT), PD-1(Q75FSY), PD-1(D77FSY) or PD-1(A129FSY) was incubated with PD-L1(WT) or PD-L1(H69A) in PBS buffer at a molar ratio of 1:1 at 37 ℃ for 6 hours. The amount of PD-L1 was 4. mu.g. After incubation, 5 × reducing loading buffer (CWBio, catalog No. CW0027) was added to the incubation and heated at 100 ℃ for 10 min. These samples were then separated by 15% SDS-PAGE gels followed by staining with Coomassie Brilliant blue. Western blotting was then performed using primary antibody specific for the His6x tag (mAb anti-6 XHis tag, Abcam, cat # 18184,1:1000 dilution) and secondary antibody goat pAb anti-mouse IgG (Abcam, cat # 97023,1:5000 dilution). Protein bands were visualized by chemiluminescence (Bio-rad, cat # 1705062).

3.2 Mass Spectrometry

PD-1(FSY) and PD-1(FSY)/PD-L1 crosslinked protein samples were digested with trypsin. The digested peptides were analyzed using a built-in EASY-spray source and a nano-LC UltiMate 3000 high performance liquid chromatography system (Thermo Fisher) connected to an Elite mass spectrometer (Thermo Fisher). EASY-spray PepMap C18 column (50 cm; particle size, 2 μm; pore size,

thermo Fisher) was used with 2% -40% buffer B (80% acetonitrile, 20% H)₂O, 0.1% formic acid) was separated at a flow rate of 300nL/minA peptide. Eluted peptides were detected by an Elite mass spectrometer, which was run in data-dependent mode with an R-60,000 (m/z-200) mass range (AGC target 1 × 10) from 375 to 1800⁶) One full MS scan is performed followed by 10 CID MS/MS scans. Singly charged ions were excluded using a dynamic exclusion time of 30 seconds. The raw data of the mass spectrum is searched by Maxquant.

3.3 Cross-linking of PD-1(FSY) to endogenous PD-L1 expressed on the cell surface

H460 cells (5X 10)⁵One from CAS Cell Bank, catalog number SCSP-584) and U-87 cells (5X 10)⁵One, purchased from CAS Cell Bank, catalog number TCTU 138) was seeded in 6-well plates and treated with RPMI-1640[ + 10% FBS (Gibco, catalog number 10099-]Or DMEM (+ 10% FBS and 1:100 penicillin-streptomycin). After 6 hours, PD-1(WT) or PD-1(FSY) was added to the medium in a final volume of 800. mu.L. After incubation at 37 ℃ for 12 hours, the cells were dissociated with 0.25% trypsin-EDTA (Gibco, Cat. No. 25200-056), collected, and lysed by addition of 100. mu.L of RIPA (Beyotime, Cat. No. P0013C) containing a1 Xprotease inhibitor cocktail (Cell Signaling Technology, Cat. No. 5872), followed by sonication. Protein concentration was quantified using the BCA protein assay kit (Beyotime, catalog No. P0010). The sample was then heated at 100 ℃ for 10min after adding 5x reduction loading buffer (CWBio, catalog No. CW 0027). Denatured samples were analyzed by electrophoresis in 12% SDS-PAGE followed by Western blotting using primary anti-human PD-L1(Abcam, cat # ab 213524; 1:1000) and internal standard anti-beta-actin (Abcam, cat # ab 179467; 1:3000) and secondary anti-rabbit IgG (Cell Signaling Technology, cat # 7074S; 1: 3000). Protein bands were visualized by chemiluminescence (Bio-rad, cat # 1705062).

To test whether PD-1(FSY) could cross-link with endogenous mouse PD-L1, thymus and spleen were isolated from BALB/C mice and then ground by syringe. The cells obtained were resuspended in DPBS, filtered through a 40 μm filter (Corning, catalog No. 352340) and centrifuged. These single cells (1X 10)⁶One) were inoculated into 6-well plates and plated in a medium containing 10% FBS (Gibco, Cat. No. 10099-14)1) And 1:100 penicillin-streptomycin (Gibco, Cat. No. 15140-122) in RPMI-1640. PBS, PD-1(WT) or PD-1(FSY) was added to the wells at a final volume of 800. mu.L. After 12 hours of incubation, cells were harvested for western blot analysis using a procedure similar to that described above for H460 and U-87 cells. The primary antibody was anti-mouse PD-L1(Proteintech, Cat. No. 66248-1-Ig; 1:2000) and the secondary antibody was anti-mouse IgG (CST, Cat. No. 7076S; 1: 3000). Primary anti- β -actin antibodies (Abcam, cat # ab179467,1:3000) and secondary anti-rabbit IgG (Cell Signaling Technology, cat # 7074S,1:3000) were used to detect β -actin as an internal standard.

3.4 Cross-linking of PD-1(FSY) to endogenous PD-L1 in tumor tissue in vivo

All animal studies were approved by the institutional animal care and use committee. H460 or U-87 cells (2X 10)⁶Individually) resuspended with 200. mu.L DPBS and injected separately into 6-8 week old male M-NSG mice (NOD-Prkdc)^-/--IL2rg^-/YShanghai Model organization, China, catalog No. NM-NSG-001). After 10 days, the tumor size was about 4X4mm². PD-1(WT) or PD-1(FSY) is injected via tail vein or into the skin site near the tumor. After 3 hours, the mice were sacrificed and the tumors were collected. To the tumor was added 200 μ L RIPA (Beyotime, cat # P0013C) containing a 1x protease inhibitor cocktail (Cell Signaling Technology, cat # 5872), disrupted by a homogenizer (LUKACEXUYIQI, cat # LUKYM-I), and lysed by sonication. Western blotting was then performed using the same procedure as described in section 3.3.

Results

Covalent binding of PD-1 to PD-L1 by proximity-enabled reaction of FSY

To test whether FSY-incorporated PD-1 could covalently bind to human PD-L1 in vitro, the inventors incubated FSY-containing PD-1 mutant proteins with PD-L1 protein in buffer at 37 ℃ followed by analysis using SDS-PAGE and western blot (fig. 3A). The extracellular domain of WT human PD-1 (hereinafter PD-1(WT)) was purified and included as a control, which did not form a covalent complex with PD-L1 under denaturing assay conditions. A stable covalent complex of PD-1/PD-L1 was tested for PD-1(Q75FSY) and PD-1(A129FSY), with PD-1(A129FSY) showing a higher crosslinking efficiency (45. + -. 5%). PD-1(A129FSY) is hereinafter referred to as PD-1(FSY) for the sake of simplicity. To verify whether PD-1(FSY) covalently targets the proximal His69 of human PD-L1, the inventors generated a PD-L1(H69A) mutant in which His69 was mutated to Ala and found that it did not form a covalent complex with PD-1(FSY) (fig. 3B). In addition, the inventors analyzed the incubation product of PD-1(FSY) with PD-L1 using high resolution mass spectrometry, clearly indicating that FSY of PD-1 reacts specifically with His69 of PD-L1 (fig. 3C).

The inventors next tested whether PD-1(FSY) could covalently bind to human PD-L1, which is physiologically expressed on the surface of living cancer cells. PD-1(FSY) was incubated with H460 cells (human large cell lung cancer cell line) or U87 cells (human primary glioblastoma cell line), both of which express PD-L1 on the cell surface. After incubation, cells were lysed and the lysate analyzed using western blot (fig. 3D). As expected, PD-1(WT) was not cross-linked with PD-L1, whereas PD-1(FSY) was covalently cross-linked with endogenous full-length PD-L1 on both cancer cells, and the cross-linking efficiency increased with increasing concentration of PD-1(FSY) applied.

The inventors further tested whether PD-1(FSY) could covalently cross-link with human PD-L1 in tumor tissue in vivo. The inventors have used H460 and U87 cell transplantation to form immunodeficient NOD Scid Gamma (NSG) mice with these tumors. When the tumor size reached 4x4mm²PD-1(WT) or PD-1(FSY) is delivered by tail vein injection or by paraneoplastic injection. After 3 hours, tumors were collected for western blot analysis. As shown in fig. 3E, PD-1(WT) also did not produce any cross-linking with PD-L1, whereas PD-1(FSY) apparently cross-linked covalently with PD-L1 in both tumors and by both injection methods, the cross-linking efficiency increased with increasing dose of injected PD-1 (FSY).

It is known that human PD-1 cross-binds to mouse PD-L1²². The inventors therefore tested whether human PD-1(FSY) of the invention could covalently cross-link with mouse PD-L1 on the surface of mouse cells. Immune cells from mouse thymus and spleen were dissociated and incubated with PD-1(WT) and PD-1 (FSY). In the incubation andafter western blot analysis using a similar procedure, no covalent cross-linking of PD-1(FSY) to mouse PD-L1 was detected (fig. 4A). Homology ratios of human and mouse PD-L1 amino acid sequences indicate that the target His69 of human PD-L1 corresponds to Ala69 of mouse PD-L1 (FIG. 4B)²⁴It cannot react with FSY by proximity enabling reaction⁹. This high selectivity not only suggests that high target specificity can be achieved through proximity-enabling reaction strategies, but also suggests that off-target effects of covalent protein drugs allowed by proximity-enabling reactions should be low.

Taken together, these results indicate that PD-1(FSY) and PD-L1 are covalently bound by reaction of 129FSY of PD-1 with His69 of PD-L1. The covalent binding occurs efficiently on proteins purified in vitro, on the surface of cancer cells in cell culture, and on tumor tissue in mice in vivo.

Example 4

Mixed Lymphocyte Reaction (MLR)

Fresh PBMC were isolated from peripheral blood of healthy donors by gradient centrifugation on Ficoll (GE Healthcare, Cat. No. 17-5442-02). Monocytes were enriched from PBMC using CD14 microbeads (Miltenyi, catalog No. 130-050-201). Purified CD14⁺Monocytes were cultured in RPMI-1640 containing 10% FBS (Gibco, Cat. No. 10099-141), 1:100 penicillin-streptomycin (Gibco, Cat. No. 15140-122), 100ng/mL GM-CSF (Peprotech, Cat. No. 300-03), and 50ng/mL IL-4(Peprotech, Cat. No. 200-04) to induce DC differentiation. Fresh medium was added every 3 days. On day 6, 100ng/mL TNF-. alpha. (Peprotech, Cat. No. 300-01A) and 3. mu.g/mL LPS (Sigma, Cat. No. L4391) were added to the medium to induce DC maturation. After 48 hours, the cells were passed through a flow cytometer (BD LSRFortessa)^TM) CD11c (BD Pharmingen, catalog No. 555392), PD-L1(BD Pharmingen, catalog No. 558065), CD86(BD Horizon, catalog No. 562999), CD83(BD Pharmingen, catalog No. 561132), and HLA-DR (BD Pharmingen, catalog No. 560652) expressed on DCs were examined.

For allogeneic DC-T cell stimulation, CD3 was enriched from allogeneic PBMCs of healthy donors by CD3 microbeads (Miltenyi, Cat. No. 130-097-043)⁺T cells. CD3⁺T cells (1X 10)⁷One) was labeled with 2 μ M CFSE in 1mL PBS (eBioscience, Cat. No. 65-0850-84) for 15min at 37 ℃; the labeling was stopped by adding 3mL of cold FBS, then washed twice with cold PBS.

Mature DCs were seeded in 96-well round bottom plates. PBS, PD-1 or Attributab (CrownBio, Cat. No. E4543-T1901) was added to the wells. After 2 hours, CFSE-labeled T cells (1X 10)⁵One) was added to the wells and co-cultured with allogeneic DCs for 5 days. On day 3, each well was supplemented with 30 μ L of fresh medium. After 5 days, cells were harvested, stained with anti-human CD3(BD Pharmingen, cat # 561812), examined for T cell proliferation using flow cytometry and CD3⁺T cells were gated. Culture supernatants were harvested and INF-. gamma.concentration was measured using ELISA kit (Invitrogen, Cat. No. 88-7316-76). Flow cytometry data was analyzed using the software Flowjo _ V10.

Results

PD-1(FSY) in vitro enhancement of T cell activation

To examine whether PD-1(FSY) could enhance T cell activation by blocking the PD-1/PD-L1 interaction, the inventors performed an in vitro allogeneic Mixed Lymphocyte Reaction (MLR). Mature Dendritic Cells (DCs) were derived from monocytes isolated from human Peripheral Blood Mononuclear Cells (PBMCs) of healthy donors and PD-L1 expression and DC maturation was confirmed by flow cytometry (fig. S1). Mature DCs were treated with PD-1(FSY), PD-1(WT) or Attributab (FDA-approved anti-PD-L1 monoclonal antibody for cancer therapy) alone²⁵Treatment for 2 hours, then with allogeneic CD3 purified from peripheral blood of healthy donors and pre-stained with carboxyfluorescein succinimidyl ester (CFSE) dye for monitoring T cell proliferation⁺T cell co-culture. After 5 days of co-culture, CFSE positive CD3 was analyzed using flow cytometry⁺T cells (fig. 5A). Co-culture with DCs increased T cell proliferation by CFSE intensity lower than that of the parental population (CFSE positive cells) as shown in PBS control^low) Increase indication (fig. 5B, fig. S2). PD-1(WT) did not increase T cell proliferation at concentrations of 50nM and 250nM, compared to the PBS control. In contrast, PD-1(FSY) caused a significant dose-dependent enhancement of T cell proliferation at both concentrations.The T cell activation effect of PD-1(FSY) was comparable to that of altlizumab applied at the same molar concentration.

As another indicator of T cell activation, cytokine interferon gamma (INF- γ) released by T cells in culture was measured using ELISA (fig. 5C). PD-1(WT) did not increase INF- γ production at a concentration of 50nM, with a moderate increase (0.77-fold) at 250nM compared to PBS control. In contrast, PD-1(FSY) caused a significant increase (3.4-fold) in INF- γ production at a concentration of 50nM and a further increase to 4.1-fold at 250 nM. PD-1(FSY) also had an effect on INF- γ comparable to that of astuzumab. These results indicate that PD-1(FSY) can significantly enhance T cell activation induced by allogeneic DCs by blocking the interaction of PD-1 with PD-L1, whereas PD-1(WT) cannot.

Example 5

PBMC-tumor xenograft model study

On day-10, fresh PBMCs were activated with 3. mu.g/mL anti-CD 3 antibody (BD pharmingen, cat # 555329) and 1. mu.g/mL anti-CD 28 antibody (BD pharmingen, cat # 555725) coated in 12-well plates and cultured in RPMI-1640 containing 10% FBS, 1:100 penicillin-streptomycin (Gibco, cat # 15140-122), 100IU/mL IL-2(PeproTech, cat # AF-200-02-500), and 2mM glutamine (Gibco, cat # 25030-081). On day-7, 5X10⁵Individual H460 cells were seeded into 6-well plates. After 6 hours, H460 cells were treated with mitomycin C (10. mu.g/mL) for 2 hours and then washed twice with PBS. Activated PBMC (5X 10) were then added to these H460 cells⁶Individual) were co-cultured (PBMC: H460 ═ 10: 1). PBMCs were harvested every 2 days and re-cultured with H460 cells treated with mitomycin C (10. mu.g/mL). After 3 co-cultures PBMC were harvested and compared to fresh H460 cells at a ratio of 1:4 (H460 ═ 2 × 10)⁶PBMC 5x10⁵One) are mixed. The cell mixture was injected into 6-8 week old male M-NSG mice (NOD-Prkdc)^-/--IL2rg^-/YShanghai Model organization, China, catalog No. NM-NSG-001). PBS, 22. mu.g PD-1(WT), 22. mu.g PD-1(FSY) or 200. mu.g attrituximab were administered by tail vein injection after 3 hours and every 6 days (on days 6, 12, 18, 24, 30, 36, 42). After 3 hours and every 3 days (at 3, 6, 9, 1)2. 15, 18, 21, 24, 27, 30, 33, 36, 39, 42 days) 11 μ g PD-1(FSY) or 100 μ g atuzumab was administered by tail vein injection. Tumor growth was measured in two dimensions using a vernier caliper and tumor volume was calculated using the following formula: tumor volume-length x width²/2. On day 44, the tumor length was approximately 15mm and the mice were sacrificed for analysis.

Statistical analyses of CFSE proliferation assay, CD69 expression, T cell infiltration in tumor tissues (flow cytometry data), ELISA data, and tumor weight data were compared by one-way ANOVA using Prism 6.0(GraphPad software), followed by Tukey multiple comparison test. Tumor growth data were compared by two-way ANOVA using Prism 6.0(GraphPad software), followed by Tukey multiple comparison test.

Results

Antitumor Effect of PD-1(FSY) in a tumor xenograft model reconstituted with human PBMC

In view of the ability of PD-1(FSY) to irreversibly bind to PD-L1 and promote T cell activation in vitro, the present inventors attempted to evaluate its anti-tumor activity in vivo. Since PD-1(FSY) is covalently specific to human PD-L1 but not to murine PD-L1, the present inventors did not use syngeneic immunocompetent mouse models, but instead resorted to immunodeficient mouse models reconstituted with human immune cells, which are more predictive preclinical models for cancer immunotherapy²⁶. In contrast, both previously reported high affinity mutants of human PD-1 cross-bind to mouse PD-L1, and their anti-tumor effects were evaluated only for inhibition of mouse PD-L1 in a mouse model with a fully murine immune system^19,22。

The present inventors co-transplanted immunodeficient NSG mice with a mixture of human tumor H460 cells and human PBMCs. Human PBMCs were activated with anti-CD 3 and CD28 antibodies for 3 days and then co-cultured with H460 cells for 7 days (fig. 6A). Mixtures of these PBMCs and H460 (ratio 1:4) were injected subcutaneously into the flank of immunodeficient NSG mice. PD-1 protein or atlizumab was then administered by tail intravenous injection every 3 days (low dose) or every 6 days (high dose). Tumor growth was monitored for 44 days. As expected, tumors of vehicle-treated mice (PBS control) grew rapidly. Treatment with 22 μ g PD-1(WT) delayed tumor growth to some extent, while treatment with 22 μ g PD-1(FSY) significantly inhibited tumor growth (P <0.0001) (fig. 6B,6C) for the entire 44 days. Reducing the dose of PD-1(FSY) to 11. mu.g maintained a similar tumor suppression effect with 22. mu.g. In fact, PD-1(FSY) achieved the same anti-tumor effect as alemtuzumab administered in the same molar amount, whereas the required mass of PD-1(FSY) was one tenth of that of alemtuzumab. Tumors excised at day 44 are shown in fig. 6D, and their weights are compared in fig. 6E. PD-1(FSY) -treated tumors were significantly smaller in weight than those treated with PD-1(WT) (P <0.001) and comparable to those treated with atuzumab.

It will be further understood by those skilled in the art that the present disclosure may be embodied in other specific forms without departing from the spirit or central attributes thereof. Since the foregoing description of the present disclosure discloses only exemplary embodiments thereof, it is to be understood that other variations are considered to be within the scope of the present disclosure. Accordingly, the present disclosure is not limited to the particular embodiments that have been described in detail herein. Rather, reference should be made to the appended claims as an indication of the scope and content of the present disclosure.

Reference to the literature

(1)Singh,J.；Petter,R.C.；Baillie,T.A.；Whitty,A.The Resurgence of Covalent Drugs.Nat.Rev.Drug Discov.2011,10(4),307–317.

(2)Bauer,R.A.Covalent Inhibitors in Drug Discovery:From Accidental Discoveries to Avoided Liabilities and Designed Therapies.Drug Discovery Today 2015,20(9),1061–1073.

(3)Lonsdale,R.；Ward,R.A.Structure-Based Design of Targeted Covalent Inhibitors.Chem.Soc.Rev.2018,47(11),3816–3830.

(4)Johnson,D.S.；Weerapana,E.；Cravatt,B.F.Strategies for Discovering and Derisking Covalent,Irreversible Enzyme Inhibitors.Future Med Chem 2010,2(6),949–964.

(5)Robertson,J.G.Mechanistic Basis of Enzyme-Targeted Drugs.Biochemistry 2005,44(15),5561–5571.

(6)Wang,L.；Brock,A.；Herberich,B.；Schultz,P.G.Expanding the Genetic Code of Escherichia Coli.Science 2001,292(5516),498–500.

(7)Wang,L.；Schultz,P.G.Expanding the Genetic Code.Angew.Chem.Int.Ed.2004,44(1),34–66.

(8)Xiang,Z.；Ren,H.；Hu,Y.S.；Coin,I.；Wei,J.；Cang,H.；Wang,L.Adding an Unnatural Covalent Bond to Proteins Through Proximity-Enhanced Bioreactivity.Nat.Methods 2013,10(9),885–888.

(9)Wang,N.；Yang,B.；Fu,C.；Zhu,H.；Zheng,F.；Kobayashi,T.；Liu,J.；Li,S.；Ma,C.；Wang,P.G.；Wang,Q.；Wang,L.Genetically Encoding Fluorosulfate-L-Tyrosine to React with Lysine,Histidine,and Tyrosine via SuFEx in Proteins in Vivo.J.Am.Chem.Soc.2018,140(15),4995–4999.

(10)Wang,L.Genetically Encoding New Bioreactivity.N.Biotechnol.2017,38(Pt A),16–25.

(11)Okazaki,T.；Honjo,T.PD-1 and PD-1 Ligands:From Discovery to Clinical Application.Int.Immunol.2007,19(7),813–824.

(12)Francisco,L.M.；Sage,P.T.；Sharpe,A.H.The PD-1 Pathway in Tolerance and Autoimmunity.Immunol.Rev.2010,236,219–242.

(13)Sharpe,A.H.；Pauken,K.E.The Diverse Functions of the PD1 Inhibitory Pathway.Nat.Rev.Immunol.2018,18(3),153–167.

(14)Sharma,P.；Allison,J.P.The Future of Immune Checkpoint Therapy.Science 2015,348(6230),56–61.

(15)Rosenberg,J.E.；Hoffman-Censits,J.；Powles,T.；van der Heijden,M.S.；Balar,A.V.；Necchi,A.；Dawson,N.；O'Donnell,P.H.；Balmanoukian,A.；Loriot,Y.；Srinivas,S.；Retz,M.M.；Grivas,P.；Joseph,R.W.；Galsky,M.D.；Fleming,M.T.；Petrylak,D.P.；Perez-Gracia,J.L.；Burris,H.A.；Castellano,D.；Canil,C.；Bellmunt,J.；Bajorin,D.；Nickles,D.；Bourgon,R.；Frampton,G.M.；Cui,N.；Mariathasan,S.；Abidoye,O.；Fine,G.D.；Dreicer,R.Atezolizumab in Patients with Locally Advanced and Metastatic Urothelial Carcinoma Who Have Progressed Following Treatment with Platinum-Based Chemotherapy:a Single-Arm,Multicentre,Phase 2 Trial.Lancet 2016,387(10031),1909–1920.

(16)Syed,Y.Y.Durvalumab:First Global Approval.Drugs 2017,77(12),1369–1376.

(17)Kaufman,H.L.；Russell,J.；Hamid,O.；Bhatia,S.；Terheyden,P.；D'Angelo,S.P.；Shih,K.C.；Lebbé,C.；Linette,G.P.；Milella,M.；Brownell,I.；Lewis,K.D.；Lorch,J.H.；Chin,K.；Mahnke,L.；Heydebreck,von,A.；Cuillerot,J.-M.；Nghiem,P.Avelumab in Patients with Chemotherapy-Refractory Metastatic Merkel Cell Carcinoma:a Multicentre,Single-Group,Open-Label,Phase 2 Trial.Lancet Oncol.2016,17(10),1374–1385.

(18)Lee,C.M.；Tannock,I.F.The Distribution of the Therapeutic Monoclonal Antibodies Cetuximab and Trastuzumab Within Solid Tumors.BMC Cancer 2010,10(1),–11.

(19)Maute,R.L.；Gordon,S.R.；Mayer,A.T.；McCracken,M.N.；Natarajan,A.；Ring,N.G.；Kimura,R.；Tsai,J.M.；Manglik,A.；Kruse,A.C.；Gambhir,S.S.；Weissman,I.L.；Ring,A.M.Engineering High-Affinity PD-1 Variants for Optimized Immunotherapy and Immuno-PET Imaging.Proc.Natl.Acad.Sci.U.S.A.2015,112(47),E6506–E6514.

(20)Li,C.；Zhang,N.；Zhou,J.；Ding,C.；Jin,Y.；Cui,X.；Pu,K.；Zhu,Y.Peptide Blocking of PD-1/PD-L1 Interaction for Cancer Immunotherapy.Cancer Immunology Research 2018,6(2),178–188.

(21)Zarganes-Tzitzikas,T.；Konstantinidou,M.；Gao,Y.；Krzemien,D.；Zak,K.；Dubin,G.；Holak,T.A.；

A.Inhibitors of Programmed Cell Death 1(PD-1):a Patent Review(2010-2015).Expert Opin Ther Pat 2016,26(9),973–977.

(22)Lázár-Molnár,E.；Scandiuzzi,L.；Basu,I.；Quinn,T.；Sylvestre,E.；Palmieri,E.；Ramagopal,U.A.；Nathenson,S.G.；Guha,C.；Almo,S.C.Structure-Guided Development of a High-Affinity Human Programmed Cell Death-1:Implications for Tumor Immunotherapy.EBioMedicine 2017,17,30–44.

(23)Zak,K.M.；Kitel,R.；Przetocka,S.；Golik,P.；Guzik,K.；Musielak,B.；

A.；Dubin,G.；Holak,T.A.Structure of the Complex of Human Programmed Death 1,PD-1,and Its Ligand PD-L1.Structure 2015,23(12),2341–2348.

(24)Tan,S.；Chen,D.；Liu,K.；He,M.；Song,H.；Shi,Y.；Liu,J.；Zhang,C.W.H.；Qi,J.；Yan,J.；Gao,S.；Gao,G.F.Crystal Clear:Visualizing the Intervention Mechanism of the PD-1/PD-L1 Interaction by Two Cancer Therapeutic Monoclonal Antibodies.Protein Cell 2016,7(12),866–877.

(25)Akinleye,A.；Rasool,Z.Immune Checkpoint Inhibitors of PD-L1 as Cancer Therapeutics.J Hematol Oncol 2019,12(1),–13.

(26)La Rochere,De,P.；Guil-Luna,S.；Decaudin,D.；Azar,G.；Sidhu,S.S.；Piaggio,E.Humanized Mice for the Study of Immuno-Oncology.Trends in Immunology 2018,39(9),748–763.

(27)Xuan,W.；Shao,S.；Schultz,P.G.Protein Crosslinking by Genetically Encoded Noncanonical Amino Acids with Reactive Aryl Carbamate Side Chains.Angew.Chem.Int.Ed.Engl.2017,56(18),5096–5100.

(28)Zak,K.M.；Kitel,R.；Przetocka,S.；Golik,P.；Guzik,K.；Musielak,B.；

A.；Dubin,G.；Holak,T.A.Structure of the Complex of Human Programmed Death 1,PD-1,and Its Ligand PD-L1.Structure 2015,23(12),2341–2348.

(29)Wang,N.；Yang,B.；Fu,C.；Zhu,H.；Zheng,F.；Kobayashi,T.；Liu,J.；Li,S.；Ma,C.；Wang,P.G.；Wang,Q.；Wang,L.Genetically Encoding Fluorosulfate-L-Tyrosine to React with Lysine,Histidine,and Tyrosine via SuFEx in Proteins in Vivo.J.Am.Chem.Soc.2018,140(15),4995–4999.

(30)Lee,J.Y.；Lee,H.T.；Shin,W.；Chae,J.；Choi,J.；Kim,S.H.；Lim,H.；Won Heo,T.；Park,K.Y.；Lee,Y.J.；Ryu,S.E.；Son,J.Y.；Lee,J.U.；Heo,Y.-S.Structural Basis of Checkpoint Blockade by Monoclonal Antibodies in Cancer Immunotherapy.Nat.Commun.2016,7,13354。

Sequence listing

<110> Hangzhou institute of physical and chemical technology of Chinese academy of sciences

<120> covalent protein drugs developed by proximity enabling response therapy

<130> IDC216008

<160> 21

<170> PatentIn version 3.5

<210> 1

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 1

gttagactca tatgtggaat ccgccgacct ttagc 35

<210> 2

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 2

actgctcgag cggactagga ctcggatgtg cg 32

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 3

cctcatatgt ggaatccgcc gacctttagc 30

<210> 4

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 4

ggtctggttg ctcgggctca tgc 23

<210> 5

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 5

cccgagcaac cagacctaga aactggccgc ctttcc 36

<210> 6

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 6

ttagcagccg gatctcagtg gtgg 24

<210> 7

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 7

tgcaggctaa tggcgccgca cagatag 27

<210> 8

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 8

ggcgccatta gcctgtagcc gaaagcccag attaag 36

<210> 9

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 9

tcgcatgagc ccgagcaaca gaccgataaa ctg 33

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 10

gttgctcggg ctcatgcgat accaattcag 30

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 11

ttccatatgt ttaccgttac cgtg 24

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 12

gaactcgagg tacggggcat 20

<210> 13

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 13

cattcagttt gtggccggcg aagaagatct g 31

<210> 14

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 14

cagatcttct tcgccggcca caaactgaat g 31

<210> 15

<211> 138

<212> PRT

<213> Artificial sequence

<220>

<223> amino acid sequence of PD-1(WT)

<400> 15

Met Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu

1 5 10 15

Gly Asp Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser

20 25 30

Phe Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys

35 40 45

Leu Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Ser Arg

50 55 60

Phe Arg Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val

65 70 75 80

Val Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile

85 90 95

Ser Leu Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu

100 105 110

Arg Val Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro

115 120 125

Ser Pro Leu Glu His His His His His His

130 135

<210> 16

<211> 417

<212> DNA

<213> Artificial sequence

<220>

<223> PD-1 Gene comprising amber stop codon (75TAG)

<400> 16

atgtggaatc cgccgacctt tagcccggcc ctgctggttg ttaccgaggg tgataatgcc 60

accttcacct gcagcttcag caacaccagc gagagcttcg tgctgaattg gtatcgcatg 120

agcccgagca actagaccga taaactggcc gcctttccgg aagatcgtag ccagccgggc 180

caggatagcc gctttcgtgt tacccagctg ccgaacggtc gcgattttca catgagcgtg 240

gtgcgcgccc gccgtaatga tagcggtacc tatctgtgcg gcgccattag cctggcaccg 300

aaagcccaga ttaaggaaag cctgcgcgca gaactgcgcg tgaccgaacg tcgcgcagaa 360

gtgccgaccg cacatccgag tcctagtccg ctcgagcacc accaccacca ccactga 417

<210> 17

<211> 417

<212> DNA

<213> Artificial sequence

<220>

<223> PD-1 Gene comprising amber stop codon (77TAG)

<400> 17

atgtggaatc cgccgacctt tagcccggcc ctgctggttg ttaccgaggg tgataatgcc 60

accttcacct gcagcttcag caacaccagc gagagcttcg tgctgaattg gtatcgcatg 120

agcccgagca accagaccta gaaactggcc gcctttccgg aagatcgtag ccagccgggc 180

caggatagcc gctttcgtgt tacccagctg ccgaacggtc gcgattttca catgagcgtg 240

gtgcgcgccc gccgtaatga tagcggtacc tatctgtgcg gcgccattag cctggcaccg 300

aaagcccaga ttaaggaaag cctgcgcgca gaactgcgcg tgaccgaacg tcgcgcagaa 360

gtgccgaccg cacatccgag tcctagtccg ctcgagcacc accaccacca ccactga 417

<210> 18

<211> 417

<212> DNA

<213> Artificial sequence

<220>

<223> PD-1 Gene comprising amber stop codon (129TAG)

<400> 18

atgtggaatc cgccgacctt tagcccggcc ctgctggttg ttaccgaggg tgataatgcc 60

accttcacct gcagcttcag caacaccagc gagagcttcg tgctgaattg gtatcgcatg 120

agcccgagca accagaccga taaactggcc gcctttccgg aagatcgtag ccagccgggc 180

caggatagcc gctttcgtgt tacccagctg ccgaacggtc gcgattttca catgagcgtg 240

gtgcgcgccc gccgtaatga tagcggtacc tatctgtgcg gcgccattag cctgtagccg 300

aaagcccaga ttaaggaaag cctgcgcgca gaactgcgcg tgaccgaacg tcgcgcagaa 360

gtgccgaccg cacatccgag tcctagtccg ctcgagcacc accaccacca ccactga 417

<210> 19

<211> 72

<212> DNA

<213> Artificial sequence

<220>

<223> tRNAPyl

<400> 19

ggaaacctga tcatgtagat cgaacggact ctaaatccgt tcagccgggt tagattcccg 60

gggtttccgc ca 72

<210> 20

<211> 454

<212> PRT

<213> Artificial sequence

<220>

<223> amino acid sequence of FSYRS

<400> 20

Met Asp Lys Lys Pro Leu Asn Thr Leu Ile Ser Ala Thr Gly Leu Trp

1 5 10 15

Met Ser Arg Thr Gly Thr Ile His Lys Ile Lys His His Glu Val Ser

20 25 30

Arg Ser Lys Ile Tyr Ile Glu Met Ala Cys Gly Asp His Leu Val Val

35 40 45

Asn Asn Ser Arg Ser Ser Arg Thr Ala Arg Ala Leu Arg His His Lys

50 55 60

Tyr Arg Lys Thr Cys Lys Arg Cys Arg Val Ser Asp Glu Asp Leu Asn

65 70 75 80

Lys Phe Leu Thr Lys Ala Asn Glu Asp Gln Thr Ser Val Lys Val Lys

85 90 95

Val Val Ser Ala Pro Thr Arg Thr Lys Lys Ala Met Pro Lys Ser Val

100 105 110

Ala Arg Ala Pro Lys Pro Leu Glu Asn Thr Glu Ala Ala Gln Ala Gln

115 120 125

Pro Ser Gly Ser Lys Phe Ser Pro Ala Ile Pro Val Ser Thr Gln Glu

130 135 140

Ser Val Ser Val Pro Ala Ser Val Ser Thr Ser Ile Ser Ser Ile Ser

145 150 155 160

Thr Gly Ala Thr Ala Ser Ala Leu Val Lys Gly Asn Thr Asn Pro Ile

165 170 175

Thr Ser Met Ser Ala Pro Val Gln Ala Ser Ala Pro Ala Leu Thr Lys

180 185 190

Ser Gln Thr Asp Arg Leu Glu Val Leu Leu Asn Pro Lys Asp Glu Ile

195 200 205

Ser Leu Asn Ser Gly Lys Pro Phe Arg Glu Leu Glu Ser Glu Leu Leu

210 215 220

Ser Arg Arg Lys Lys Asp Leu Gln Gln Ile Tyr Ala Glu Glu Arg Glu

225 230 235 240

Asn Tyr Leu Gly Lys Leu Glu Arg Glu Ile Thr Arg Phe Phe Val Asp

245 250 255

Arg Gly Phe Leu Glu Ile Lys Ser Pro Ile Leu Ile Pro Leu Glu Tyr

260 265 270

Ile Glu Arg Met Gly Ile Asp Asn Asp Thr Glu Leu Ser Lys Gln Ile

275 280 285

Phe Arg Val Asp Lys Asn Phe Cys Leu Arg Pro Met Leu Ile Pro Asn

290 295 300

Leu Tyr Asn Tyr Leu Arg Lys Leu Asp Arg Ala Leu Pro Asp Pro Ile

305 310 315 320

Lys Ile Phe Glu Ile Gly Pro Cys Tyr Arg Lys Glu Ser Asp Gly Lys

325 330 335

Glu His Leu Glu Glu Phe Thr Met Leu Thr Phe Ile Gln Met Gly Ser

340 345 350

Gly Cys Thr Arg Glu Asn Leu Glu Ser Ile Ile Thr Asp Phe Leu Asn

355 360 365

His Leu Gly Ile Asp Phe Lys Ile Val Gly Asp Ser Cys Met Val Leu

370 375 380

Gly Asp Thr Leu Asp Val Met His Gly Asp Leu Glu Leu Ser Ser Ala

385 390 395 400

Val Val Gly Pro Ile Pro Leu Asp Arg Glu Trp Gly Ile Asp Lys Pro

405 410 415

Lys Ile Gly Ala Gly Phe Gly Leu Glu Arg Leu Leu Lys Val Lys His

420 425 430

Asp Phe Lys Asn Ile Lys Arg Ala Ala Arg Ser Glu Ser Tyr Tyr Asn

435 440 445

Gly Ile Ser Thr Asn Leu

450

<210> 21

<211> 1365

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of FSYRS

<400> 21

atggataaaa agcctttgaa cactctgatt tctgcgaccg gtctgtggat gtcccgcacc 60

ggcaccatcc acaaaatcaa acaccatgaa gttagccgtt ccaaaatcta cattgaaatg 120

gcttgcggcg atcacctggt tgtcaacaac tcccgttctt ctcgtaccgc tcgcgcactg 180

cgccaccaca aatatcgcaa aacctgcaaa cgttgccgtg ttagcgatga ggacctgaac 240

aaattcctga ccaaagctaa cgaggatcag acctccgtaa aagtgaaggt agtaagcgct 300

ccgacccgta ctaaaaaggc tatgccaaaa agcgtggccc gtgccccgaa acctctggaa 360

aacaccgagg cggctcaggc tcaaccatcc ggttctaaat tttctccggc gatcccagtg 420

tccacccaag aatctgtttc cgtaccagca agcgtgtcta ccagcattag cagcatttct 480

accggtgcta ccgcttctgc gctggtaaaa ggtaacacta acccgattac tagcatgtct 540

gcaccggtac aggcaagcgc cccagctctg actaaatccc agacggaccg tctggaggtg 600

ctgctgaacc caaaggatga aatctctctg aacagcggca agcctttccg tgagctggaa 660

agcgagctgc tgtctcgtcg taaaaaggat ctgcaacaga tctacgctga ggaacgcgag 720

aactatctgg gtaagctgga gcgcgaaatt actcgcttct tcgtggatcg cggtttcctg 780

gagatcaaat ctccgattct gattccgctg gaatacattg aacgtatggg catcgataat 840

gataccgaac tgtctaaaca gatcttccgt gtggataaaa acttctgtct gcgtccgatg 900

ctgattccga acttgtacaa ctatttacgt aaactggacc gtgccctgcc ggacccgatc 960

aaaatattcg agatcggtcc ttgctaccgt aaagagtccg acggtaaaga gcacctggaa 1020

gaattcacca tgctgacatt cattcagatg ggtagcggtt gcacgcgtga aaacctggaa 1080

tccattatca ccgacttcct gaatcacctg ggtatcgatt tcaaaattgt tggtgacagc 1140

tgtatggtgt taggcgatac gctggatgtt atgcacggcg atctggagct gtcttccgca 1200

gttgtgggcc caatcccgct ggatcgtgag tggggtatcg acaaacctaa aatcggtgcg 1260

ggttttggtc tggagcgtct gctgaaagta aaacacgact tcaagaacat caaacgtgct 1320

gcacgttccg agtcctatta caatggtatt tctactaacc tgtaa 1365

<210> 22

<211> 417

<212> DNA

<213> Artificial sequence

<220>

<223> nucleotide sequence of PD-1(WT)

<400> 22

atgtggaatc cgccgacctt tagcccggcc ctgctggttg ttaccgaggg tgataatgcc 60

accttcacct gcagcttcag caacaccagc gagagcttcg tgctgaattg gtatcgcatg 120

agcccgagca accagaccga taaactggcc gcctttccgg aagatcgtag ccagccgggc 180

caggatagcc gctttcgtgt tacccagctg ccgaacggtc gcgattttca catgagcgtg 240

gtgcgcgccc gccgtaatga tagcggtacc tatctgtgcg gcgccattag cctggcaccg 300

aaagcccaga ttaaggaaag cctgcgcgca gaactgcgcg tgaccgaacg tcgcgcagaa 360

gtgccgaccg cacatccgag tcctagtccg ctcgagcacc accaccacca ccactga 417

<210> 23

<211> 138

<212> PRT

<213> Artificial sequence

<220>

<221> o-fluorosulfuric acid-L-tyrosine (FSY)

<222> (45)

<223> amino acid sequence of PD-1(Q75FSY)

<400> 23

Met Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu

1 5 10 15

Gly Asp Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser

20 25 30

Phe Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Xaa Thr Asp Lys

35 40 45

Leu Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Ser Arg

50 55 60

Phe Arg Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val

65 70 75 80

Val Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile

85 90 95

Ser Leu Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu

100 105 110

Arg Val Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro

115 120 125

Ser Pro Leu Glu His His His His His His

130 135

<210> 24

<211> 138

<212> PRT

<213> Artificial sequence

<220>

<221> o-fluorosulfuric acid-L-tyrosine (FSY)

<222> (47)

<223> amino acid sequence of PD-1(D77FSY)

<400> 24

Met Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu

1 5 10 15

Gly Asp Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser

20 25 30

Phe Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Xaa Lys

35 40 45

Leu Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Ser Arg

50 55 60

Phe Arg Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val

65 70 75 80

Val Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile

85 90 95

Ser Leu Ala Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu

100 105 110

Arg Val Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro

115 120 125

Ser Pro Leu Glu His His His His His His

130 135

<210> 25

<211> 138

<212> PRT

<213> Artificial sequence

<220>

<221> o-fluorosulfuric acid-L-tyrosine (FSY)

<222> (99)

<223> amino acid sequence of PD-1(A129FSY)

<400> 25

Met Trp Asn Pro Pro Thr Phe Ser Pro Ala Leu Leu Val Val Thr Glu

1 5 10 15

Gly Asp Asn Ala Thr Phe Thr Cys Ser Phe Ser Asn Thr Ser Glu Ser

20 25 30

Phe Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp Lys

35 40 45

Leu Ala Ala Phe Pro Glu Asp Arg Ser Gln Pro Gly Gln Asp Ser Arg

50 55 60

Phe Arg Val Thr Gln Leu Pro Asn Gly Arg Asp Phe His Met Ser Val

65 70 75 80

Val Arg Ala Arg Arg Asn Asp Ser Gly Thr Tyr Leu Cys Gly Ala Ile

85 90 95

Ser Leu Xaa Pro Lys Ala Gln Ile Lys Glu Ser Leu Arg Ala Glu Leu

100 105 110

Arg Val Thr Glu Arg Arg Ala Glu Val Pro Thr Ala His Pro Ser Pro

115 120 125

Ser Pro Leu Glu His His His His His His

130 135

2

Claims (31)

1. A proximity-enabling response therapy method for generating a covalent protein drug, the method comprising: incorporating a potentially biologically reactive unnatural amino acid (Uaa) into a protein drug to produce a mutein drug, wherein the mutein drug reacts upon drug-target binding by proximity enabling reaction with a target natural residue of its target protein, thereby enabling covalent binding of the protein drug to its target.

2. The method of claim 1, wherein Uaa is genetically incorporated into the protein drug.

3. The method according to claim 2, wherein the Uaa is genetically incorporated into the protein drug by introducing an amber stop codon (TAG) at a desired site in the nucleotide sequence of the wild-type protein encoding the protein drug by means of a mutated aminoacyl-tRNA synthetase (aaRS) specific for the Uaa.

4. The method of claim 1, wherein the Uaa is o-fluorosulfate-L-tyrosine (FSY) and the aaRS is a mutated pyrrolysinyl-tRNA synthetase specific for FSY.

5. The method of claim 1, wherein the mutein drug is PD-1 containing a mutation of one FSY in its amino acid sequence.

6. The method of claim 5, wherein the FSY is introduced into human PD-1 at one of the following sites: gln75, Asp77 or Ala129, to substitute the respective natural amino acid residue at the position numbered according to the amino acid sequence of wild type human PD-1.

7. A mutated human PD-1, said mutated human PD-1 comprising one FSY (o-fluorosulfate-L-tyrosine) in its amino acid sequence, wherein the FSY residue in said mutated human PD-1 is capable of specifically reacting with a proximal one of the target native amino acid residues selected from Tyr, His or Lys in its target PD-L1 by click chemistry sulfur-fluoride exchange (SuFEx).

8. Human PD-1 comprising a mutation of one FSY according to claim 7, wherein said FSY is introduced into human PD-1 at one of the following sites: gln75, Asp77 or Ala129 to replace the respective natural amino acid residue at that position, which position is numbered in accordance with the amino acid sequence of wild type human PD-1.

9. Human PD-1 comprising a mutation of one FSY according to claim 8, wherein said FSY is introduced into human PD-1 at position Ala 129.

10. Human PD-1 containing a mutation of one FSY according to claim 7, which is contained in the expectation by expression in a host cellPD-1 gene for amber stop codon (TAG) introduced at site and method for orthogonal tRNA^PylThe gene of the/FSYRS pair incorporates the FSY residue into the extracellular domain of human PD-1.

11. Human PD-1 comprising a mutation of one FSY according to claim 10, wherein the host cell is selected from e.

12. A mutated human PD-1 comprising an FSY according to claim 10, wherein said mutated human PD-1 exhibits the following properties:

(i) specifically covalently binds to human PD-L1 in vitro, specifically covalently binds to human PD-L1 that is physiologically expressed on the surface of living cancer cells, and specifically covalently binds to human PD-L1 in tumor tissue in vivo;

(ii) specifically enhancing T cell activation by blocking the PD-1/PD-L1 interaction; and

(iii) the same anti-tumor effect as that of the same molar amount of atuzumab was achieved, whereas the required mass of PD-1(FSY) was one tenth of that of atuzumab.

13. The mutated human PD-1 of claim 7, which comprises a FSY, said mutated human PD-1 having an amino acid sequence as set forth in any one of SEQ ID NOs 23-25.

14. A method of genetically incorporating FSY into PD-1, the method comprising:

expressing in a host cell, in cell culture medium comprising synthetic FSY and an agent for inducing expression of a protein:

(i) a PD-1 gene comprising an amber stop codon (TAG) introduced at a desired site; and

(ii) for orthogonal tRNA^PylGenes of the/FSYRS pair.

15. The method of claim 14, wherein the host cell is e.coli and the agent for inducing protein expression is IPTG.

16. The method of claim 14, wherein the PD-1 is human PD-1 represented by SEQ ID No. 15.

17. The method of claim 16, wherein said amber stop codon (TAG) is introduced at a position selected from position Gln75, Asp77 or Ala129 of human PD-1 to replace the respective native amino acid residue at said position.

18. The method of claim 17, wherein the PD-1 gene comprising an amber stop codon (TAG) is set forth in any one of SEQ ID NOs 16-18.

19. The method of claim 14, wherein the tRNA is^PylShown as SEQ ID NO. 19.

20. The method of claim 14, wherein the FSYRS is a mutant Methanococcus equi (Methanosarcina mazei) pyrlysyl-tRNA synthetase (PylRS) and is set forth in SEQ ID NO: 20.

21. A pharmaceutical composition comprising an effective amount of a covalent protein drug prepared by the method according to any one of claims 1-6 or an effective amount of a mutated human PD-1 according to any one of claims 7-13 comprising one FSY and a pharmaceutically acceptable carrier and/or excipient.

22. A kit comprising an effective amount of a covalent protein drug prepared by the method of any one of claims 1-6 and a pharmaceutically acceptable carrier and/or excipient.

23. A kit comprising an effective amount of a mutated human PD-1 comprising an FSY according to any one of claims 7-13 and a pharmaceutically acceptable carrier and/or excipient.

24. A covalent protein drug prepared by the method of any one of claims 1-6 for use in the prevention and/or treatment of a PD-L1-related disease.

25. Human PD-1 comprising a mutation of one FSY according to any one of claims 7-13, said mutated human PD-1 for use in the prevention and/or treatment of PD-L1-related diseases.

26. A method of preventing and/or treating a PD-L1-associated disease in a subject, the method comprising: administering to the subject the pharmaceutical composition of claim 21.

27. The method of claim 26, wherein the PD-L1-related disease is selected from melanoma, renal cell carcinoma, head and neck cancer, cervical cancer, glioblastoma, bladder cancer, esophageal cancer, breast cancer, hepatocellular carcinoma, hodgkin's lymphoma, and mediastinal large B-cell lymphoma.

28. Use of a covalent protein drug prepared by a method according to any one of claims 1-6 for the preparation of a pharmaceutical composition for the prevention and/or treatment of a PD-L1-related disease.

29. Use of a human PD-1 comprising a mutation of one FSY according to any one of claims 7-13 for the preparation of a pharmaceutical composition for the prevention and/or treatment of PD-L1-related diseases.

30. The use of claim 28 or 29, wherein the PD-L1-associated disease is selected from melanoma, renal cell carcinoma, head and neck cancer, cervical cancer, glioblastoma, bladder cancer, esophageal cancer, breast cancer, hepatocellular carcinoma, hodgkin's lymphoma, and mediastinal large B-cell lymphoma.

31. The method according to claim 5, wherein the amino acid sequence of the mutated PD-1 is as set forth in any one of SEQ ID Nos. 23-25.

Images