CN101492744B

CN101492744B - Noncompetitive internal comparison system in PCR reaction

Info

Publication number: CN101492744B
Application number: CN2009101192544A
Authority: CN
Inventors: 李丙亮; 杨国翠; 张文艳; 李振勇; 黄道培
Original assignee: Shanghai Haoyuan Biotech Co Ltd
Current assignee: Shanghai Haoyuan Biotech Co Ltd
Priority date: 2009-03-10
Filing date: 2009-03-10
Publication date: 2011-11-09
Anticipated expiration: 2029-03-10
Also published as: CN101492744A

Abstract

The invention relates to a quantitative method and a construction method for internal control molecules in the PCR system, a nucleic acid amplification method based on the obtained quantity thereof and/or internal control molecules and corresponding detection kits. In addition, the invention further relates to a two-step PCR amplification method, application of internal control molecules or kits and the like. The method is used for improving sensitivity and/or detecting sensitivity and reliability of characteristic false negative result, and flexibly adapted to the change of PCR amplification system and detection mode.

Description

Noncompetitive internal reference system in the PCR reaction

Technical field

The invention belongs to the nucleic acid detection technique field, particularly, the present invention relates to the construction process of the quantivative approach of internal reference molecule in the polymerase chain reaction system and internal reference molecule and based on the nucleic acid amplification method and the corresponding detection kit of its amount that obtains and/or internal reference molecule.In addition, the invention still further relates to the application etc. of two step method pcr amplification method and internal reference molecule or test kit.

Background technology

Nucleic acid detection technique is universal day by day, and detection method is varied, and wherein main have polymerase chain reaction (PCR) and a deriving technology thereof, as reverse transcription PCR (RT-PCR), PCR in real time etc.Round pcr has obtained using widely in testing processes such as infectious diseases, tumour, inherited disease, parasite, medical jurisprudence and in the research of animals and plants, archaeology at present, is very important nucleic acid detection technique in fields such as medical and health, biological detection, food safety.Especially, PCR has been widely used in the detection practice with the nucleic acid of disease-related, and the clinical diagnosis of disease has been played important effect and also developing rapidly among the popularization.

In actual process of carrying out detection of nucleic acids, use round pcr, in order to characterize the generation of false negative result, also in order to determine the reaction efficiency of PCR, need in the PCR reaction system, add the internal reference molecule, could provide proper explanations to the PCR detected result like this, as in order to get rid of false negative result, Chinese patent application CN1203366A employing globin genes etc. are as the internal reference molecule, CN1664098A adopts the beta-Actin muscle as the internal reference molecule, CN1687454A adopts the res-1 gene as the internal reference molecule, and CN1940087A has adopted RNA internal reference molecule.Therefore, during each PCR, need guarantee that actual PCR detects quality by internal reference.Yet with respect to the PCR detection method, people are to the relative much less of the research work of internal reference.

The internal reference molecule by with target nucleic acid competing reaction substrate, thereby and the target nucleic acid molecule that may the exist inhibition of in the process of pcr amplification, vying each other in the sample.This competition is useful in the quantitative PCR detection process, and the ratio that obtains after the amplification because internal reference molecule and target nucleic acid molecule are vied each other can be used to quantitative assay target nucleic acid molecule quantity.Yet, in the qualitative test that sensitivity is had relatively high expectations (promptly, whether qualitatively judge target nucleic acid molecule is present in the sample) in, this competition then can produce considerable influence to the susceptibility that PCR detects, even the right sequence identity of internal reference molecule and target nucleic acid or target nucleic acid primer is low, (relative quantity of target nucleic acid is big especially relatively but if internal reference molecule add-on is big, particularly the first few circulation time target nucleic acid relative quantity of pcr amplification can be very low), owing to more chance and target nucleic acid primer are arranged to contacting, although not necessarily annealing jointly, but influence the target nucleic acid primer on the space to contacting with target nucleic acid, the amplified reaction that then still can suppress target molecule descends sensitivity; , internal reference molecule add-on is little, then obviously reduces the internal reference molecule by the chance of internal reference primer to amplification, and internal reference self is not easy to be amplified out, can't play the effect of monitoring reaction (that is, characterizing false negative result).Therefore; the testing staff usually can according to own long term experience determine internal reference molecule in the specific PCR reaction system add-on (as; absolute magnitude; concentration etc.); but experimental like this operation can vary with each individual; be unfavorable for very much detecting the stable of quality; as be unfavorable for sharing with other testing staff's result; also can't (comprise target nucleic acid sequence to the change of pcr amplification system and detection mode; the internal reference molecular sequences; primer is to sequence; the amplification mode; the change of detection mode etc.) makes the adjusting of respective flexible, be unfavorable for comprising the PCR detection method of internal reference and the exploitation of corresponding detection kit.For sensitivity that takes into account detection and the generation that characterizes false negative result, CN1664098A adopts twice method for measuring, promptly do not add earlier the internal reference molecule and carry out (or several times preceding) PCR detection for the first time, add the internal reference molecule again and carry out for the second time (or after several times) PCR and detect for detecting negative sample, but this method is more and more complicated than a method for measuring step, amount of samples is more, it is higher to detect cost, and need judgement (or several times preceding) PCR detected result first time and select negative sample to remeasure, this will increase the difficulty of automated operation design, be unfavorable for very much extensive detection, the PCR parallel as a large amount of samples detects, and (or after several times) PCR detects the add-on that still needs rule of thumb to come to determine the internal reference molecule in addition for the second time.

In order to overcome the deficiencies in the prior art, grope through long-term and arduous effort and experience, the inventor is surprisingly to being improved for the internal reference molecule aspect that the people thinked little of in the PCR reaction system, PCR detected result when not adding target nucleic acid, utilization Poisson distributes to determine the add-on of internal reference molecule, take into account the sensitivity of detection and the generation of sign false negative result thus, under the condition that internal reference molecule and target nucleic acid molecule are not competed, improve the validity that characterizes false negative result as far as possible, avoid empirical to determine that add-on is given simultaneously and detect the unstable that quality causes, thereby can and characterize the add-on of the internal reference molecule of false negative result for the PCR detection method that comprises internal reference (the especially PCR detection method of automatization) of exploitation and corresponding detection kit balance is provided detection sensitivity.Therefore, the inventor has also developed PCR detection method and corresponding detection kit according to the determined amount of method of the add-on of above-mentioned definite internal reference molecule.

Act on the improved thinking in internal reference molecule aspect, the inventor has also optimized the construction process of internal reference molecule surprisingly, the internal reference molecule of Gou Jianing can improve the sensitivity that PCR detects by the adjusting to annealing temperature thus, the add-on that cooperates above-mentioned quantitative internal reference molecule can further improve PCR and detect quality.Therefore, the invention still further relates to the PCR detection method and the corresponding detection kit of the internal reference molecule that comprises corresponding structure.Although CN101343659A discloses a kind of PCR primer design method, make the primer of internal reference be lower than the primer of target nucleic acid to annealing temperature to annealing temperature, but it is at the primer design method, be not the structure at the internal reference molecule, the concrete mode of its design also is different from of the present invention fully.Simultaneously, the inventor has also developed a kind of new PCR qualitative checking method surprisingly, it is a two step method pcr amplification method, to the internal reference primer to optimizing the opportunity that in PCR, adds, can improve the sensitivity that PCR detects, the add-on that cooperates above-mentioned quantitative internal reference molecule can further improve PCR and detect quality.

Summary of the invention

The object of the present invention is to provide the method and the PCR detection method of the amount of determining the internal reference molecule, it is by the improvement to internal reference in the PCR qualitative checking method, improve detection sensitivity and/or take into account detection sensitivity and the reliability of sign false negative result, in order to obtain higher-quality PCR detected result, and can adapt to the change of pcr amplification system and detection mode, for design, implement the PCR detection method and detection kit brings convenience.More specifically, the objective of the invention is to by in the PCR qualitative checking method, determining the internal reference molecule amount, make up the internal reference molecule and/or improve internal reference primer right opportunity that in the pcr amplification process, adds, obtain and take into account detection sensitivity and characterize false negative result, thereby make the detected result steady quality, the variation of reply detection method flexibly, and/or improve the beneficial effects such as sensitivity that detect.In addition, the present invention also aims to provide corresponding detection kit and application etc.

Particularly, in first aspect, the object of the present invention is to provide the optimization method for determination of amount of internal reference molecule used in the method for target nucleic acid in the PCR qualitative detection sample, it comprises:

(1) with identical amplification condition, carry out k identical negative pcr amplification respectively, the amount of internal reference molecule is No in the described negative pcr amplification system, k 〉=10; It is right to, internal reference molecule and internal reference primer that this feminine gender pcr amplification system comprises the target nucleic acid primer, wherein do not have target nucleic acid;

(2) whether amplify the internal reference molecule after detecting the negative pcr amplification of step (1) respectively, the number that does not detect the negative pcr amplification of internal reference molecular cloning is t; If t=0 or t=k then adjust No, begin to carry out from step (1) again; If t=0, the amount of raising internal reference molecule; If t=k, the amount of reduction internal reference molecule;

(3) calculate critical amount Nc according to formula (I)

Nc = \frac{No}{- \ln (t / k)} - - - (I);

With

(4) determine the optimized amount of internal reference molecule according to Nc, the optimized amount of internal reference molecule is between 3.0 * Nc to 9.2 * Nc.

In this article, the method for target nucleic acid in the test sample of the present invention, the sample that is detected is the potential vitro samples that may contain target nucleic acid, as food, blood, blood products, saliva, medical treatment product or medicine etc.In described sample, the target that method detected of target nucleic acid in the test sample of the present invention (that is, target nucleic acid) can be the nucleic acid of any suitable pcr amplification, as gene or gene fragment, comprises DNA and RNA.For example, in the specific embodiment of the present invention, can detect HCV (hepatitis C virus, it is a RNA viruses) 5 ' non-coding region RNA, HIV (human immunodeficiency virus, it is a RNA viruses) the gag gene RNA and the antigenic gene DNA of coding S of HBV (hepatitis B virus, it is a dna virus).Therefore, target nucleic acid can be RNA or DNA, preferably the RNA of pathogenic agent or DNA, specific RNA or DNA as corresponding pathogenic agent, preferably the RNA of bacterium, virus or pathogenic microorganism or DNA are more preferably viral RNA or DNA, most preferably are HCV RNA, HIV RNA or HBV DNA.In the specific embodiment of the present invention, the example of target nucleic acid has 5 ' non-coding region (promptly 5 ' non-translational region is called for short 5 ' UTR) the gag gene RNA of RNA, HIV and the antigenic gene DNA of coding S of HBV (that is s district DNA) of HCV.These nucleic acid can characterize the existence of corresponding pathogenic agent to a certain extent.

It is pointed out that detection method of the present invention is the detection that is used for vitro samples, the direct result of detection be target nucleic acid existence whether.Even for utilize detection method of the present invention detect pathogenic agent in human or animal's the blood sample (as, virus) target nucleic acid on, the existence that also can only directly draw target nucleic acid whether, also need empirical doctor or sampling personnel and judge that detected target nucleic acid comes from the pathogenic agent that pathogenic agent in the blood or when sampling pollute accidentally, and can not directly obtain the diagnostic result or the healthy state of disease; Even target nucleic acid comes from the pathogenic agent in the blood, can only illustrate that also corresponding human or animal is corresponding carrier of pathogens, also need empirical doctor and just can judge whether can cause disease or influential healthy state according to comprehensive conditions such as corresponding human or animal's physique, medical history, clinical symptom.

In this article, the method of PCR qualitative detection nucleic acid refers to the technology that those skilled in the art know, as do not add and limit or explanation, it comprises pcr amplification and detection, wherein use the internal reference molecule in the pcr amplification, that is, and by the described nucleic acid of PCR reaction amplification, and whether have the amplification of described nucleic acid to judge whether described nucleic acid exists, and use the internal reference molecule to monitor the generation of false negative result by detecting.Wherein, pcr amplification is well-known to those skilled in the art, has developed multiple pcr amplification mode.Those skilled in the art can easily select the target nucleic acid primer to the reagent required with pcr amplification according to the object of pcr amplification, as resistant to elevated temperatures archaeal dna polymerase (as, the Taq enzyme), nucleic acid monomer (as, dATP, dCTP, dGTP, dTTP, ATP, CTP, GTP and UTP), for adopting reverse transcription PCR (RT-PCR) cloning RNA, wherein also need ThermoScript II, as avian myeloblastosis virus (AMV) ThermoScript II, Moloney murine leukemia virus (MMLV) ThermoScript II etc.And, the right implication of primer is for understood by one of ordinary skill in the art, it is made up of forward primer and reverse primer, be used to increase at the sense strand of nucleic acid and its complementary strand, but in this article, " forward " in forward primer and the reverse primer and " oppositely " be only for distinguishing forward primer and reverse primer, and be not limited to refer to that itself and specific chains (sense strand or its complementary strand) anneal.And in this article, arbitrary primer of two primers and another kind of primer centerings that 2 kinds of right differences of primer refer to a kind of primer centering is all different.In addition; the required reagent of pcr amplification also preferably comprise pH buffer reagent (as Tris-HCl, PBS etc.), ionic strength adjustor (as; salt), antioxidant (reductive agent), albumen (enzyme) protective material (as, bovine serum albumin (BSA), human serum albumin (HSA) etc.), RNase and/or RNase inhibitor etc.These compositions and effect and required instrument all are well-known to those skilled in the art, and commercialization, can buy or entrust manufacturing by the commercial channel.For detection, usually behind pcr amplification, detect, as by electrophoresis (as, micro flow chip electrophoresis, gel electrophoresis), enzyme linked immunological absorption test (ELISA) waits and detects amplified production, but also can detect when pcr amplification, (Real-time PCR) detects fluorescence influence in amplification procedure by fluorescent agent on the probe and quencher as PCR in real time.Above-mentioned detection means is known to those skilled in the art, and wherein required reagent, instrument also can be bought or consigned processing by the industry channel.In addition, can not use internal reference in the method for PCR qualitative detection nucleic acid, but the qualitative detection (employed PCR qualitative detection in the part as clinical diagnosis, blood screening process) of having relatively high expectations for interpretation of result, for the generation that detects false negative result (promptly, physical presence target nucleic acid in the sample, but do not detect), can adopt internal reference, comprise that internal reference molecule and internal reference primer are right.Therefore, the method for target nucleic acid comprises pcr amplification and detection in the PCR qualitative detection sample of the present invention, wherein uses the internal reference molecule in the pcr amplification.Certainly, the internal reference molecule needn't all be used in the whole process of pcr amplification, can add the internal reference molecule behind the pcr amplification that has carried out several cycles again, also can all add the internal reference molecule, carries out as fifth aspect present invention is described.

The internal reference molecule is the nucleic acid molecule that sequence is different from target nucleic acid.The internal reference molecule can be a single-chain nucleic acid, can be double-strandednucleic acid also, in the specific embodiment of the present invention, and double-strandednucleic acid preferably.Had in the prior art specific nucleic acid molecule is used as the internal reference molecule, third aspect present invention also provides a kind of construction process of internal reference molecule.During pcr amplification, conditions suitable in theory (as, condition that in theory can amplifying target nucleic acid) under, therefore the internal reference molecule can monitor false negative result in theory by the internal reference primer to amplification.But, in fact, very complicated to the pcr amplification system composition of forming with the required reagent of pcr amplification and water by the sample that may have target nucleic acid, target nucleic acid primer to, internal reference molecule, internal reference primer, between target nucleic acid and the internal reference molecule in the pcr amplification system and the competition under the different pcr amplification conditions for the sensitivity of the detection mode gained of different accuracy influence, be difficult to extrapolate theoretic conditions suitable with accurate method of calculation.Can only draw the roughly conclusion of operability difference: the internal reference molecule number that strict control is added in the pcr amplification (for reducing the internal reference template number that competition should add minimum), efficient that contrast template within the adding can be monitored reflect this PCR or false negative and add, but the strict control in the least possible again Calais may suppress the negative impact of target molecule amplification.Therefore, the inventor adopts with pcr amplification system during target nucleic acid in the PCR qualitative detection sample and compares, the negative pcr amplification system that only lacks target nucleic acid, carry out pcr amplification, test out can not amplify when carrying out pcr amplification and can detect the probability that obtains the internal reference molecule for this pcr amplification system and pcr amplification mode thereof and condition, and utilize this probability to go out the critical amount of internal reference molecule in this pcr amplification system by the Poisson distributed computation, extrapolate the optimized amount (optimization addition) of internal reference molecule, thereby optimize in the extensive PCR detection or reliability and repeatability between the different batches that PCR detects.

In the method for a first aspect of the present invention, negative pcr amplification system refers to the pcr amplification system, its by the target nucleic acid primer to, internal reference molecule, internal reference primer to forming with required reagent and the water of pcr amplification, wherein do not have target nucleic acid.In other words, compare with the pcr amplification system that is adopted during target nucleic acid in the PCR qualitative detection sample, negative pcr amplification system is not except containing the target nucleic acid certainly, and other are all identical.For example, can not add sample, and replace the sample solvent (as water, damping fluid etc.) that adds equal volume, and add the target nucleic acid primer to, internal reference molecule, internal reference primer to reagent and the water required with pcr amplification, obtain negative pcr amplification system thus.To the pcr amplification that negative pcr amplification system is carried out, promptly negative pcr amplification will obtain target nucleic acid in theory and detect negative result (that is, detect less than).Preferred wherein target nucleic acid primer to the internal reference primer to being different, it is right to, internal reference molecule and internal reference primer to be that preferred described negative pcr amplification system comprises the target nucleic acid primer, wherein the target nucleic acid primer to the internal reference primer to being different, the more preferably continuous sequence high to sequence identity not in the internal reference molecule with the target nucleic acid primer, as identity greater than 50%, 40%, 30%, 20%, 10% or 5% sequence.

In the method for a first aspect of the present invention, can detect the probability that obtains the internal reference molecule in order accurately to test out for not amplifying under specific pcr amplification system and the specific pcr amplification condition, need carry out k identical negative pcr amplification, wherein k is bigger, preferred k is more than or equal to 10, be preferably greater than and equal 30, more preferably greater than equaling 50, most preferably more than or equal to 80.Although the big more just approaching more objective probability of k, but according to inventor's protracted experience, the probability that identical negative pcr amplification quantity more than 30 is obtained is just more accurate, and 80 very accurate, what increase the probability of test number (TN) gained and 80 again differs very little, can no longer increase experiment number for the consideration of cost.Each negative pcr amplification should be identical, be that the pcr amplification condition all is identical with negative pcr amplification system, all identical as amplification conditions such as annealing temperature, annealing time, extension times, and all identical with type etc. to, internal reference primer in the amplification system to the amount of opportunity of amount, sequence and the adding of, internal reference molecule etc. and employed enzyme, reagent such as the target nucleic acid primer.Wherein, the amount of internal reference molecule all is expressed as No in each negative pcr amplification system.In this article, " amount " can refer to absolute quantity, as molecule number, molecule mole number etc., also can refer to the quantity in the certain space, as concentration.Because the pcr amplification system is specific and know in advance, so those skilled in the art are easy to by cumulative volume or total mass respective concentration is converted into absolute quantity, and vice versa.

After having carried out k identical negative pcr amplification, detect respectively and whether amplify the internal reference molecule, precision difference for fear of different detection modes, it is identical detecting the mode that whether amplifies the internal reference molecule in the method for the mode of preferred detection and PCR qualitative detection nucleic acid of the present invention, detect as the gel electrophoresis of all using same type, wherein testing conditions (as gel strength, size of current etc.) is all identical.After the detection, the number that does not detect the negative pcr amplification of internal reference molecular cloning is t, if t=0, the amount that the internal reference molecule then is described very little, few be enough to amplify with corresponding pcr amplification condition and pcr amplification system can detect the internal reference molecule that obtains, can't play the effect of internal reference monitoring at all, therefore need to improve the amount (No) of internal reference molecule in the negative pcr amplification system, carry out successively from step (1) beginning of the method for a first aspect of the present invention again; If t=k, the amount that the internal reference molecule then is described may be too many, though can play the effect of internal reference monitoring, but the amount that has reduction internal reference molecule is avoided the leeway with the target nucleic acid competition, therefore need to reduce the amount (No) of internal reference molecule in the negative pcr amplification system, carry out successively from step (1) beginning of the method for a first aspect of the present invention again.So carry out, up to 0＜t＜k.At this moment, (obviously, n is directly proportional with No, and counting the individual internal reference molecule of No=m * n), all not to be amplified detectable probability be P (0)=t/k can to calculate n in this pcr amplification system.Because the absolute value of internal reference molecule number is very big, and the Probability p that each internal reference molecule is not amplified is very little, so the internal reference molecule all is not amplified detectable probability and meets Poisson and distribute, for example P (0)=e ^{-n * p}Simultaneously, in this pcr amplification system, the internal reference molecule number that does not increase of expectation is the product of n and p, if the internal reference molecule number that does not increase of expectation is less than 1, then there is maximum probability to make this pcr amplification system not have 1 internal reference molecule to participate in the competition, so critical internal reference molecule number the n '=1/p that participates in the competition, wherein n ' is directly proportional with critical amount Nc, be Nc=m * n ', can calculate critical amount Nc by No and P (0) according to formula (I).But this moment, has only the internal reference molecule only with e ^-1The probability of (about 37%) is amplified out, can't reach the purpose of effective monitoring.Therefore, when getting optimized amount, the internal reference molecule is amplified and can detects with very big probability (counting 1-P (0) '), and be not amplified detectable situation is small probability event (probability is counted P (0) '), be difficult in the practice produce, therefore increase probability again and have only and increased on foot with the competition of target molecule and cost, distribute according to Poisson, this moment, optimized amount was Nc * (ln P (0) ').That is to say, for specific pcr amplification condition, when the amount of internal reference molecule in the specific pcr amplification system is critical amount Nc * (ln P (0) '), detection is considered to can not take place less than the situation of internal reference molecule, and the amount of internal reference molecule is to be considered to the internal reference molecule can not competed minimum concentration with target nucleic acid under the situation of omission at this moment, has taken into account the sign of detection sensitivity and false negative result.And the small probability that It is generally accepted is 5%, 1%, 0.5%, 0.1%, 0.01% etc.Therefore, in the method for a first aspect of the present invention, the optimized amount of preferred internal reference molecule preferably between 4.6 * Nc to 6.9 * Nc, most preferably is 5.3 * Nc between 3.0 * Nc to 9.2 * Nc.

In second aspect, the object of the present invention is to provide the application in the method for optimized amount target nucleic acid in PCR qualitative detection sample of the internal reference molecule that the described method of first aspect present invention determines.Correspondingly, the invention provides the method for target nucleic acid in the PCR qualitative detection sample, it comprises pcr amplification and detection, wherein use the internal reference molecule in the pcr amplification, and the amount of employed internal reference molecule is the optimized amount of the definite internal reference molecule of the described method of first aspect present invention.Because the optimized amount of this internal reference molecule is at the pcr amplification system in the method for a first aspect of the present invention, pcr amplification condition and detect the mode of internal reference molecule, thus in the PCR qualitative detection sample of second aspect present invention pcr amplification system, the pcr amplification condition of the method for target nucleic acid and the mode that detects the internal reference molecule wish can with pcr amplification system, pcr amplification condition in the method for a first aspect of the present invention and to detect the mode of internal reference molecule identical or close.Wherein, the amplification condition in the method for target nucleic acid is the described identical amplification condition of the described method steps of first aspect present invention (1) in the preferred PCR qualitative detection sample; In the also preferred PCR qualitative detection sample in the method for target nucleic acid the detection of internal reference molecule be the detection of the described internal reference molecule of the described method steps of first aspect present invention (2); Because target nucleic acid may exist also and may not exist in the sample, be not to be predetermined, the pcr amplification system in the therefore also preferred PCR qualitative detection sample in the method for target nucleic acid is made up of the optional target nucleic acid that exists in described negative pcr amplification system of the described method steps of first aspect present invention (1) and the sample.In addition, the present invention also provides the detection kit in the method that is used for above-mentioned PCR qualitative detection sample target nucleic acid, and wherein the amount of the employed internal reference molecule of method of target nucleic acid is the optimized amount of the definite internal reference molecule of the described method of first aspect present invention in the PCR qualitative detection sample.For example, preparation detection reagent product (as, detection kit) time, determine sequence, composition and the consumption of various primers, reagent, after pcr amplification system and amplification condition are determined, adopt the described method of first aspect present invention to determine the optimized amount of internal reference molecule, determine the consumption of internal reference molecule thus.

In the third aspect, the object of the present invention is to provide the construction process of used internal reference molecule in the method for target nucleic acid in the PCR qualitative detection sample, it comprises selects candidate nucleic acid or sudden change candidate nucleic acid to become the internal reference molecule, in the described internal reference molecule with the internal reference primer to being different with the target nucleic acid primer to the annealed sequence in annealed sequence and the target nucleic acid, and the right annealing temperature of internal reference molecule and internal reference primer is lower than target nucleic acid and the right annealing temperature of target nucleic acid primer.The optimized amount of internal reference molecule is determined by the optimization method for determination of amount of above-mentioned internal reference molecule.In the method for third aspect present invention, the implication of structure is to select or mutant nucleic acid molecule and and then obtain nucleic acid entity selected or sudden change.Primer and its at the annealing temperature of nucleotide sequence can determine that this knows to those skilled in the art by the Tm value.Because target nucleic acid pre-determines, therefore need construct the internal reference molecule, and design corresponding primer according to the Tm value.Like this, reduce the temperature that combines of internal reference primer pair and internal reference molecule, can make target nucleic acid primer pair and target nucleic acid annealed combination under higher temperature, preferentially increase, and combine more difficult with the internal reference primer in the internal reference molecule; Then, increase several or tens (as, 5～10) after the circulation, as existing, the amount of target nucleic acid will increase, its ratio with respect to the internal reference molecule has also increased, and also reduced relatively by the competitive influence of internal reference molecule, so has improved detection sensitivity; After this reduce annealing temperature again, so that the internal reference molecular cloning, also can take into account the sign of false negative result.

In the method for third aspect present invention, candidate nucleic acid can suddenly change by gene engineering method well-known to those skilled in the art and/or chemical synthesis process, or selects wherein one section sequence, forms the internal reference molecule.In order to reduce the cost of sudden change, also in order to increase the chance of therefrom selecting the internal reference molecule, the sequence identity of preferred candidate nucleic acid and target nucleic acid is more preferably less than 10% less than 20%.By with the comprehensive comparison of common virus such as the mankind and HBV, HCV, HIV and germ genome sequence, the inventor has found a kind of and the low gene of they sequence identity degree of integrations, it is the neomycin resistance gene (neo) of sequence shown in Seq ID No:1, is suitable for as candidate nucleic acid.Therefore, in the specific embodiment of the present invention, candidate nucleic acid is the neomycin resistance gene, selects or mutate the internal reference molecule listed as the embodiment of the invention on its basis.

For the method for third aspect present invention, in some embodiments, according to target nucleic acid and interior many target nucleic acid primers according to molecules of constructing to the internal reference primer to being inequality.Wherein, with the internal reference primer annealed sequence and internal reference primer are mated fully to sequence in the internal reference molecule, in the preferred described internal reference molecule with the internal reference primer to the annealed sequence length between 10-25 Nucleotide, more preferably between 15-20 Nucleotide.

For the method for third aspect present invention, in other embodiments, according to target nucleic acid and interior many target nucleic acid primers of determining according to molecules of constructing to the internal reference primer to being identical.Wherein, be not exclusively coupling to annealed sequence and internal reference primer to sequence with the internal reference primer in the internal reference molecule, in the preferred described internal reference molecule with the internal reference primer to the annealed sequence length between 25-35 Nucleotide, more preferably between 27-32 Nucleotide.The sequence of preferred wherein said incomplete coupling all is arranged in the sequence of being made up of 3-7 successive A and/or T, more by bit selecting in the sequence of forming by 5 successive A and/or T, the sequence that the also preferred sequence of being made up of 3-7 successive A and/or T is made up of A or T is as 5 '-AAAA-3 ' or 5 '-TTTTT-3 '.The sequence of preferred described incomplete coupling is more close but be not arranged in internal reference molecule and internal reference primer 5 ' end to the annealed sequence, as the distance as described in 5 ' end 6-8 base, and/or 1-3 base of the described 5 ' end of distance, even 12-16 base of the described 5 ' end of distance is also passable, as long as with the internal reference primer annealed sequence length sufficiently long is made the more close 5 ' end in its position but not 3 ' end in the described internal reference molecule.Usually, directly select from candidate nucleic acid owing to be difficult to have an opportunity the internal reference molecule of such character with the internal reference primer to the annealed sequence, therefore need be suddenlyd change to the sequence of selecting on the candidate nucleic acid, with the internal reference primer form on to (that is, target nucleic acid primer to) annealed position in the described internal reference molecule with the internal reference primer to the annealed sequence.For example, can determine that according to target nucleic acid the target nucleic acid primer is right earlier, be that the internal reference primer is right, to be mutated into the right sequence of coupling fully of internal reference primer to the annealed position with the internal reference primer then, and then more close but be not positioned at and the internal reference primer becomes 5 ' distal process of annealed sequence, form the sequence of described incomplete coupling, finish the structure of internal reference molecule thus.

In fourth aspect, the object of the present invention is to provide the application in the method for internal reference molecule target nucleic acid in PCR qualitative detection sample that the described method of third aspect present invention makes up.Correspondingly, the invention provides the method for target nucleic acid in the PCR qualitative detection sample, it comprises pcr amplification and detection, wherein use the internal reference molecule in the pcr amplification, employed internal reference molecule is the internal reference molecule that the described method of third aspect present invention makes up, and reduces annealing temperature in the pcr amplification process.In addition, the preferred wherein amount of internal reference molecule is the optimized amount of the internal reference molecule determined of the described method of first aspect present invention.Like this, reduce the temperature that combines of internal reference primer pair and internal reference molecule, target nucleic acid primer pair and target nucleic acid are preferentially increased under higher temperature (preferred temperature is a target nucleic acid primer pair and the annealing temperature of target nucleic acid); In amplification several or tens (as, 5～10) after the circulation, as existing, the amount of target nucleic acid will increase, its ratio with respect to the internal reference molecule has also increased, and also reduced relatively by the competitive influence of internal reference molecule, so has improved detection sensitivity; After this reduce annealing temperature (preferably reducing to internal reference molecule and the right annealing temperature of internal reference primer) again, so that the internal reference molecular cloning, also can take into account the sign of false negative result.For the method for third aspect present invention, in some embodiments, the target nucleic acid primer to the internal reference primer to being different.Wherein, with the internal reference primer annealed sequence and internal reference primer are mated fully to sequence in the internal reference molecule, the sequence length of preferred described internal reference primer centering forward primer and reverse primer is all between 10-25 Nucleotide, more preferably between 15-20 Nucleotide.For the method for third aspect present invention, in other embodiments, wherein the target nucleic acid primer to the internal reference primer to being identical.Wherein, be not exclusively coupling to annealed sequence and internal reference primer to sequence with the internal reference primer in the internal reference molecule, the sequence length of preferred described internal reference primer centering forward primer and reverse primer is all between 25-35 Nucleotide, more preferably between 27-32 Nucleotide.The sequence of preferred wherein said incomplete coupling all is arranged in the sequence of being made up of 3-7 successive A and/or T, more by bit selecting in the sequence of forming by 5 successive A and/or T, the sequence that the also preferred sequence of being made up of 3-7 successive A and/or T is made up of A or T is as 5 '-AAAA-3 ' or 5 '-TTTTT-3 '.The sequence of preferred described incomplete coupling is more close but be not arranged in internal reference molecule and internal reference primer 5 ' end to the annealed sequence, as the distance as described in 5 ' end 6-8 base, and/or 1-3 base of the described 5 ' end of distance, even 12-16 base of the described 5 ' end of distance is also passable, as long as with the internal reference primer annealed sequence length sufficiently long is made the more close 5 ' end in its position but not 3 ' end in the described internal reference molecule.In addition, the present invention also provides the detection kit in the method that is used for above-mentioned PCR qualitative detection sample target nucleic acid, and wherein the employed internal reference molecule of the method for target nucleic acid is the internal reference molecule that the described method of third aspect present invention makes up in the PCR qualitative detection sample.For example, when (as, detection kit),, adopt the described method of third aspect present invention to make up the internal reference molecule at preparation detection reagent product in order to constitute internal reference molecule wherein.

Aspect the 5th, the object of the present invention is to provide the method for target nucleic acid in the PCR qualitative detection sample, it comprises:

(1) sample is carried out pcr amplification, wherein the internal reference primer that comprised of pcr amplification system is to there being and having only forward primer;

(2) after step (1) is finished, add the reverse primer of internal reference primer, continue sample is carried out pcr amplification; With

(3) after step (2) is finished, detect the target nucleic acid whether amplification is arranged.

The method of fifth aspect present invention has adopted two step pcr amplifications, amplifications in two steps: only add a kind of primer (, forward primer) of internal reference primer centering during the first step pcr amplification, and do not add another kind of primer (that is reverse primer); Carry out the second step pcr amplification then, wherein add reverse primer.In the step (1) of the method for fifth aspect present invention, described pcr amplification system is made up of, internal reference molecule, right forward primer and required reagent and the water of pcr amplification of internal reference primer sample, target nucleic acid primer.Certainly wherein, the target nucleic acid primer to the internal reference primer to being inequality, can't utilize right forward primer of target nucleic acid primer or reverse primer to play the effect of the right reverse primer of internal reference primer.Like this, a nucleic acid chains in the internal reference molecule wherein of in the first step pcr amplification, only increasing, the growth pattern of this nucleic acid chains amount is linear growth, can be much slower than the growth of the target nucleic acid amount of amplification simultaneously.For example, 20 circulations of the first step pcr amplification, the internal reference molecule only produces 20 times of single-chain nucleic acids to original bulk so in theory, if and exist, the amount of target nucleic acid will increase by geometric progression, so the internal reference molecule that produces behind the first step pcr amplification is less owing to relative quantity, and not have ability and target molecule competing reaction substrate, thereby reduced of the competition of internal reference molecule, improved detection sensitivity target nucleic acid.In the second step pcr amplification, mend the right reverse primer of internal reference primer again, the internal reference molecule that increases when reducing competition, plays the effect of internal reference monitoring.

In the method for fifth aspect present invention, the pcr amplification of step (1) can adopt identical annealing temperature with the pcr amplification of step (2), also can adopt different annealing temperatures.For example wherein, the annealing temperature of the pcr amplification of step (1) is than the annealing temperature height of the pcr amplification of step (2), and this moment, preferred wherein internal reference molecule was the internal reference molecule that the described method of third aspect present invention makes up.

In the method for fifth aspect present invention, make that preferably the amount of the forward primer that internal reference primer in the step (1) is right is less, the amount of in step (2), supplying forward primer during the reverse primer of adding internal reference primer.For example, the add-on of the right forward primer of internal reference primer only is no more than 50%, 40%, 30%, 20%, 10% for the adding total amount of the right forward primer of internal reference primer in the method for fifth aspect present invention in the step (1), as for adding 10%, 5% of total amount, the amount of in step (2), supplying forward primer during the reverse primer of the whole internal reference primers of adding.Like this, can further lower the amplification amount of internal reference molecule in the first step pcr amplification, further reduce of the competition of internal reference molecule target nucleic acid.

In the method for fifth aspect present invention, the amount of preferred internal reference molecule is the optimized amount of the definite internal reference molecule of the described method of first aspect present invention.Can further optimize the method for fifth aspect present invention like this, make under the prerequisite that guarantees detection sensitivity as far as possible, take into account the validity of internal reference monitoring amplification.

Aspect the 6th, the object of the present invention is to provide the method for target nucleic acid in the PCR qualitative detection sample, it comprises pcr amplification and detection, wherein use the internal reference molecule in the pcr amplification, it is characterized in that, described internal reference molecule is the internal reference molecule that the described method of third aspect present invention makes up, and/or the amount of described internal reference molecule is the optimized amount of the definite internal reference molecule of the described method of first aspect present invention.The method of sixth aspect present invention can be referring to the method for target nucleic acid in the PCR qualitative detection sample of describing in fourth aspect present invention or the second aspect present invention.

Aspect the 7th, the object of the present invention is to provide the detection kit in the method that is used for fifth aspect present invention or the described PCR qualitative detection of sixth aspect present invention sample target nucleic acid.Preferred described test kit comprises the nucleic acid shown in the Seq ID No:1 as the internal reference molecule.The target nucleic acid primer that uses in the method for target nucleic acid in the preferred described PCR qualitative detection sample to, internal reference molecule, internal reference primer to the required reagent of, pcr amplification and/or detect required reagent and can be divided in the identical or different container.In this article, test kit has conventional sense understood by one of ordinary skill in the art, and for example, during the reagent that uses in having different step, then these different reagent should be sub-packed in different vessels, avoid mixing mutually in advance.Preferred described test kit also has label or specification sheets, is used for indicating the using method of described test kit heterogeneity, and the method for fifth aspect present invention or sixth aspect present invention for example is in order to instruct the carrying out of described method.Label can be attached on the said vesse, perhaps directly prints on the said vesse, also can provide independently specification sheets.Wherein, container can be the container that bottle, box, syringe etc. can hold mentioned component, for example conventional container that is used to adorn PCR, enzyme or nucleic acid reagent.As required, as the needs that conveniently transport, deposit, test kit further packing advances in the bigger packing, and such product also within the scope of the invention.

In eight aspect, the object of the present invention is to provide the described detection kit of seventh aspect present invention to be used for application in the detection reagent product of method of fifth aspect present invention or the described PCR qualitative detection of sixth aspect present invention sample target nucleic acid in preparation.The detection reagent product can be a detection kit itself, also can be to merge the more bulk goods that a plurality of detection kit are housed.According to preamble, those skilled in the art are readily appreciated that the composition of detection kit wherein and the flow process of preparation method's and methods for using them wherein.

For the ease of understanding, below will describe in detail the present invention by concrete accompanying drawing, embodiment.It needs to be noted that these descriptions only are exemplary descriptions, do not constitute limitation of the scope of the invention.According to the argumentation of this specification sheets, many variations of the present invention, change all are conspicuous concerning one of ordinary skill in the art.In addition, the present invention has quoted open source literature, and these documents are in order more clearly to describe the present invention, and their full text content is all included this paper in and carried out reference, just looks like that repeated description is the same excessively in this article for their full text.

Description of drawings

Fig. 1: use internal reference molecule single stage method PCR to detect the detected result figure of the S gene of HBV, wherein IC represents internal reference Molecular Detection peak, and HBV represents the detected peaks of S gene.

Fig. 2: use internal reference molecule two step method PCR to detect the detected result figure of the S gene of HBV, wherein IC represents internal reference Molecular Detection peak, and HBV represents the detected peaks of S gene.

Fig. 3: PCR detects the detected result figure of the S gene of HBV, and wherein IC represents internal reference Molecular Detection peak, and HBV represents the detected peaks of S gene.

The detected result figure of the negative pcr amplification of the S gene of Fig. 4: PCR detection HBV, wherein IC represents internal reference Molecular Detection peak, the detected peaks of expression S gene occurs.

Embodiment

Following this paper will describe invention by specific embodiment.As do not specialize part, can be according to " molecule can swell experiment guide " (third edition) (Cold Spring Harbor laboratory Press), " cell experiment guide " (Science Press that those skilled in the art were familiar with, Beijing, China, calendar year 2001), " RNA experimental technique handbook (Science Press, Beijing, China, 2004), " immunoassay technology " (Science Press, Beijing, China, 1991) etc. listed method is implemented in the reference that laboratory manual and this paper quoted.

The structure of embodiment 1 internal reference molecule and quantitative example

From the neomycin resistance gene (neo) of sequence shown in Seq ID No.1, select the 936th-1076 nucleotide sequence, entrust synthetic this nucleic acid of the precious biotech firm in Dalian, be configured to the internal reference molecule.

In the PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mMTris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The above-mentioned internal reference molecule of 1 copy that dilution obtains, the internal reference primer is to (IC1 (SEQ ID NO.4), IC2 (SEQ ID NO.5), each 0.2uM), 0.2uM IC probe (SEQ IDNO.20), the target nucleic acid primer is to (HBV primer 1 (SEQ ID NO.2), each 0.4uM of HBV primer 2 (SEQ ID NO.3), it is at the S gene on the HBV), 0.2uM HBV probe (SEQID NO.19), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), 0.0005U UNG (uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 30ul (the surplus water is supplied).Carry out PCR:50 ℃ * 2min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 40 circulation.Repeat 80 above-mentioned negative pcr amplifications altogether.

After amplification finishes, the negative pcr amplification product of gained is detected the amplification of internal reference molecule by fluorescent method, detected result is as shown in table 1, (the no ct) that wherein do not detect the internal reference molecule has 30, according to formula (I), the threshold concentration Nc=1/-ln (30/80)=1.02 of internal reference molecule in above-mentioned pcr amplification system.Can get thus, be detected probability greater than 99.5% in order to guarantee the internal reference molecule, it is 1.02 * 5.3=5.4 copy that above-mentioned pcr amplification system should add the optimization concentration that reaches.

Table 1: the fluorescence data detected result of internal reference molecule behind the negative pcr amplification

No.	Results/ct	No.	Results/ct	No.	Results/ct	No.	Results/ct
								1	32	21	34	41	32	61	32
2	33	22	33	42	33	62	no?ct
								3	32	23	31	43	32	63	no?ct
4	no?ct	24	35	44	no?ct	64	33
								5	35	25	no?ct	45	35	65	35
6	34	26	36	46	34	66	34
								7	34	27	35	47	34	67	34
8	33	28	33	48	33	68	34
								9	no?ct	29	no?ct	49	no?ct	69	35
10	no?ct	30	no?ct	50	no?ct	70	no?ct
								11	34	31	34	51	34	71	34
12	no?ct	32	no?ct	52	no?ct	72	no?ct
								13	no?ct	33	no?ct	53	35	73	35
14	no?ct	34	35	54	35	74	no?ct
								15	no?ct	35	no?ct	55	no?ct	75	34
16	36	36	36	56	36	76	35
								17	32.4	37	34	57	34	77	no?ct
18	33	38	33	58	no?ct	78	no?ct
								19	34	39	no?ct	59	no?ct	79	no?ct
20	35	40	no?ct	60	35	80	34

Embodiment 2 uses internal reference molecule single stage method PCR to detect the S gene of HBV

With the S gene of HBV as detect at target nucleic acid.The reagent composition that following primer and pcr amplification below adding in the PCR test tube are required also reaches following final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 5.4 copy sequences shown in SEQ ID NO.21 that dilution obtains, the internal reference primer is to (IC1 (SEQ ID NO.4), IC2 (SEQ ID NO.5), each 0.2uM), (it is by getting available from the examination criteria product dilution of Ministry of Health's visiting central authority for the 5uL target nucleic acid, extent of dilution is respectively 10,100,1000 times or do not contain target nucleic acid), the target nucleic acid primer is to (HBV primer 1 (SEQID NO.2), HBV primer 2 (SEQ ID NO.3), each 0.4uM, it is at the S gene on the HBV), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), and the UNG of 0.0005U (the uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 30ul (the surplus water is supplied).Carry out PCR:50 ℃ * 2min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 40 circulation.

After amplification finishes, the pcr amplification product of gained is detected target nucleic acid by the micro flow chip method, and (target nucleic acid probes is 5 '-(FAM) TGTGT CTGCG GCGTT TTATC A (eclipse)-3 ', can entrust the precious biotech firm in Dalian synthetic) and the internal reference molecule (the internal reference molecular probe is 5 '-(Texas Red) tgcgctgacagccggaacac (eclipse)-3 ', can entrust the precious biotech firm in Dalian synthetic) amplification, detected result as shown in Figure 1, can detect 1000 dilution target nucleic acids, and the internal reference molecule can be monitored effectively.

Embodiment 3 uses internal reference molecule two step method PCR to detect the S gene of HBV

With the S gene of HBV as detect at target nucleic acid.Under the prerequisite that contains target nucleic acid of lower concentration very,, determine that the add-on of the internal reference molecule of sequence shown in SEQ ID NO.21 reaches 100 copies in advance according to the whole process of following two step method PCR.

In the PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 100 copy sequences shown in SEQ ID NO.21 that dilution obtains, 0.2uM internal reference primer I C1 (SEQ ID NO.4), (it is by getting available from the examination criteria product dilution of Ministry of Health's visiting central authority for the 5uL target nucleic acid, extent of dilution is 1000 times or does not contain target nucleic acid), the target nucleic acid primer is to (HBV primer 1 (SEQ IDNO.2), HBV primer 2 (SEQ ID NO.3), each 0.4uM, it is at the S gene on the HBV), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), 0.0005U UNG (uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 20ul (the surplus water is supplied).Carry out PCR:50 ℃ * 2min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 20 circulation.Finish the first step pcr amplification thus.

In above-mentioned PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mMTris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂, 0.2uM internal reference primer I C1 (SEQ ID NO.4), 0.2uM internal reference primer be to IC2 (SEQ ID NO.5), and 0.03U Taq archaeal dna polymerase (can available from MBI company) makes final volume reach 30ul (the surplus water is supplied).Carry out PCR:94 ℃ * 5min by following parameter; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 35 circulation.Finish the second step pcr amplification thus.

After amplification finishes, the pcr amplification product of gained is detected the amplification of target nucleic acid and internal reference molecule by the micro flow chip method, detected result can detect 1000 dilution target nucleic acids, and the internal reference molecule can be monitored effectively as shown in Figure 2.

The structure of embodiment 4 internal reference molecules and the S gene that uses its detection HBV

From the neomycin resistance gene (neo) of sequence shown in Seq ID No.1, select the 936th-1072 nucleotide sequence, and according to the sequence of the determined target nucleic acid primer of the S gene of HBV to (HBV primer 3 (SEQ ID NO.6), HBV primer 4 (SEQ ID NO.7)) sudden change annealing region, and mutate the continuous aaaaa zone (its sequence is shown in SEQ ID NO.16) of containing the sequence that do not match, entrust the nucleic acid of sequence shown in the synthetic SEQ ID NO.16 of the precious biotech firm in Dalian, be configured to the internal reference molecule.

With the S gene of HBV as detect at target nucleic acid.The reagent composition that following primer and pcr amplification below adding in the PCR test tube are required also reaches following final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 4.7 copy sequences shown in SEQ ID NO.16 that dilution obtains, (it is by getting available from the examination criteria product dilution at Ministry of Health visiting center for the 5uL target nucleic acid, extent of dilution is respectively 10,100,1000 times or do not contain target nucleic acid), the target nucleic acid primer is to (HBV primer 3 (SEQ ID NO.6), HBV primer 4 (SEQ ID NO.7), each 0.5uM, it is at the S gene on the HBV, be equivalent to the internal reference primer to), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), 0.0005U UNG (uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 30ul (the surplus water is supplied).Carry out PCR:50 ℃ * 2min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 40 circulation.

After amplification finishes, the pcr amplification product of gained is detected the amplification of target nucleic acid and internal reference molecule by the micro flow chip method, detected result can detect 1000 dilution target nucleic acids, and the internal reference molecule can be monitored effectively as shown in Figure 3; Fig. 4 shows the detected result figure of negative control.

Embodiment 5 uses internal reference molecule single stage method PCR to detect the RNA of HCV

With the non-coding region RNA of HCV as detect at target nucleic acid.Under the prerequisite that does not contain target nucleic acid,, determine the add-on of the internal reference molecule of sequence shown in SEQ ID NO.21 in advance according to the whole process of following PCR.

In the PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mMTris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 5.4 copies shown in SEQ ID NO.21 that dilution obtains, the internal reference primer is to (IC1 (SEQ ID NO.4), IC2 (SEQ ID NO.5), each 0.2uM), (it is by getting available from the examination criteria product dilution of Ministry of Health's visiting central authority for the 5uL target nucleic acid, extent of dilution is respectively 10,100,1000 times or do not contain target nucleic acid), the target nucleic acid primer is to (HCV primer 1 (SEQ ID NO.8), HCV primer 2 (SEQ ID NO.9), each 0.4uM, it is at 5 on the HCV ' non-coding region gene), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05UTaq archaeal dna polymerase (can available from MBI company), 0.5U MMLV ThermoScript II (can available from EPI company), 0.0005U UNG (uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 30ul (the surplus water is supplied).Carry out RT-PCR:42 ℃ * 50min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 40 circulation.

After amplification finishes, the pcr amplification product of gained is detected the amplification of target nucleic acid and internal reference molecule by the micro flow chip method, can detect 1000 dilution target nucleic acids, and the internal reference molecule can effectively monitor, and illustrates that internal reference molecule construction method of the present invention and internal reference molecule method for determination of amount are suitable for the detection to the RNA target nucleic acid too.

Embodiment 6 uses internal reference molecule two step method PCR to detect the RNA of HCV

With the non-coding region RNA of HCV as detect at target nucleic acid.Under the prerequisite of the target nucleic acid that contains critical low concentration,, determine the add-on of the internal reference molecule of sequence shown in SEQ ID NO.21 in advance according to the whole process of following two step method PCR.

In the PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 100 copy sequences shown in SEQ ID NO.21 that dilution obtains, 0.2uM internal reference primer I C1 (SEQ ID NO.4), (it is by getting available from the examination criteria product dilution of Ministry of Health's visiting central authority for the 5uL target nucleic acid, extent of dilution is respectively 10,100,1000 or do not contain target nucleic acid), the target nucleic acid primer is to (HCV primer 1 (SEQ ID NO.8), HCV primer 2 (SEQ ID NO.9), each 0.4uM, it is at 5 on the HCV ' non-coding region gene), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), 0.5U MMLV ThermoScript II (can available from EPI company), the UNG of 0.0005U (the uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 20ul (the surplus water is supplied).Carry out PCR:42 ℃ * 50min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 20 circulation.Finish the first step pcr amplification thus.

In above-mentioned PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mMTris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂, 0.2uM internal reference primer I C1 (SEQ ID NO.4), 0.2uM internal reference primer I C2 (SEQ ID NO.5), 0.03U Taq archaeal dna polymerase (can available from MBI company) makes final volume reach 30ul (the surplus water is supplied).Carry out PCR:94 ℃ * 5min by following parameter; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 35 circulation.Finish the second step pcr amplification thus.

After amplification finishes, the pcr amplification product of gained is detected the amplification of target nucleic acid and internal reference molecule by the micro flow chip method, detected result shows can detect 1000 dilution target nucleic acids, and the internal reference molecule can effectively be monitored.

The structure of embodiment 7 internal reference molecules and the RNA that uses its detection HCV

From the neomycin resistance gene (neo) of sequence shown in Seq ID No.1, select the 936th-1072 nucleotide sequence, and according to the sequence of the determined target nucleic acid primer of the S gene of HCV to (HCV primer 3 (SEQ ID NO.10), HCV primer 4 (SEQ ID NO.11)) sudden change annealing region, and mutate the continuous aaaaa zone (its sequence is shown in SEQ ID NO.17) of containing the sequence that do not match, entrust the nucleic acid of sequence shown in the synthetic SEQ ID NO.17 of the precious biotech firm in Dalian, be configured to the internal reference molecule.

With HCV 5 ' non-coding region gene as detect at target nucleic acid.The reagent composition that following primer and pcr amplification below adding in the PCR test tube are required also reaches following final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 6.2 copies shown in SEQ ID NO.17 that dilution obtains, (it is by getting available from the examination criteria product dilution at Ministry of Health visiting center for the 5uL target nucleic acid, extent of dilution is respectively 10,100,1000 times or do not contain target nucleic acid), the target nucleic acid primer is to (HCV primer 3 (SEQ ID NO.10), HCV primer 4 (SEQ ID NO.11), each 0.6uM, it is at 5 ' non-coding region genes on the HCV, be equivalent to the internal reference primer to), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), 0.5U MMLV ThermoScript II (can available from EPI company), the UNG of 0.0005U (the uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 30ul (the surplus water is supplied).Carry out RT-PCR:42 ℃ * 50min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 40 circulation.

Embodiment 8 uses internal reference molecule single stage method PCR to detect the RNA of HIV

With the gag gene of HIV RNA-1 as detect at target nucleic acid.Under the prerequisite that does not contain target nucleic acid,, determine the add-on of the internal reference molecule of sequence shown in SEQ ID NO.21 in advance according to the whole process of following PCR.

In the PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 5.4 copy sequences shown in SEQ ID NO.21 that dilution obtains, the internal reference primer is to (IC1 (SEQID NO.4), IC2 (SEQ ID NO.5), each 0.2uM), (it is by getting available from the examination criteria product dilution at Ministry of Health visiting center for the 5uL target nucleic acid, extent of dilution is respectively 10,100,1000 or do not contain target nucleic acid), the target nucleic acid primer is to (HIV primer 1 (SEQ ID NO.12), HIV primer 2 (SEQ ID NO.13), each 0.4uM, it is at the gag gene on the HIV), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), the MMLV ThermoScript II of 0.5U (can available from EPI company), 0.0005U UNG (uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 30ul (the surplus water is supplied).Carry out RT-PCR:42 ℃ * 50min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 40 circulation.

Embodiment 9 uses internal reference molecule two step method PCR to detect the RNA of HIV

With the gag gene of HIV RNA-1 as detect at target nucleic acid.Under the prerequisite that contains target nucleic acid of lower concentration very,, determine the add-on of the internal reference molecule of sequence shown in SEQ ID NO.21 in advance according to the whole process of following two step method PCR.

In the PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 100 copies shown in SEQ ID NO.21 that dilution obtains, 0.2uM internal reference primer I C1 (SEQ ID NO.4), (it is by getting available from the examination criteria product dilution of Ministry of Health's visiting central authority for the 5uL target nucleic acid, extent of dilution is respectively 10,100,1000 times or do not contain target nucleic acid), the target nucleic acid primer is to (HIV primer 1 (SEQ ID NO.12), HIV primer 2 (SEQ ID NO.13), each 0.4uM, it is at the gag gene on the HIV), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), 0.5U MMLV ThermoScript II (can available from EPI company), the UN6 of 0.0005U (the uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 20ul (the surplus water is supplied).Carry out PCR:42 ℃ * 50min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 20 circulation.Finish the first step pcr amplification thus.

The structure of embodiment 10 internal reference molecules and the RNA that uses its detection HIV

From the neomycin resistance gene (neo) of sequence shown in Seq ID No.1, select the 936th-1072 nucleotide sequence, and according to the sequence of the determined target nucleic acid primer of the gag gene of HIV to (HIV primer 3 (SEQ ID NO.14), HIV primer 4 (SEQ ID NO.15)) sudden change annealing region, and mutate the continuous aaaaa zone (its sequence is shown in SEQ ID NO.18) of containing the sequence that do not match, entrust the nucleic acid of sequence shown in the synthetic SEQ ID NO.18 of the precious biotech firm in Dalian, be configured to the internal reference molecule.

With the gag gene of HIV as detect at target nucleic acid.In the PCR test tube, add the required reagent composition of following primer and pcr amplification and reach following final concentration: 10mM Tris-HCl (pH 8.5), 50mM KCl, 2mM MgCl ₂The internal reference molecule of 5.6 copy sequences shown in SEQ ID NO.18 that dilution obtains, (it is by getting available from the examination criteria product dilution at Ministry of Health visiting center for the 5uL target nucleic acid, extent of dilution is respectively 10,100,1000 or do not contain target nucleic acid), the target nucleic acid primer is to (HIV primer 3 (SEQ ID NO.14), HIV primer 4 (SEQ ID NO.15), each 0.6uM, it is at the gag gene on the HIV, be equivalent to the internal reference primer to), dATP, dCTP, each 0.2mM of dGTP and dUTP, 0.05U Taq archaeal dna polymerase (can available from MBI company), 0.5U MMLV ThermoScript II (can available from EPI company), the UNG of 0.0005U (the uracil glycosylase, the amplified production that is used to degrade pollutes, can be available from EPI company), make final volume reach 30ul (the surplus water is supplied).Carry out RT-PCR:42 ℃ * 50min by following parameter; 94 ℃ * 5min; (94 ℃ * 20s, 50 ℃ * 20s, 65 ℃ * 45s) * 40 circulation.

Sequence table

＜110〉Shanghai Haoyuan Biotechnology Co., Ltd.

＜120〉the noncompetitive internal reference system in the PCR reaction

<160>21

<210>1

<211>4380

<212>DNA

＜213〉neomycin resistance gene (NEO)

<400>1

1 gggccccccc?tcgaggtcga?cggtatcgat?aagcttgata?tcgaattcct?gcagcccggg

61 ggatccacta?gttctagagc?ggccgccacc?gcggtggagc?tcgctgcatg?caggtcactg

121 gattttggtt?ttaggaatta?gaaattttat?tgatagaagt?attttacaaa?tacaaataca

181 tactaagggt?ttcttatatg?ctcaacacat?gagcgaaacc?ctataagaac?cctaattccc

241 ttatctggga?actactcaca?cattattctg?gagaaaaata?gagagagata?gatttgtaga

301 gagagactgg?tgatttttgc?gggtcccgct?cagaagaact?cgtcaagaag?gcgatagaag

361 gcgatgcgct?gcgaatcggg?agcggcgata?ccgtaaagca?cgaggaagcg?gtcagcccat

421 tcgccgccaa?gctcttcagc?aatatcacgg?gtagccaacg?ctatgtcctg?atagcggtcc

481 gccacaccca?gccggccaca?gtcgatgaat?ccagaaaagc?ggccattttc?caccatgata

541 ttcggcaagc?aggcatcgcc?atgggtcacg?acgagatcct?cgccgtcggg?catgcgcgcc

601 ttgagcctgg?cgaacagttc?ggctggcgcg?agcccctgat?gctcttcgtc?cagatcatcc

661 tgatcgacaa?gaccggcttc?catccgagta?cgtgctcgct?cgatgcgatg?tttcgcttgg

721 tggtcgaatg?ggcaggtagc?cggatcaagc?gtatgcagcc?gccgcattgc?atcagccatg

781 atggatactt?tctcggcagg?agcaaggtga?gatgacagga?gatcctgccc?cggcacttcg

841 cccaatagca?gccagtccct?tcccgcttca?gtgacaacgt?cgagcacagc?tgcgcaagga

901 acgcccgtcg?tggccagcca?cgatagccgc?gctgcctcgt?cctgcagttc?attcagggca

961 ccggacaggt?cggtcttgac?aaaaagaacc?gggcgcccct?gcgctgacag?ccggaacacg

1021 gcggcatcag?agcagccgat?tgtctgttgt?gcccagtcat?agccgaatag?cctctccacc

1081 caagcggccg?gagaacctgc?gtgcaatcca?tcttgttcaa?tccaagctcc?catggtggcc

1141 actcgaggtc?ctctccaaat?gaaatgaact?tccttatata?gaggaagggt?cttgcgaagg

1201 atagtgggat?tgtgcgtcat?cccttacgtc?agtggagata?tcacatcaat?ccacttgctt

1261 tgaagacgtg?gttggaacgt?cttctttttc?cacgatgttc?ctcgtgggtg?ggggtccatc

1321 tttgggacca?ctgtcggtag?aggcatcttg?aacgatagcc?tttcctttat?cgcaatgatg

1381 gcatttgtag?aagccatctt?ccttttctac?tgtcctttcg?atgaagtgac?agatagctgg

1441 gcaatggaat?ccgaggaggt?ttcccgatat?taccctttgt?tgaaaagtct?caatagccct

1501 ctggtcttct?gagactgtat?ctttgatatt?cttggagtag?acgagagtgt?cgtgctccac

1561 catgtttgca?tgcatgcatg?catgcaagct?tggtaccaga?tcttataatt?aaatggcctt

1621 cgctgcccat?attattggta?actcaacagc?atcaatcacg?ggatttttct?cgaattaatt

1681 gcgtcgaatc?tcagcatcga?aatattcgcc?tttttcgtcc?attagactat?ctattgtgat

1741 ggtggattta?tcacaaatgg?gacccgccgc?cgacagaggt?gtgatgttag?gccaggactt

1801 tgaaaatttg?cgcaactatc?gtatagtggc?cgacaaattg?acgccgagtt?gacagactgc

1861 ctagcatttg?agtgaattat?gtaaggtaat?gggctacact?gaattggtag?ctcaaactgt

1921 cagtatttat?gtatatgagt?gtatattttc?gcataatctc?agaccaatct?gaagatgaaa

1981 tgggtatctg?ggaatggcga?aatcaaggca?tcgatcgtga?agtttctcat?ctaagccccc

2041 atttggacgt?gaatgtagac?acgtcgaaat?aaagatttcc?gaattagaat?aatttgttta

2101 ttgctttcgc?ctataaatac?gacggatcgt?aatttgtcgt?tttatcaaaa?tgtactttca

2161 ttttataata?acgctgcgga?catctacatt?tttgaattga?aaaaaaattg?gtaattactc

2221 tttctttttc?tccatattga?ccatcatact?cattgctgat?ccatgtagat?ttcccggaca

2281 tgaagccatt?tacaattgaa?tatatcctgc?cgccgctgcc?gctttgcacc?cggtggagct

2341 tgcatgttgg?tttctacgca?gaactgagcc?ggttaggcag?ataatttcca?ttgagaactg

2401 agccatgtgc?accttccccc?caacacggtg?agcgacgggg?caacggagtg?atccacatgg

2461 gacttttaaa?catcatccgt?cggatggcgt?tgcgagagaa?gcagtcgatc?cgtgagatca

2521 gccgacgcac?cgggcaggcg?cgcaacacga?tcgcaaagta?tttgaacgca?ggtacaatcg

2581 agccgacgtt?cacggtaccg?gaacgaccaa?gcaagctagc?ttagtaaagc?cctcgctaga

2641 ttttaatgcg?gatgttgcga?ttacttcgcc?aactattgcg?ataacaagaa?aaagccagcc

2701 tttcatgata?tatctcccaa?tttgtgtagg?gcttattatg?cacgcttaaa?aataataaaa

2761 gcagacttga?cctgatagtt?tggctgtgag?caattatgtg?cttagtgcat?ctaacgcttg

2821 agttaagccg?cgccgcgaag?cggcgtcggc?ttgaacgaat?tgttagacat?tatttgccga

2881 ctaccttggt?gatctcgcct?ttcacgtagt?ggacaaattc?ttccaactga?tctgcgcgcg

2941 aggccaagcg?atcttcttct?tgtccaagat?aagcctgtct?agcttcaagt?atgacgggct

3001 gatactgggc?cggcaggcgc?tccattgccc?agtcggcagc?gacatccttc?ggcgcgattt

3061 tgccggttac?tgcgctgtac?caaatgcggg?acaacgtaag?cactacattt?cgctcatcgc

3121 cagcccagtc?gggcggcgag?ttccatagcg?ttaaggtttc?atttagcgcc?tcaaatagat

3181 cctgttcagg?aaccggatca?aagagttcct?ccgccgctgg?acctaccaag?gcaacgctat

3241 gttctcttgc?ttttgtcagc?aagatagcca?gatcaatgtc?gatcgtggct?ggctcgaaga

3301 tacctgcaag?aatgtcattg?cgctgccatt?ctccaaattg?cagttcgcgt?ttagctggat

3361 aacgccacgg?aatgatgtcg?tcgtgcacaa?caatggtgac?ttctacagcg?cggagaatct

3421 cgctctctcc?aggggaagcc?gaagtttcca?aaaggtcgtt?gatcaaagct?cgccgcgttg

3481 tttcatcaag?ccttacggtc?accgtaacca?gcaaatcaat?atcactgtgt?ggcttcaggc

3541 cgccatccac?tgcggagccg?tacaaatgta?cggccagcaa?cgtcggttcg?agatggcgct

3601 cgatgacgcc?aactacctct?gatagttgag?tcgatacttc?ggcgatcacc?gcttccctca

3661 tgatgtttaa?ctttgtttta?gggcgactgc?cctgctgcgt?aacatcgttg?ctgctccata

3721 acatcaaaca?tcgacccacg?gcgtaacgcg?cttgctgctt?ggatgcccga?ggcatagact

3781 gtaccccaaa?aaaacagtca?taacaagcca?tgaaaaccgc?cactgcgccg?ttaccaccgc

3841 tgcgttcggt?caaggttctg?gaccagttgc?gtgagcgcat?acgctacttg?cattacagct

3901 tacgaaccga?acaggcttat?gtccactggg?ttcgtgcctt?catccgtttc?cacggtgtgc

3961 gtcacccggc?aaccttgggc?agcagcgaag?tcgaggcatt?tctgtcctgg?ctggcgaacg

4021 agcgcaaggt?ttcggtctcc?acgcatcgtc?aggcattggc?ggccttgctg?ttcttctacg

4081 gcaaggtgct?gtgcacggat?ctgccctggc?ttcaggagat?cggaagacct?cggccgtcgc

4141 ggcgcttgcc?ggtggtgctg?accccggatg?aagtggttcg?catcctcggt?tttctggaag

4201 gcgagcatcg?tttgttcgcc?cagcttctgt?atggaacggg?catgcggatc?agtgagggtt

4261 tgcaactgcg?ggtcaaggat?ctggatttcg?atcacggcac?gatcatcgtg?cgggagggca

4321 agggctccaa?ggatcgggcc?ttgatgttac?ccgagagctt?ggcacccagc?ctgcgcgagc

<210>2

<211>19

<212>DNA

＜213〉artificial sequence

<400>2

CCT?GTC?C?TG?GTT?ATC?GCT?G

<210>3

<211>22

<212>DNA

＜213〉artificial sequence

<400>3

CCA?GAA?GAA?CCA?ACA?AGA?AGA?T

<210>4

<211>18

<212>DNA

＜213〉artificial sequence

<400>4

CTC?GTC?TTG?CAG?TTC?ATT

<210>5

<211>18

<212>DNA

＜213〉artificial sequence

<400>5

gag?agg?cta?ttc?ggc?tat

<210>6

<211>30

<212>DNA

＜213〉artificial sequence

<400>6

tct?gta?ctt?tcc?tgc?tgg?TGGCT?cca?gtt?c

<210>7

<211>31

<212>DNA

＜213〉artificial sequence

<400>7

aaa?att?gag?aga?agt?cca?cc?TCGAG?tct?aga

<210>8

<211>20

<212>DNA

＜213〉artificial sequence

<400>8

TGC?GAA?AGG?CCT?TGT?GGT?AC

<210>9

<211>20

<212>DNA

＜213〉artificial sequence

<400>9

GCA?CGG?TCT?ACG?AGA?CCT?CC

<210>10

<211>30

<212>DNA

＜213〉artificial sequence

<400>10

aac?tac?tgt?ctt?cac?gca?GAAAG?cgt?cta?g

<210>11

<211>30

<212>DNA

＜213〉artificial sequence

<400>11

acc?aca?agg?cct?ttc?gcg?ACCCA?aca?cta?c

<210>12

<211>23

<212>DNA

＜213〉artificial sequence

<400>12

agc?cca?gaa?gta?ata?ccc?atg?tt

<210>13

<211>21

<212>DNA

＜213〉artificial sequence

<400>13

tcc?atc?cta?ttt?gtt?cct?gaa

<210>14

<211>30

<212>DNA

＜213〉artificial sequence

<400>14

agt?ggg?ggg?aca?tca?agc?AGCCA?t?gca?aat

<210>15

<211>30

<212>DNA

＜213〉artificial sequence

<400>15

tca?tcc?atc?cta?ttt?gtt?CCTGG?a?ggg?tac

<210>16

<211>181

<212>DNA

＜213〉artificial sequence

<400>16

cggatcaagc?gtatgcagcc?gccgcattgc

atcagccatg?atggatactt?tctcggcagg?agcaaggtga?gatgacagga?gatcctgccc?cggcacttcg

cccaatagca?gccagtccct

<210>17

<211>180

<212>DNA

＜213〉artificial sequence

<400>17

cggatcaagc?gtatgcagcc?gccgcattgc

atcagccatg?atggatactt?tctcggcagg?agcaaggtga?gatgacagga?gatcctgccc?cggcacttcg

cccaatagca?gccagtccct

<210>18

<211>180

<212>DNA

＜213〉artificial sequence

<400>18

cggatcaagc?gtatgcagcc?gccgcattgc

atcagccatg?atggatactt?tctcggcagg?agcaaggtga?gatgacagga?gatcctgccc?cggcacttcg

cccaatagca?gccagtccct

<210>19

<211>21

<212>DNA

＜213〉artificial sequence

<400>19

TGTGT?C?TGCG?GCGTT?TTATC?A

<210>20

<211>20

<212>DNA

＜213〉artificial sequence

<400>20

tgcgctgacagccggaacac

<210>21

<211>107

<212>DNA

＜213〉artificial sequence

<400>21

Ctc?attcagggca?ccggacaggt?cggtcttgac?aaaaagaacc?gggcgcccct?gcgctgacag?ccggaacacg

gcggcatcag?agcagccgat?tgtctgttgt?gccc

Claims

1.PCR the method for target nucleic acid in the qualitative detection sample, it comprises the steps:

(1) sample is carried out pcr amplification, the pcr amplification system comprises sample, target nucleic acid primer to, internal reference molecule, the right forward primer of internal reference primer;

(2) after step (1) is finished, add the right reverse primer of internal reference primer, continue sample is carried out pcr amplification; With

(3) after step (2) is finished, detect the target nucleic acid whether amplification is arranged;

Wherein the optimized amount of internal reference molecule adopts following method to determine that it comprises the steps:

(1) with identical amplification condition, carry out k identical negative pcr amplification respectively, the add-on of internal reference molecule is No in the described negative pcr amplification system, k 〉=10; It is right to, internal reference molecule and internal reference primer that this feminine gender pcr amplification system comprises the target nucleic acid primer, wherein do not have target nucleic acid;

(3) calculate critical amount Nc according to formula (I)

Nc = \frac{No}{- \ln (t / k)} (I);

With

(4) determine the optimized amount of internal reference molecule according to Nc, the optimized amount of internal reference molecule is between 3.0 * Nc to 9.2 * Nc; Described internal reference molecule is the 936th-1076 a nucleic acid shown in Seq ID No.1, perhaps is nucleic acid shown in Seq ID No:16, Seq ID No:17, Seq ID No:18 or Seq ID No:21.

2. method according to claim 1, wherein k is more than or equal to 30.

3. according to the arbitrary described method of claim 1-2, wherein the optimized amount of internal reference molecule is between 4.6 * Nc to 6.9 * Nc.

4. according to the method for claim 3, wherein the optimized amount of internal reference molecule is 5.3 * Nc.