CN101492694A

CN101492694A - Methods and compositions for directed cloning and subcloning using homologous recombination

Info

Publication number: CN101492694A
Application number: CNA2009100050851A
Authority: CN
Inventors: F·A·斯图尔特; Y·张; J·P·P·穆伊雷尔斯
Original assignee: Europaisches Laboratorium fuer Molekularbiologie EMBL
Current assignee: Europaisches Laboratorium fuer Molekularbiologie EMBL
Priority date: 1999-07-09
Filing date: 2000-07-10
Publication date: 2009-07-29
Anticipated expiration: 2020-07-10
Also published as: NZ516722A; WO2001004288A1; JP4312981B2; KR100751587B1; IL147385A0; CA2377938A1; HU228977B1; ZA200200152B; CN100469877C; DE60022766D1; PL353634A1; MX252928B; CN1373803A; DK1204740T3; ES2249291T3; JP2009106295A; CN101492694B; CA2377938C; EP1204740B1; MXPA02000233A

Abstract

The present invention is directed to methods and compositions for DNA subcloning using bacterial recombinase-mediated homologous recombination. The invention relates to methods for cloning, compositions comprising polynucleotides useful as cloning vectors, cells comprising such polynucleotide compositions, and kits useful for cloning mediated by bacterial recombinases, such as RecE/T and Red alpha / beta .

Description

Use the method and composition of homologous recombination directed cloning and subclone

The application is to be the Chinese patent application 00812739.5 on July 10th, 2000 dividing an application of " using the method and composition of homologous recombination directed cloning and subclone " applying date.

1. technical field

The homologous recombination technique that the present invention relates to use the bacterial recombinase mediation carries out the method and composition of dna clone and subclone.In a specific embodiments, use RecE/T or Red α/β recombinase, or any function equivalence system starts the bacterium homologous recombination, Tathagata is from the erf of phage P22.Specifically, the present invention relates to cloning process, diagnostic method contains the composition as the polynucleotide of cloning vector, contains the cell of described polynucleotide compositions, and by RecE/T and Red α/beta mediated clone's test kit.

2. background technology

Carrying out dna clone and subclone in intestinal bacteria is molecular biological basis.Dna clone is meant a process, and one of them replication orgin operability is connected in double chain DNA fragment, and increases in intestinal bacteria or other suitable hosts.The DNA subclone also is meant a process, wherein double chain DNA fragment is taken from a dna molecular that had increased already, described amplification can be carried out external, as pass through PCR, also can carry out in vivo, as in intestinal bacteria or other suitable hosts, increasing, then this dna fragmentation operability is connected in replication orgin.The typical case that carries out in intestinal bacteria clone and subclone are that the end with dna fragmentation is connected with the linearized vector end, but described carrier comprises colibacillary replication orgin and selective marker.But the selective marker that carrier comprises can guarantee new clone product, contain and insert segmental plasmid when importing its host cell intestinal bacteria, can keep and increase.

Traditional cloning process has some limitation.For example, because traditional cloning process needs the application limitations enzyme, so the selection of dna fragmentation just is subjected to certain limitation, i.e. recognition site that must restricted property enzyme in the target dna zone.Restriction site must make enzyme cut to be positioned at outside the required dna fragmentation, and can not exist wherein.Because it is quite frequent that most useful Restriction Enzymes play a role, so the size of gained linear DNA fragment also is restricted.

It is second major defect of traditional subclone that using polymerase chain reaction (PCR) produces dna fragmentation.The end of PCR product can not be used for ligation, because heat-resisting polymerase has added nontemplated nucleotide at amplification PCR products 3 ' end.And, use PCR and also have the excessive risk of sudden change.Therefore, molecular biologist is being sought the new more effectively segmental method of cloned DNA, particularly when these fragments compare by traditional Restriction Enzyme or obtainable segment length of PCR method institute.

Homologous recombination is the another kind of alternative method of clone and subclone dna fragmentation.Method in the intestinal bacteria Central Asia clone PCR products that contains host's homologous recombination system was stated (Oliner etal., 1993, Nucleic Acids Res.21:5192-97 already; Bubeck et al., 1993, Nucl.Acids.Res.21:3601-3602).In these methods, the segmental PCR primer of the target dna that is used to increase, the end sequence that is designed to contain and linearizing carrier end sequence homology.Then PCR product and linearized vector are imported intestinal bacteria.The homologous recombination of carrying out in e. coli host cell is inserted in the plasmid vector PCR product sequence.Can be used for subclone PCR fragment although these methods have shown already, they also are not used in the long dna fragmentation of subclone, perhaps clone the dna fragmentation of any size.

The subclone method is to use two linear DNA molecule transformed into escherichia coli sbcBC host cells in the another kind of body of describing, and one in these two dna moleculars has replication orgin, and two molecules all have long homology zone at its end.Homologous recombination takes place in vivo, causes the cyclisation and the propagation (Degryse, 1996, Gene 170:45) of the new plasmid that forms.Then, this ability of intestinal bacteria sbcBC host cell mediation homologous recombination is used for large-scale dna fragmentation (Chartier et al., 1996, the J.Virol.70:4805 of subclone from adenovirus and hsv gene group DNAs again; Messerle, et al., 1997, Proc.Natl.Acad.Sci.USA 94,14759-14763; He, 1998, Proc.Natl.Acad.Sci.USA 95:2509-2514).As described in it, need at least two pre-prepd subclone steps, make long homology zone be positioned at the both sides of intestinal bacteria replication orgin by in intestinal bacteria sbcBC host cell, carrying out homologous recombination.And also not having document to show can carry out dna clone in intestinal bacteria sbcBC bacterial strain.

Recently, (homologous recombination of mediation of Red α/β) had shown already and can be used for preparing dna molecular (Zhang et al., 1998, Nature Genetics, 20,123-128 intestinal bacteria by RecE/RecT (RecE/T) or Red α/Red β; Muyrers et al., 1999, Nucleic Acids Res.27:1555-1557).These documents show, in intestinal bacteria, any complete and independent duplicating, ring-shaped DNA molecule all can change by RecE/T or Red α/beta mediated reorganization, linear DNA is used in this reorganization, and the short regional sequence of the flank of this linear DNA molecule is consistent with the corresponding zone of ring molecule.By homologous recombination technique linear DNA molecule is incorporated in the ring molecule, makes the corresponding sequence of the sequence displacement ring-shaped DNA molecule between its flanking sequence.

Prior art of the present invention that the document that this paper quotes should not be construed as that Here it is.

3. summary of the invention

The invention provides the homologous recombination of using the bacterial recombinase mediation and carry out the method and composition of dna clone and subclone.The preferred RecE/T of bacterial recombinase and/or Red α/β.These methods can be used for clone, subclone, propagation and amplification herbicide-tolerant polynucleotide or polynucleotide mixture, use the carrier that comprises with a short zone of target specified target dna sequence dna flanking sequence homologous DNA and a replication orgin.

In one embodiment, the invention provides a kind of method that double-stranded target DNA is imported carrier, the bacterium that comprises the functional recombinase of culture expression, described bacterium comprises (a) target DNA, contain first double-stranded terminal and second double-stranded end, and (b) carrier DNA, on the carrier DNA chain, contain in the following sequence: (i) (ii) replication orgin of first double-stranded homology arm, and (iii) second double-stranded homology arm, like this, first homology arm sequence of carrier DNA chain and first end sequence homology of target dna strand, second homology arm sequence of carrier DNA chain and second end sequence homology of target dna strand, like this, target DNA can insert in the carrier DNA between homology arm.

In another embodiment, the method for preparing the homologous dna molecule is provided, comprise: a) with double-stranded carrier transfered cell, described cell contains double-stranded target DNA, and expresses bacterial recombinase, described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, a chain of replication orgin, and second homology arm; Described target DNA contains a target DNA sequence and two ends, on target dna strand, from 3 ' to 5 ', exist in the following sequence: first end, the target DNA sequence, and second end, first homology arm sequence on the carrier DNA chain and first end sequence homology on the target dna strand like this, second homology arm sequence on the carrier DNA chain and second end sequence homology on the target dna strand; And b) cell is placed under the condition that homologous recombination in the cell can take place.

In another embodiment, the method for preparing the homologous dna molecule is provided, comprise: a) with double-stranded carrier and first, second double chain oligonucleotide transfered cell, described cell contains double-stranded target DNA, and expresses bacterial recombinase, described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; Described target DNA contains a target DNA sequence and two ends, on target dna strand, and from 3 ' to 5 ': first end, target DNA sequence, and second end; Described first oligonucleotide contains first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand; Described second oligonucleotide contains second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand; And b) cell is placed under the condition that homologous recombination in the cell can take place.

In another embodiment, the method for preparing the homologous dna molecule is provided, comprise: a) with double-stranded target DNA molecule transfered cell, described cell contains a carrier, and expresses bacterial recombinase, described target DNA contains a target DNA sequence and two double-stranded ends, on target dna strand, from 3 ' to 5 ', exist in the following sequence: first end, target DNA sequence, and second end; Described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, and from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; First homology arm sequence on the carrier DNA chain and first end sequence homology on the target dna strand like this, second homology arm sequence on the carrier DNA chain and second end sequence homology on the target dna strand; And b) cell is placed under the condition that homologous recombination in the cell can take place.

In another embodiment, the method for preparing the homologous dna molecule is provided, comprise: a) with double-stranded target DNA molecule and first, second double chain oligonucleotide transfered cell, described cell contains a carrier, and expresses bacterial recombinase, described target DNA contains a target DNA sequence and two ends, on target dna strand, from 3 ' to 5 ', exist in the following sequence: first end, target DNA sequence, and second end; Described first oligonucleotide contains first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand; Described second oligonucleotide contains second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand; Described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, and from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; And b) cell is placed under the condition that homologous recombination in the cell can take place.

In another embodiment, the method for preparing the homologous dna molecule is provided, comprise: a) double-stranded carrier and double-stranded target DNA are imported the cell of expressing bacterial recombinase, described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; Described target DNA contains a target DNA sequence and two ends, on target dna strand, and from 3 ' to 5 ', exist in the following sequence: first end, target DNA sequence, and second end; First homology arm sequence on the carrier DNA chain and first end sequence homology on the target dna strand like this, second homology arm sequence on the carrier DNA chain and second end sequence homology on the target dna strand; And b) cell is placed under the condition that homologous recombination in the cell can take place.

In a particular of this method, host cell also comprises a nucleotide sequence, site-specific recombinase that links to each other with the promotor operability of this sequence encoding, carrier also comprise site-specific recombinase identification first, second recognition site, first recognition site is positioned at first and second homology arm outside, and second site-specific recombinase recognition site is positioned at first and second homology arm inside; During step b) is carried out or afterwards, induce the expression of site-specific recombinase.

In another particular of this method, host cell also comprises a nucleotide sequence, site-specific recombinase that links to each other with the promotor operability of this sequence encoding, carrier also comprises a site-specific recombinase recognition site, and this site is positioned at first and second homology arm inside; During step b) is carried out or afterwards, induce the expression of site-specific recombinase.

In another embodiment, the method for preparing the homologous dna molecule is provided, comprise: a) with double-stranded carrier, double-stranded target DNA molecule, and first, second double chain oligonucleotide import the cell of expressing bacterial recombinase, described carrier contains a replication orgin and two double-stranded homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; Described target DNA contains a target DNA sequence and two double-stranded ends, on target dna strand, and from 3 ' to 5 ', exist in the following sequence: first end, target DNA sequence, and second end; Described first oligonucleotide contains first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand; Described second oligonucleotide contains second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand; And b) cell is placed under the condition that homologous recombination in the cell can take place.

In another particular of this method, wherein, host cell also comprises a nucleotide sequence, site-specific recombinase that links to each other with the promotor operability of this sequence encoding, carrier also comprises a site-specific recombinase recognition site, and this site is positioned at first and second homology arm inside; During step b) is carried out or afterwards, induce the expression of site-specific recombinase.

In specific embodiments, but carrier also comprises a selective marker that is positioned at the homology arm outside, like this, on the carrier DNA chain, from 5 ' to 3 ', carrier can following two kinds of orders contain: i) first homology arm, but selective marker, replication orgin and second homology arm, or ii) first homology arm, replication orgin, but selective marker and second homology arm.In a particular, but selective marker makes the cell that contains this carrier present antibiotic resistance.

In a plurality of particular, bacterial recombinase is RecE/T or Red α/β recombinase, perhaps uses RecE/T and Red α/β simultaneously.In other particular, cell is a bacterial cell.In other particular, cell is a Bacillus coli cells.In other particular, cell is an eukaryotic cell, and recombinant expressed RecE/T and/or Red α/β albumen.In other particular, this method also comprises the separating recombinating DNA molecule, and this molecule contains the target DNA that is inserted in the carrier.

In another embodiment, the present invention also provides the double-stranded DNA carrier that is used for directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; Like this, article one, the nucleotide sequence of first homology arm on the carrier DNA chain and first end sequence homology on article one target dna strand, second terminal nucleotide sequence homology on the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand.In a particular of relevant carrier, replication orgin is the bacterium replication orgin.In another particular, replication orgin plays a role in intestinal bacteria.In another particular, replication orgin plays a role in mammalian cell.

The present invention also provides the cell that contains the double-stranded DNA carrier, this carrier can be used for directed cloning or subclone target dna molecular, comprise a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; Like this, article one, the nucleotide sequence of first homology arm on the carrier DNA chain and first end sequence homology on article one target dna strand, second terminal nucleotide sequence homology on the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand.In a particular, cell is a bacterial cell.

The present invention also provides the test kit that can be used for directed cloning or subclone target DNA molecule, this test kit comprises one or more containers: the double-stranded DNA carrier that a) is used for directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; Like this, article one, the nucleotide sequence of first homology arm on the carrier DNA chain and first end sequence homology on article one target dna strand, second terminal nucleotide sequence homology on the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand; And b) contains the cell of bacterial recombinase.In the particular of a relevant test kit, the sequence of homology arm with based on BAC, PAC, λ, the cloning vector homology of plasmid or YAC.In another relevant particular of test kit, the nucleotide sequence that first and second double chain oligonucleotide have with based on BAC, PAC, λ, the cloning vector homology of plasmid or YAC.

In another embodiment, the test kit that is used for directed cloning or subclone target DNA molecule is provided, this test kit comprises one or more containers: the double-stranded DNA carrier that a) is used for directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; B) first double chain oligonucleotide, contain first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand; C) second oligonucleotide, contain second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand; And d) contains the cell of bacterial recombinase.In the particular of a relevant test kit, cell is a Bacillus coli cells.In another relevant particular of test kit, cell is the freeze-stored cell with picked-up DNA ability.

In another embodiment, the invention provides the test kit that is used for directed cloning or subclone target DNA molecule, this test kit comprises one or more containers: the double-stranded DNA carrier that a) is used for directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; B) first double chain oligonucleotide, contain first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand; And c) second oligonucleotide, contain second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand.In the particular of a relevant test kit, the purified processing of dna vector.In another relevant particular of test kit, dna vector, first double chain oligonucleotide and second all purified processing of double chain oligonucleotide.

In another relevant particular of test kit provided by the invention, the target DNA molecule comprises bacterium, virus, parasite or protozoon DNA.In another particular, the target DNA molecule comprises transgenation or polymorphism known or suspection and certain dysfunction or disease-related.In another particular, bacterial recombinase is RecE/T or Red α/β recombinase, or RecE/T and two kinds of recombinases of Red α/β.

Method of the present invention also can be used for diagnosis.For example, plasmid or linear DNA fragment can be designed to be able to capture the specificity target DNA, whether be present in experimenter's sample to detect this DNA, as, viral DNA is present in patient's sample.In one embodiment, the invention provides detection when producer suddenlys change, the method for the target DNA of known or doubtful and dysfunction or disease-related.In specific embodiments, this target DNA is bacterium, virus, parasite or protozoon DNA.In a particular, a kind of method is provided, this method comprises that further detection contains the recombinant DNA molecules that is inserted into the target DNA in the carrier.In another embodiment, this method comprises that also detection contains the recombinant DNA molecules that is inserted into the target DNA in the carrier.

In another embodiment, the present invention also provides a kind of method that infectious substance exists of surveying, and wherein, target DNA is derived from suspects the patient who suffers from infectious diseases, and, the dna sequence dna homology that exists in first and second homology arm and the infectious substance.In a particular, target DNA is derived from suspects the patient suffer from infectious diseases, and, the dna sequence dna homology that exists in described second and the 4th nucleotide sequence and the infectious substance.In another particular, infectious substance is virus, bacterium, protozoon, fungi or parasite.

In another embodiment, the present invention also provides a kind of detection heredity patient's condition, disease, the method that dysfunction or polymorphism feature exist, wherein, target DNA is derived from suspects to suffer from the heredity patient's condition, disease, the patient of dysfunction or polymorphism feature, and, the sequence of first homology arm and known or the suspection and the described heredity patient's condition, disease, the site upstream sequence homology that dysfunction or polymorphism feature are relevant, the sequence of second homology arm and known or the suspection and the described heredity patient's condition, disease, the site downstream sequence homology that dysfunction or polymorphism feature are relevant.In a particular, a kind of detection heredity patient's condition is provided, heredopathia, the method that heredity dysfunction or polymorphism feature exist, wherein, target DNA is derived from suspects to suffer from the heredity patient's condition, heredopathia, the patient of heredity dysfunction or polymorphism feature, and, first double chain oligonucleotide sequence and known or the suspection and the described heredity patient's condition, heredopathia, the site upstream sequence homology that heredity dysfunction or polymorphism feature are relevant, second double chain oligonucleotide sequence and known or the suspection and the described heredity patient's condition, heredopathia, the site downstream sequence homology that heredity dysfunction or polymorphism feature are relevant.In a particular, the heredity patient's condition, heredopathia, heredity dysfunction or polymorphism feature suffer from the patient or the susceptible tumour, asthma, sacroiliitis, resistance, drug toxicity, or neural system, neural spirit, metabolism, muscle, cardiovascular or skin conditions, disease or dysfunction.

4. description of drawings

Figure 1A-C.The formation of homologous recombination clone and subclone method.

A. carrier comprises a replication orgin (starting point), but a selective marker (Sm) and two homology arms (with A and B representative).

B. alternative double chain oligonucleotide adapter (adaptor).Each adapter comprises and homology arm (being respectively A and B) homologous zone (with A ' and B ' representative); With target DNA end (respectively with C and D representative) second zone of homologous (with C ' and D ' representative).

C. target DNA.Target DNA terminal nucleotide sequence (C and D) can with the nucleotide sequence homology of the homology arm (being respectively A and B) of carrier, also can with the nucleotide sequence homology of alternative adapter oligonucleotide (respectively with C ' and D ' representative).

Fig. 2.The experiment main points of method 1.The carrier that carries out subclone by homologous recombination technique is passable, for example by transforming, imports escherichia coli host, has had target DNA and RecE/T or Red α/β albumen among this host.But this figure has illustrated to carry the linear DNA molecule of intestinal bacteria replication orgin and selectable marker gene (Sm), and " homology arm " flank is arranged, and preferred its product of described Sm has the gene of antibiotic resistance.Homology arm shown in the figure is the grey square frame that is positioned at the linear DNA molecule two ends, homology arm be with target DNA in be positioned at the short zone of the regional homologous of two of subclone DNA district flank, this subclone DNA district flank is called the target DNA end again, in the drawings the thick line that is held by the homology arm flank.After the conversion, the selective expression of Sm gene can be used to identify the cell that contains the homologous recombination product, and described homologous recombination is between the homology arm and target DNA of linear DNA molecule.

Fig. 3.Represent method 2 in the mode of drawing.This method is similar with the method that is used for Fig. 1, and difference is that in the method the target DNA molecule is not present in the escherichia coli host in advance, but with the linear DNA carrier molecule, the common importing.Target DNA can be any source, can be a kind of mixture also, is derived from the target dna zone that needs the clone, or is rich in the molecule of DNA, and being derived from needs the DNA of subclone zone.As shown in Figure 1, homology arm is represented with the grey square frame.

Fig. 4.Represent method 3 in the mode of drawing.But clone or subcloning vector comprise an intestinal bacteria replication orgin and a selectable marker gene (Sm), and its flank is two homology galianconism, shows with the grey square frame.In addition, carrier also comprises two reorganization target sites (SSRTs), but one of them is between starting point and selectable marker gene.The most simply be at first to be linear DNA fragment as shown in the figure with vector construction.On the cyclisation basis, make second SSRT between two homology arms, orientation becomes the direct repetition with respect to first SSRT, like this, locus specificity reorganization between two SSRTs will produce two different ring molecules, thereby but starting point and selectable marker gene is separated.The cyclisation carrier is transformed into expresses RecE/T or Red α/β albumen maybe can be expressed in RecE/T or the proteic coli strain of Red α/β.Coli strain also carries one can induce site-specific recombinase (SSR) gene, the SSRTs of this gene product in can identification carrier, like this, unless the site-specific recombinase gene is induced or expressed,, the locus specificity between SSRTs can take place just recombinating.The Bacillus coli cells of carrier and regulatory site specificity recombinase gene is carried in preparation, makes them carry RecE/T or Red α/β albumen, and can be used for transforming.The dna molecular that will contain pre-clone zone then imports host cell.After carrying out homologous recombination between homology arm, induce the proteic expression of site-specific recombinase, but and the expression of screening selectable marker gene.Before locus specificity reorganization, cell or comprise the not recombinant vectors that carries two SSRTs perhaps comprises required homologous recombination product, and this product only carries a SSRT, because homologous recombination will be removed the SSRT between two homology arms.Behind the site-specific recombinase abduction delivering, but the expression of screening selective marker like this, comprises that the cell of homologous recombination product will obtain viability, because this product no longer is the substrate of locus specificity reorganization.

Fig. 5.By RecE/T or Red α/β homologous recombination, use adapter oligonucleotide clone or subclone.This figure illustrates the variation of method 2 shown in Figure 3.Two adapter oligonucleotide, each all comprises two homologous regions, a homology arm homology of one of them homologous region and carrier, a homology of two ends of second homologous region and target target DNA zone.The clone in the cyclisation of carrier and target dna zone can by between carrier and the adapter and the homologous recombination between adapter and the target DNA finish.In this embodiment, there is not sequence homology between carrier and the target DNA.Therefore, by using target-specific adapter oligonucleotide, can use the different target DNA of identical carrier cloning or subclone with respect to each target DNA.The adapter oligonucleotide also can be used for

method

1 and 3, as above shown in Fig. 1 and 3.

Fig. 6.The painted sepharose of bromination second pyridine, the result behind the display application EcoRI dna digestion.The DNA of digestion is from 9 independent clonings (swimming lane 1-9) of mAF4BAC experiment.Swimming lane M be 1kb DNA standard substance (BRL, Bethesda, MD).Swimming lane 10, the initial vector of EcoRI digestion.This experiment will have a detailed description in the embodiment of part 6.

Fig. 7 A-B.Cloned DNA district from total pastoris genomic dna.

A. illustrate the PCR fragment of the p15A starting point that increased, its flank is the homology arm of two 98 or 102bp, its either side integrated 98 or the yeast strain MGD353-13D of 102bp in the penbritin drug resistant gene.PCR product (0.5mg) and total pastoris genomic dna (4.0mg) is mixed, and electricity is transformed in the JC5519 intestinal bacteria, and this bacterial strain contains from the Red α of pBAD α β γ/β expresses.Identify the clone by screening penbritin resistance.

B. bromination second pyridine stained gel is confirmed the correct clone among 10 alternative clones.

Fig. 8 A-C.In the ET subclone, the terminal tumor-necrosis factor glycoproteins that occurs of linear carrier or the effect of 5 ' phosphoric acid.

A. shown the oligonucleotide sequence that is used for the pcr amplification linear carrier.The italic sequence is represented the necessary oligonucleotide part of pcr amplification linear carrier, and other Nucleotide constitute the homology arm of intestinal bacteria lacZ gene.The black matrix sequence all occurs at the two ends of linear carrier, can form terminal repetition like this.Linear carrier construction a-x has the tumor-necrosis factor glycoproteins of different lengths.This linear carrier comprises the p15A replication orgin, adds paraxin drug resistant gene Cm ', and flank is two homology arms, and illustrated terminal repeat.

B. illustrate and be used to detect the strategy of vector construct in ET subclone intestinal bacteria lacZ gene efficient, shown in vector construct contain the different tumor-necrosis factor glycoproteinss shown in the A.

C. tabulation has shown the effect to ET subclone efficient of tumor-necrosis factor glycoproteins length and phosphorylation.Application contains the test result that the carrier of tumor-necrosis factor glycoproteins shown in the A obtains, and it is as shown in the table.

Fig. 9 A-B.Use pBAD-α β γ (tet) and carry out ET reorganization subclone.

A. illustrate pR6K/BAD α β γ plasmid, comprise the R6K starting point, the pir-116 replicon, from the tetracycline resistance gene of pBR322 (tet '), and pectinose suppresses son (araC).

B. relatively use pBAD-α β γ (tet) and (ColE1ori) carry out ET reorganization subclone with pR6K/BAD α β γ.

Figure 10 A-B.The 19kb fragment of subclone AF-4 gene on BAC.

A. plasmid construction thing and subclone strategy, tet ', tetracycline resistance gene.AraC, pectinose suppresses son.

B. analyze 5 independent clonings.Bromination second pyridine dyeing HindIII dna digestion gel, this DNA is from correct clone of 5 independences and linear carrier.The colloid subclone is confirmed through dna sequence analysis.M, 1kb DNA ladder.

Figure 11 A-B.Applying gene group DNA carries out the ET subclone as the target DNA source.

A. digest pre-linearizing from colibacillary genomic dna by XhoI.This linear carrier comprises ColE1 starting point and kantlex drug resistant gene kan, and its flank is a homology arm, reorganization can be positioned the lacI/lacZ site of escherichia coli chromosome.

B. to the restriction analysis of 16 independent clonings.Swimming lane 17 is represented linear carrier.M, the 1kbDNA ladder.

Figure 12 A-B.Subclone is from the neomycin gene neo of mouse ES cell genomic dna.

A. subclone policy map.

B. kantlex resistance clone's restriction analysis.

Figure 13.The combination of ET clone and subclone.

5. embodiment

The homologous recombination technique that the present invention relates to use the bacterial recombinase mediation carries out the method and composition of dna clone and subclone.The inventor finds, bacterial recombinase can certain ad hoc fashion, is used for obtaining efficient target clone or subclone.

Bacterial recombinase advantageous applications RecE/T and/or Red α/β.In intestinal bacteria, the RecE/T approach was described in the past already to some extent, and its component is also by part understanding (Hall and Kolodner, 1994, Proc.Natl.Acad.Sci.U.S.A.91:3205-3209; Gillen et al., 1981, J.Bacteriol.145:521-532).Reorganization by the RecE/T approach needs two expression of gene, rec E and rec T, its dna sequence dna open (Hall et al., 1993, J.Bacteriol.175:277-278).The proteic function of Rec E is similar to the λ exon, the latter Red α that is otherwise known as, the proteic function of Rec T similar (Gillen et al., 1977, J.Mol.Biol.113:27-41 to the erf of Red β and phage P22; Little, 1967, J.Biol.Chem.242:679-686; Radding and Carter, 1971, J.Biol.Chem.246:2513-2518; Joseph and Kolodner, 1983, Biol.Chem.258:10411-17; Joseph and Kolodner, 1983, Biol.Chem.258:10418-24; Muniyappa and Radding, 1986, J.Biol.Chem.261:7472-7478; Kmiec andHollomon, 1981, J.Biol.Chem.256:12636-12639; Poteete and Fenton, 1983, J.Mol.Biol.163:257-275; Passy et al., 1999, Proc.Natl.Acad.Sci.USA 96:4279-4284, and the reference of these reference citations).

Described hereinly relate to use the method and composition that bacterial recombinase instructs dna clone and subclone.The term " dna clone " that this paper uses is meant that the DNA with any source is inserted into the process of autonomous replicating vector, and like this, this DNA can breed in host cell.Term " DNA subclone " is meant that the dna fragmentation that will be present in autonomous replicating vector already shuttles back and forth in the process of another autonomous replicating vector, perhaps will be from being rich in the genomic dna fragmentation of dna molecular such as purified virus or shuttling back and forth in the process of another autonomous replicating vector through the dna fragmentation of pcr amplification.Term " orientation " or " target " clone and subclone are meant uses homology arm and (being) adapter oligonucleotide is selected target DNA in a lot of embodiments, and selection and directive action by homology arm, the insertion of guidance or directed target DNA.Be noted that all application methods of the present invention are applicable to clone and subclone DNA.

The structure of the present composition and method will give elaboration here.Specifically, part 5.1 has been described the present invention and has been used the segmental mediation recombinant clone of homologous recombination technique target cloned DNA method.Following part 5.2 has been described the present composition, comprises that design is used for locating, capturing and clone the DNA construction of target dna fragmentation.This part has also been described coding bacterial recombinase such as RecE/T and/or the proteic nucleic acid molecule of Red α/β, contains the cell of these compositions, and the method that makes up these nucleic acid and cell.Following part 5.3 has been described the application of bacterial recombinase target cloning process, and the test kit of surveying the genetic expression and the state that diagnoses the illness.

5.1 method by homologous recombination technique clone and subclone

By the homologous recombination technique of bacterial recombinase mediation, can use different methods described herein, efficient target is cloned any target dna.The required common component of 3 kinds of methods described herein is a kind of cell and carrier of expressing the bacterial recombinase recombinant protein.An example of this carrier is seen Figure 1A.Carrier comprises 3 essential elements: a replication orgin and two short districts of double-stranded DNA, this paper is called " homology arm " again.

Homology arm specially is designed to can pass through homologous recombination technique, allows carrier " to capture " the target target DNA between two homology arms.The sequence of homology arm, position and directional property are most important for the correct insertion of target DNA between two arms.In one embodiment, the terminal homology of homology arm sequence and target DNA, the dna sequence dna of two homology arms is positioned at the flank of target target DNA, one of them arm (representing with A in Fig. 1) is corresponding to the upstream dna sequence dna of target DNA (representing with C in Fig. 1), and second arm (representing with B in Fig. 1) is corresponding to the downstream sequence of target DNA (representing with D in Fig. 1).Two arms with respect to the directional property of required insertion must with the directional property identical (see figure 1) of homologous sequence with respect to target DNA, like this, the reorganization between homology arm and the target DNA just can cause target DNA to be inserted between two homology arms or " inside " (see figure 1).Here, a position is defined as homology arm " inside " and is meant, if this position is between two homology arms, like this, in one direction, first homology arm is between replication orgin and itself, on another direction, second homology arm is between replication orgin and itself.Otherwise a position is defined as homology arm " outside " and is meant, if in one direction, does not have homology arm itself and replication orgin can be separated.Therefore, by this definition, replication orgin and can select mark to be positioned at " outside " (see figure 1) of carrier homology arm, like this, but the insertion of target sequence can not influence replication orgin and selective marker on the plasmid.On the contrary, by this definition, target DNA is " inside " that is inserted into homology arm.Figure 1A depicts homology arm " inside " and " outside " visually.

In another embodiment, homology arm sequence and the double-stranded adapter oligonucleotide homology of a cover.These adapter oligonucleotide are shown in Figure 1B.Each adapter oligonucleotide sequence all comprises the sequence of a homology arm of carrier, and with target gene flanking sequence homologous sequence (seeing Fig. 1 C).Therefore, an adapter oligonucleotide comprises one and homology arm dna sequence dna homologous sequence (representing with A ') in Fig. 1, and the upstream nucleotide sequence of target DNA (representing with C ' in Fig. 1).Second adapter oligonucleotide comprises one and homology arm dna sequence dna homologous sequence (representing with B ') in Fig. 1, and the nucleotide sequence (representing with D ' at Fig. 1) that is arranged in the target DNA downstream.By this way, the adapter oligonucleotide can be used for making common homologous clone carrier to adapt to target specific target gene order (see figure 5) by changing its sequence.The method and composition that can be used for carrying out multiple embodiments of the present invention will give detailed description here.

The method that describes below comprises three kinds of different methods, carries out directed cloning by homologous recombination technique.As detailed below, each of these three kinds of methods all has their advantage, can preferably be used for carrying out concrete clone and use.These methods and applications will describe in detail below.In a method, as shown in Figure 2, cloning vector is imported into the cell that contains the target target DNA.This method can be used to insertion is shuttled back and forth in another replicon from a replicon easily, and need not to carry out tiring restriction analysis and manipulation in vitro.This method can be used for the situation that target DNA had been present in the intestinal bacteria replicon already, and its further application need carries out subclone to selecting part.For example, separate from the dna clone in clay, phage or BAC storehouse can by with the selected portion subclone in novel vector and use easily, described subclone is for insertion sequence being carried out sequential analysis or expressing gene encoded protein.In the second approach, as shown in Figure 3, earlier preparation cloning vector and target target DNA, transfered cell together then.In addition, as shown in Figure 4, target dna is added in the cell that comprises cloning vector.The two kinds of methods in back can be used for the situation of target DNA from external source, and for example, DNA is from tumour cell.

5.1.1 method 1: carrier is imported the host cell that contains target DNA

In one embodiment, as shown in Figure 2, target DNA had been present in the host cell of expressing bacterial recombinase already.For example, target DNA may be positioned on the independently duplicated dna molecular, such as but not limited to the escherichia coli chromosome in plasmid, phage, bacterial artificial chromosome (BAC) or the e. coli host cell.The method of the host cell of construction expression bacterial recombinase will describe in detail in part 5.2.2, shown in bacterial recombinase such as RecE/T or Red α/β.

Carrier DNA is imported host cell.Shown in carrier DNA comprise a replication orgin and two homology arms, these two homology arms can be positioned at the either side of starting point and mark.Preferably, carrier is a linear molecule, and homology arm is positioned at the two ends of linear molecule, although they can be in inside.After entering cell, the homologous recombination that occurs between carrier DNA homology arm and the target sequence is inserted between the homology arm target DNA, and forms the ring-type episome.Then with cell transfer in selective medium, have the cell of selective marker on the screening vector.Since have only ring molecule to duplicate, and selected in host cell, and a lot of cells that can grow in selecting substratum all contain the recombinant molecule that comprises target DNA.

In one embodiment, the end of linear carrier dna fragmentation is blocked by modified nucleotide, the connection event quantity of the linear fragment end that causes with the additive method that reduces except homologous recombination, i.e. illegally reorganization.These modified nucleotides as the phosphoric acid thio nucleotides, can be incorporated in the 5 ' terminal nucleotide of homology arm.Modified nucleotide can import being used for the Oligonucleolide primers building-up process of carrier construction (seeing with lower section 5.2.1), perhaps, also can be after synthetic, the oligonucleotide of linear carrier DNA is carried out enzyme or chemically modified is added.The method of oligonucleotide and linear DNA fragment being carried out these modifications is well-known in the art, and in lower section 5.2.2 detailed description is arranged.

5.1.2 method 2: carrier and target DNA are imported host cell jointly

In another embodiment, as shown in Figure 3, external mixed carrier DNA and target DNA, common then the importing contained in the cell of RecE/T or Red α/β recombinase.Target DNA can be to originate arbitrarily.For example, target DNA can be from biological specimen, such as but not limited to whole blood, and blood plasma, serum, skin, saliva, urine, lymph liquid, biopsy cells, tissue culture cells, substratum also can be from abiotic sample, as food, water, or other materials.The method for preparing DNA from these materials is well known to those skilled in the artly (to see, as Current Protocols inMolecular Biology series of laboratory technique manuals, 1987-1994Current Protocols, 1994-1997 John Wiley and Sons, Inc.).

External preparation and mixed carrier and target DNA, common then the importing expressed in the proteic cell of bacterial recombinase, preferably transforms transformed into escherichia coli by common electricity.Carrier DNA can be the linear DNA form, also can be the form of cyclic plasmid DNA.In a preferred embodiment, carrier is a linear DNA molecule.Target DNA source outweigh or more than, with respect to carrier DNA, the copy number in the target target DNA zone in the transfered cell can be as much as possible like this, thereby make the maximum production of recombinant products.Cell is grown, with the screening cyclic products in selecting substratum.In a preferred embodiment, carrier comprises an antibiotics resistance mark, and cell grows in and contains in this antibiotic substratum.The colony that can grow in this selection substratum contains the linear fragment of cyclisation, recombinant forms.

In one embodiment, as with as described in the 5.2.1 of lower section, the blocking-up of the end use application modified nucleotide of linear carrier dna fragmentation.The method of these modified oligonucleotides is well-known in the art, as with as described in the 5.2.2 of lower section.

This method is not that to come from colibacillary situation particularly useful for target DNA, and for example, target DNA derives from yeast or eukaryotic cell.In one embodiment, this method can be used for diagnostic purpose, surveys the existence of specific DNA in any biological specimen.For example, this method can be used to survey specificity estrogen receptor or BRCA 1 allelic existence in patient with breast cancer's biopsy sample.

In another embodiment, this method can be used as the alternative method of polymerase chain reaction (PCR) technology amplification, is used for the DNA amplification zone.By homologous recombination, clone and the amplification method of in intestinal bacteria, breeding,, there are some advantages with respect to the technology of PCR-based.At first, the PCR error is essential obstacles for a lot of application purposes.Combined utilization PCR primer is to producing some pseudoreaction products.And after error was introduced dna sample, the quantity of this error in final reacting product was taken turns along with each of pcr amplification, with exponential rising.On the contrary, in intestinal bacteria, have the advantage that cell is read preceding mechanism by the amplification of homologous recombination clone technology, like this, more reliable at least 1000 times.The second, use present method, treat the big or small less-restrictive in DNA amplification zone.It is just quite difficult to the DNA zone of (surpassing 5-10kb) that application round pcr, amplification length surpass several kilobase.And present method is applicable to the zone that the clone is bigger, about at least 100,000 base pairs.At present, the clone gene group comprises creates large-scale lengthy process with hangar, also will carry out each clone's classification and ordering subsequently.Use present method, can design homology arm, carrier construction, with the genome directed cloning in large-scale, nonredundancy, contiguous clone, promptly so-called " contigs ".The 3rd, prepare DNA by round pcr after, even also need extra process, carry out the clone of PCR product.The homologous recombination clone technology has then avoided carrying out the needs of extra subclone step.Only need DNA zone to be amplified is inserted between the homology arm, then with carrier DNA transformed into escherichia coli host.

Homologous recombination in this embodiment can externally be carried out before DNA is added cell.For example, isolating RecE and RecT, the cell extract that perhaps contains RecE/T can add in the DNAs mixture.When being binned in external generation, the screening of dna molecular can by use the reorganization mixture transform suitable host cell and as previously mentioned screening positive clone realize.

5.1.3 method 3: target DNA is imported the host cell that contains carrier DNA

In another embodiment, target DNA is imported in the cell that contains carrier DNA.Target DNA can be to originate arbitrarily, and as above 5.1.2 is described, and its form can be linear, also can be ring-type.As mentioned above, in a single day target DNA enters cell, and the homologous recombination of carrying out between homology arm and target DNA will make target DNA be inserted between the homology arm.But, in this case, be used for selecting the not anti-selection of recombinant vectors to carry out, but because required product and not recombinant vectors all express selectable marker gene.This paper will describe multiple embodiment of carrying out this anti-chosen process in detail.For example, in one embodiment, used the method for locus specificity reorganization and excision reaction.This method has given description at Fig. 5.In another embodiment, can induce nuclease to be induced, cracking is recombinant vectors not.In two embodiments, the carrier that does not contain recombinant products all is eliminated.

Carrier at first is built into plasmid, imports host cell then, and breeds in host cell.As shown in Figure 5, carrier contains (i) replication orgin (starting point arbitrarily); But (ii) selective marker (Sm); (iii) two homology arms; And (iv) selectable back mark, such as but not limited to the recognition site of a pair of site-specific recombinase, first recognition site is positioned at the homology arm outside, and second recognition site is positioned within the homology arm, the perhaps recognition site of endonuclease, this enzyme can be used for screening initial plasmid vector.Here, a position is defined as homology arm " inside " and is meant, if this position is between two homology arms, like this, in one direction, first homology arm is between replication orgin and itself, on another direction, second homology arm is between replication orgin and itself.Otherwise a position is defined as homology arm " outside " and is meant, if in one direction, does not have homology arm itself and replication orgin can be separated.(see Fig. 1, illustrate homology arm " inside " and " outside " connotation).But replication orgin and selective marker must be positioned at the outside of homology arm, and as described in top 5.1, like this, but the insertion of target sequence just can not influence replication orgin and selective marker on the plasmid.One of them that can select back mark, endonuclease site or two site-specific recombinase target sites is preferably placed at " inside " (see figure 5) of homology arm, but at the opposite side of replication orgin and selective marker.

Can use that any methods known in the art are counter selects non-recombinant vectors.For example, in one embodiment, anti-selection can induce site-specific recombinase (SSR) to realize by one.Site-specific recombinase is to discern the enzyme of two target sites, these two target sites are called site-specific recombinase target site (SSRTs) again, this enzyme plays a role by these two sites, the exchange of mediated dna chain and excision reaction (Hallet et al., FEMS Microbiol.Rev., 1997,21:157-78; Sauer, 1994, Curr.Opin.Biotechnol.5:521-7; Stark et al., 1992, Trends Genet., 8:432-9).The example of site-specific recombinase is well-known in the art, includes but not limited to Cre, Flp, Kw or R recombinase (Nunes-Duby et al., 1998, Nucleic Acids Res.26:391-406; Ringrose et al., 1997, Eur.J.Biochem.248:903-912; Utatsu et al., 1987, J.Bacteriol.169:5537-5545).When two were directly repeated SSRTs and are positioned on the cyclic plasmid, the locus specificity reorganization between two SSRTs will form two cyclic plasmids.The product that only contains replication orgin is retained in the cell.Therefore, directly repeat locus specificities reorganization between the SSRTs, can remove between two SSRTs, not comprise the dna sequence dna of replication orgin two of cyclic plasmids.

Dna vector can make up and comprise two SSRTs, directed as directly repetition, and one of them is positioned at the inside of homology arm, second outside that is positioned at homology arm, but between selective marker (SM) and replication orgin.The reorganization that takes place between localized by this way SSRTs, but the (see figure 5) of separating of replication orgin and selective marker can be caused.Therefore, SSR can act on the non-recombinant DNA carrier that contains two SSRTs, causes the disappearance of this plasmid in host cell.

Then by standard method, application vector DNA transformed host cell.In this embodiment, host cell must comprise: 1) RecE/T and/or Red α/β gene, and 2) gene of coding SSR.Preferably, RecE/T and/or Red α/β expression of gene are can inductive, but fixedly expression also is fine.The gene that coding can be discerned the site-specific recombinase (SSR) of SSRTs must be derivable.Can induce and fixedly promotor be well known in the art; Their application methodes in recombination structure and expression process will be described in lower section 5.2.3.If RecE/T and/or Red α/β gene need abduction delivering, before the preparation functioning cell, carrier-containing cell must be able to grown under the condition of abduction delivering.The host cell that contains carrier DNA can select substratum to screen, keep by inoculating, growing in.

From carrier-containing host cell, prepare functioning cell then.Use the target DNA transformant, described target DNA can be to originate arbitrarily, as the total genomic dna for preparing from any cell.Homologous recombination can take place in the of short duration cultivation of cell.Homologous recombination can be removed the sequence between the homology arm that contains a SSRT, and inserts target-gene sequence.Induce the expression of SSR then.SSR can act on the not direct repetition SSRTs of recombinant vectors, but selective marker and plasmid replication starting point are separated.Contain the plasmid that inserts target sequence and have only a SSRT, therefore can be kept perfectly.When carrying out this step, can screen, can not screen, but after SSR induces yet, promptly after the locus specificity reorganization takes place, F.F. row filter step very.By this way, SSR's induces to screen and contains the plasmid that inserts target gene.

In another embodiment, can be before homologous recombination takes place, during or afterwards, use endonuclease in the body and between two homology arms, make the carrier linearizing.Before reorganization, carry out the carrier linearizing and can select correct recombinant products, unless because linear plasmid generation cyclisation, otherwise in cell, can not survive.After the reorganization, the continuous activity of endonuclease will help to screen the plasmid that contains insertion sequence, because between recombination phase, SSR has removed endonuclease recognition site, and insert target DNA in this position.Because the non-recombinant vectors of an endonuclease cracking, contain the plasmid that inserts target sequence and be kept perfectly and make, therefore the continuous activity of reorganization back endonuclease can be screened non-recombinant products.In this embodiment, must use the very rare endonuclease of recognition site, like this, in host cell DNA, not have other recognition sites to exist.The example of these " rare cleavers " is well known in the art, and includes but not limited to λ cos, the endonuclease such as the PI-Sce1 of yeast HO or intron coding.The recognition site of endonuclease should be cloned between two homology arms, and like this, the enzyme of endonuclease is cut digestion will form linearized vector between homology arm.The expression of endonuclease gene must be derivable.But structure that inducible protein is expressed and method part 5.2.3 are below inquired into.

In another embodiment, can use SSR, for example the Cre recombinase replaces endonuclease, and the body inner linearization is recombinant vectors (see Mullins et al., 1997, Nucleic Acids Res.25:2539-40) not.In this case, the carrier of structure has only a SSRT site that is positioned at homology arm inside.The excess oligonucleotide and the target DNA that contain identical SSRT copy are mixed, and with target DNA, the cotransformation host.Preferably, oligonucleotide is double-stranded short dna molecule.When a recombinant molecule contains the SSRT that is positioned on the short oligonucleotide, site-specific recombinase will SSRT site linearized vector (Mullins et al., 1997, supra).

In another embodiment, can be with above-mentioned locus specificity reorganization and endonuclease enzyme method combined utilization.In this case, recombinant vectors does not contain SSRT and endonuclease site in homology arm inside.In an embodiment of this method, SSR and endonuclease can be regulated under an independent inducible promoters control jointly.But these protein are regulated the structure and the method for abduction delivering jointly and will be inquired in lower section 5.2.3.

In another embodiment, can unite to adopt these locus specificity recombinant technology is counter and screen.In this embodiment, adopt two couples of SSR/SSRTs, for example Cre/lox and Flp/FRT.Carrier comprises at first SSR, two sites of SSR1, and one is positioned at homology arm inside, and second is positioned at the homology arm outside, but between replication orgin and the selective marker.In addition, this carrier comprises also that at second SSR the site of SSR2 is positioned at homology arm inside.Another site of SSR2 is positioned on the double-stranded short oligonucleotide, and during cell transformation, to surpass the amount of target DNA, adds with target DNA.In a particular, for example, a SSR/SSRT of linearizing step is to being Cre/loxP, and the second couple who removes step is Flp/FRT.

In another embodiment, directly application cell is counter screens.In this case, the plasmid replication starting point has only single copy (perhaps number of copies is very low) in intestinal bacteria.Such replication orgin comprises iteron type starting point, as phage P1 starting point, and based on the plasmid starting point of escherichia coli chromosome, oriC.Select suitable replication orgin, see Helinski, D.R., Toukdarian, A.E., Novick, R.P.Chapter 122, pp 2295-2324 in " Escherichiacoli and Salmonella, Cellular and Molecular Biology " 2 ^NdEdition FrederickC.Niedhardt, Ed.ASM Press, Washington, 1996, ISBN 1-55581-084-5.In this case, the carrier of structure can be without any SSRTs, but must comprise anti-screening-gene between homology arm.These anti-selection markers genes are well-known in the art, for example, can use sacB, and ccdB or tetracycline resistance gene (suitable anti-screening-gene and method list are also seen, Reyrat et al., and 1998, Infect.Immun.66:4011-7).The homologous recombination reaction of expection will be removed anti-screening-gene, like this, carry and expect that the cell of recombinant products will survive under anti-screening pressure, and the cell that carries recombinant vectors not be with death.

5.2 clone composition with subclone by homologous recombination technique

This paper has described in multiple embodiments, the composition of cloning by homologous recombination technique.All must there be following three kinds of components simultaneously in each cloning process describing with lower section 5.2 in a single cell: the first, carry the carrier in the short zones of two DNA (this paper is called " homology arm "), the sequence and the target sequence homology in the short zone of this DNA; The second, RecE/T and/or Red α/β albumen are right, or other bacterial recombinase; The 3rd, the target DNA sequence.By bacterial recombinase mediation, the reorganization that takes place between the homologous sequence that homology arm and target gene flank region exist can be with target DNA insertion or " capturing " between two homology arms.Here will describe composition and method that they make up in detail.

5.2.1 homologous clone carrier

The homologous clone carrier can be linearity or cyclic DNA carrier, comprises a replication orgin, but a selective marker and two short zones of DNA that are designed to capture the target target DNA.Can select the cloning vector of several forms according to used means or method.Preferred form that their make up and method and will here be described in detail shown in Fig. 1-5.

5.2.1.1 replication orgin

Carrier needs a replication orgin, makes plasmid replication, propagation.If clone and propagation in intestinal bacteria, can use any intestinal bacteria replication orgin, the example of these replication orgin is well-known in the artly (to see Miller, 1992, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, NY, and incorporated by reference document).The example of the non-limiting plasmid replication starting point that can obtain at present is the derivative replication orgin of ColE1 (Bolivar et al., 1977, Gene 2:95-113; See Sambrook et al., 1989, supra), the p15A starting point (Chang and Cohen, 1978, the J.Bacteriol.134:1141-56 that exist on as the pACYC184 plasmid; Also see Miller, 1992, p.10.4-10.11), and the pSC101 starting point that is applicable to low copy plasmid expression, they all are well-known in the art.

For example, in one embodiment, used the replication orgin that from high copy number plasmid, obtains, as contained the plasmid of the derivative replication orgin of ColE1, the example of these plasmids be well-known in the art (see Sambrook et al., 1989, supra; Also see Miller, 1992, A Short Course inBacterial Genetics, Cold Spring Harbor Laboratory Press, NY, and incorporated by reference document).Example is starting point and the derivative (Yanisch-Perron etal., 1985, Gene 33:103-119) thereof from pUC19.The level that exists of pUC carrier is each cell 300-500 copy, and has the convenient cloning site that inserts heterologous gene.For high horizontal expression, can use the λ carrier, as λ gt11 (Huynh et al., 1984, in " DNA Cloning Techniques:Vol I:A Practical Approach ", D.Glover, ed., pp 49-78, IRL Press Oxford), or uses T7 or SP6 phage promoter (Srudier et al. in the cell that contains T7 and Sp6 polysaccharase expression system, 1990, Methods Enzymol.185:60-89).

When the needs low expression level, can use the replication orgin of medium or low copy.Medium copy plasmid is well known in the art, and as pBR322, has the derivative replication orgin of ColE1, and 20-100 copy (Bolivar et al., 1977, Gene 2:95-113 are arranged in each cell; See Sambrook et al., 1989, supra), or the pACYC184 plasmid in the pACYC100 plasmid series, have the p15A starting point, 10-12 copy (Chang and Cohen, 1978, J.Bacteriol.134:1141-56 are arranged in each cell; Also see Miller, 1992, p.10.4-10.11).Low copy plasmid also is well-known in this area, and for example, pSC101 has the pSC101 starting point, nearly 5 copies in each cell.The same with the pUC plasmid with pBR, pACYC and pSC101 plasmid vector all have cloning site easily, and can exist jointly in same cell, because they have compatible replication orgin and unique selectivity antibiotic marker.Other suitable plasmid replication starting points comprise λ or the phage P1 replicon based on plasmid, for example Lorist series (Gibsonet al., 1987, Gene 53:283-286).

When required expression level is lower, can use replication orgin from bacterial chromosome (see Miller, 1992, supra; Niedhardt, F.C., ed., 1987, Escherichia coli andSalmonella typhimurium, American Society for Microbiology, WashingtonD.C.; Yarmolinsky, M.B.and Sternberg, N., 1988, pp.291-438, in Vol.1 ofThe Bacteriophages, R.Calendar, ed., Plenum Press, New York).In addition, also can use synthetic replication orgin.

But 5.2.1.2 selective marker

In order to keep plasmid vector in cell, but typical carrier also comprises a selective marker.But can use any selective marker known in the art.When making up escherichia coli vector, can use any gene that makes intestinal bacteria effectively produce antibiotics resistance, and anyly make intestinal bacteria produce stable differentiating maybe can to screen the gene that phenotype changes.Advantageous applications antibiotics resistance mark, as kantlex drug resistant gene (Friedrich and Soriano from TN903,1991, Genes.Dev.5:1513-1523), or other aminoglycosides antibiotics drug resistant genes (described other aminoglycosides antibiotics include but not limited to Vibriomycin, gentamicin, Xin Meisu, paromycin and Streptomycin sulphate), from the β-Nei Xiananmei of IS1, make intestinal bacteria produce the penicillins resistance and (include but not limited to penbritin, Pyocianil, the X-1497, penicillin N, penicillin and penicillin v).Other can select gene order to include but not limited to the gene order of coded polypeptide, and this polypeptide can produce zeocin resistance (Hegedus et al., 1998, Gene 207:241-249).Other adaptable microbiotic are to produce amphenicols such as the drug-fast gene of chloramphenicol, for example, can use the encoding sequence (Eikmanns et al., 1991, Gene 102:93-98) of chloramphenicol transaldolase (CAT).For those skilled in the art, be noted that also and can use other non-antibiotic method, be used for screening plasmid keeping in cell, for example, can use multiple nutrients defective mark (see Sambrook et al., 1989, supra; Ausubel et al., supra).

5.2.1.3 homology arm

One of carrier must component be the short districts of two double-stranded DNAs, is called " homology arm " here again.In one embodiment, as shown in Figure 1, the flanking DNA sequence of two homology arms (with " A " and " B " representative) and target target DNA (with " A ' " and " B ' " representative) homology, one of them arm and target DNA upstream dna sequence dna homology, second arm and the sequence homology that is positioned at the target DNA downstream.As used herein,, can choose wantonly and insert one or more difference base pairs if two double chain DNA molecules have identical constant region, and can be as the substrate of homologous recombination, they are " homologous " so.In a preferred embodiment, homology arm comprises about 22-100 base pair or more base pair continuously, and is identical with the double-stranded flanking region of target target DNA.Homologous region can also insert one or more different residues, as long as homology arm still can become effective substrate of homologous recombination.In a preferred embodiment, in order to make the recombination efficiency optimization, the length of homology arm is approximately 50 Nucleotide, and wherein the individual continuous base-pair sequence of 20-30 (as 25) is identical, does not insert.Although consecutive identical zone can be shorter (as, at least 6,8 or 10 base pairs), use this short consecutive identical zone, can predict, recombination efficiency may be lower.For example, in one embodiment, the length in consecutive identical zone is 6bp (Keim andLark, 1990, J.Structural Biology 104:97-106).The consecutive identical length of the length of homology arm or itself and target DNA flanking sequence does not have the upper limit.

Target DNA flanking nucleotide sequence is called target DNA " end " here again.Therefore, a target DNA has two ends, first terminal and second end.Two homology arms with respect to the directional property of required insertion sequence must with the directional property consistent (see figure 1) of homologous sequence with respect to target DNA, like this, reorganization between homology arm and first, second target DNA end can be inserted into target DNA between two homology arms.

The sequence of two homology arms can be selected according to experimental design.Unique restriction when selecting homology arm is that surpassing once should not appear in target DNA in this sequence, and, should not occur at the elsewhere of host cell between the reaction period in homologous recombination.In this case, in the background of other homologous recombination incidents, still can obtain required homologous recombination product.In one embodiment, the homology arm sequence is the polylinker flanking sequence of cloning vector commonly used, described cloning vector commonly used such as BAC, PAC, YAC (yeast artificial chromosome), phage clone carrier such as λ EMBL or λ GT sequence, phagemid, clay, pBR322, pGEM, pGEX, pET, baculovirus vector, virus vector such as adenovirus carrier and adeno-associated virus (AAV) carrier.Therefore, can use any insertion sequence of in these carriers, cloning of single carrier subclone.The carrier that contains these homology arms is particularly useful for the subclone insertion sequence, and described insertion sequence is from the positive colony in DNA library, this DNA library such as BAC, PAC, YAC, clay or λ storehouse.

In a plurality of embodiments, as described below, homology arm is positioned at the end of linear DNA molecule, perhaps is positioned within the linear DNA molecule, perhaps is positioned at the cyclic DNA plasmid vector.

The directional property of homology arm is consistent with the directional property of target nucleotide sequences with respect to them.In other words, the direction of homology arm makes required dna sequence dna after reorganization takes place, and is inserted between the homology arm.When homology arm is positioned at linear DNA when terminal, insert dna sequence dna and capture or be inserted between two homology arms, and and then form a reproducible plasmid of ring-type.

5.2.1.4 adapter oligonucleotide homology arm

In another embodiment, the nucleotide sequence homology of the nucleotide sequence of homology arm and adapter oligonucleotide.Each of two adapter oligonucleotide all comprise one with a homology arm nucleotide sequence homologous nucleotide sequence, and second with two ends of target DNA in a homologous homology zone.The adapter oligonucleotide as shown in Figure 1.The homology arm of carrier is with " A " and " B " representative, represents with " A ' " and " B ' " with the adapter oligonucleotide zone of these sequence homologies.Two ends of target DNA are with " C " and " D " representative, and correspondingly homologous sequence is represented with " C ' " and " D ' " on the adapter oligonucleotide.In this embodiment, by RecE/T or Red α/beta mediated reorganization that between carrier homology arm, adapter oligonucleotide homologous region and target gene flank end, takes place, make target DNA insertion or " capturing " between the carrier homology arm.

5.2.1.5 carrier construction

Can use standard method known in the art make up linear fragment or circular vectors (see Sambrook et al., 1989, supra; Ausubel et al., supra).For example, can use synthetic or recombinant DNA technology.In one embodiment, linear fragment prepares by the pcr amplification technology.In the method, the synthetic oligonucleotide comprises the homology arm sequence at their 5 ' end, holds in their 3 ' to comprise the PCR primer sequence.Use the primer of these oligonucleotide as pcr amplification reaction then, amplification comprises replication orgin and can select the DNA zone of genetic marker.In another embodiment, can pass through standard recombinant dna technique construction plasmid, make it to comprise two suitable directed homology arms, flaning a replication orgin and one can select genetic marker (to see, Methods in Enzymology for example, 1987, Volume 154, Academic Press; Sambrook et al., 1989, Molecular Cloning-A Laboratory Manual, 2 ^NdEdition, Cold Spring Harbor Press, New York; And Ausubel et al., CurrentProtocols in Molecular Biology, Greene Publishing Associates and WileyInterscience, New York).Then, for example,, make plasmid linearization by restriction endonuclease digestion.

In another embodiment, for example, can use following method and make up the carrier DNA that is used for upper section 5.1.3.Synthetic two oligonucleotide, one of them comprises, from 5 ' to 3 ', carrier specificity restriction site, a left side homology arm and a PCR primer.Another oligonucleotide comprises, from 5 ' to 3 ', and identical carrier specificity restriction site, a SSRT, a right side homology arm and a PCR primer.Select two homology arms to flank target DNA.SSRT is can be by any site-specific recombinase (SSR) as Cre, Flp, the site of Kw or the identification of R recombinase.The synthetic oligonucleotide of design must make two SSRTs be orientated direct repeat sequence in carrier.Two PCR primers are used to the DNA amplification template, and this template comprises a plasmid starting point, one can select gene with starting point with can select intergenic identical SSRT.Application limitations enzyme enzyme is cut the PCR reaction product then, and by connecting effective cyclisation, described Restriction Enzyme can be discerned the site that oligonucleotide 5 ' end comprises.Use the cyclic products transformed into escherichia coli then, to increase, to produce a large amount of carriers.

In another embodiment, but linear fragment can make up by the plasmid that employing has selective marker, starting point and two cloning sites, then the oligonucleotide homology arm is cloned in each cloning site.Application limitations enzyme digested plasmid DNA then is to produce the linear fragment that is limited by homology arm.This method is preferred for making up more complicated plasmid---for example,, contain the plasmid of eucaryon enhanser and promoter element in order to comprise the eukaryotic expression element.In addition, but other sequential elements also subclone to carrier.

Carrier can also comprise protein expression, operates or keep other required target nucleotide sequences of insertion target DNA.For example,, can also comprise promoter sequence, enhancer sequence, translation sequences such as Shine and Dalgarno sequence, transcription factor recognition site, Kozak know together sequence and termination signal in the suitable location of carrier.At non-bacterial cell, as recombinant clone in plant, insect, yeast or mammalian cell, other sequential elements must be arranged, as the specific specificity replication orgin, transcribe, process and translation signals.These elements include but not limited to the eucaryon replication orgin, enhanser, transcription factor recognition site, CAT box, or Pribnow box.

In one embodiment, RecE/T and/or Red α/β or other bacterial recombinase are reorganization preparations from the expression plasmid of cell, selected carrier must with the bacterial recombinase expression plasmid compatibility described in the lower part 5.2.3.Those skilled in the art are perfectly clear, the necessary compatibility requirement of a plurality of plasmid expressions in single cell.The method of the two or more constructions of propagation is that those skilled in the art are well-known in prokaryotic cell prokaryocyte.For example, contain the cell of a plurality of replicons, can use the carrier that contains suitable compatible replication orgin and independent screening system select and keep (see Miller et al., 1992, supra; Sambrook et al., 1989, supra).

5.2.2 bacterial recombinase

The present invention has mainly described the application about RecE/T and/or Red α/β.But veteran technician should be very clear, and the present invention is equally applicable to the application of other bacterial recombinase, adopts a pair of homoduplex dna molecular as substrate, and described other bacterial recombinase have the ability of mediation homologous recombination.Here the bacterial recombinase of Ying Yonging is a kind of recombinase of endogenous expression in bacterium or phage or bacterium starting point, and has the ability of mediation homologous recombination.In a plurality of embodiments, bacterial recombinase is RecE/T and/or Red α/β recombinase.In another particular, the function equivalence system of startup homologous recombination comprises the erf albumen from phage P22.And in an application of the invention, the protein ingredient out of the ordinary of bacterial recombinase can be assigned to replace by other functional group.

Here " RecE " of Ying Yonging and " RecT " at first refer to intestinal bacteria, as e. coli k12, in RecE or RecT.The Nucleotide of intestinal bacteria RecE and RecT and aminoacid sequence are well-known (RecE, GenBank Accession No.M24905 and SWISS-PROTAccession No.P15033; RecT, GenBank Accession No.L23927 and SWISS-PROT Accession No.P33228)." Red α " and " Red β " refers to the phage proteins encoded.Red α has 5 ' to the 3 ' exonuclease activity similar to RecE 5 ' to 3 ' exonuclease, and it is active that Red β has the DNA annealing similar to RecT.These two kinds of proteic Nucleotide of λ and aminoacid sequence also are well-knownly (to see GenBank Accession Nos.J02459; M17233).

Veteran technician should be very clear, and the reference that relates to RecE/T and/or Red α/β also is applicable to the situation of RecE/T and Red α/β combined utilization, unless otherwise specified or context indication arranged.In a particular, two kinds of enzyme complexs of combined utilization have synergy for recombination efficiency.

Adaptable recombinase also comprises the allelic variation body of recombinase component.For example, the aminoacid sequence of using in RecE/T of the present invention and Red α/β recombination system can also comprise the E by Rec, RecT, any allelic variation body amino acid sequence coded of Red α or Red β, as long as these allelic variation bodies are function varients, and has the homologous recombination activity at least to a certain extent.These allelic variation bodies can the application standard recombinant DNA technology (see, Methods in Enzymology for example, 1987, volume 154, Academic Press; Sambrook etal., 1989, Molecular Cloning-A Laboratory Manual, 2 ^NdEdition, ColdSpring Harbor Press, New York; And Ausubel et al., Current Protocols inMolecular Biology, Greene Publishing Associates and Wiley Interscience, New York) or albumen evolvement method (Jermutus et al., 1998, Curr.Opin.Biotechnol.9:534-548) carry out routine and identify, prepare.

Generally, the Nucleotide of these allelic variation bodies of encoding should (use, for example standard Southern blot hybridization condition be cleaned with 0.2 * SSC/0.1%SDS at 42 ℃ at last under the moderate stringent condition; Ausubel et al., Current Protocols in MolecularBiology, Vol.I, Green Publishing Associates, Inc., and John Wiley ﹠amp; Sons, Inc., New York, at are p.2.10.3) or the height stringent condition under (use, for example standard Southern blot hybridization condition is cleaned with 0.1 * SSC/0.1%SDS at 68 ℃ at last; Ausubel et al., supra), with coding RecE, RecT, the complementary sequence hybridization of Red α or Red β.

Here the RecE of Ying Yonging, RecT, Red α or Red β also comprise deutero-RecE from phage or cell, RecT, the homologous compound of Red α or Red β, host of described phage and described cell all are prokaryotic cell prokaryocytes of enterobacteriaceae.The family member of enterobacteriaceae includes but not limited to Escherichia, salmonella, Citrobacter, Kleb and sex change Pseudomonas.These RecE, RecT, the homologous compound of Red α or Red β are usually by the genes encoding in the phage genome, and this gene product participates in the process of recombinase-mediated in the phage life cycle, as Red α in the lambda particles phage life cycle and Red β.

The RecE/T homologous compound can the application standard prokaryotic gene and recombinant DNA technology carries out that routine is identified, preparation (see as, Sambrook et al., supra, and Ausubel et al., supra).Recombinant DNA can be by clone gene group or cDNA library, or obtains by the pcr amplification technology.For example, genomic library can obtain by standard molecular biological technique, also can obtain by commercial channel or non-commercial channel.Use then can carry out with the nucleic acid of intestinal bacteria recE or recT probe hybridization screening (Grunstein and Hogness, 1975, Proc.Natl.Acad.SciU.S.A.72:3961), separate positive colony, and carry out sequential analysis.

In a particular embodiment, the homologous compound of RecE or RecT conventional evaluation in the mouse salmonella typhi.RecE and the character of recT gene in e. coli k-12 are perfectly clear, the Nucleotide of RecE (GenBank Accession No.M24905 and SWISS-PROT AccessionNo.P15033) and RecT (GenBank Accession No.L23927 and SWISS-PROTAccession No.P33228) and protein sequence is also known (also sees Bachmann, 1990, Microbiol.Rev.54:130-197; Rudd, 1992, in Miller, 1992, supra, pp.2.3-2.43).Can use the complete genome group clay or the λ library of mouse salmonella typhi.Then under aforesaid hybridization conditions, by coming screening mouse salmonella typhi library with intestinal bacteria RecE or RecT probe hybridization.For example, because the expection of the homology of two genes is very high, so the hybridization conditions of the medium strictness of preferred standard.

In one embodiment, such condition comprises: the filter that contains DNA is containing 6XSSC, 5X Denhart ' s solution, and in the solution of 0.5%SDS and 100ug/ml denatured salmon sperm dna, 55 ℃ of pre-treatment 6 hours.Hybridization is carried out in same solution, and the probe of application is 5-20 * 10 ⁶Cpm ³²The P mark.Filter was hatched in 55 ℃ hybridization mixture 18-20 hour, and then with the solution that contains 1X SSC and 0.1%SDS, 60 ℃ are cleaned 30 minutes 2 times.With filter trace drying, be exposed to X-ray film, radioautograph then.Adaptable other medium stringent conditions are well-known in the art.The cleaning of filter is at 37 ℃, uses to contain 2X SSC, and the solution of 0.1%SDS carried out 1 hour.The separation, purifying and the signature analysis that contain mouse salmonella typhi clone that carry out subsequently can carry out (seeing Ausubelet al., supra) according to method well-known in the art.These sequences can be used for making up mouse salmonella typhi RecE/Ts of the present invention.

In addition, mouse salmonella typhi gene also can separate from mouse salmonella typhi mRNA.MRNA can separate from express RecE or the proteic cell of RecT.Can prepare cDNA by reverse transcription mRNA, use methods known in the art then and carry out screening, (see Ausubel et al., supra) as the method for above-mentioned screening genomic library.In addition, recE or recT cDNA also can use round pcr and identify, as the RACE (rapid amplifying of cDNA end, Ausubelet al., supra), in this technology, use two primers according to intestinal bacteria recE or recT sequences Design: the sequence of " leading " primer is identical with the 5 ' end of intestinal bacteria recE or recT mRNA, and " oppositely " primer and its 3 ' end are complementary.The PCR product can be proofreaied and correct by sequential analysis, and subclone is used to make up RecE/T of the present invention then.These cDNA sequences also can be used method well-known in the art, are used to separate mouse salmonella typhi genome recE or recT sequence (Sambrook et al., 1989, supra; Ausubel et al., supra).

The nucleic acid molecule of code book invention RecE/T recombinase also can be according to well-known reorganization of those skilled in the art and synthetic method, synthesize and/or make up (see as, Sambrook et al., supra and Ausubel et al., supra).

As described below, the ability that control sequence is expressed is very useful for using the inventive method, and the control that this sequence is expressed can make expression can regulate (as inducing), and makes the non-constant width of expression level scope.

Nucleic acid molecule can, for example outside karyomit(e), keep, as on plasmid, clay or phage.In addition, nucleic acid molecule can also be used, and for example phage transduction or transposition is incorporated on the karyomit(e), on escherichia coli chromosome.Like this, the RecE/T encoding sequence just can pass through standard technique, is present in each cell with height copy, low copy or single copy through the engineering science means.Also can use multiple different regulating and controlling sequence and drive Recombinant Protein Expression.Each aspect of expression/strain construction all can be operated, in order to the different cell of preparation expression of recombinant proteins level.Be noted that the single copy of recombinant protein encoding sequence on karyomit(e) also has other advantages, promptly such preparation is more prone to the structure of bacterial strain.

5.2.2.1 protein expression

Expression or the fixed of bacterial recombinase in bacterium, yeast, insect or mammalian cell, or derivable.In a preferred embodiment, recombinant protein is expressed in bacterium, most preferably at expression in escherichia coli.For example, host cell can comprise recE and recT gene on its karyomit(e).The intestinal bacteria example of endogenous expression RecE/T is known, for example intestinal bacteria sbcA bacterial strain (Zhang et al., 1998, supra).In addition, RecE/T also can be recombinant expressed from nonchromosomal DNA, preferably on plasmid vector, as pBADET γ (Zhang etal., 1998, supra) or pGETrec (Narayanan et al., 1999, Gene Ther.6:442-447).Equally, Red α/β can be endogenic for the bacterial strain of having integrated the λ prophage, also can be by plasmid expression, as pBAD α β γ (Muyrers et al., 1999, supra).Can according to standard recombinant dna technique construction RecE/T and/or Red α/β expression constructs (see, Methods in Enzymology for example, 1987, volume 154, Academic Press; Sambrook et al., 1989, Molecular Cloning-A Laboratory Manual, 2 ^NdEdition, Cold Spring Harbor Press, New York; And Ausubel et al., CurrentProtocols in Molecular Biology, Greene Publishing Associates and WileyInterscience, New York, every document is introduced in full at this, as a reference).

In one embodiment, RecE/T and/or Red α/β are expressed by high copy number plasmid in intestinal bacteria, and described high copy number plasmid is as containing the plasmid of the derivative replication orgin of ColE1, and its example is well-known in the artly (to see Sambrook et al., 1989, supra; Also see Miller, 1992, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, NY, and the reference of quoting), as pUC 19 and derivative (Yanisch-Perron et al., 1985, Gene 33:103-119) thereof.

About express the problem of (adjusting or fixed) regulation and control at different expression levels, those skilled in the art will know that a lot of such regulating and controlling sequences.As described below, the ability that produces the wide region expression level is useful for using the inventive method.This expression can be by fixing and regulation and control or the realization of inductive form.

But, can realize the abduction delivering of different expression levels by using multiple induction regulating controlling sequence.In one embodiment, for example, when the encoding sequence of these polypeptide is transcribed by the lacOP regulating and controlling sequence, use lacI gene and elicitor IPTG thereof and can produce the inducing of RecE/T, high level expression.

RecE and RecT can express by different promoters, and perhaps, recE and recT gene can pass through single promoter expression in polycistronic mRNA.These allogeneic promoters can be derivable, also can be fixed.This expression is preferably regulated and control by inducible promoters.But but the abduction delivering of different expression levels can be realized by multiple induction regulating controlling sequence.In one embodiment, for example, when the encoding sequence of these polypeptide is transcribed by the lacOP regulating and controlling sequence, use lacI gene and elicitor IPTG thereof and can produce the inducing of RecE/T, high level expression.A large amount of other inducible promoters systems also can use, and they are well-known to those skilled in the art.By using the promotor of varying strength, the expression level of RecE/T or Red α/β construction also can be different.

Other adaptable expression regulation systems include but not limited to pass through pectinose (AraC) inductive araC promotor, (the Geissendorfer and Hillen of TET system, 1990, Appl.Microbiol.Biotechnol.33:657-663), the P of phage temperature _LPromotor and can induce λ to suppress sub-CI ₈₅₇(Pirrotta, 1975, Nature 254:114-117; Petrenko et al., 1989, Gene 78:85-91), trp promotor and trp suppress subsystem (Bennett et al., 1976, Proc.Natl.Acad.Sci USA 73:2351-55; Wame et al., 1986, Gene 46:103-112), lacUV5 promotor (Gilbert and Maxam, 1973, Proc.Natl.Acad.Sci USA 70:1559-63), lpp (Nokamura et al., 1982, J.Mol.Appl.Gen.1:289-299), T7 gene-1 0 promotor, phoA (alkaline phosphatase), recA (Horii et al., 1980) and the tac promotor, can pass through tryptophane inductive trp-lac promoter, fusion (Amann et al., 1983, Gene 25:167-78), for example, all be the strong promoter of using always, the protein level of every kind of promotor control all can be accumulated the about 1-10% that reaches total protein of cell.Stronger if desired promotor, the intensity of tac promotor are approximately strong 10 times than lacUV5, but can cause high-level baseline to be expressed, and therefore, should need only be used to the situation of overexpression.More weak if desired promotor, other bacterium promotors are well-known in the art, for example, (sequence of these promotors can obtain by Genbank for maltose, semi-lactosi or other required promotors, (Burks et al., 1991, Nucl.Acids Res.19:2227-2230)

The cell that is used for this paper described method can be any cell that contains RecE/T and/or Red α/β recombinase.Preferably, host cell is the gram-negative bacteria cell.More preferably, host cell is that enterobacteria belongs to cell.The family member of enterobacteriaceae includes but not limited to Escherichia, salmonella, Citrobacter, Kleb and sex change Pseudomonas.Most preferred host cell is a Bacillus coli cells.Cell can include but not limited to yeast, fly class, mouse or human cell from any organism, expresses suitable recombinase as long as these cells can be modified through engineering science.Recombinase is preferably from colibacillary RecE/T recombinase, perhaps from the Red α/β recombinase of phage, or from the RecE/T of enterobacter or enterobacter phage or the function equivalent of Red α/β recombinase system, these systems can mediate the reorganization between the homologous sequence zone.

Expressing RecE/T and/or the proteic cell of Red α/β can prepare by prior electrical reset, and is stored in-70 ℃.

In addition, the inventive method also can be carried out in other any cells that can express RecE/T and/or Red α/β.For example, multiple host carrier system can be used for the expressing protein encoding sequence.These include but not limited to that virus (expresses as cowpox, adenovirus etc.) the mammal cell line system that infects, the insect cell system that virus (as baculovirus) infects, microorganism, the yeast that for example contains yeast vector, the perhaps bacterium of phage, DNA, plasmid DNA or cosmid DNA conversion.The Expression element of carrier is having nothing in common with each other aspect its intensity and the specificity.According to the host carrier system of using, can select to use any suitable element of transcribing, translate.In specific embodiments, express RecE/T and/or Red α/β gene, the sequence of RecE/T and/or the Red α that perhaps encodes/β functionally active part.In another embodiment, express RecE/T and/or the Red α/β fragment that contains RecE/T and/or Red α/β protein function district.

Any aforesaid method that dna fragmentation is inserted carrier all can be used for making up the expression vector that contains mosaic gene, and described mosaic gene comprises suitable transcribing/translational control signal and albumen coded sequence.These methods comprise extracorporeal recombinant DNA and synthetic technology, and recombinant technology (gene recombination) in the body.The expression of the nucleotide sequence of coding RecE/T or Red α/β albumen or polypeptide fragment can be by second nucleotide sequence regulation and control, and like this, RecE/T or Red α/β albumen or polypeptide can be expressed in the host cell that has transformed recombinant DNA molecules.For example, RecE/T or the proteic expression of Red α/β can be regulated and control by any promotor/enhancer element known in the art.Can be used for regulating and control RecE/T or Red α/β expression promoter and include but not limited to SV40 promoter region (Bernoist and Chambon early, 1981, Nature 290:304-310), promotor (the Yamamoto et al. that Rous sarcoma virus 3 ' end long terminal repeat comprises, 1980, Cell 22:787-797), simplexvirus Thymine deoxyriboside kinase promoter (Wagner et al., 1981, Proc.Natl.Acad.Sci.USA 78:1441-1445), metallothioneins gene regulating sequence (Brinster et al., 1982, Nature 296:39-42); Plant expression vector comprises nopaline synthase promoter zone (Herrera-Estrella et al., 1984, Nature 303:209-213) or Cauliflower embedded virus 35S RNA promotor (Gardner et al., 1981, Nucl.Acids Res.9:2871), and photosynthetic enzyme diphosphoribulose carboxylase promotor (Herrera-Estrella et al., 1984, Nature 310:115-120); Promoter element from yeast or other fungies, as the Gal4 promotor, ADC (ethanol dehydrogenase) promotor, PGK (phosphoglycerokinase) promotor, alkaline phosphatase promoter, and the following animal transcriptional control zone that has tissue specificity and be used for transgenic animal: have active elastoser I gene regulating zone (Swift et al., 1984, Cell 38:639-646 at pancreatic acinar cell; Ornitz et al., 1986, Cold SpringHarbor Symp.Quant.Biol.50:399-409; MacDonald, 1987, Hepatology 7:425-515); In pancreatic beta cell, has active insulin gene regulation and control zone (Hanahan, 1985, Nature 315:115-122), in lymphocyte, have active immunoglobulin gene regulation and control zone (Grosschedl et al., 1984, Cell 38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et al., 1987, Mol.Cell.Biol.7:1436-1444), in testis, mammary gland, lymph and mastocyte, has active mouse mammal tumor virus regulation and control zone (Leder et al., 1986, Cell 45:485-495), in liver cell, has active albumin gene regulation and control zone (Pinkerr et al., 1987, Genes and Devel.1:268-276), in liver cell, have active a-fetoprotein gene regulation and control zone (Krumlauf etal., 1985, Mol.Cell.Biol.5:1639-1648; Hammer et al., 1987, Science 235:53-58); In liver cell, has active alpha1-antitrypsin gene regulating zone (Kelseyet al., 1987, Genes and Devel.1:161-171), in myelocyte, have active beta globin gene regulation and control zone (Mogram et al., 1985, Nature 315:338-340; Kollias etal., 1986, Cell 46:89-94); In the brain oligodendrocyte, has active myelin basic protein gene regulating zone (Readhead et al., 1987, Cell 48:703-712); In skeletal muscle, has active myosin light chain-2 gene regulating zone (Sani, 1985, Nature 314:283-286), and at hypothalamus has active gonadotropin releasing hormone gene regulating zone (Mason et al., 1986, Science 234:1372-1378).

In a particular, application carrier comprises a promotor that links to each other with bacterial recombinase (as RecE or RecT) coding nucleic acid operability, one or more replication orgin, but and can choose one or more selective markers (as the antibiotics resistance gene) wantonly.

Selected carrier must with the described vector plasmid compatibility of upper section 5.2.1.Those skilled in the art are perfectly clear, and keep the necessary compatibility requirement of a plurality of plasmids in single cell.The method of the two or more constructions of propagation is that those skilled in the art are well-known in prokaryotic cell prokaryocyte.For example, contain the cell of a plurality of replicons, can use the carrier that contains suitable compatible replication orgin and independent screening system come conventional select and keep (see Miller et al., 1992, supra; Sambrooket al., 1989, supra).

5.2.3 host cell

The host cell that is used for cloning process of the present invention and cloned DNA propagation can be any cell of expressing recE and recT and/or red α and red β gene product, also can be any cell that these genes can heterogenous expression.Adaptable possibility cell type example include but not limited to the protokaryon eukaryotic cell, as bacterium, yeast, plant, rodent, mouse, the mankind, insect or mammalian cell.In a preferred embodiment, host cell is a bacterial cell.In most preferred embodiment, host cell is a Bacillus coli cells.Adaptable specific coli strain example is JC 8679 and JC 9604.The genotype of JC 8679 and JC 9604 is Sex (Hfr, F+, F-, or F): the variation that F-JC 8679 comprises: recBC 2l, recC 22, and sbcA 23, thr-1, ara-14, leu B 6, DE (gpt-proA) 62, lacY1, tsx-33, gluV44 (AS), galK2 (Oc), LAM-his-60, relA 1, rps L 31 (strR), xyl A5, mtl-1, argE3 (Oc) and thi-1.JC9604 comprises identical variation, and recA 56 variations.

In another embodiment, use the host cell of eukaryotic cell as clone described herein and subclone method.Can use any expression or modify the cell to express bacterial recombinase or its function equivalent through engineering science.Can use clone from the mankind, mouse, monkey or other any organisms.For example, the non-limiting clone example that is used for the inventive method comprises CHO, VERO, BHK, HeLa, COS, MDCK, 293,3T3 and WI 38 cell.

Multiple host carrier system all can be used for importing or expressing RecE/T, the albumen coded sequence of Red α/β or its function equivalence system.These methods are (seeing Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing ASsociates andWiley Interscience, New York) well-known in the art.These include but not limited to that virus (expresses as cowpox, adenovirus etc.) the mammal cell line system that infects, the insect cell system that virus (as baculovirus) infects, microorganism, the yeast that for example contains yeast vector, the perhaps bacterium of phage, DNA, plasmid DNA or cosmid DNA conversion.The method of protein expression is also inquired among the part 5.2.2 in the above.

5.2.4 target DNA

Should select target DNA according to experimental design, target DNA can be any double-stranded DNA, and its length can have only 1 base pair, also can surpass 100,000 base pairs.In a particular, target DNA length is up to 100,125, and 200 or 300kb.In another particular, it is right that target DNA contains the 25-100 kilobase, for example, to exist in the BAC carrier similar.Other particular of target DNA s will be described in the embodiment of part 6.Target DNA may reside on any independently duplicated dna molecular, such as but not limited to plasmid, and BAC or escherichia coli chromosome.The dna molecular that target DNA also can be positioned at any source is, includes but not limited to derive from prokaryotic cell prokaryocyte, archeobacteria or eukaryotic DNA, perhaps derives from the DNA of virus, phage or compound body.For example, can obtain nucleotide sequence from following source: the mankind, pig, ox, cat, bird, horse, dog, insect (as fruit bat), invertebrates (as C.elegans), plant etc.DNA can prepare by standard method known in the art and (sees Sambrook for example, et al, 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold SpringHarbor Laboratory Press, Cold Spring Harbor, New York; Glover (ed.), 1985, DNA Cloning:A Practical Approach, MRL Press, Ltd., Oxford, U.K.Vol.I, II).

5.3 application method of the present invention

5.3.1 DNA is imported host cell

Any known DNA preparation that will contain target DNA imports the method for host cell, all is applicable to aforesaid method.These methods include but not limited to that known in the art the electricity of cell transforms, and use calcium chloride or rubidium and prepare functioning cell, use the target DNA transfering DNA that is wrapped in the virion.For eukaryotic cell, method includes but not limited to the DNA and the virus parcel of electricity conversion, transfection calcium phosphate precipitation.In a preferred embodiment, answer electricity consumption to transform.Processing contains RecE/T or the proteic cell of Red α/β, the electricity that makes it to be applicable to standard method transforms (sees Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates andWiley Interscience, New York).Preferably, about 50ul standard electric transformation function cell preparation is used for the electricity conversion of standard method.Transform in the experiment of linearity or circular vectors the carrier of advantageous applications 〉=0.3ug at needs.Transform in the experiment of the DNA preparation that contains target DNA advantageous applications 〉=0.3ug at needs.For the cotransformation experiment, preferably before transforming, electricity mixes DNAs.Electricity preferably dilutes cell after transforming in substratum, and cultivates preincubation about 1.5 hours in condition, and as the recovery phase, but described condition can be differentiated the phenotypic alternation that is caused by selectable marker gene.

Cut in the experiment of carrier in reorganization of practical site specificity or endonuclease enzyme, before the electric transformation function cell of preparation, perhaps during the recovery after electricity transforms, but perhaps between the incubation period of identifying selective marker, can induce the expression of SSR or endonuclease, perhaps induce the expression of uniting of SSR and endonuclease, perhaps induce the expression of uniting of two SSR.

Optional phenotypic alternation is to a kind of antibiotic resistance, with cell cultures in containing on the corresponding antibiotic flat board.In this case, the colony of demonstration antibiotic resistance mainly contains required subclone product after the incubated overnight.

In another embodiment, DNA imports host cell by transduction, and the DNA of transduction was packaged in the phage particle already.The transduction of P1 known in the art or lambda particles phage and wrapping process.The λ packaging extract can buy by the commercial channel (for example, by Promega, Madison, WI).

5.3.2 oligonucleotide

Be approximately 10-100 Nucleotide with oligonucleotide homology arm, primer and the adapter oligonucleotide normal length of the inventive method combined utilization.In some particular aspects, oligonucleotide length is 10 Nucleotide, 15 Nucleotide, and 20 Nucleotide, 50 Nucleotide, perhaps 100 Nucleotide are perhaps up to 200 Nucleotide.In preferred embodiments, oligonucleotide length is approximately 90 Nucleotide.

Oligonucleotide can synthesize (for example, synthetic in the enterprising column criterion phosphorous acid of Applied Biosystems 392/394DNA synthesizer amination) by any method known in the art.And synthetic agent can obtain by arbitrary supplier of family.

Can be synthetic with the oligonucleotide or derivatives thereof of the inventive method combined utilization by any method known in the art, for example, use automatic dna synthesizer (as can be, purchases such as Applied Biosystems) by the commercial channel from Biosearch.As example, phosphorothioate oligonucleotide can be by the method synthetic (1988 of Stein etc., Nucl.Acids Res.16,3209), the methyl acid phosphate oligonucleotide can prepare (Sarin et al. by application controls hole glass Support Polymer, 1988, Proc.Natl.Acad.Sci.USA 85,7448-7451) etc.

An oligonucleotide can comprise at least one modified base, as long as this modification can not disturbed homologous recombination.For example, these modifications include but not limited to 5 FU 5 fluorouracil, 5-bromouracil, the 5-chlorouracil, 5-iodouracil, xanthoglobulin, xanthine, 4-acetylcytosine, 5-(carboxylic methylol) uridylic, 5-carboxylic aminomethyl-2-thiouracil nucleosides, 5-carboxylic aminomethyl uridylic, two hydrogen uridylics, β-D-galactosylqueosine, inosine, N6-isopentennyladenine, the 1-methyl guanine, the 1-methyl hypoxanthine nucleosides, 2, the 2-dimethylguanine, the 2-methyladenine, the 2-methyl guanine, 3-methylcystein, 5-methylcytosine, the N6-VITAMIN B4, the 7-methyl guanine, 5-aminomethyl uridylic, 5-methoxy aminomethyl-2-thiouracil, β-D-mannosylqueosine, 5 '-methoxy carboxymethyl uracil, 5-methoxy uridylic, 2-first sulphur-N6-isopentennyladenine, uridylic-the 5-fluoroacetic acid (v), methyluracil, queosine, 2-sulphur cytosine(Cyt), 5-methyl-2-thiouracil, the 2-thiouracil, 4-thiouracil, methyl uracil, uridylic-5-fluoroacetic acid methyl esters, uridylic-5-fluoroacetic acid (v), 5-methyl-2-thiouracil, 3-(3-ammonia-3-N-2-carboxylic propyl group) uridylic, and 2,6-diaminopurine.

Oligonucleotide comprises the phosphoric acid trunk of at least one modification, as long as this modification can not disturbed homologous recombination.These modifications include but not limited to thiophosphatephosphorothioate, phosphorodithioate, sulfo-phosphoramidite, phosphoramidite, inferior phosphoryl diamine, methyl carbon phosphate cpd, alkyl phosphotriester, and methylal or its analogue.

5.3.3DNA amplification

Can using polymerase chain reaction (PCR) together with the present invention, from a certain source (as, tissue samples, genome or cDNA library) required sequence increases.Represent the Oligonucleolide primers of known array can be used as the PCR primer.Carry out typical PCR and need use thermal cycler (as from Perkin-Elmer Cetus) and heat-stabilised poly synthase (as Gene Amp ^TMThe Taq polysaccharase of board).The nucleic acid-templated mRNA that includes but not limited to any species, cDNA or genomic dna to be amplified.The pcr amplification method is well-known in the artly (to see that for example U.S. Patent number 4,683,202,4,683,195 and 4.889.818; Gyllenstein et al., 1988, Proc.Natl.Acad.Sci.USA85,7652-7656; Ochman et al., 1988, Genetics 120,621-623; Loh, et al., 1989, Science 243,217-220).

5.4 the method for diagnostic use

The inventive method can be used for surveying, prognosis, diagnosis or monitor multiple infection, the patient's condition, disease and the dysfunction relevant with allos or abnormal dna, or monitors its treatment situation.For example, as described in the 5.4.1 of lower section, these methods can be used for detection, prognosis, diagnosis or monitor multiple infection and disease, as with virus infection, infectation of bacteria or protozoon, parasite or other known pathogenic infection diseases associated.As described in the 5.4.2 of lower section, these methods can be used to survey, prognosis, diagnosis or monitor and multiplely have relevant infection, the patient's condition, disease and dysfunction with abnormal dna, as transgenation or single nucleotide polymorphism (SNP).To give elaboration here with the method that is diagnosed as purpose.

5.4.1 detection allogeneic dna sequence DNA

Above-described the inventive method also can be used for surveying allogeneic dna sequence DNA, as in being exposed to the patient of pathogenic agent, surveys the virus or the DNA of bacteria that come from the pathogenic agent exposure and produce.The patient may occur also the pathogenic infection symptom may not occurring, or has relevant disease or dysfunction with pathogenic agent.For example, in one embodiment, the target DNA sample can prepare from suffering from or suspecting the patient DNA that suffers from this disease or infection.Design and preparation have the homology arm with allos target DNA homologous sequence.Use upper section 5.1 described arbitrary methods then, sample DNA import is expressed bacterial recombinase and contain in the e. coli host cell of carrier DNA.In another embodiment, the adapter oligonucleotide can design first sequence that comprises with the carrier sequence homology, and with second sequence of allos target DNA homologous, its directional property details is as described in the upper section 5.1.These adapter oligonucleotide can be with sample DNA and carrier DNA, and the e. coli host cell of common transfection expression RecE/T or Red α/β also can direct transfection have comprised the cell of carrier DNA and sample DNA.As described in the upper section 5.1, cell is cultivated in selecting substratum then, presented the cell of selecting resistance and can be used for analyzing the existence of big or small insertion sequence of suiting.

Target DNA can separate from patient or experimenter's biological specimen, such as but not limited to whole blood, and blood plasma, serum, skin, saliva, urine, lymph liquid, biopsy cells, tissue culture cells, substratum also can separate from abiotic sample, as food, and water or other materials.The method for preparing DNA from these materials is well known to those skilled in the artly (to see, as CurrentProtocols in Molecular Biology series of laboratory technique manuals, 1987-1994 Current Protocols, 1994-1997 John Wiley and Sons, Inc.).

For example, in one embodiment, need to survey or diagnose a disease poison infection or disease, homology arm comprises the dna sequence dna homologous dna sequence dna with known viruse DNA.These methods can be used for surveying, isolated viral DNA, and its form can be the viral DNA chain, also can be the dna replication dna intermediate product of DNA or RNA viruses.

For example, in one embodiment, can use homology arm and directly determine the replicative intermediate of DNA genome or dna virus, described homology arm sequence is designed to and the virus sequence homology, these dna virus include but not limited to hepatitis B virus, parvovirus such as adeno-associated virus and cytomegalovirus, Papova virus is as papillomavirus, polyomavirus and SV40, adenovirus, simplexvirus such as I herpes simplex virus type (HSV-I), II herpes simplex virus type (HSV-II) and Epstein-Barr virus, and poxvirus such as variola (smallpox) and vaccinia virus.In another embodiment, can use homology arm directly determines to duplicate the replicative intermediate of the retroviral RNA viruses of acquisition from the DNA intermediate product, described homology arm sequence is designed to and the virus sequence homology, these RNA viruses include but not limited to I type human immunodeficiency virus (HIV-I), II type human immunodeficiency virus (HIV-II), the I type is had a liking for human T-lymphocyte virus (HTLV-I), and the II type is had a liking for human T-lymphocyte virus (HTLV-II).In another embodiment, in order to survey, separate genome or the replicative intermediate that duplicates the RNA viruses of acquisition from the RNA intermediate product, can be according to method well-known in the art, isolation of RNA, and the application reversed transcriptive enzyme is transcribed into the cDNA copy of RNA with it.These cDNA copies just can be used as the existence that target DNA is surveyed RNA viruses, described RNA viruses such as influenza virus, Measles virus, rabies virus, Sendai virus, picornavirus such as poliovirus, Coxsackie virus, rhinovirus, reovirus, togavirus such as rubella virus (Rubella) and Semliki forest virus, arboviruses, and hepatitis A virus.

In a further preferred embodiment, need diagnosis or survey infectation of bacteria, homology arm comprises the dna sequence dna with known DNA of bacteria sequence homology.For example, in one embodiment, the homology arm dna sequence dna can with cDNA or the genomic dna homology of pathogenetic bacteria, described bacterium includes but not limited to streptococcus pyogenes, streptococcus pneumoniae, neisseria gonorrhoeae, Neisseria meningitidis, diphtheria corynebacterium, Clostridium botulinum, clostridium perfringens, Clostridium tetani, hemophilus influenzae, bacillus canalis capsulatus, klebiella ozaenae, klebiella rhinoscleromatis, streptococcus aureus, vibrio cholerae, intestinal bacteria, Pseudomonas aeruginosa, embryo's Campylobacter, campylobacter jejuni, Aeromonas hydrophila, the cereus bacillus, edwardsiella tarda, yersinia entero-colitica, Yersinia pestis, artificial tuberculosis yersinia genus, shigella, shigella flexneri, shigella sonnei, Salmonella typhimurium, treponema pallidum, superfine treponema, treponema carateum, put forth energy gloomy borrelia burgdorferi, the yellow subcutaneous ulcer Leptospira of hemorrhagic, Mycobacterium tuberculosis, toxoplasma gondii, Pneumocystis carinii, Francisella tularensis, Bacillus abortus, Brucella suis, Bacterium melitense, Mycoplasma spp., dermacetor orientalis, Chlamydia spp., and Hp.

In another embodiment, the homology arm dna sequence dna can with the cDNA or the genomic dna homology of pathogenic epiphyte, described fungi includes but not limited to Coccidioides immitis, Aspergillus fumigatus, Candida albicans, Blastomyces dermatitidis, Cryptococcus neoformans, and Histoplasma capsulatum.

In a further preferred embodiment, need diagnosis or survey protozoal infections, homology arm can comprise and known protozoon dna sequence dna homologous dna sequence dna.For example, these homology arm dna sequence dnas can with any known protozoic cDNA or genomic dna homology.Interested especially pathogenicity bo protozoon such as Entomoeba histolytica, buccalis, Trichomonas hominis, Trichomonas vaginalis, the castellanella gambiense, trypanosoma rhodesiense, schizotrypanum cruzi, crithidia cunninghami, leishmania brasiliensis, pneumocystis pneumoniae, Plasmodium vivax, plasmodium falciparum, and malariae.

In a further preferred embodiment, need diagnosis or survey parasitic infection, homology arm can comprise and known parasite dna sequence dna homologous dna sequence dna.For example, these homology arm dna sequence dnas can with any known parasitic cDNA or genomic dna homology, these parasites comprise, for example worm, comprise pinworm, Trichuris trichiura, roundworm, Trichinella spiralis, strongyloides intestinalis, Schistosoma japonicum, Schistosoma mansoni, Schistosoma haematobium and hookworm.

5.4.2 diagnosis sudden change and polymorphism in cell DNA

The inventive method also is used in patient's sample separates, surveys genetic disorder, and prognosis, diagnosis or the monitoring multiple patient's condition, disease and the dysfunction relevant with abnormal dna, described abnormal dna such as transgenation or single nucleotide polymorphism (SNP), and survey the genetic predisposition who suffers from certain disease or dysfunction.

For example, in one embodiment, the target DNA sample can be from suffering from or suspecting and separate preparation patient's sample DNA of suffering from certain heredopathia or dysfunction.In a preferred embodiment, design and preparation contain the carrier of homology arm, and import in the e. coli host cell of expressing bacterial recombinase such as RecE/T and/or Red α/β the sequence of described homology arm and specific objective gene or target genome area homology.Then sample DNA is imported host cell.In another embodiment, the adapter oligonucleotide of design comprises first sequence with the carrier sequence homology, and with second sequence of target gene DNA homologous, its directional property details is as described in the upper section 5.1.In a preferred embodiment, these adapter oligonucleotide can be with sample DNA, and common transfection expression RecE/T and/or Red α/β also contain the e. coli host cell of carrier DNA.In addition, any other that can use also that upper section 5.1 describes in detail is used for homologous recombination clone's method.As described in the upper section 5.1, culturing cell in selecting substratum is analyzed the anti-existence of selecting suitable big or small insertion sequence in the cell then.Then by restriction analysis well-known in the art or sequential analysis technology, targeted mutagenesis or existing of DNA varient (see in the analyzing DNA, Current Protocols in Molecular Biology series of laboratory techniquemanuals for example, 1987-1994 Current Protocols, 1994-1997 John Wiley and Sons, Inc.).

In another embodiment, homology arm or adapter oligonucleotide can comprise target gene sudden change or dna polymorphism sequence.In this embodiment, when having only sample DNA to comprise this sudden change, reorganization just can take place.This method can be used for specific sudden change or the dna polymorphism in the extensive sample of diagnostic screening, because only comprise that the cell of this specific sudden change just can be to selecting to have resistance.

Target DNA can obtain from any dna sample, as genomic dna, and cDNA or Mitochondrial DNA.For example, in one embodiment, target DNA can be a zone of human chromosomal.In another embodiment, target DNA is mixed form, the genomic dna miscellany that obtains among the multiple goal of for example the comforming experimenter, and described target subject is as suffering from the patient of a certain specific function disorder.Such target DNA can separate from biological specimen, such as but not limited to whole blood, and blood plasma, serum, skin, saliva, urine, lymph liquid, biopsy cells, tissue culture cells, substratum also can separate from abiotic sample, as food, water or other materials.The method for preparing DNA from these materials is well known to those skilled in the artly (to see, as CurrentProtocols in Molecular Biology series of laboratory technique manuals, 1987-1994 Current Protocols, 1994-1997 John Wiley and Sons, Inc.).

The non-limiting example that can use the heredity dysfunction of this method detection comprises sudden change relevant with heredopathia and SNPs, as the Brca-1 relevant, with cystic fibrosis, Tay-Sachs disease, sicklemia, hemophilia, arteriosclerosis, diabetes, leukemia, prostate cancer and other tumours and fat relevant sudden change with mammary cancer.These heredopathias also comprise degeneration, non-degeneration nervous system disorders such as alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, Huntington ' s disease, Wilson ' s disease, spinocebellar ataxia, Friedreich ' s ataxia and other ataxia, (month unit) virus disease comprises the Creutzfeldt-Jakob disease, dentate nucleus rubrum pallidoluysian atrophy, sponge encephalopathic, myotonic atrophy, depression, schizophrenia and epilepsy.Heredopathia also may comprise metabolic disease, for example, and hypoglycemia or pku.Also comprise the cardiovascular disorder and the patient's condition, the non-limiting example of these diseases comprises arteriosclerosis, myocardial infarction and hypertension.The present invention also can be used to survey, diagnosis Lyme disease, tuberculosis and sexually transmitted disease (STD).

In another embodiment, homologous recombination cloning process of the present invention can be used for detecting the genetics basis of a kind of disease or dysfunction.For example, target DNA can separate from patient's sample of suffering from certain dysfunction, and the genetics basis of described dysfunction is not still known.In another embodiment, it is known or suspect to suffer among the patient of certain dysfunction that this cloning process is used in a group, separates known or suspection and this disease or the relevant chromosomal region of dysfunction.Then, use abnormal dna drawing technique well-known in the art, as restriction fragment length polymorphism or other SNP Detection Techniques, can further separate, analyze the DNA that obtains, survey the existing of transgenation or polymorphism (see as, Nikiforov et al., the U.S. Patent number 5 that on October 21st, 1997 authorized, 679,524; McIntosh et al., the PCT publicationWO 98/59066 that on December 30th, 1998 put on record; Goelet et al., the PCT publication WO95/12607 that put on record May 11 nineteen ninety-five; Wang et al., 1998, Science 280:1077-1082; Tyagi et al., 1998, Nature Biotechnol.16:49-53; Chen et al., 1998, Genome Res.8:549-556; Pastinen et al., 1996, Clin.Chem.42:1391-1397; Chen et al., 1997, Proc.Natl.Acad.Sci.94:10756-10761; Shuber et al., 1997, Hum.Mol.Gen.6:337-347; Liu et al., 1997, Genome Res.7:389-398; Livak et al., 1995, Nature Genet.9:341-342; Day and Humphries, 1994, Annal.Biochem.222:389-395).

The non-limiting example of target chemical qualitative correlation target dysfunction comprises asthma, sacroiliitis, psoriatic, excema, allergy, resistance, drug toxicity and tumour are such as but not limited to human sarcoma and cancer, as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, angiosarcoma, endotheliosarcoma, the lymph vessels sarcoma, lymph vessels endotheliosarcoma, synovioma, mesothelioma, Ewing ' s tumour, leiomyosarcoma, rhabdosarcoma, colorectal carcinoma, carcinoma of the pancreas, mammary cancer, ovarian cancer, prostate cancer, squamous cell cancer, rodent cancer, gland cancer, syringocarcinoma, fatty gland cancer, papillary carcinoma, adenocarcinoma of nipple, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, kidney, hepatoma, cholangiocarcinoma, choriocarcinoma, spermocytoma, embryonal carcinoma, Wilm ' s tumour, cervical cancer, tumor of testis, lung cancer, small cell lung cancer, bladder cancer, epidermal carcinoma, neurospongioma, star-like glucagonoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic tumor, Oligodendroglioma, meningioma, melanoma, neuroblastoma, retinoblastoma; Leukemia, as acute lymphoblastic leukemia and acute myelocytic leukemia (myeloblastic leukemia, the promyelocyte leukemia, the Myelomonocyte leukemia, monocytic leukemia and erythroleukemia), chronic leukemia (chronic myelocytic (granulocyte) leukemia and chronic lymphocytic leukemia), multiple myeloma, Waldenstrom ' s macroglobulinemia, and heavy chain disease.This homologous recombination cloning process also can be further used for diagnosis, survey unusual difference, and diagnose the patient who suffers from autoimmune disorder, described autoimmune disorder includes but not limited to insulin-dependent diabetes, multiple sclerosis, systemic lupus erythematous, Sjogren ' s syndrome, scleroderma, polymyositis, chronic active hepatitis, miscibility connective tissue disease (CTD), primary biliary cirrhosis, deleterious anaemia, autoimmune thyroiditis, the special property sent out Addison ' s disease, vitiligo, seitan susceptibility enteropathy, the Graves disease, myasthenia gravis, autoimmune neutropenia, idiopathic thrombocytopenic purpura, rheumatoid arthritis, liver cirrhosis, pemphigus vulgaris, autoimmunity is sterile, Goodpasture ' s disease, bullous pemphigoid, discoid lupus, ulcerative colitis, and dense deposit disease.

The homologous recombination cloning process also can be used for separating, dna mutation, change, variation and the SNPs of diagnosis, detection and disease independent.Non-limiting example is included in dna mutation, change, variation and the SNPs that occurs in the non-encoding gene group sequence, dna mutation, change, variation and SNPs that perhaps different with mankind blood groups are relevant.

In aspect one of the present invention is preferred, the inventive method can specifically be used for separation, detection, diagnosis, prognosis or the sudden change of monitoring human DNA, change, variation and SNPs.But, should be appreciated that method described herein also can be used for separation, detection, diagnosis, prognosis or monitors other mammalian diseases, for example, agricultural animal comprises ox, horse, sheep, goat and pig, and pet comprises cat and dog at home, and plant comprises farm crop and gardening plant.

5.5 test kit

The present invention also provides the test kit that can make homologous recombination clone described herein and subclone method be easier to use.In one embodiment, the test kit that provides comprises one or more containers: the double-stranded DNA carrier that a) is used for directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; Like this, article one, the nucleotide sequence of first homology arm on the carrier DNA chain and first end sequence homology on article one target dna strand, second terminal nucleotide sequence homology on the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand; And b) contains the cell of bacterial recombinase.This cell can this recombinase of endogenous expression, also can recombinant expressed this recombinase.

In another embodiment, the test kit that is used for directed cloning or subclone target DNA molecule is provided, this test kit comprises one or more containers: the double-stranded DNA carrier that a) is used for directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm, like this, article one, the nucleotide sequence of first homology arm on the carrier DNA chain and first end sequence homology on article one target dna strand, second terminal nucleotide sequence homology on the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand; B) first double chain oligonucleotide, contain first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first sequence and second sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand; C) second oligonucleotide, contain second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand; And d) contains bacterial recombinase albumen, as RecE/T and/or the proteic cell of Red α/β.In a particular, cell is a Bacillus coli cells.

In another embodiment, test kit provided by the invention comprises one or more containers: the double-stranded DNA carrier that a) is used for directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm, like this, article one, the nucleotide sequence of first homology arm on the carrier DNA chain and first end sequence homology on article one target dna strand, second terminal nucleotide sequence homology on the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand; B) first double chain oligonucleotide, contain first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand; And c) second oligonucleotide, contain second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand.

In a plurality of particular, the target DNA of test kit can be bacterium, virus, parasite, protozoon or cause of disease DNA.In other particular, the test kit target DNA can comprise transgenation or polymorphism known or suspection and a certain dysfunction or disease-related.In another particular, adapter oligonucleotide sequence or carrier homology arm sequence with based on BAC, PAC, λ, the cloning vector homology of plasmid or YAC.

6. embodiment: clone and subclone RecE/T and Red α/β

The embodiment that provides in this part has described application homologous recombination method of the present invention, successfully a plurality of experiments of clone, subclone.The means of different that has also shown the subclone method.Special needs to be pointed out is that an embodiment has successfully cloned than the big fragment of aforementioned any insertion fragment---from the BAC carrier of about 150kb directed subclone the dna fragmentation of 25kb.

6.1. method and material

The preparation linear fragment

Application standard PCR reaction conditions amplification linear DNA fragment.P15A starting point and kantlex drug resistant gene (from Tn903) from pACYC177 amplification 1972bp.The p15A starting point allows this plasmid or recombinant chou to exist jointly with the plasmid that carries the compatible group of ColE1 starting point in cell.Paraxin (from Tn9) drug resistant gene and p15A starting point from pACYC184 amplification 1934bp.

The oligonucleotide that is used for PCR reaction comprises, at its 3 ' end, and as the 18-30 nucleotide sequence of pACYC plasmid primer, and 5 ' end, with 50-60 Nucleotide extension sequence of target DNA flanking region homologous.For long oligonucleotide, the PCR of application reaction annealing temperature is 62 ℃.By application QIAGEN PCR purification kit (QIAGEN) purified pcr product, and use dH ₂The O wash-out.By using Dpn I digestion PCR product, remove template DNA.After the digestion, use ethanol sedimentation PCR product, and then be suspended in dH ₂Among the O, concentration is 0.5ug/ul.

The preparation functioning cell

Prepare electric transformation function cell by standard method.In brief, the cell of incubated overnight is used and is contained 100 times of suitable antibiotic LB substratum dilutions.Grow into optimum density, OD ₆₀₀The Bacillus coli cells of=0.25-0.4 was at freezing 15 minutes on ice.Then-5 ℃ with 7, the centrifugal bacterial cell of 000rpm 10 minutes.The outstanding more sedimentary bacterial cell of freezing glycerine with 10%, then-5 ℃ with 7, centrifugal 10 minutes of 000rpm is to produce precipitation.With freezing 10% glycerine clean, again after centrifugal 3 times, to wait freezing 10% glycerine suspension cell precipitation of cell volume.Functioning cell is stored in the eppendorf pipe with the 50ul five equilibrium, puts into liquid nitrogen freezing, be stored in-70 ℃.

The experiment of using plasmid pBAD-ET γ or pBAD-α β γ comprises that the application standard method is transformed into these plasmids in the escherichia coli host, overnight incubation in the LB substratum that has added 0.2% glucose, 50ug/ml penbritin then, saturated until growing into, use the LB substratum that has added the 50ug/ml penbritin then and dilute 100 times of cultures, and continued growth is to OD ₆₀₀Be 0.15.Adding L-arabinose to final concentration then is 0.1%.Grow into OD at cell ₆₀₀Behind 0.25-0.4, at freezing 15 minutes on ice.

Electricity transforms

The dna solution of 1ul (comprise approximately 〉=the cotransformation DNA of 0.5ug, perhaps approximately 〉=carrier DNA of 0.3ug, for cell provides the grappling target, perhaps approximately 〉=DNA of 0.5ug, contain the target gene of cell grappling carrier) is mixed with functioning cell.Cell, DNA mixture are transferred in the freezing cuvette.Use Bio-Rad gene pulse instrument and carry out the electricity conversion, be set to 25uFD, 2.3kV, the pulse contrast is set to 200ohms.After electricity transforms, add LB substratum (1ml).Cell shakes at 37 ℃ and hatches 1-1.5 hour, but be inoculated into then contain with the corresponding microbiotic flat board of carrier selectable marker gene on.

6.2 result

Table 1 has been summed up 6 result of experiment, in these 6 experiments, uses the RecE/T of different sources or Red α/β different target target DNA zone of having expressed subclone.First row are expressed beginning with " ET ", are meant RecE/T or Red α/β source, and it is as shown in the table, and its source can be the endogenous RecE/T of escherichia coli host JC8679 or JC9604, also can be the pBAD-recE/T that comes from plasmid pBAD α β γ.Secondary series is indicated used escherichia coli host.The 3rd row indication target gene.

In first experiment, the subclone in coli strain JC8679 of the recE/T gene on the escherichia coli chromosome, the expression of RecE/T is a fixed in this bacterial strain.This can realize by the generalized strategy of Fig. 2.Design, synthetic oligonucleotide have following sequence:

5 '-TTCCTCTGTATTAACCGGGGAATACAGTGTAATCGATAATTCAGAGGAATAGCTCG AGTTAATAAGATGATCTTCTTGAGATCG-3 ' (sequence 1)

With

P15A replication orgin and Tn903 kantlex drug resistant gene on 5 '-CAGCAATGTCATCGAGCTGAGACTTACTGATACCGGGACCCGCGTGGTAATTCTCG AGTGATTAGAAAAACTCATCGAGCATC-3 ' (sequence 2) pACYC177 that increases.This experimental result is summarized in first row of table 1.

Table 1.

In second experiment, the subclone in coli strain JC8679 of the lacZ gene on the escherichia coli chromosome, the expression of RecE/T is a fixed in this bacterial strain.This can realize by the generalized strategy of Fig. 2.Carrier is prepared by round pcr, and used oligonucleotide has following sequence among the PCR:

5 '-TCAACATTAAATGTGAGCGAGTAACAACCCGTCGGATTCTCCGTGGGAACAAACGG GAATTCTGATTAGAAAAACTCATCGAGCATCAAAGT-3 ' (sequence 3)

With

P15A replication orgin and Tn903 kantlex drug resistant gene on 5 '-TCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGGGATC CTTAATAAGATGATCTTCTTGAGATCG-3 ' (sequence 4) pACYC177 that increases.This experimental result is summarized in second row of table 1.

In the 3rd experiment, the subclone in coli strain JC9604 of the lacZ gene on the escherichia coli chromosome, the expression of RecE/T is a fixed in this bacterial strain.This can realize by the generalized strategy of Fig. 2.Carrier is prepared by round pcr, and used oligonucleotide has following sequence among the PCR:

5 '-TCAACATTAAATGTGAGCGAGTAACAACCCGTCGGATTCTCCGTGGGAACAAACGG GAATTCTGATTAGAAAAACTCATCGAGCATCAAATG-3 ' (sequence 5)

With

P15A replication orgin and Tn903 kantlex drug resistant gene on 5 '-TCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGGGATC CTTAATAAGATGATCTTCTTGAGATCG-3 ' (sequence 6) pACYC177 that increases.This experimental result is summarized in the third line of table 1.

In the 4th experiment, the gentamicin gene that is positioned on the high copy number plasmid pFastBAC1 (Gibco) passes through the generalized strategy of Fig. 3, subclone in coli strain JC5519.After the pBAD-recE/T plasmid transforms JC5519,, and before the preparation functioning cell, use pectinose and induce by this plasmid expression RecE/T.Carrier is prepared by round pcr, and used oligonucleotide has following sequence among the PCR:

5 '-TGCACTTTGATATCGACCCAAGTACCGCCACCTAACAATTCGTTCAAGCCGAGGAT CCTTAATAAGATCATCTTCTGAGATCGTTTTGG-3 ' (sequence 7)

With

5 '-TGCATTACAGTTTACGAACCGAACAGGCTTATGTCAACTGGGTTCGTGCCTTCAGA ATTCTGATTAGAAAAACTCATCGAGCATCAAATG-3 ' (sequence 8)

Increase p15A replication orgin and Tn903 kantlex drug resistant gene on the pACYC177, the pFastBAC1 of PCR product and BamHI digestion is mixed, cotransformation, and be inoculated on the flat board that contains gentamicin and kantlex.

In the 5th experiment, the lacZ gene that is positioned on the escherichia coli chromosome passes through the generalized strategy of Fig. 2, subclone in coli strain HB101.After the pBAD-recE/T plasmid transforms HB101,, and before the preparation functioning cell, use pectinose and induce by this plasmid expression RecE/T.Carrier is prepared by round pcr, and used oligonucleotide has following sequence among the PCR:

5 '-TCAACATTAAATGTGAGCGAGTAACAACCCGTCTTATTCTCCGTGGGAACAAACGG GAATTCTGATTAGAAAAACTCATCGAGCATCAAATG-3 ' (sequence 9)

With

P15A replication orgin and Tn903 kantlex drug resistant gene on 5 '-TCAGGGGAAAACCTTATTTATCAGCCGGAAAACCTACCGGATTGATGGTAGGGATC CTTAATAAGATGATCTTCTTGAGATCG-3 ' (sequence 10) pACYC177 that increases.This experimental result is summarized in the fifth line of table 1.

In the 6th experiment, carry about 150kb BAC clone's of mouse AF4 gene 25kb zone and pass through the generalized strategy of Fig. 3, subclone in coli strain HS996.After the pBAD-recE/T plasmid transforms HS996,, and before the preparation functioning cell, use pectinose and induce by this plasmid expression RecE/T.Carrier is prepared by round pcr, and used oligonucleotide has following sequence among the PCR:

5 '-TGTAGCTGAGCCCAGGGGCAAGGCTGCTTTGTACCAGCCTGCTGTCTGCGGGGGCA TCACCTGGAATTCTTAATAAGATGATCTTCTTGAGATCGTTTTGG-3 ' (sequence 11)

With

5 '-TGGGTGTCAACCTCAGGCTTTCTCACACGCAATACAGGTAGGGACTTGCACCCCTA CACACCGAATTCTGATTAGAAAAACTCATCGAGCATCAAATG-3 ' (sequence 12)

P15A replication orgin and Tn903 kantlex drug resistant gene on the pACYC 177 increase.PCR product and 0.5ug purifying BAC DNA are mixed, then cotransformation.This experimental result is summarized in the 6th row of table 1.What Fig. 6 showed is the painted sepharose of bromination second pyridine, has shown the DNA that uses EcoRI digestion, and this DNA separates from 9 independent colonies (swimming lane 1-9) from the mAF4BAC experiment, and contrast is an initial vector (swimming lane 10) of using EcoRI digestion.

In the 7th experiment, application drawing 7 generalized strategies have been cloned the genomic dna zone of containing from the penbritin drug resistant gene of yeast strain MGD 353-13D.As scheme shown in the A, containing the dna fragmentation of p15A replication orgin, its flank is 98 or the homology arm of 102bp, described homology arm points to 98 or 102bps of the penbritin drug resistant gene flank region among the yeast strain MGD 353-13D.Use coli strain JC5519, the expression of Red α/β is provided by plasmid pBAD α β γ-TET, then, before the preparation functioning cell, uses pectinose and induces.PBAD α β γ-TET is the derivative of pBAD α β γ, and wherein, the penbritin drug resistant gene is replaced by tetracycline resistance gene.Cloning vector is prepared by round pcr, and used oligonucleotide has following sequence among the PCR:

5 '-TCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGC AAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATAACACCCCTTGTATT ACTGTTTATGTAAGCAGACAG-3 ' (sequence 13)

With

5 '-TCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAA TAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAATTAATAAGAT GATCTTCTTGAGATCGTTTTGG-3 ' (sequence 14)

P15A replication orgin on the pACYC 177 increases.The MGD 353-13D pastoris genomic dna of PCR product and 4ug NcoI digestion is mixed, cotransformation comprises the JC5519 that Red α/β expresses then, Red α/β expresses from pBAD α β γ, cultivates 90 minutes recovery after dates in 37 ℃, L-meat soup, is inoculated in the flat board that contains penbritin.Select to identify the clone by the penbritin resistance.Have 18 clones and carried out DNA analysis.Fig. 7 B has shown 10 correct clones' bromination second pyridine dyeing gel.

The embodiments described herein explanation, RecE/T and Red α/β homologous recombination cloning process can successfully be cloned into multiple ring-type target gene on the escherichia coli chromosome, and described ring-type target gene copies than big target gene (BAC) to low from high copy number plasmid.

7. carrier tumor-necrosis factor glycoproteins and phosphorylation are to the influence of cloning efficiency

The embodiment that this part gives has described application RecE/T or Red α/beta mediated homologous recombination (" ET clone ") technology is carried out the top condition of high-efficient cloning and subclone.Particularly as shown in Figure 8, the tumor-necrosis factor glycoproteins of removing in the carrier can improve cloning efficiency.On the contrary, but very little in the terminal 5 ' phosphorylation that occurs of linear carrier to ET clone's effectiveness affects.

At first, in following experiment, detected the influence of tumor-necrosis factor glycoproteins to cloning efficiency.As shown in Figure 8, linear carrier as cloning vector comprises the p15A replication orgin, the paraxin drug resistant gene (Cm '), the nucleotide sequence (representing with italic among Fig. 8) that the pcr amplification linear carrier is required, the flank homology arm of intestinal bacteria lacZ gene, and the terminal repeat of the different lengths that exists at the linear carrier two ends (with the black matrix representative).Linear carrier is transformed into expression pBADRed α/β (Zhang et al., 1998, (the endogenous ET of JC8679 Nat.Genet.20:123-128); Clark, 1974, Genetics, 78,259-271) or JC5519 (Willetts and Clark, 1969, J.Bacteril100:231-239) in.After having shown application indication oligonucleotide pcr amplification linear carrier in Fig. 8 table, behind the ET subclone, the colony quantity that contains on the LB flat board (paraxin that contains 50ug/ml).Wherein 18 colonies have carried out restrictive diges-tion.Draw recombination efficiency with correct recombinant chou quantity divided by total colony quantity.Therefore, terminal repetition＞6 Nucleotide can significantly reduce ET subclone efficient.The colony of having powerful connections all contains the linear carrier that connects again.

Also detected the influence of phosphorylation to recombination efficiency, the result as shown in Figure 8.Use T4DNA kinases and γ-ATP and make the linear carrier terminal phosphateization.Shown in last row of Fig. 8, do not observe the influence that ET subclone or carrier are connected again.

This embodiment shows, the tumor-necrosis factor glycoproteins terminal or that between the essential element of homology arm and carrier, exist at linear carrier, the reorganization that causes can significantly reduce ET clones and subclone efficient, but shown in must element be replication orgin and selective marker.Therefore, in a preferred embodiment, homologous clone carrier sequence does not comprise the direct repeat sequence of any 〉=5 base in coding replication orgin and the outside that can select flag sequence.

8.RecE/T and other embodiment of Red α/β clone and subclone

The embodiment that this part provides has described other experiments, and these experiment display application RecE/T or Red α/beta mediated homologous recombination techniques are successfully cloned the method with subclone.

Escherichia coli host

As mentioned above, " ET function host " is meant any Bacillus coli cells that can express RecE/T and/or Red α/β.This can as the bacterial strain of (i) endogenous expression RecE/T or Red α/β, perhaps (ii) import the bacterial strain of plasmid expression RecE/T or Red α/β by multiple by way of realization by external source.This embodiment has described the structure based on the plasmid expression vector of JC9604 and JC8679 and derivative (mainly being YZ2000 and YZ2001) thereof.ET function host's other varients and example are seen Murphy et al., 2000, Gene 246:321-330; Yu et al., 2000, Proc.Natl.Acad.Sci.97:5978-5983; And Datsenko and Wanner, 2000, Proc.Natl.Acad.Sci.97:6640-6645.

In the first kind, two bacterial strains of application carry the sbcA sudden change, therefore at RecA ^-(JC 9604; Gillen et al., 1981, J.Bacteriology 145:521-532) or RecA ⁺(JC8679; Gillenet al., supra) endogenous expression RecE/RecT under the background.The advantage of using these bacterial strains is that they can directly be used, and needn't at first import a plasmid for making this bacterial strain have the ET cloning function.Shortcoming is RecE and RecT fixing all the time expression the in clone's whole process, particularly at RecA ⁺Under the background, increased the not risk of desire reorganization of intramolecularly.Second shortcoming is that these JC bacterial strains are not modified to be used for the clone and to breed the host.They comprise complete activity restriction/modification system, therefore greatly reduce the efficient that macromole such as BACs import these hosts.

Select the host strain of endogenous expression RecE/T or Red α/β, still import the host strain of plasmid expression RecE/T or Red α/β, depend on the character of ring-type target sequence.No matter select which kind of strategy, it all is vital preparing colory functioning cell.If host strain lacks endogenous ET clone potential, this bacterial strain must at first transform pBAD-α β γ or pBAD-ET γ.It is 0.1% L-arabinose induced growth that the bacterial strain that obtains must be used final concentration, prepares electricity then and transforms.According to experience, the best of cell results point is OD ₆₀₀Be approximately 0.35, particularly when target sequence is big DNA substrate.If the OD of cell ₆₀₀Greater than 0.5, just should not use.The best importing time is approximately 1 hour.Must answer electricity consumption to transform, can not play a role because find other DNA introduction methods.The good electric transformant of preparation quality is vital for obtaining the ET recombinant chou.Between the electric transformation function cell stage of preparation, institute in steps all need carry out on ice or on the keg of precooling, rotor.Electric transformation function cell height is concentrated: for OD ₆₀₀The 250ml culture of=0.35 o'clock results, our routine is prepared into the functioning cell that is no more than 10 five equilibriums, every five equilibrium 50ul.The transformation efficiency that obtains depends on used host strain greatly, but typical variation is approximately 10 ⁹Cfu/ug.About how to prepare electric transformation function cell and how to carry out the electric detailed experiment flow that transforms can obtain from following network address:

http://www.embl-heidelberg.de/ExternalInfo/stewart/index.html。

Shown in Fig. 9 A, make up plasmid pR6K/BAD-α β γ (tet), BAC host strain HS996 (Invitrogen) is had carry out the ability that ET recombinates.This plasmid is based on pBAD24 skeleton (Guzman et al., 1995, J Bacteriol 177:4121-4130).Red α (or RecE) can induce pBAD promotor abduction delivering by L-arabinose, and Red β (or RecT) is by fixing EM-7 promotor abduction delivering.RecT is with respect to RecE, or Red β can increase ET clone's efficient (is standard to select the colony quantity on the flat board) with respect to the overexpression of Red α.At last, the fixing Red γ albumen of expressing of this plasmid, in this case, this proteic expression is induced by fixing Tn5 promotor, described promotor is necessary (Murphy for the RecBCD enzymic activity that exists in the host strain that suppresses the most normal application, 1991, J.Bacteriology 173:5808-5821).If do not make its inactivation, RecBAD can suppress ET clone fully, and its reason may be that the exonuclease activity of this enzyme makes linear DNA just be degraded before the reorganization having an opportunity.Therefore, pBAD-α β γ (tet) has formed a mobile system, can be delivered to by conversion and accepts in the host strain regulating ET clone characteristic.The expression of supposing RecE or Red α has inducibility, for reorganization is taken place, the absolute demand that two components are expressed simultaneously in RecE/T and the Red α/beta system also is met, and the restriction of reorganization window is exactly pectinose induction time and transformation period of least stablizing component.These combined factors are considered, and are recA that the host also can be recBC or recBC certainly in conjunction with the most frequently used host ^-Phenocopy (depending on the expression of Red γ), this means that not desiring the risk that intramolecularly reorganization takes place significantly reduces.Another useful feature of pBAD-α β γ (tet) is not have in the training period when selected when these plasmids, and they tend to rapidly disappear.This may be the fixedly expression owing to Red γ, and other factors that also can rely on host cell change, for example the existence of RecBCD.

The duplicating of pR6K/BAD-α β γ need R6K starting point and Pir-116 albumen (Metcalfet al., 1994, Gene 138,1-7).PR6K/BAD/ α β γ carries R6K starting point (the Penfold and Pemberton from pJP5603,1992, Gene 118:145-6), the pir-116 replicon gene of control R6K ori plasmid replication in bacterium, and from the tetracycline resistance gene tet of pBR322.Pir-116 is a copy mutant, and the plasmid that allows to contain the R6K starting point exists with the amount that surpasses every cell 200 copies in coli strain.The pir-116 gene comes from coli strain BW3647, by pcr amplification, and at lacZ promotor rear clone.

In order to prepare pR6K/BAD/ α β γ, R6K starting point, pir-116 and tet are imported pBAD-α β γ (Muyrers et al. by the ET reorganization, 1999, Nucleic Acids Research, 27:1555-1557), displacement was present in ColE1 starting point and the penbritin drug resistant gene on the pBAD-α β γ originally.Same preparation pR6K/BAD/ET γ and pR6K/BAD/recT.Compared to the parental plasmid based on ColE1, copy number is approximately high 2 times based on any plasmid of R6K.Parallel relatively pR6K/BAD/ α β γ and pBAD-α β γ found that the plasmid working efficiency higher (seeing Fig. 9 B) based on R6K in the exercise of standard BAC subclone.The R6K dubbing system that exists in these pR6K plasmids does not contain any and the remarkable homologous sequence of other replication orgin, and described other replication orgin comprise p15a and ColE1.And, based on plasmid and other any replication orgin compatibilities of R6K.Therefore, the replication orgin as ColE1 and p15A can be included in the linear carrier that is used for the ET subclone.

The ET subclone

Figure 10 has shown the fragment of a 19kb of subclone, and this fragment comprises that BAC goes up the

exon

2 and 3 of AF-4 gene.At first, pR6K/BAD-α β γ is transformed in the bacterial strain that carries BAC.Subsequently, in the LB substratum that contains 15ug/ml tsiklomitsin and 12.5ug/ml paraxin, cultivate these and transform bacterial strain.Use L-arabinose induced growth cell 1 hour, prepare electric transformation function cell then.These cells transform by electricity and import linear carrier, shown in carrier comprise p15A replication orgin and penbritin drug resistant gene, β-Nei Xiananmei (bla), its flank are two homology arms that length is 50 Nucleotide, can instruct the target DNA homologous recombination on the AF-4BAC.After containing on the LB flat board of 50ug/ml penbritin growth, the results recombinant chou.

Shown in Figure 10 B, select 5 independent sets to drop into row analysis.From 5 independent colonies, prepare DNA, use HindII digestion then, and on bromination second pyridine dyeing gel, analyze.The correct colony of HindIII digestion and linear carrier and 1kb DNA ladder (Gibco BRL) serve as a mark.Correct subclone is confirmed by dna sequence analysis.

The ET clone

Shown in Figure 11 experiment, genomic dna also can be used as the direct sources of target DNA.In this experiment, linear carrier comprises ColE1 starting point and kantlex drug resistant gene (kan), and its flank is a homology arm, can instruct the reorganization (seeing Figure 11 A) that betides lacI/lacZ site on the escherichia coli chromosome.Genomic dna separates from intestinal bacteria, and through XhoI digestion, linearizing in advance.Mixed linear carrier and pre-linearizing genomic dna, common electricity transforms the YZ2000 that imports endogenous expression RecE/RecT.By selecting containing on the LB flat board of 50ug/ml kantlex, obtain to contain the required subclone of lacI and lacZ gene, ColE1 starting point and kan.Shown in Figure 11 B, the restriction analysis of 16 independent colonies is found, is contained correct product (swimming lane 1-16).Swimming lane 17 is a linear carrier, and swimming lane M is the 1kb DNA ladder (Gibco BRL) that serves as a mark.

Another successful ET recombinant clone example as shown in figure 12.In this experiment, by using the homology arm cloning vector, direct cloned sequence in mouse ES cell genomic dna.As summarized shown in Figure 12 A of clone's strategy, from the Xin Meisu drug resistant gene (neo) of mouse ES cell genomic dna as target DNA.Linear carrier comprises ColE1 replication orgin and paraxin drug resistant gene Cm ', and its flank is two arms, with the Tn5-neo dna homolog.Required mouse ES clone can comprise the produced in fragments of Tn5-neo by transfection, and described fragment and adds the polyA tail under PGK promotor control.Isolation of genomic DNA from G418 resistance colony, and,, create the linear fragment of about 20-40kb by the phenol/chloroform extracting with the pin shearing.

Transform the genomic dna of linear carrier and shearing by common electricity, it is imported the derivative YZ2000 (Clark of JC8679, supra), carry out the ET clone, in YZ2000, the restricted system of degraded allos methylate DNA has been owing to removed mcrA, mcrBC, hsdRMS and mrr gene and part weakens.Because overexpression RecT can significantly increase whole ET recombination efficiency, therefore use the pR6K/BAD/recT plasmid and transform YZ2000.Carry the YZ2000 of pR6K/BAD/recT, used L-arabinose in preceding 1 hour in results and induce, use 0.5ug linear carrier and 5.0ug then and shear the common electricity conversion of mouse ES cell genomic dna.Containing 25-35 colony of average results on the LB flat board of 50ug/ml paraxin.On the flat board that contains the 50ug/ml kantlex, breed these colonies once more, by finding to have 6 growths in 30 colonies of Tn5-neo representation test.In Figure 12 part B, to the restriction analysis demonstration of kantlex resistance colony, all 6 test colonies all are correct (swimming lane 2-7).The false positive restriction map is shown in swimming lane 1, and this colony is having under the situation of paraxin and can grow, but can't grow under the situation that kantlex exists.All these false positive colonies all comprise the carrier that connects again.

Figure 13 has shown an experiment of uniting ET subclone and clone.Linear carrier comprises ColE1 replication orgin and kantlex drug resistant gene Km '.Each end of linear carrier all comprises BstZ17I site and 2 homology arms.In terminal homology arm that exists of linear carrier (in Figure 13 with little box indicating) and lambda particles phage target DNA homology.LacI-lacZ dna homolog on the second cover homology arm (in Figure 13 with big box indicating) and the escherichia coli chromosome.

In the first step subclone, linear carrier and the common electricity of linearizing lambda particles phage target DNA are transformed among the coli strain JC8679 Δ lacZ with ET characteristic.This step causes the λ dna fragmentation subclone of 6.7kb to linear carrier, and this fragment comprises exo, bet, and gam, rexA and cI857 gene, and then produce pYZN/ λ-PR.A new linear carrier is used in next step ET reorganization, and this carrier comprises the site (laxP by sudden change laxP ^*, Araki et al., 1997, Nucleic AcidsResearch, 25:868-872) the paraxin drug resistant gene cat that holds of flank, and with the terminal arm of the last λ dna homology of pYZN/ λ-PR.This linear carrier is with pYZN/ λ-PR, and common electricity is transformed among the coli strain JC8679AlacZ with ET characteristic, causes the formation of pYZN/ λ-PR/Cm.By BstZ 17I digestion, this plasmid discharges the λ dna fragmentation that contains cat, and this fragment is by holding with two terminal arm flanks of lacI-lacZ homologous.This fragment is used to locate coli strain JC5519 (Willetts and Clark, 1969, J Bacteriol, karyomit(e) 100:231-239), this bacterial strain is expressed RecE and the RecT (Zhanget al., 1998, Nature Genetics 20:123-128) from pBADRecE/T.After the ET reorganization, under the situation that has 20ug/ml paraxin, select growth, produce the YZ2001/Cm bacterial strain.By using the 706-Cre plasmid, remove the cat gene, produce YZ2001, what described plasmid was different with 705-Cre is, it carries tetracycline resistance gene (tet) but not the paraxin drug resistant gene, as (Buchholz etal., 1996 as described in the document, Nucleic Acids Research, 24:3118-3119).Therefore, YZ2001 carries the λ dna fragmentation (exo----cI857) of 6.7kb, and the sudden change laxP site on the karyomit(e).Because YZ2001/Cm allows λ gene exo, the thermal induction of bet and gam is expressed, and therefore has condition ET characteristic.For example, strategy preparation that can applications similar knocks out construction or carries out BAC and modify.

Therefore, the embodiment that gives has above shown that several application RecE/T and Red α/beta mediated homologous recombination technique successfully clone the method with subclone.

Particular disclosed herein should not limit the scope of the present invention and claim, because these embodiments are several aspects in order to demonstrate the invention.Any equivalent embodiments all should belong to category of the present invention.In fact, by the description of front, except the modification that this paper has shown or described, those skilled in the art can carry out multiple other modifications to the present invention easily.These modify the category that also should belong to the back claim.In present specification, quoted a lot of reference, the content of every piece of document is all introduced in full at this, as the reference of present specification.

Claims

1. method that double-stranded target DNA is imported carrier, the bacterium that comprises the functional recombinase of culture expression, described bacterial cell comprises (a) target DNA, contain first double-stranded terminal and second double-stranded end, and (b) carrier DNA, on the carrier DNA chain, contain in the following sequence: (i) (ii) replication orgin of first double-stranded homology arm, and (iii) second double-stranded homology arm, like this, first homology arm sequence of carrier DNA chain and first end sequence homology of target dna strand, second homology arm sequence of carrier DNA chain and second end sequence homology of target dna strand, like this, target DNA can insert in the carrier DNA between homology arm.

2. prepare the method for recombinant DNA molecules, comprising:

A) with double-stranded carrier transfered cell, described cell contains double-stranded target DNA, and expression bacterial recombinase, described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, a chain of replication orgin, and second homology arm;

Described target DNA contains a target DNA sequence and two ends, on target dna strand, and from 3 ' to 5 ', exist in the following sequence: first end, target DNA sequence, and second end;

Like this, first homology arm sequence on the carrier DNA chain and first end sequence homology on the target dna strand, second homology arm sequence on the carrier DNA chain and second end sequence homology on the target dna strand; And

B) cell is placed under the condition that homologous recombination in the cell can take place.

3. prepare the method for recombinant DNA molecules, comprising:

A) with double-stranded carrier and first, second double chain oligonucleotide transfered cell, described cell contains double-stranded target DNA, and expresses bacterial recombinase,

Described carrier contains a replication orgin and two double-stranded homology arms, on the carrier DNA chain, and from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm;

Described target DNA contains a target DNA sequence and two double-stranded ends, on target dna strand, and from 3 ' to 5 ', exist with following order: first end, target DNA sequence, and second end;

Described first oligonucleotide contains first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand;

Described second oligonucleotide contains second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand; And

4. prepare the method for recombinant DNA molecules, comprising:

A) with double-stranded target DNA molecule transfered cell, described cell contains a carrier, and expresses bacterial recombinase,

Described target DNA contains a target DNA sequence and two double-stranded ends, on target dna strand, and from 3 ' to 5 ', exist in the following sequence: first end, target DNA sequence, and second end;

Described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, and from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm;

5. prepare the method for recombinant DNA molecules, comprising:

A) with double-stranded target DNA molecule and first, second double chain oligonucleotide transfered cell, described cell contains a carrier, and expression bacterial recombinase, described target DNA contains a target DNA sequence and two ends, on target dna strand, from 3 ' to 5 ', exist in the following sequence: first end, target DNA sequence, and second end; Described first oligonucleotide contains first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand;

Described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, and from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; And

6. prepare the method for recombinant DNA molecules, comprising:

A) double-stranded carrier and double-stranded target DNA are imported the cell of expressing bacterial recombinase, described carrier contains a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm;

First homology arm sequence on the carrier DNA chain and first terminal nucleotide sequence homology on the target dna strand like this, second homology arm nucleotide sequence on the carrier DNA chain and second end sequence homology on the target dna strand; And

7. prepare the method for recombinant DNA molecules, comprising:

A) with double-stranded carrier, double-stranded target DNA molecule, and first, second double chain oligonucleotide import the cell of expressing bacterial recombinase,

Described first oligonucleotide contains first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first end sequence homology of second nucleotide sequence and target dna strand;

8. the method for claim 6, wherein host cell further comprises the nucleotide sequence of a coding site-specific recombinase that links to each other with the promotor operability, carrier further comprises first and second recognition site of site-specific recombinase identification, first recognition site is positioned at the outside of first and second homology arm, and second site-specific recombinase recognition site is positioned at the inside of first and second homology arm; During step b) is carried out or after carrying out, induce the expression of site-specific recombinase.

9. the method for claim 7, wherein host cell further comprises the nucleotide sequence of a coding site-specific recombinase that links to each other with the promotor operability, carrier further comprises first and second recognition site of site-specific recombinase identification, first recognition site is positioned at the outside of first and second homology arm, and second site-specific recombinase recognition site is positioned at the inside of first and second homology arm; During step b) is carried out or after carrying out, induce the expression of site-specific recombinase.

10. the method for claim 6, wherein host cell further comprises the nucleotide sequence of a coding site specific nucleic acid restriction endonuclease that links to each other with the promotor operability, carrier further comprises the recognition site of locus specificity endonuclease, and this site is positioned at the inside of first and second homology arm; During step b) is carried out or after carrying out, induce the expression of locus specificity nucleosides restriction endonuclease.

11. the method for claim 7, wherein host cell further comprises the nucleotide sequence of a coding site specific nucleic acid restriction endonuclease that links to each other with the promotor operability, carrier further comprises the recognition site of locus specificity endonuclease, and this site is positioned at the inside of first and second homology arm; During step b) is carried out or after carrying out, induce the expression of locus specificity nucleosides restriction endonuclease.

12. each method of claim 2-11, wherein but carrier also further comprises a selective marker, is positioned at the outside of first and second homology arm, like this, on the carrier DNA chain, from 5 ' to 3 ', carrier can following two kinds of orders contain: i) first homology arm, but selective marker, replication orgin and second homology arm, or ii) first homology arm, replication orgin, but selective marker and second homology arm.

13. the method for claim 12, but wherein selective marker can pass to antibiotic resistance the cell that contains this carrier.

14. each method of claim 2-11, wherein bacterial recombinase is RecE/T or Red α/β recombinase, or RecE/T and two kinds of recombinases of Red α/β.

15. each method of claim 2-11, wherein cell is a bacterial cell.

16. each method of claim 2-11, wherein cell is a Bacillus coli cells.

17. each method of claim 2-11, wherein cell is the eukaryotic cell of recombinant expressed RecE/T and/or Red α/β recombinase.

18. each method of claim 2-11, this method also further comprises the separating recombinating DNA molecule, and described recombinant DNA molecules contains the target DNA that is inserted in the carrier.

19. be used for the double-stranded DNA carrier of directed cloning or subclone target dna molecular, described carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, and from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin and second homology arm; First end sequence homology of the nucleotide sequence of first homology arm on article one carrier DNA chain and article one target dna strand like this, second end sequence homology of the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand.

20. the carrier of claim 19, wherein replication orgin is the replication orgin of bacterium.

21. the carrier of claim 19, wherein replication orgin plays a role in intestinal bacteria.

22. the carrier of claim 19, wherein replication orgin plays a role in mammalian cell.

23. contain the cell of double-stranded DNA carrier, this carrier is used for directed cloning or subclone target dna molecular, comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin and second homology arm; First end sequence homology of the nucleotide sequence of first homology arm on article one carrier DNA chain and article one target dna strand like this, second end sequence homology of the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand.

24. the cell of claim 23, described cell is a bacterial cell.

25. be used for the test kit of directed cloning or subclone target DNA molecule, comprise one or more containers:

A) be used for the double-stranded DNA carrier of directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; Like this, article one, the nucleotide sequence of first homology arm on the carrier DNA chain and first end sequence homology on article one target dna strand, second terminal nucleotide sequence homology on the nucleotide sequence of second homology arm on article one carrier DNA chain and article one target dna strand; And

B) contain the cell of bacterial recombinase.

26. the test kit of claim 25, wherein the sequence of homology arm with based on BAC, PAC, λ, the cloning vector homology of plasmid or YAC.

27. the test kit of claim 25, wherein the nucleotide sequence that has of first and second double chain oligonucleotide with based on BAC, PAC, λ, the cloning vector homology of plasmid or YAC.

28. be used for the test kit of directed cloning or subclone target DNA molecule, comprise one or more containers:

A) be used for the double-stranded DNA carrier of directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm; With

B) first double chain oligonucleotide, contain first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first sequence and second sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand;

C) second double chain oligonucleotide, contain second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th nucleotide sequence and target dna strand; And

D) contain the cell of bacterial recombinase.

29. the test kit of claim 25 or 28, wherein cell is a Bacillus coli cells.

30. the test kit of claim 25 or 28, wherein cell is the freeze-stored cell with picked-up DNA ability.

31. be used for the test kit of directed cloning or subclone target DNA molecule, comprise one or more containers:

A) be used for the double-stranded DNA carrier of directed cloning or subclone target dna molecular, this carrier comprises a replication orgin and two homology arms, on the carrier DNA chain, from 5 ' to 3 ', exist in the following sequence: first homology arm, replication orgin, and second homology arm;

B) first double chain oligonucleotide, contain first oligonucleotide DNA chain, this chain in the following sequence, from 3 ' to 5 ' contains: first nucleotide sequence and second nucleotide sequence, the nucleotide sequence homology of first homology arm on described first nucleotide sequence and the carrier DNA chain, first terminal nucleotide sequence homology of second nucleotide sequence and target dna strand; And

C) second double chain oligonucleotide, contain second oligonucleotide chain, this chain in the following sequence, from 3 ' to 5 ' contains: the 3rd nucleotide sequence and the 4th nucleotide sequence, the nucleotide sequence homology of second homology arm on described the 3rd nucleotide sequence and the carrier DNA chain, second terminal nucleotide sequence homology of the 4th sequence and target dna strand.

32. the test kit of claim 25,28 or 31, wherein dna vector is purified processing.

33. the test kit of claim 28 or 31, wherein dna vector, first double chain oligonucleotide and second double chain oligonucleotide all are purified processing.

34. the test kit of claim 25,28 or 31, wherein the target DNA molecule comprises bacterium, virus, parasite or protozoon DNA.

35. the test kit of claim 25,28 or 31, wherein the target DNA molecule comprises transgenation or polymorphism known or suspection and certain dysfunction or disease-related.

36. each test kit of claim 25-29, wherein bacterial recombinase is RecE/T or Red α/β recombinase, or RecE/T and two kinds of recombinases of Red α/β.

37. each method of claim 2-11, wherein target DNA when producer suddenlys change, known or suspect and certain dysfunction or disease-related.

38. each method of claim 2-11, wherein target DNA is bacterium, virus, parasite or protozoon DNA.

39. claim 2,4,6,8 or 10 method, this method also further comprise the detection recombinant DNA molecules, and described recombinant DNA molecules comprises the target DNA that is inserted in the carrier.

40. claim 3,5,7,9 or 11 method, this method also further comprise the detection recombinant DNA molecules, and described recombinant DNA molecules comprises the target DNA that is inserted in the carrier.

41. survey the method that infected material exists, comprise the method for implementing claim 39, the target DNA patient that suffers from infectious diseases from suspection wherein, and, the sequence homology that exists among second and the 4th nucleotide sequence and the infected material DNA.

42. survey the method that infected material exists, comprise the method for implementing claim 40, the target DNA patient that suffers from infectious diseases from suspection wherein, and, first with second homology arm sequence and infected material DNA in the sequence homology that exists.

43. the method for claim 41 or 42, wherein infected material is virus, bacterium, protozoon, fungi or parasite.

44. survey the heredity patient's condition, disease, the method that dysfunction or polymorphism feature exist, comprise the method for implementing claim 39, wherein, target DNA is derived from suspects to suffer from the heredity patient's condition, disease, the patient of dysfunction or polymorphism feature, and, the sequence of first homology arm and known or the suspection and the described heredity patient's condition, disease, the site upstream sequence homology that dysfunction or polymorphism feature are relevant, the sequence of second homology arm and known or the suspection and the described heredity patient's condition, disease, the site downstream sequence homology that dysfunction or polymorphism feature are relevant.

45. survey the heredity patient's condition, heredopathia, the method that heredity dysfunction or polymorphism feature exist, comprise the method for implementing claim 40, wherein, target DNA is derived from suspects to suffer from the heredity patient's condition, heredopathia, the patient of heredity dysfunction or polymorphism feature, and, first double chain oligonucleotide sequence and known or the suspection and the described heredity patient's condition, heredopathia, the site upstream sequence homology that heredity dysfunction or polymorphism feature are relevant, second double chain oligonucleotide sequence and known or the suspection and the described heredity patient's condition, heredopathia, the site downstream sequence homology that heredity dysfunction or polymorphism feature are relevant.

46. the method for claim 44 or 45, wherein the heredity patient's condition, heredopathia, heredity dysfunction or polymorphism feature make the patient have the tumour of suffering from, asthma, sacroiliitis, resistance, drug toxicity, or the proneness of neural system, neural spirit, metabolism, muscle, cardiovascular or skin conditions, disease or dysfunction.

47. the carrier of claim 19, wherein but carrier also further comprises a selective marker that is positioned at first and second homology arm outside, like this, on the carrier DNA chain, from 5 ' to 3 ', carrier can following two kinds of orders contain: i) first homology arm, but selective marker, replication orgin and second homology arm, or ii) first homology arm, replication orgin, but selective marker and second homology arm.

48. the carrier of claim 47, but wherein the carrier sequence 5 ' end of replication orgin and selective marker or 3 ' end all do not comprise one or more direct repeat sequences, described direct repeat sequence comprise at least 〉=5 nucleotide bases are right.