CN101489382A

CN101489382A - Polynucleotide therapy

Info

Publication number: CN101489382A
Application number: CNA2007800271425A
Authority: CN
Inventors: 海德基·葛元; 迈克尔·勒维滕; 内尼特·苏瓦山
Original assignee: Bayhill Therapeutics Inc
Current assignee: Bayhill Therapeutics Inc
Priority date: 2006-06-13
Filing date: 2007-06-13
Publication date: 2009-07-22
Also published as: EP2034833A2; WO2007147011A3; WO2007147011A2; CA2655357A1; AU2007260779A1; JP2009540017A; WO2007147011A8; IL195773A0; US20100048679A1

Abstract

This invention provides methods of treating an autoimmune disease in a subject associated with one or more self-protein(s), polypeptide(s), or peptide(s) present in the subject non-physiologically comprising administering to the subject: a self-vector comprising an immunosuppressive vector backbone and a polynucleotide encoding the self-protein(s), polypeptide(s) or peptide(s) associated with the autoimmune disease; and a divalent cation at a concentration greater than physiological levels. Administration of the self-vector comprising a polynucleotide encoding the self-protein(s), polypeptide(s) or peptide(s) modulates an immune response to the self-protein(s), polypeptide(s) or peptide(s) expressed from administration of the self-vector. This invention further provides a method of treating multiple sclerosis by administering a self-vector comprising a BHT-1 vector backbone, for example, self-vector BHT-3009 encoding human myelin basic protein (MBP). The invention also provides a pharmaceutical composition comprising: a BHT-1 vector backbone and a polynucleotide encoding one or more self-protein(s), polypeptide(s), or peptide(s) associated with an autoimmune disease; and a divalent cation at concentrations greater than physiological levels. This invention further provides a pharmaceutical composition comprising a self-vector comprising a BHT-1 vector backbone, for example, self-vector BHT-3009 encoding human myelin basic protein (MBP), and methods of administering a BHT-1 self-vector, for example BHT-3009, to a subject.

Description

Polynucleotide therapy

The cross reference of related application

The application requires to enjoy the rights and interests of No. the 60/813rd, 552, U.S. Provisional Patent Application, for whole its complete contents of purpose are hereby incorporated by.

The statement of the right of the invention of in research that federal government subsidizes or exploitation, finishing

Inapplicable

Background of invention

Invention field

The present invention relates to treat the method and composition of individual disease, described disease be present in this individuality and to participate in one or more oneself proteins, self polypeptide or the self peptide of non-physiological state relevant.The invention still further relates to the method and composition of the individual disease of prevention, described disease be present in this individuality and one or more oneself proteins of participation non-physiological state, self polypeptide or self peptide relevant.The invention still further relates to that evaluation exists with non-physiological state and with the oneself protein of disease association, self polypeptide or self peptide.The invention still further relates to giving of polynucleotides, described polynucleotide encoding exist with non-physiological state and with the oneself protein of disease association, self polypeptide or self peptide.The invention still further relates to the immune response of metering needle to oneself protein, self polypeptide or self peptide, described oneself protein, self polypeptide or self peptide are present in the animal body, participate in non-physiological state and and disease association.More particularly, the present invention relates to treat or prevent the method and composition of autoimmune disease, described autoimmune disease and one or more oneself proteins that are present in non-physiological state in the animal, self polypeptide or self peptide are relevant, described non-physiological state is such as multiple sclerosis, rheumatic arthritis, insulin-dependent diabetes mellitus, the autoimmunity uveitis, primary biliary cirrhosis of liver, myasthenia gravis, Si Yegelun (family name) syndrome (Sjogren ' s syndrome), pemphigus vulgaris, chorionitis, pernicious anaemia, systemic loupus erythematosus (SLE) and Graves disease (Grave ' s disease).

Autoimmune disease and immune response are regulated

Autoimmune disease refers to the disease that the acquired immunity by misrouting body health cell and/or tissue causes.Autoimmune disease influences the industrialization world population (Jacobson et al., Clin Immunol Immunopathol 84,223-43, (1997)) of 3% U.S. population and the similar ratio of possibility.Being characterized as of autoimmune disease: the T and the bone-marrow-derived lymphocyte of target oneself protein, self polypeptide, self peptide and/or other self molecule (for example cause intracorporeal organ, tissue or cell type singularly, pancreas, brain, thyroid gland or intestines and stomach) damage and/or dysfunction, thereby cause clinical manifestation (the Marrack et al. of this disease, Nat Med 7,899-905, (2001)).Autoimmune disease comprises the disease that influences specific tissue and can influence the disease of many tissues.For some disease, this may depend in part on autoimmune reaction is to point to the antigen that is confined to particular organization or point to the antigen that is distributed widely in body.The autoimmune characteristic feature of tissue specificity is single tissue of selectivity target or single cell type.Yet some autoimmune disease of the ubiquitous oneself protein of target also can influence specific tissue.For example, in polymyositis, the protein groups aminoacyl-tRNA synthetase that the autoimmune reaction target extensively exists, however the clinical manifestation that relates generally to is the autoimmune destruction of muscle.

Immune system adopts the mechanism of high complexity to be used to produce reaction and resists multiple foreign pathogens with the protection mammal and stop reaction to autoantigen simultaneously.Whether react (antigentic specificity) except decision, immune system also must select suitable effector function to handle every kind of pathogene (effect specificity).Mediation and the key cells of regulating and control these effector functions are CD4 ⁺The T cell.In addition, to from CD4 ⁺The retrofit of the specific cell factor of T cell shows as the main mechanism of cell-mediated its function of T.Therefore, characterize CD4 ⁺Cell factor type that the T cell produces and their secretion are that what how to control is how to be conditioned very important to understanding immune response.

Delivered first before more than ten years long-term mouse CD4 ⁺The T cell clone produces the sign (Mosmann et al., J.Immunol.136:2348-2357, (1986)) of cell factor.In these researchs, shown CD4 ⁺The T cell causes two kinds of different modes, called after t helper cell 1 (Th1) and the t helper cell 2 (Th2) that cell factor produces.Found that the Th1 cell produces proleulzin (IL-2), interferon-(IFN-γ) and lymphotoxin (LT) specially, and special IL-4, IL-5, IL-6 and IL-13 (the Cherwinski et al. of producing of Th2 clone, J.Exp.Med.169:1229-1244, (1987)).After a while, from the Th2 clone and separate to other cell factor: IL-9 with IL-10 (Van Snick et al., J.Exp.Med.169:363-368, (1989); Fiorentino et al., J.Exp.Med.170:2081-2095,1989).At last, find the other cell factor of Th1 and Th2 cell both secretions such as IL-3, granulocyte macrophage colony stimulating factor (GM-CSF) and tumor necrosis factor-alpha (TNF-α).

Autoimmune disease comprises the spectrum of diseases that can influence many Different Organs and tissue in the body that following table 1 lists.Referring to, for example, Paul W.E. (ed.2003) Fundamental Immunology (basic immunology) (5th Ed.) Lippincott Williams ﹠amp; Wilkins; ISBN-10:0781735149, ISBN-13:978-0781735148; Rose and Mackay (eds.2006) The AutoimmuneDiseases (autoimmune disease) (4th ed.) Academic Press, ISBN-10:0125959613, ISBN-13:978-0125959612; Erkan, et al. (eds.2004) The Neurologic Involvementin Systemic Autoimmune Diseases (nerve of systemic autoimmune disease is got involved), Volume3 (Handbook of Systemic Autoimmune Diseases (systemic autoimmune disease handbook)) Elsevier Science, ISBN-10:0444516514, ISBN-13:978-0444516510; And Richter, et al. (eds.2003) Treatment of Autoimmune Disorders (immunity treatment of conditions), Springer, ISBN-10:3211837728, ISBN-13:978-3211837726.

The major organs of table 1-target	Disease
The major organs of table 1-target	Disease	Thyroid gland	Chronic lymphocytic thyroiditis (Hashimoto ' s Disease)
Thyroid gland	The primary myxedema	Thyroid gland	Chronic lymphocytic thyroiditis (Hashimoto ' s Disease)
Thyroid gland	The primary myxedema	Thyroid gland	Hyperthyroidism
Stomach	Pernicious anaemia	Thyroid gland	Hyperthyroidism
Stomach	Pernicious anaemia	Stomach	Atrophic gastritis
Suprarenal gland	Addision's disease (Addison ' s disease)	Stomach	Atrophic gastritis
Suprarenal gland	Addision's disease (Addison ' s disease)	Pancreas islet	The diabetes that insulin relies on
Kidney	Goodpasture (Goodpasture ' s syndrome)	Pancreas islet	The diabetes that insulin relies on
Kidney	Goodpasture (Goodpasture ' s syndrome)	Neuromuscular junction	Myasthenia gravis
Interstitial cell	Male sterility	Neuromuscular junction	Myasthenia gravis
Interstitial cell	Male sterility	Skin	Pemphigus vulgaris
Skin	Pemphigoid	Skin	Pemphigus vulgaris
Skin	Pemphigoid	Eye	Sympathetic ophthalmia
Eye	Crystal originality uveitis (Phacogenic uveitis)	Eye	Sympathetic ophthalmia
Eye	Crystal originality uveitis (Phacogenic uveitis)	Brain	Multiple sclerosis

Erythrocyte	Hemolytic anemia
Erythrocyte	Hemolytic anemia	Blood platelet	Congenital thrombocytopenic purpura
Leucocyte	Congenital leukopenia	Blood platelet	Congenital thrombocytopenic purpura
Leucocyte	Congenital leukopenia	Biliary system	Primary biliary cirrhosis of liver
Intestines	Ulcerative colitis	Biliary system	Primary biliary cirrhosis of liver
Intestines	Ulcerative colitis	Artery	Arteriosclerosis
Salivary gland and lachrymal gland	Si Yegelun (family name) syndrome	Artery	Arteriosclerosis
Salivary gland and lachrymal gland	Si Yegelun (family name) syndrome	Synovial joint	Rheumatic arthritis
Muscle	Polymyositis	Synovial joint	Rheumatic arthritis
Muscle	Polymyositis	Muscle and skin	Dermatomyositis
Skin	Chorionitis	Muscle and skin	Dermatomyositis
Skin	Chorionitis	Skin, joint, muscle, haemocyte	MCTD
Coagulation factors	Anti-phosphatide disease	Skin, joint, muscle, haemocyte	MCTD
Coagulation factors	Anti-phosphatide disease	Skin	Lupus erythematosus discoides
Skin, joint, kidney, brain, haemocyte	Systemic loupus erythematosus (SLE)	Skin	Lupus erythematosus discoides

The biology therapy that comprises glucocorticoid, cytotoxic agent and nearest exploitation when the treatment of forefathers' autoimmune disease.Usually, treatment people systemic autoimmune disease rule of thumb and can not be satisfactory.The main wide spectrum immunosuppressive drug that adopts such as corticosteroid in multiple serious autoimmune illness and inflammatory conditions.Except that the cortex steroids, in the treatment systemic autoimmune disease, use other immunodepressant.Cyclophosphamide is the alkylating agent that causes that T and two kinds of lymphocytes of B exhaust fully and cell-mediated immunity damages.Cyclosporin, tacrolimus and to examine the fen ester for wheat be to have the natural products that suppresses the lymphocytic specific physique of T, and be used for the treatment of SLE, RA and in the qualification degree, be used for the treatment of vasculitis and myositis.These medicines are with tangible Toxicity of Kidney.Methotrexate (MTX) also is used for RA as " two wires " reagent, and purpose is for slowing down progression of disease.It also is used for polymyositis and other connective tissue diseases.The additive method of having attempted comprises and is intended to block the cell factor effect or removes lymphocytic monoclone antibody.(Fox，D.A.，Am.J.Med；99：82-88(1995))。The treatment of multiple sclerosis (MS) comprises interferon beta and copolymer 1, and they reduce recurrence rate 20-30% and the only appropriate progression of disease that influences.The immunodepressant that comprises the strong dragon of first, other steroids, methotrexate (MTX), Cladribine and cyclophosphamide is also used in the treatment of MS.These immunodepressant have minimum effectiveness in treatment MS.The current therapy of rheumatic arthritis (RA) adopts such as the non-specific inhibition of methotrexate (MTX), Sulfasalazine, hydroxychloroquine, Lu Fulong amine (leuflonamide), prednisone or regulates the immunologic function medicament, and the TNF alpha-2 antagonists Etanercept and Yin Fulimei (the Moreland et al of exploitation recently, J Rheumatol 28,1431-52, (2001)).Etanercept and Yin Fulimei block TNF α comprehensively, make patient Geng Yi die from the deterioration of septicemia, chronic mycobacterial infections and take off the generation of myelin incident.

Under organ-specific autoimmune's situation, a large amount of different methods of treatments had been attempted.General gives soluble protein antigen to suppress subsequently the immune response to this antigen.These therapies comprise to the animal that suffers from experimental autoimmune encephalomyelitis and the people that suffers from multiple sclerosis carry myelin basic protein, its dominance peptide or myelin protein mixture (Brocke et al., Nature 379,343-6, (1996); Critchfield et al., Science 263,1139-43., (1994); Weiner et al., Annu Rev Immunol 12,809-37, (1994)), to suffering from mixture (the Gumanovskaya et al. that collagen arthritic animal of inducing and the people who suffers from rheumatic arthritis give II collagen type or collagen, Immunology 97,466-73., (1999); McKown et al., Arthritis Rheum 42,1204-8., (1999); Trentham et al., Science 261,1727-30., (1993)), the humans and animals of suffering from the autoimmune diabetes is carried insulin (Pozzilli andGisella Cavallo, Diabetes Metab Res Rev 16,306-7, (2000)), and to suffering from the uveitic humans and animals conveying of autoimmune S-antigen (Nussenblatt et al., Am JOphthalmol 123,583-92., (1997)).The problem relevant with this method is the T cell anergy that the general injections of antigens is induced.Based on TXi Baoshouti be attached to special interaction between the peptide on the MHC molecule, another kind of method attempts being designed for the rational therapy strategy that general gives peptide antigen.The exploitation (Hurtenbach, U.etal., JExp.Med 177:1499, (1993)) that a research of use peptide method has caused this peptide antibody to produce in diabetes animal model.Another kind method is to give the immunity of TXi Baoshouti (TCR) peptide.Referring to, for example, Vandenbark, A.A.et al., Nature 341:541, (1989).Other has a kind of method also to induce oral tolerance by taking in peptide or proteantigen.Referring to, for example, Weiner, H.L, Immmunol Today, 18:335 (1997).

Currently carry albumen, polypeptide or peptide to change immune response by uniting separately or with adjuvant (immunostimulant).For example, Hepatitis B virus vaccine comprises the recombinant hepatitis b surface antigen (non-autoantigen) as the aluminium hydroxide preparation of adjuvant.This vaccine-induced immune response at hepatitis b virus s antigen is with anti-infective.Selectable method relates to carries virus or bacterium (the non-autoantigen of respectively doing for oneself) attenuation, pathogene form replication defective and/or non-to induce the host's protective immunological reaction at this pathogene.For example, OPV is made up of the attenuated virus (non-autoantigen) of living, its infection cell and duplicating in vaccinated individuality, thus effective immunity induced at polyovirus (external source or non-autoantigen), and can not cause clinical disease.Selectively, this inactivation polio vaccine comprises the inactivation that can not infect or duplicate or " killed " virus, subcutaneous this vaccine that gives is to induce the protective immunity at polyovirus.

The treatment of dna vaccination inoculation/polynucleotides

Polynucleotides treatment or dna vaccination inoculation are to induce at foreign pathogens (Davis, 1997; Hassett and Whitton, 1996; And Ulmer et al., 1996) and the immunity of cancer antigen (Stevenson etal., 2004) and the effective ways of regulating autoimmune process (Waisman et al., 1996).After the intramuscular injection, plasmid DNA is absorbed by for example myocyte, allows expression encoded polypeptides (Wolff et al., 1992) and the generation lasting immunity reaction (Hassett et al., 2000) to expressed albumen.Under the situation of autoimmune disease, effect is that the ongoing immune response of conversion destroys to suppress autoimmune, and thinks that this effect comprises that be that the Th2 type reacts with the autoreactivity lymphocyte from the response transform of Th1 type.This immunoreactive adjusting can not be a general, but only the part occurs in the target organ of autoimmunity attack.

Being different from of the polynucleotides of coding oneself protein, self polypeptide or self peptide traditional " gene therapy ", these polynucleotides are with precipitation promoter and/or the preparation of transfection promoter or use the viral vectors preparation.Gene therapy is a delivery of polynucleotide so that the expression of albumen or peptide to be provided, thereby replaces defective or disappearance albumen or peptide in the host, and/or strengthens the physiological function of expectation.Gene therapy comprises for therapeutic purposes makes DNA be incorporated into the method for genes of individuals group.The example of gene therapy comprise carry DNA, described dna encoding to be used for haemophiliachemophiliac coagulation factors, be used for the adenosine deaminase of severe combined immunodeficiency, be used for familial hypercholesterolemia low density lipoprotein receptor, be used for Gaucher'disease (Gaucher ' s disease) glucocerebrosidase, be used for α ₁The α of-antitrypsin defective ₁-antitrypsin, the alpha-globulin gene that is used for hemoglobinopathy or betaglobulin gene and the chloride channel (Verma and Somia, Nature 389,239-42, (1997)) that is used for cystic fibrosis.

The researcher has described the DNA therapy of coding immune molecule with the treatment autoimmune disease.These DNA therapies comprise that the DNA of encode T cell receptor antigen calmodulin binding domain CaM changes the level (Waisman et al., Nat Med 2:899-905, (1996)) (United States Patent (USP) the 5th, 939, No. 400) of the ART that drives autoimmune reaction.The DNA of coding self-antigen is attached on the particle, and (International Patent Application Publication No. WO 97/46253 with arthritis that prevention multiple sclerosis and collagen are induced to be delivered to skin with particle gun; Ramshaw et al.Immunol.and Cell Bio.75:409-413, (1997)).Coding adhesion molecule, cell factor are (for example, TNF α), chemotactic factor (CF) (for example, the C-C chemotactic factor (CF)) and other immune molecules (for example, the Fas-part) DNA has been used for animal model (Youssef et al., J Clin Invest 106:361-371, (2000)) (the Wildbaum et al. of autoimmune disease, J Clin Invest 106:671-679, (2000)) (Wildbaum et al, J Immunol 165:5860-5866, (2000); Wildbaum et al., J Immunol161:6368-7634, (1998); Youssef et al., J Autoimmun 13:21-9, (1999)).International Publication No. WO 00/53019, WO 2003/045316 and WO 2004/047734 have described the method by the exonuclease treatment autoimmune disease of one or more self-antigen of encoding.Although these methods are succeedd, still need further improvement.

An object of the present invention is to provide the method for the relevant disease of treatment or prevention and oneself protein, self polypeptide or self peptide, there are and participate in the non-physiology course of animal in described oneself protein, self polypeptide or self peptide.Another object of the present invention provides treatment or the common ad hoc approach that does not damage immune autoimmune disease of prevention.Another purpose of the present invention provides the ad hoc approach of treatment or prevention neurodegenerative disease.Another purpose of the present invention provides the composition that treatment or prevention and non-physiology are present in the relevant disease of oneself protein in the animal, self polypeptide or self peptide.A further object of the present invention be identify that non-physiology exists and with the oneself protein of disease association, self polypeptide or self peptide.With specification as one on the whole, these and other purpose of the present invention will become clear.

The invention summary

The invention provides the new method of disease relevant in treatment or the prevention animal with one or more oneself proteins, self polypeptide or self peptide, described oneself protein, self polypeptide or the non-physiology of self peptide are present in the animal body, and described method comprises self carrier of polynucleotides that comprises oneself protein, self polypeptide or the self peptide of coding and described disease association to animal.Comprise the immune response that gives the oneself protein of metering needle to described self vector expression, self polypeptide or self peptide of self carrier of the polynucleotides of coding oneself protein, self polypeptide or self peptide.The composition that comprises the polynucleotides of one or more oneself proteins of coding, self polypeptide or self peptide (their non-physiology is present in the animal of being treated) can be used for treating with animal body in the relevant disease of target of the described oneself protein, self polypeptide or self peptide and/or the non-physiology course that exist.The present invention finds, the polynucleotides of coding oneself protein, self polypeptide or self peptide (their non-physiology ground exist or by non-physiology course as target) give the immune response of metering needle to described oneself protein, self polypeptide or self peptide, with treat with animal in the oneself protein that relates to of non-physiology, self polypeptide or relevant disease of self peptide.

In one aspect, the invention provides the method for the individual autoimmune disease of treatment, it is relevant that described disease and non-physiology are present in intraindividual one or more oneself proteins, self polypeptide or self peptide, described method comprises to individuality and giving: self carrier, and it comprises the polynucleotides of inhibitive ability of immunity carrier framework and the coding oneself protein relevant with described autoimmune disease, self polypeptide or self peptide; With total concentration one or more bivalent cations greater than physiological level.In some embodiments, described self carrier framework is the BHT-1 carrier framework.In some embodiments, described self carrier framework is non-immunostimulating (for example, " immunological neutrality ").

In some embodiments, one or more bivalent cations are selected from Ca ²⁺, Mg ²⁺, Mn ²⁺, Zn ²⁺, Al ²⁺, Cu ²⁺, Ni ²⁺, Ba ²⁺, Sr ²⁺And its mixture.In some embodiments, described bivalent cation is independent calcium.In some embodiments, described bivalent cation is Ca ²⁺And Mg ²⁺Mixture.

In some embodiments, autoimmune disease is a multiple sclerosis; In other embodiments, autoimmune disease is a rheumatic arthritis; And again in other embodiments, autoimmune disease is a lupus.In some embodiments, self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's myelin basic protein (MBP); In other embodiments, self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's proteolipin albumen (PLP); In other embodiments, self carrier comprises the polynucleotides of the glycoprotein (MAG) of BHT-1 carrier framework and the combination of coding people myelin; Again in other embodiments, self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's myelin oligodendrocyte albumen (MOG).In preferred embodiment, described self carrier is BHT-3009, and does not contain endotoxin.In some embodiments, described bivalent cation is a calcium.In some embodiments, the concentration of calcium is greater than about 2mM; In preferred embodiment, the concentration of calcium approximately is 5.4mM.

In yet another aspect, the invention provides the method for the individual multiple sclerosis of treatment, comprise the pharmaceutical composition that comprises BHT-3009 (SEQ ID NO:3) to individuality.In some embodiments, described pharmaceutical composition be do not contain endotoxic.In some embodiments, described pharmaceutical composition also comprises the bivalent cation of concentration greater than physiological level.In some embodiments, described bivalent cation is a calcium.In some embodiments, the concentration of calcium is greater than about 2mM; In preferred embodiment, the concentration of calcium approximately is 5.4mM.

In yet another aspect, the invention provides pharmaceutical composition, it comprises: comprise self carrier of inhibitive ability of immunity carrier framework and polynucleotides, one or more oneself proteins that described polynucleotide encoding is relevant with autoimmune disease, self polypeptide or self peptide; With the bivalent cation of concentration greater than physiological level.In some embodiments, described self carrier framework is the BHT-1 carrier framework.In some embodiments, described self carrier framework is non-immunostimulating (for example, " immunological neutrality ").

In some embodiments, autoimmune disease is a multiple sclerosis; In other embodiments, autoimmune disease is a rheumatic arthritis; And again in other embodiments, autoimmune disease is a lupus.In some embodiments, self carrier of described pharmaceutical composition comprises the polynucleotides of BHT-1 carrier framework and coding people's myelin basic protein (MBP); In other embodiments, self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's proteolipin albumen (PLP); In other embodiments, self carrier comprises the polynucleotides of the glycoprotein (MAG) of BHT-1 carrier framework and the combination of coding people myelin; And again in other embodiments, self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's myelin oligodendrocyte albumen (MOG).In preferred embodiment, self carrier of described pharmaceutical composition is BHT-3009, and does not contain endotoxin.In some embodiments, described bivalent cation is a calcium.In some embodiments, the concentration of calcium is greater than about 2mM; In preferred embodiment, the concentration of calcium approximately is 5.4mM.

In yet another aspect, the invention provides the pharmaceutical composition that comprises BHT-3009.Composition of the present invention does not contain endotoxin usually, and can comprise the calcium of concentration greater than about 2mM.

The accompanying drawing summary

The carrier structure figure of Fig. 1: BHT-3009: the part with mark shows self carrier B HT-3009.The expression of CMV promoters driven people myelin basic protein (MBP).Bovine growth hormone stops and poly A sequence (bGH pA) is inserted into 3 of hMBP '.Realize carrier propagation and screening by pUC replication origin and kalamycin resistance gene (Kanr) respectively.BHT-3009 is 3485 base-pairs, and the position of each component is described at the left of carrier figure.

Fig. 2: I phase experimental scheme: 30 MS patients are assigned to one of 3 BHT-3009 dosage groups.For each dosage group, the patient is randomized to either one of following treatment group: A group: BHT-placebo+Atorvastatin-placebo (4 patients); B group: BHT-3009+ Atorvastatin-placebo (3 patients); C group: BHT-3009+ Atorvastatin (3 patients).The patient who assigns to A group at random assigned at random again accept one of following open (open label) treatment: D group: independent BHT-3009 (2 patients) or E group: BHT-3009+ Atorvastatin (2 patients), it is received treatment, and assigned to the patient that B organizes or C organizes to start with at random and estimate.

Fig. 3 shows that the albumen of the improvement when utilizing the calcium transfection BHT-1 carrier framework that is higher than physiological concentration produces.Under the condition that does not contain magnesium, with BHT-3021 (0.25mg/ml) DNA, BHT-1 carrier framework with sequence of the former oneself protein of encoding insulin has scope preparation in the Du Shi PBS (Dulbecco ' s PBS) of the calcium of the concentration increase of 0.9mM to 9.0mM.With the DNA freeze overnight of preparation to promote the formation of DNA/ calcium phosphate granules.The solution that thaws then is to about 3 * 10 of the 24 hole tissue culturing plates that comprise 0.4ml DMEM medium ⁵Add 5 micrograms of DNA in the HEK293 cell.Cultivate after 24 hours, handle cell to prevent the degraded of the cytoplasm proinsulin albumen that plasmid produces with proteasome inhibitor, and then cultivated 24 hours, collection, cell lysis, and utilize commercial proinsulin ELISA kit to measure proinsulin albumen.Observing maximum albumen in the DNA with the preparation of 5.4mM calcium produces.

Detailed Description Of The Invention

In order more fully to understand the present invention described herein, provide following explanation.

The invention provides the method for disease relevant with one or more oneself proteins, self polypeptide or self peptide in treatment or the prevention animal body, described oneself protein, self polypeptide or the non-physiology of self peptide are present in the animal body or participate in non-physiological state, and described method comprises self carrier of polynucleotides that comprises oneself protein, self polypeptide or the self peptide of coding and described disease association to animal. Comprise the immune response that gives the oneself protein of metering needle to described self vector expression, self polypeptide or self peptide of self carrier of the polynucleotides of coding oneself protein, self polypeptide or self peptide.

Described self carrier gives altogether with one or more bivalent cations that are higher than physiological concentration or altogether preparation. Be surprisingly, be equal to or less than comparing altogether of dna vaccination inoculation carrier under one or more bivalent cation existence conditions of physiological level with total concentration, dna vaccination inoculation carrier and total concentration be higher than physiological level one or more bivalent cations improve altogether transfection efficiency, the expression of the self-antigen that is encoded (that is, transcribe and translate) and in the immunoreactive therapeutic inhibition of not expecting one or more.

Treatment of the present invention or prevention method can be used for animal in non-physiology have and/or participate in the relevant any disease of oneself protein, self polypeptide or the self peptide of non-physiology course.

Autoimmune disease

In following table, list several examples of the autoimmune disease relevant with the oneself protein that exists of non-physiology, self polypeptide or self peptide in the animal, and hereinafter description.

Table 2

Multiple sclerosis.The invention provides the composition and the method that can be used for treating multiple sclerosis (MS), MS is modal CNS demyelinate illness, influence 350,000 Americans and 100 all ages circle population.Referring to, for example, Cohen and Rudick (eds.2007) Multiple Sclerosis Therapeutics (multiple sclerosis treatment) (3d ed) Informa Healthcare, ISBN-10:1841845256, ISBN-13:978-1841845258; Matthews and Margaret Rice-Oxley (2006) Multiple Sclerosis:The Facts (multiple sclerosis: the fact) (Oxford Medical Publications 4th Ed.) OxfordUniversity Press, USA, ISBN-10:0198508980, ISBN-13:978-0198508984; Cook (ed.2006) Handbook of Multiple Sclerosis (Neurological Disease andTherapy, 4th Ed.) (multiple sclerosis handbook (sacred disease and treatment, the 4th edition)) InformaHealthcare, ISBN-10:1574448277, ISBN-13:978-1574448276; Compston, et al. (2005) McAlpine ' s Multiple Sclerosis (McAlpine multiple sclerosis) (4th edition) Churchill Livingstone, ISBN-10:044307271X, ISBN-13:978-0443072710; Burks and Johnson (eds 2000) Multiple Sclerosis:Diagnosis, MedicalManagement, and Rehabilitation (multiple sclerosis: diagnosis, medical treatment and nursing and rehabilitation) DemosMedical Publishing ISBN-10:1888799358, ISBN-13:978-1888799354; Waxman (2005) Multiple Sclerosis As A Neuronal Disease (as the multiple sclerosis of neuronal disease) Academic Press ISBN-10:0127387617, ISBN-13:978-0127387611; Filippi, et al. (eds.) Magnetic Resonance Spectroscopy in Multiple Sclerosis (Topics inNeuroscience) (Magnetic Resonance Spectrum of multiple sclerosis (Neuscience theme)) Springer, ISBN-10:8847001234, ISBN-13:978-8847001237; Herndon (ed.2003) Multiple Sclerosis:Immunology, Pathology and Pathophysiology (multiple sclerosis: immunology, pathology and Pathological Physiology) Demos Medical Publishing, ISBN-10:1888799625, ISBN-13:978-1888799620; Costello, et al. (2007) ＂ Combination therapies for multiplesclerosis:scientific rationale, clinical trials, the and clinical practice ＂ (therapeutic alliance of multiple sclerosis: scientific theory, clinical testing and clinical practice) Curr.Opin.Neurol.20 (3): 281-285, PMID:17495621; Burton and O ' connor (2007) ＂ Novel Oral Agents for MultipleSclerosis ＂ (the new oral agent of multiple sclerosis) Curr.Neurol.Neurosci.Rep.7 (3): 223-230, PMID:17488588; Correale and Villa (2007) ＂ Theblood-brain-barrier in multiple sclerosis:functional roles and therapeutictargeting ＂ (blood-brain barrier of multiple sclerosis: function and treatment target) Autoimmunity40 (2): 148-60, PMID:17453713; De Stefano, et al. (2007) ＂ Measuring brainatrophy in multiple sclerosis ＂ (measuring the encephalatrophy in the multiple sclerosis) J.Neuroimaging17 Suppl 1:10S-15S, PMID:17425728; Neema, et al. (2007) ＂ T1-and T2-basedMRI measures of diffuse gray matter and white matter damage in patients withmultiple sclerosis ＂ (MRI based on T1 and T2 of disperse grey matter and white matter damage detects in the patients with multiple sclerosis) J.Neuroimaging 17 Suppl 1:16S-21S, PMID:17425729; DeStefano and Filippi (2007) ＂ MR spectroscopy in multiple sclerosis ＂ (the MR wave spectrum of multiple sclerosis) J.Neuroimaging 17 Suppl 1:31S-35S, PMID:17425732; With Comabella and Martin (2007) ＂ Genomics in multiple sclerosis-Current state andfuture directions ＂ (genomics-present situation of multiple sclerosis and following direction) J.Neuroimmunol.Epub ahead of print] PMID:17400297.

Paresthesia epilepsy usually occurs in 20 years old to 40 years old, and shows as (by the order of frequency reduction) acute or subacute outbreak of one-sided impaired vision, myasthenia, cacesthesia, ataxia, vertigo, aconuresis, dysarthrosis or phrenoblabia.These symptoms cause by taking off myelinic focus infringement, and it had both caused the negative conduction abnormalities that slows down owing to the aixs cylinder transduction, also caused the positive conduction abnormalities (for example, Lai Ermite (Lhermitte) symptom) that produces owing to ectopic impulse.The diagnosis of MS based on medical history, is comprised the outbreak of at least twice tangible nervous disorder, the separated region that it separates, produces the objective clinical indication of nervous disorder in time and relates to the CNS white matter.Laboratory research provides the other objective evidence of supporting the MS diagnosis, and described research comprises Magnetic resonance imaging (MRI), IgG cerebrospinal fluid (CSF) OCB of CNS white matter infringement and the abnormal response that causes.Alleviate the course of disease though Most patients can experience progressive recurrence, the clinical course of MS is far from each other between individuality, and its scope can be shown effect to the explosive disease of chronic accumulation from the several gentleness that is limited in life.The increase of myelin-ART quantity with secretion of gamma-IFN ability is relevant with the pathogenesis of MS and EAE.

In the autoimmune demyelinating disease such as multiple sclerosis and experimental autoimmune encephalomyelitis (EAE), the oneself protein of autoimmune reaction, self polypeptide or self peptide target can comprise the epi-position from following albumen or peptide: PLP (PLP); Myelin basic protein (MBP); Myelin oligodendrocyte albumen (MOG); Cyclic nucleotide phosphodiesterase (CNPase); The glycoprotein of myelin combination (MAG); And the oligodendrocyte basic protein (MBOP) of myelin combination; α-B-crystalline protein (heat shock protein); Virus and bacterium simulating peptide (for example, influenza, herpes virus, hepatitis type B virus, or the like); OSP (oligodendrocyte specific proteins); The MBP that citrulling is modified (the C8 isomer of MBP, wherein 6 arginine to have taken off imido grpup be citrulling), or the like.Conformity membrane albumen PLP is myelinic main self-antigen.In several mouse species, identify PLP antigenicity decision base, comprised residue 139-151,103-116,215-232,43-64 and 178-191.At least 26 MBP epi-positions (Meinl et al, J Clin Invest 92,2633-43,1993) have been reported.It should be noted that residue 1-11,59-76 and 87-99.The immundominance MOG epi-position of having identified in several mouse species comprises residue 1-22,35-55,64-96.Term used herein " epi-position " should be understood that to represent the part of oneself protein, self polypeptide or self peptide, and it has by the given shape or the structure of immune B cell of animal or T cell recognition.

In people MS patient, identify following myelin protein and epi-position as autoimmune T and B cell effect target.Antibody recognition myelin basic protein (MBP) peptide 83-97 (Wucherpfennig et al, J Clin Invest 100:1114-1122, (1997)) from MS brain spot wash-out.Another discovers that about 50% MS patient has peripheral blood lymphocyte (PBL) t cell responses (6-10% contrast), 20% at myelin oligodendrocyte glycoprotein (MOG) and has reactivity (8-12% contrast), 8% at MBP and have reactivity (0% contrast), 0% at PLP and have reactivity (0% contrast) at MAG.In this research, the reactive patient of 7/10 MOG has the reaction of T cell proliferative, and described reaction focuses on one of 3 kinds of peptide epitopes, comprise MOG 1-22, MOG 34-56, MOG 64-96 (Kerlero de Rosbo et al., Eur J Immunol 27,3059-69, (1997)).T cell and B cell (Ab of brain damage wash-out) reaction focuses on MBP 87-99 (Oksenberg et al, Nature 362,68-70,1993).In MBP 87-99, amino acid motif HFFK is the main target (Wucherpfennig et al., J Clin Invest 100,1114-22, (1997)) of T and two kinds of cell effects of B.The lymphocyte reaction at the oligodendrocyte basic protein (MOBP) of myelin combination is observed in another research, and it comprises residue MOBP 21-39 and MOBP 37-60 (Holz et al., JImmunol 164,1103-9, (2000)).The immune golden conjugate that uses MOG and MBP peptide is to MS brain and the dyeing of contrast brain, and the Abs by the combination of MS spot recognizes MBP and MOG peptide (Genain and Hauser, Methods 10,420-34, (1996)).

Rheumatic arthritis.Rheumatic arthritis (RA) is chronic autoimmune inflammatory synovitis, affects 0.8% of world population.It is characterized by the chronic inflammatory synovitis that causes the aggressivity destruction of joint.Referring to, for example, St.Clair, et al. (2004) Rheumatoid Arthritis (rheumatic arthritis) Lippincott Williams ﹠amp; Wilkins, ISBN-10:0781741491, ISBN-13:978-0781741491; Firestein, et al. (eds.2006) Rheumatoid Arthritis (rheumatic arthritis) (2d Ed.) Oxford University Press, USA, ISBN-10:0198566301, ISBN-13:978-0198566304; Emery, electronic publishing before et al. (2007) ＂ Evidence-based review of biologicmarkers as indicators of disease progression and remission in rheumatoidarthritis ＂ (as the evidential summary of the biomarker of rheumatic arthritis progression of disease and remission index) the Rheumatol.Int.[printing] PMID:17505829; Nigrovic, etal. (2007) ＂ Synovial mast cells:role in acute and chronic arthritis ＂ Immunol.Rev.217 (1): 19-37, PMID:17498049; And Manuel, et al. (2007) ＂ Dendritic cells inautoimmune diseases and neuroinflammatory disorders ＂ (dendritic cell in autoimmune disease and the neural inflammatory conditions) Front.Biosci.12:4315-335, PMID:17485377.RA is by T cell, B cell and macrophage-mediated.

The evidence that proof T cell plays a crucial role in RA comprises 1) invade the CD4 of lubricating film ⁺The dominance of T cell, 2) with the relevant clinical improvements of medicine suppressor T cell function that uses such as cyclosporin, and 3) correlation between RA and some HLA-DR allelomorph.The HLA-DR allelomorph relevant with RA comprises the similar amino acid sequence of the site 67-74 of β chain the 3rd hypervariable region, and described site participates in the peptide combination and is presented to the T cell.RA is mediated by ART, and this ART is identified in the oneself protein that exists in the synovial joint or modified oneself protein.Autoantigen of the present invention (self-antigens), oneself protein, self polypeptide or self peptide are called self-antigen (autoantigens) again, are used as target in RA, comprise from following epi-position: the II collagen type; HnRNP; A2/RA33; Sa; Microfilament is assembled albumen; Keratin; Citrulling; The chondroprotein that comprises gp39; I, III, IV, V, IX, XI collagen type; HSP-65/60; IgM (the rheumatic factor); RNA polymerase; HnRNP-B1; HnRNP-D; Cuorin; Aldolase A; The microfilament that citrulling is modified is assembled albumen and fibrin.Identified the identification microfilament and assemble the auto-antibody of protein peptides in a high proportion of RA patient's serum, described microfilament is assembled protein peptides and is comprised modified arginine residues (taking off imido grpup to form citrulling).Among some patients, same immunodominant II collagen type (CII) peptide 257-270 is all pointed in ART and B cell effect.

The diabetes that insulin relies on.The diabetes (IDDM) that people I type or insulin rely on are characterized by the autoimmune destruction of β cell in youth's lattice Han Shi (Langerhans) pancreas islet.Removing the β cell causes regulating blood sugar level.Referring to, for example, Sperling (ed.2001) Type 1 Diabetes inClinical Practice (Contemporary Endocrinology) (type 1 diabetes in the clinical practice (contemporary endocrinology)) Humana Press, ISBN-10:0896039315, ISBN-13:978-0896039315; Eisenbarth (ed.2000) Type 1 Diabetes:Molecular, Cellular andClinical Immunology (Advances in Experimental Medicine and Biology) (type 1 diabetes: molecule, cell and clinical immunology (experimental medicine and biology progress)) Springer, ISBN-10:0306478714, ISBN-13:978-0306478710; Wong and Wen (2005) ＂ B cells inautoimmune diabetes ＂ (the B cells in the autoimmune diabetes) Rev.Diabet.Stud.2 (3): 121-135, Epub 2005 Nov 10, PMID:17491687; Sia (2004) ＂ Autoimmunediabetes:ongoing development of immunological intervention strategies targeteddirectly against autoreactive T cells ＂ (autoimmune diabetes: the progress that directly gets involved strategy) Rev.Diabet.Stud.1 (1): 9-17 at the immunity of ART, Epub 2004 May 10, PMID:17491660; Triplitt (2007) ＂ New technologies and therapies in themanagement of diabetes ＂ (new technology and the new treatment of diabetes control) Am.J.Manag.Care13 (2Suppl): S47-54, PMID:17417933; And Skyler (2007) ＂ Prediction andprevention of type 1 diabetes:progress, problems, and prospects ＂ (prediction of type 1 diabetes and prevention: progress, problem and prospect) Clin.Pharmacol.Ther.81 (5): 768-71, Epub2007 Mar 28, PMID:17392722.

When blood sugar level raise on the specified level (about usually 250mg/dl), tangible diabetes promptly took place.The preceding symptom phase that one segment length's time was arranged before the human diabetes outbreak.In this period, the pancreatic beta cell function can be lost gradually.The existence prompting progression of disease of the auto-antibody of anti-insulin, anti-glutamate decarboxylase and anti-tyrosine phosphatase IA2 (IA2) (above all is the example of oneself protein of the present invention, self polypeptide or self peptide).

The mark that the preceding symptom phase can be estimated is the existence of inflammation of pancreatic islet in the pancreas; The level of ICA, ICSA and frequency; MHC II quasi-molecule is at the unconventionality expression of pancreatic beta cell; The plasma concentration of blood sugar concentration and insulin.As the reduction of insulin concentration, described disease is indicated in the increase of the amount of pancreas T lymphocyte, ICA and blood sugar.

Non-obese diabetes (NOD) mouse is as animal model, have many identical with people IDDM clinically, on the immunology and the feature on the histopathology.The pancreas islet inflammatory spontaneously takes place and to the destruction of described β cell in the NOD mouse, and it causes hyperglycaemia and tangible diabetes.Diabetes need CD4 ⁺And CD8 ⁺Two kinds of T cells are although the effect of each it be unclear that.Show, under the toleranceization condition, give insulin or GAD, prevent disease and other autoantigens downward modulation reactions as albumen to the NOD mouse.

There is to people's type i diabetes extremely sensitive and high special in the combination that has each species specific auto-antibody in the serum.For example, the existence of anti-GAD and/or IA-2 auto-antibody has about 98% susceptibility and 99% specificity to identify type i diabetes from control serum.In type i diabetes patient's non-diabetic first degree relative, there is both auto-antibody be specific in three kinds of self-antigen that comprise GAD, insulin and IA-2, then represent positive desired value greater than 90%, it represents the progress of I type DM in 5 years.

The self-antigen of actrapid monotard's dependent diabetes mellitus target can comprise oneself protein, self polypeptide or self peptide tyrosine phosphatase IA-2; IA-2 β; The glutamate decarboxylase (GAD) of 65kDa and two kinds of forms of 67kDa; Carboxypeptidase H; Insulin; Proinsulin; Heat shock protein (HSP); Glima38; Pancreatic island cell antigen 69kDa (ICA69); P52; Two kinds of gangliosides antigens (GT3 and GM2-1); And islet cells glucose transporter (GLUT2).

Currently instruct the injection of Recombulin or based on the conveying of pump, thereby the treatment people is IDDM by the monitoring blood sugar level.Meals and motion mode help to reach enough glycemic control.

The autoimmune uveitis.The autoimmune uveitis is the autoimmune disease of eye, influences 400,000 people according to estimates, and U.S.'s incidence of disease is annual newly-increased 43,000 examples.Current steroids, immunodepressant, vein immunoglobulin and TNF α-antagonist such as methotrexate (MTX) and cyclosporin are used in the uveitic treatment of autoimmune.Referring to, for example, Pleyer andMondino (eds.2004) Uveitis and Immunological Disorders (Essentials inOphthalmology) (uveitis and immune disorders (ophthalmology main points)) Springer, ISBN-10:3540200452, ISBN-13:978-3540200451; Vallochi, et al. (2007) ＂ The role ofcytokines in the regulation of ocular autoimmune inflammation ＂ (effect of cell factor in regulating eye autoimmune inflammation) Cytokine Growth Factor Rev.18 (1-2): 135-141, Epub 2007 Mar 8, PMID:17349814; Bora and Kaplan (2007) ＂ Intraoculardiseases-anterior uveitis ＂ (ophthalmic disease-anterior uveitis) Chem.Immunol.Allergy.92:213-20, PMID:17264497; And Levinson (2007) ＂ Immunogenetics of ocularinflammatory disease ＂ (immunogenetics of ophthalmia disease) Tissue Antigens69 (2): 105-112, PMID:17257311.

Experimental autoimmune uveitis (EAU) is the cell-mediated autoimmune disease of T, and this disease is a target with linked groups in neural retina, uvea and the eye.EAU have identical with people's autoimmune uveitis many clinically with immunology on feature, and by the uveitis inducing peptide of administered peripherally with complete Freund's adjuvant (CFA) emulsification.

In people's autoimmune uveitis, the oneself protein of autoimmune reaction target can comprise that biostearin is in conjunction with albumen (IRBP), visual purple and recoverin between S-antigen, photoreceptor.

Primary biliary cirrhosis of liver.Primary biliary cirrhosis of liver (PBC) is organ specific autoimmune disease, mainly influences 40 years old to 60 years old women.The incidence of disease of report is near 1/1000 in this group.PBC is characterised in that the carrying out property destruction of stones in intrahepatic bile duct epithelial cell (IBEC), and described IBEC is little stones in intrahepatic bile duct liner.This causes the obstruction of choleresis and interference are caused final sclerosis.Reported the correlation of being damaged other autoimmune diseases that characterize by last leather lining/excretory system, described disease comprises Si Yegelun (family name) syndrome, CREST syndrome, autoimmune thyroid disease and rheumatic arthritis.The concern that drives antigen concentrated on the mitochondria surpassed 50 years, the discovery (Gershwin et al., ImmunolRev 174:210-225, (2000) that cause AMA (AMA); Mackay et al, ImmunolRev174:226-237, (2000)).AMA becomes the basis of laboratory diagnosis PBC very soon, and it occurs long ago just being present among the patients serum of 90%-95% in clinical symptoms.Reactive called after M1 of Intramitochondrial autoantigenioity and M2.The reactive 48-74kDa component family that points to of M2.M2 represents the multiple autoantigenioity enzyme subunit of 2-oxyacid dehydrogenase complex (2-OADC), and is another example of oneself protein of the present invention, self polypeptide or self peptide.

The research of identifying pyruvate dehydrogenase complex (PDC) antigenic action in the PBC pathogenesis has supported such viewpoint: PDC to play central role (Gershwin et al., Immunol Rev 174:210-225, (2000) in the inducing of described disease; Mackay et al., Immuno lRev 174:226-237, (2000)).In 95% PBC case, the most frequent reactivity is the E2 74kDa subunit that belongs to PDC-E2.Exist relevant but different complexs comprise: 2-oxoglutaric acid dehydrogenase complex (OGDC) and branched chain (BC) 2-OADC.Three kinds of composing type enzymes (E1, E2, E3) help catalysis, and this catalysis is for to become acyl-CoA (CoA) with 2-oxyacid substrate conversion, simultaneously with NAD ⁺Be reduced into NADH.Mammal PDC comprises other component, claims albumin X or E-3 in conjunction with albumen (E3BP) .In PBC patient, described main antigen-reactive points to PDC-E2 and E3BP.The E2 polypeptide comprises the sulphur decoyl domain that two series connection repeat, and E3BP has single sulphur decoyl domain.With glucocorticoid and the immunosuppressant treatment PBC that comprises methotrexate (MTX) and Ciclosporin A.Referring to, for example, Sherlock and Dooley (2002) Diseases of the Liver ﹠ amp; Biliary System (disease of liver and courage system) (11th ed.) Blackwell Pub., ISBN-10:0632055820, ISBN-13:978-0632055821; Boyer, et al. (eds.2001) LiverCirrhosis and it sDevelopment (cirrhosis and progress thereof) (Falk Symposium, Volume115) Springer, ISBN-10:0792387600, ISBN-13:978-0792387602; Crispe (ed.2001) T Lymphocytes in the Liver:Immunobiology, Pathology and Host Defense (the T lymphocyte in the liver:immuno-biology, pathology and host defense) Wiley-Liss, ISBN-10:047119218X, ISBN-13:978-0471192183; Lack (2001) Pathology of thePancreas, Gallbladder, Extrahepatic Biliary Tract, andAmpullary Region (Medicine) (pancreas, gall-bladder, the pathology of extrahepatic biliary passages and ampulla (medical science)) Oxford UniversityPress, USA, ISBN-10:0195133927, ISBN-13:978-0195133929; Gong, electronic publishing before et al. (2007) ＂ Ursodeoxycholic Acid for Patients With Primary Biliary Cirrhosis:AnUpdated Systematic Review and Meta-Analysis of Randomized Clinical TrialsUsing Bayesian Approach as Sensitivity Analyses ＂ (urso that is used for patients with primary biliary cirrhosis: the systematic review of renewal and utilize the bass analytic approach as the randomized clinical trial post analysis of sensitivity analysis) the Am.J.Gastroenterol.[printing] PMID:17459023; Lazaridis and Talwalkar (2007) ＂ Clinical Epidemiology of Primary BiliaryCirrhosis:Incidence, Prevalence, the and Impact of Therapy ＂ (clinical epidemiology of primary biliary cirrhosis of liver:take place, popular and treatment influences) J.Clin.Gastroenterol.41 (5): 494-500, PMID:17450033; And Sorokin, etal. (2007) ＂ Primary biliary cirrhosis, hyperlipidemia, and atherosclerotic risk:A systematic review ＂ (primary biliary cirrhosis of liver, hyperlipidemia and atherosclerotic risk:electronic publishing before Atherosclerosis[printing systematic review)] PMID:17240380.

The mouse model of experimental autoimmune cholangitis (EAC) adopts (i.p.) sensitizationization in the peritonaeum that use mammal PDC carries out in the SJL/J female mice, thereby induce the generation (Jones of nonpyogenic destructive cholangitis (NSDC) and AMA, J Clin Pathol 53:813-21, (2000)).

Other autoimmune diseases and relevant oneself protein, self polypeptide or self peptide.The self-antigen of myasthenia gravis can comprise the epi-position in the acetylcholinergic receptor.The self-antigen of target can comprise desmoglein-3 in the pemphigus vulgaris.Si Yegelun (family name) syndrome antigen can comprise SSA (Ro); SSB (La); And fodrin.The main self-antigen of pemphigus vulgaris can comprise desmoglein-3.The myositis group can comprise tRNA synzyme (for example, Threonyl, histidyl-, alanyl, isoleucyl-and glycyl); Ku; Scl; SSA; The U1Sn ribonucleoprotein; Mi-1; Mi-1; Jo-1; Ku; And SRP.The chorionitis group can comprise Scl-70; The centromere; The U1 ribonucleoprotein; And microfilament is assembled albumen.The pernicious anaemia group can comprise intrinsic factor; And the glycoprotein β subunit of stomach H/K ATP enzyme.The epitope antigen of systemic loupus erythematosus (SLE) can comprise DNA; Phosphatide; Nuclear antigen; Ro; La; The U1 ribonucleoprotein; Ro60 (SS-A); Ro52 (SS-A); La (SS-B); Calprotectin; Grp78; Scl-70; Histone; Sm albumen; And chromatin, or the like.In Graves disease, epi-position can comprise Na ⁺/ I ^-Symport albumen; Thyrotropin receptor; Tg; And TPO.

Polynucleotides treatment-material and method

Before describing the present invention in detail, be to be understood that to the invention is not restricted to specific formulation or technological parameter, because they naturally can change.Will also be understood that term used herein just is used to describe specific implementations of the present invention, rather than be intended to restriction.

Although can be used for implementing the present invention to lot of materials and method similar or that be equal to described herein, this paper has described preferable material and method.

Term " polynucleotides " and " nucleic acid " refer to the polymer that a plurality of nucleotide units (ribonucleotide or deoxyribonucleotide or relevant structural variant) that phosphodiester bond is connected are formed.Polynucleotides or nucleic acid can be random length basically, usually from about six (6) individual nucleotide to about 109 nucleotide to about 4000 nucleotide or bigger.Polynucleotides and nucleic acid comprise polymer, sense strand and antisense strand, two strands or the strand of RNA, DNA, synthesized form and mixing, also can be chemistry or biology nucleotide base that modify or that can comprise non-natural or derive, those skilled in the art can easily understand this point.These modifications comprise: for example, and mark; Methylate; Replace one or more naturally occurring nucleotide with analog; Such as not charged connection (for example, methyl-phosphonate, phosphotriester, phosphoramidate, carbamate etc.), charged connection (for example, thiophosphate, phosphorodithioate etc.), side group part (for example, polypeptide), intercalator (for example, acridine, psoralen etc.), the modification between the nucleotide of chelating agent, alkylating agent and being connected of modifying (for example, different nucleic acid of α etc.).Also be included in by hydrogen bond and the synthetic molecules of other chemical interactions in conjunction with simulation polynucleotides on the ability of specified sequence.These molecules are known in the art, and comprise, for example, peptide bond replaces those molecules of phosphate bond on molecular skeleton.

Term used herein " promotor " refers to the polynucleotide region for initial RNA synthesizes or " transcribing " discerned by RNA polymerase.Promotor is one of functional element of self carrier, and its adjusting is transcribed efficient and thereby regulated and control the protein expression level of self polypeptide of self vector encoded.Promotor can be " composing type ", thus allow related gene continue transcribe or " induction type ", and therefore be subjected to the existence of different material in the environment or the adjusting of disappearance.In addition, promotor can also be general, is used for the expression of different cell types widely, perhaps has cell type specificity, therefore only activates in such as the particular cell types of muscle cell or induces.The promotor that the control carrier is transcribed can obtain from various sources, for example, viral genome such as polyomavirus, simian virus 40 (SV40), adenovirus, retrovirus, hepatitis type B virus and preferred cytomegalovirus, perhaps obtain from the allos mammalian promoter, for example the b-actin promoter.The early stage of described SV40 virus can obtain easily with the instant early promoter of late promoter just as human cytomegalovirus.

" enhancer " refers to be about the cis acting polynucleotide region of 10-300 base-pair, and it acts on promotor to strengthen transcribing of this promotor.The direction and the position of enhancer are relatively independent, and can place in 5 ' or 3 ' end, intron inside or this coded sequence itself of transcript unit.

" terminator sequence " used herein points to the polynucleotide sequence that RNA polymerase sends the DNA transcription stop signals.Terminator sequence produces RNA3 ' end, can locate at its upstream obviously to process by poly-adenosine usually.3 ' the end non-template ground that " poly-adenosine " that uses points to the mRNA through transcribing adds about 50 nucleotide chains to about 200 polyadenylic acids (polyA).In the 3 ' non-translational region (UTR) of mRNA, found " poly-adenosine signal " (AAUAAA), and this signal has been specified the interpolation site of the cleavage site and the polyA tail of transcript.Tanscription termination and poly-adenosine interrelate on function, and simultaneously effectively the required sequence of cutting/poly-adenosine has also constituted the critical elements (Connelly and Manley, 1988) of terminator sequence.

Term " dna vaccination inoculation ", " dna immunization " and " polynucleotide therapy " can exchange use in this article, are meant that to regulate immune response be purpose, give polynucleotides to individuality." dna vaccination inoculation " that use to express the plasmid of inoculating microbe antigen is known method (Davis, (1997) of inducing the antiviral or antibacterial immunization of protectiveness; Hassett and Whitton, (1996); AndUlmer et al., (1996)).For the purposes of the present invention, " dna vaccination inoculation ", " dna immunization " or " polynucleotide therapy " are meant the polynucleotides of one or more self polypeptide of encoding, and described self polypeptide comprises one or more self-antigen epi-positions with disease association.The purpose of " dna vaccination inoculation " is to regulate ongoing immune response and destroys to suppress autoimmune, is used for the treatment of or prevents autoimmune disease.The immune response adjusting that " dna vaccination inoculation " made a response can comprise that the autoreactivity lymphocyte is converted to the Th2 type from the Th1 type to react.This immunoreactive adjusting can be taken place or the only local target organ that suffers the autoimmunity sexual assault that betides by whole body.

" self carrier " represents one or more carriers, and it comprises the polynucleotides of one or more oneself proteins of coding, self polypeptide, self peptide, DNA or RNA altogether.Polynucleotides used herein are a series of DNA (deoxyribonucleic acid) (comprising DNA) or ribonucleic acid (comprising RNA) and their derivatives of code book invention oneself protein, self polypeptide or self peptide.Oneself protein, self polypeptide or self peptide coded sequence are inserted into suitable plasmid expression self box (self-cassette).In case the polynucleotides of coding oneself protein, self polypeptide or self peptide are inserted into described expression self box, then this carrier is known as " self carrier ".Under the situation of the polynucleotides of more than a kind of oneself protein of encoding, self polypeptide or self peptide, single self carrier can encode oneself protein, self polypeptide or self peptide of multiple separation.In one embodiment, utilize internal ribosome to enter sequence (IRES) or other methods again from single DNA molecules expression multiple protein, sequential encoding DNA in single self plasmid, several oneself proteins of described dna encoding, self polypeptide or self peptide.Preparation and the DNA that separates coding oneself protein, self polypeptide or self peptide express self carrier, and its utilization is used for the common obtainable technology of isolated plasmid dna, those that described technology such as Qiagen company commercialization provides.With the DNA purifying for not containing bacterial endotoxin, so that flow to the people as therapeutic agent.Selectively, each oneself protein of coding, self polypeptide or self peptide on the separated DNA expression vector.

Term " carrier framework " is meant plasmid vector part but not the sequence part of coding autoantigen, oneself protein, self polypeptide or self peptide.

" inhibitive ability of immunity carrier framework " is meant the carrier framework that meets following condition: (i) compare with the parental generation carrier framework, cause the immune response that weakens, perhaps (ii) stop or suppress immune response.Can utilize external or body inner analysis known in the art to measure described immune response.For example, be exposed to the lymphopoiesis of carrier framework by measurement, perhaps measure the immunostimulating cell factor of indication generate (for example, IL-2, IFN-γ, IL-6) (in cell culture medium, serum, or the like) determines immune response.In some embodiments, compare with the parental generation carrier framework, the inhibitive ability of immunity carrier framework comprises immunostimulating sequence (for example, CpG sequence) still less.In some embodiments, the inhibitive ability of immunity carrier framework comprises one or more inhibitive ability of immunity sequences (IIS), for example, and description and known in the art in this article.In some embodiments, the inhibitive ability of immunity carrier framework promotes the Th2 immune response, but suppresses the Th1 immune response.

" autoantigen, oneself protein, self polypeptide or self peptide " used herein is meant arbitrary protein, polypeptide or the peptide or its fragment or the derivative that meet following condition: encode in the animal gene group; In this animal, produce or generate; Can carry out posttranslational modification in certain period of this animal life process; And non-physiology ground is present in this animal.Autoantigen of the present invention, oneself protein, self polypeptide or self peptide also are called as self-antigen.By disappearance part coded sequence, and the ATG initiation codon of inserting new coding methionine in some cases, insert new terminator, and/or disappearance, remove or modify other sequences to produce the fragment or the derivative of oneself protein, self polypeptide or self peptide, can generate fragment and derivative.When term " unphysiologic " or " non-physiology ground " are used to describe oneself protein of the present invention, self polypeptide or self peptide, refer to described oneself protein, self polypeptide or the self peptide normal effect in animal body or the disengaging or deviation of process.When described oneself protein, self polypeptide or self peptide are called " disease association " or " involved in diseases ", being interpreted as described oneself protein, self polypeptide or self peptide can be modified in form or on the structure, and therefore can not bring into play its physiological action or carry out its physiology course, perhaps can participate in the pathologic, physiologic of described situation or disease, described participation is by inducing pathologic, physiologic, mediation or promotion pathophysiological process; And/or undertaken by the target that becomes pathophysiological process.For example, in autoimmune disease, immune system abnormality is attacked oneself protein, causes damage and the dysfunction expressing and/or have the cell and the tissue of this oneself protein.The example of the posttranslational modification of oneself protein, self polypeptide or self peptide is glycosylation, add lipid groups, the dephosphorylation by phosphatase, add the diethylarginine residue, take off imidic acid enzyme (PAD) by the peptidyl arginine microfilament is assembled albumen and fibrin citrullingization, the phosphorylation of α-crystalline protein, the citrullingization of MBP, and the SLE self-antigen proteolysis by aspartic acid specificity cysteine protease (caspases) and granzyme (granzymes).On immunology, think that oneself protein, self polypeptide or self peptide all are host's autoantigens, and under the normal physiological situation, the immunocyte that the process that host immune system can be by being called " immune tolerance " has an identification autoantigen ability through removing, deactivation or inactivation is ignored oneself protein, self polypeptide or self peptide.Antigen is meant can be by immune system recognition promptly by the molecule of B cell or T cell or the two identification.Oneself protein, self polypeptide or self peptide do not comprise immune protein, polypeptide or peptide, and described immune protein, polypeptide or peptide are specially by immune cell physiological ground, the molecule of expression specifically for the purpose of regulating immunologic function.Immune system is a defense mechanism, and the means that this defense mechanism provides can be carried out the countless potentially pathogenic microorganism of living in the animal kingdom fast, high special and be the reaction of protectiveness.The example of immune protein, polypeptide or peptide is an albumen, and described albumen comprises TXi Baoshouti, immunoglobulin, comprises the cell factor of I type interleukin and comprises interferon and the II cytokines of IL-10, TNF, lymphotoxin and such as the chemotactic factor (CF) of macrophage inflammatory protein-1 α and β, monocyte-chemotactic protein and RANTES and such as other molecules of participating in immunologic function directly of Fas-part.Have some immune protein, polypeptide or the peptide be included in oneself protein of the present invention, self polypeptide or the self peptide, it is: I class MHC membrane glycoprotein, II class MHC glycoprotein and osteopontin.Oneself protein, self polypeptide or self peptide do not comprise albumen, polypeptide and peptide, described albumen, polypeptide and peptide be owing to cause the inheritance of metabolism or function illness or acquired defective and not existing fully or basically in individuality, and by giving described albumen, polypeptide or peptide or replaced by the polynucleotides (gene therapy) that give encoding said proteins, polypeptide or peptide.Oneself protein, self polypeptide or self peptide do not comprise cell-specific and special expressed proteins, polypeptide and peptide, described cell has the characteristic that they and normal cell can be distinguished, it comprises: (1) clone's property, it represents the propagation of the single cell after the hereditary change, thereby form the malignant T cell clone, (2) self-disciplining, its expression is to the inappropriate adjusting of growth, and (3) degenerated, or the shortage of normally collaborative cell differentiation.One or more cell with aforementioned three standards is called tumour T cell, cancer T cell or malignant T cell.

" regulate (modulation of), regulate (modulating) or change immune response " used herein refers to the existing or potential immunoreactive change at self molecule, described self molecule includes but not limited to, nucleic acid, lipid, phosphatide, sugar, oneself protein, self polypeptide, self peptide, protein complexes or nucleoprotein complex or its derivative, described change are encode oneself protein, self polypeptide, self peptide, the polynucleotides of nucleic acid or the result of its fragment or its derivative.This adjusting comprises the change that maybe can participate in existence, ability or the function of immunoreactive immunocyte to participation.Immunocyte comprises that B cell, T cell, NK cell, NK T cell, full-time antigen presenting cell, non-full-time antigen presenting cell, inflammatory cell maybe can participate in or influence immunoreactive other cell.Adjusting comprises any variation that existing immune response, the immune response that is making progress, potential immune response are caused, or induces, regulates, influences or react immunoreactive ability.Adjusting comprises as the expression of gene, albumen and/or other molecules in the immunocyte of an immune response part and/or the change of function.

" immunoreactive adjusting " includes but not limited to: the removing of immunocyte, removal or isolation; The inducing or producing of immunocyte, described immunocyte can be regulated the functional capabilities such as other cells of autoreactivity lymphocyte, APCs or inflammatory cell; Inducing of immunocyte state of anergy is called anergy; The raising of immunologic cellular activity or function, reduction or change or carry out the ability that (includes but not limited to change the albumen type of described cellular expression) like this.Example comprises the production and/or the secretion through changing of the molecule of some class, and described molecule is cell factor, chemotactic factor (CF), growth factor, transcription factor, kinases, collaborative stimulation molecule or other cell surface receptors for example; The combination of perhaps described modulability incident.

For example, the polynucleotides of coding oneself protein, self polypeptide, self peptide can be regulated immune response, its by remove, isolate or deactivation regulate maybe can regulate and do not wish immunoreactive immunocyte; Induce, produce or open the immunocyte that adjusting maybe can be regulated protective immunological reaction; Change the physiological or the functional character of immunocyte; Or the combination of these effects.The example of measuring immunoreactive adjusting includes but not limited to whether check immunocyte group's existence (uses flow cytometry, immunohistochemistry, histology, EM, polymerase chain reaction (PCR)); Measure the immune cell function sexuality, the ability of propagation or division or resistance when it is included in signal reaction (for example use based on ³The H-thymidine mixes follow the tracks of to stimulate ( ³H-thymidine incorporation followingstimulation) T analysis of cell proliferation and pepscan analysis, it uses anti-cd 3 antibodies, anti-TXi Baoshouti antibody, anti-CD28 antibody, Calcium ionophore, PMA, is loaded with the antigen presenting cell of peptide or proteantigen; The B cell proliferation test); Measurement is killed or the ability (for example cytotoxic T cell test) of other cells of cracking; Measure other products (by flow cytometry, enzyme linked immunosorbent assay, protein blot analysis, arrays of immobilized protein analysis, immunoprecipitation analysis) of cell factor, chemotactic factor (CF), cell surface molecule, antibody and cell; Measure signal path in activated immune cell biochemical marker or the immunocyte (protein blot and immunoprecipitation analysis that tyrosine, serine or threonine phosphorylation, polypeptide cutting and protein complexes are formed or dissociate; Protein arrays is analyzed; Use DNA array or difference to subtract the DNA transcripting spectrum of hybridization); Measure apoptosis, necrosis or other machine-processed cell deaths that causes and (measure dna ladder shape band, histological nexin V dyeing, TUNEL test, gel electrophoresis; The test of fluorescence aspartic acid specificity cysteine protease, the protein blot analysis of aspartic acid specificity cysteine protease substrate); Measure gene, albumen and other molecules (analysis of the Northern marking, polymerase chain reaction (PCR), dna microarray, arrays of immobilized protein, two dimensional gel electrophore-sis, protein blot analysis, enzyme linked immunosorbent assay, flow cytometry) that immunocyte produces; Measure clinical consequences, for example to autoimmune disease, neurodegenerative disease with relate to the improving of other diseases (clinical score, use requirement, functional status, the imaging research of adjunctive therapy) of unphysiologic oneself protein.

" immunological regulation sequence (IMSs) " used herein is meant the compound of being made up of deoxynucleotide, ribonucleotide or its analog, and they regulate autoimmune or inflammatory disease.IMSs can be the nucleotide sequence that is integrated into carrier." oligonucleotides " represents a plurality of nucleotide.Nucleotide is the molecule that comprises the sugar (preferred ribose or deoxyribose) that is connected with phosphate and interchangeable organic base, it can be a substituted purine (guanine (G), adenine (A) or inosine (I)) or substituted pyrimidine (thymidine (T), cytimidine (C) or uracil (U)).Oligonucleotides is meant oligoribonucleotide and oligodeoxyribonucleotide, and the latter is called as ODNs in this article.ODNs comprises that few nucleosides (promptly removing phosphatic oligonucleotides) and other contain the polymer of organic base.Oligonucleotides comprises a plurality of nucleotide from the random length of two or more multi-link nucleotide chain, has comprised the chromosome material of the nucleotide that comprises 1,000,000 connections.

In some changed, the method that is used for the treatment of autoimmune disease comprised the immunoreactive adjuvant of adjusting of CpG oligonucleotides, so that the enhance immunity reaction.CpG oligonucleotides or excitant IMSs have been proved to be the antibody response (Krieg et al., Nature, 374:546-9 (1995)) that strengthens the dna vaccination inoculation.The CpG oligonucleotides will be made up of the skeleton oligonucleotides of purifying, and the anti-in vivo degraded of described skeleton is such as phosphorothioate backbone.Can be used for excitant IMS of the present invention and comprise following core hexamer:

5 '-purine-pyrimidine-[C]-[G]-pyrimidine-pyrimidine-3 '

Perhaps

5 '-purine-purine-[C]-[G]-pyrimidine-pyrimidine-3 ';

5 ' and/or 3 ' of immunostimulating IMSs core hexamer can flank connects the nucleotide or the nucleosides of any combination or arbitrary number.Preferably, the length range of excitant IMSs is 6 to 100 base-pairs, and most preferably, long 16-50 base-pair.Excitant IMSs also can be used as the part of bigger dna fragmentation and carries its scope from 100 to 100,000 base-pairs.Excitant IMSs can introduce or be present in DNA plasmid, viral vectors and genomic DNA.Most preferably, the magnitude range of excitant IMSs can also be from 6 (no flanking sequences) to 10,000 base-pairs or bigger.Can make up the sequence that is positioned at this hexamer core flank, make it match flanking sequence in present any known immunostimulating sequence (ISS) basically.For example, flanking sequence TGACTGTG-Pu-Pu-C-G-Pyr-Pyr-AGAGATGA, wherein TGACTGTG and AGAGATGA are flanking sequence.Another preferred flanking sequence is incorporated a series of pyrimidine (C, T and U) into, or as repeating twice or single pyrimidine repeatedly, or as the mixture of two long or longer different pyrimidines.Use different flanking sequence test inhibitions to regulate sequence, and can be transformed into excitant adjusting sequence.The further example of flanking sequence is included in the following list of references: United States Patent (USP) the 6th, 225, and No. 292 and the 6th, 339, No. 068, and Zeuner et al., Arthritis andRheumatism, 46:2219-24, (2002).

Be suitable for using the particular stimulation IMSs of self carrier administration of modification of the present invention to comprise the oligonucleotides that comprises following hexamer sequence:

5 '-purine-pyrimidine-[X]-[Y]-pyrimidine-pyrimidine-3 ' IMSs, comprise CG dinucleotides core: GTCGTT, ATCGTT, GCCGTT, ACCGTT, GTCGCT, ATCGCT, GCCGCT, ACCGCT, GTCGTC, ATCGTC, GCCGTC, ACCGTC, or the like;

Guanine and inosine usually can substituted adenines, and/or uridine can replace cytimidine or thymidine usually, and can realize these replacements based on the elaboration of above-mentioned guidance.Selectively, can be according to above about the detailed description of IMSs, ISS-ODNs is comprised into self carrier.Useful especially ISS comprises the suitableeest CpG element of mouse AACGTT.Can be in single or a plurality of sites of carrier add single ISS or a plurality of ISS, only otherwise destroy other function material standed fors (electors) to self carrier of modifying.In an exemplary embodiment, the ISS that is added to self carrier of modification comprises one group of 5 the suitableeest CpG element of mouse (AACGTT) of adjacent promotor upstream.

In some changed, the method that is used for the treatment of autoimmune disease also comprised the polynucleotides of inhibition IMS or inhibitive ability of immunity sequence (IIS).Be used for IISs of the present invention and comprise following core hexamer:

5 '-purine-pyrimidine-[X]-[Y]-pyrimidine-pyrimidine-3 '

Or

5 '-purine-purine-[X]-[Y]-pyrimidine-pyrimidine-3 ';

Wherein X and Y are any natural existence or synthetic nucleotide, except X and Y can not be cytimidine-guanines.

5 ' and/or 3 ' of IMSs core hexamer can flank connects the nucleotide or the nucleosides of any combination or arbitrary number.Preferably, the length range of IMSs is 6 to 100 base-pairs, and most preferably, long 16-50 base-pair.IMSs also can be used as the part of bigger dna fragmentation and carries its scope from 100 to 100,000 base-pairs.IMSs can incorporate or be present in DNA plasmid, viral vectors and genomic DNA into.Most preferably, the magnitude range of IMSs can also be from 6 (no flanking sequences) to 10,000 base-pairs or bigger.Can make up the sequence that is positioned at this hexamer core flank, make it match flanking sequence in present any known inhibitive ability of immunity sequence (IIS) basically.For example, flanking sequence TTGACTGTG-Pu-Pyr-X-Y-Pyr-Pyr-AGAGATGA, wherein TTGACTGTG and AGAGATGA are flanking sequence.Another preferred flanking sequence is incorporated a series of pyrimidine (C, T and U) into, or as repeating twice or single more frequently pyrimidine, or as the mixture of two long or longer different pyrimidines.Used different flanking sequence test inhibitions to regulate sequence.Further example as the flanking sequence of inhibition oligonucleotides is included in the following list of references: United States Patent (USP) the 6th, 225, No. 292 and the 6th, 339, No. 068, and Zeuner et al., Arthritis andRheumatism, 46:2219-24, (2002).

Specific IISs of the present invention has comprised the oligonucleotides that comprises following hexamer sequence:

1.5 '-purine-pyrimidine-[X]-[Y]-pyrimidine-pyrimidine-3 ' IMSs comprises CG dinucleotides core: GTGGTT, ATGGTT, and GCGGTT, ACGGTT, GTGGCT, ATGGCT, GCGGCT, ACGGCT, GTGGTC, ATGGTC, GCGGTC, ACGGTC, or the like.

2.5 '-purine-pyrimidine-[X]-[Y]-pyrimidine-pyrimidine-3 ' IMSs comprises CG dinucleotides core: GTGCTT, ATGCTT, and GCGCTT, ACGCTT, GTGCCT, ATGCCT, GCGCCT, ACGCCT, GTGCTC, ATGCTC, GCGCTC, ACGCTC, or the like.

Guanine and inosine substituted adenines, and/or uridine replaces cytimidine or thymidine, and can realize these replacements based on the elaboration of above-mentioned guidance.

In some embodiments of the present invention, 5 ' or 3 ' the terminal flank in described IMS core hexamer zone connects poly G zone, and perhaps 5 ' all is connected poly G zone with 3 ' terminal flank." poly G zone " used herein or " poly G motif " refer to by at least two (2) the individual nucleic acid region of forming in abutting connection with guanine base, and it is made up of in abutting connection with guanine 2-30 or 2-20 usually.In some embodiments, described poly G zone has 2-10,4-10 or 4-8 in abutting connection with guanine base.In some preferred implementation, described flank poly G zone is adjacent to this core hexamer.Be connected with this core hexamer by non-poly G zone (non-poly G connexon) but in other embodiments, described poly G is regional; Usually, described non-poly G connexon zone has and is no more than 6, more typically is no more than 4 and the most typically be no more than 2 nucleotide.

In other embodiments of the present invention, the method for treatment autoimmune disease comprises and gives improved immunological regulation sequence that described immunological regulation sequence comprises:

1.) hexamer sequence 5 '-purine-pyrimidine [1]-[X]-[Y]-pyrimidine [2]-pyrimidine [3]-3 '; Wherein X and Y are any natural existence or synthetic nucleotide, except

A.X and Y can not be cytimidine-guanines;

B. when pyrimidine [2] when being thymidine, X and Y can not be cytimidine-cytimidines;

C. when pyrimidine [1] when being cytimidine, X and Y can not be cytimidine-thymidines

2.) described hexamer sequence 5 ' the CC dinucleotides, 5 of 1-5 the nucleotide that wherein said CC dinucleotides is described hexamer sequence '; With

3.) the poly G zone 3 of described hexamer sequence ', wherein poly G comprises at least 3 in abutting connection with G, and be described hexamer sequence 2-5 nucleotide 3 ', wherein said immunological regulation sequence does not comprise cytimidine-guanine sequence.

In in addition other embodiments of the present invention, the method for treatment autoimmune disease comprises and gives improved immunological regulation sequence that described immunological regulation sequence comprises:

1.) hexamer sequence 5 '-purine-pyrimidine-[Y]-[Z]-pyrimidine-pyrimidine-3 '; Wherein X and Y are guanine-guanines;

2.) described hexamer sequence 5 ' the CC dinucleotides, wherein the CC dinucleotides be the hexamer sequence 1-5 nucleotide 5 '; With

3.) the poly G zone 3 of described hexamer sequence ', wherein poly G comprises at least 2-10 in abutting connection with G, and be described hexamer sequence 2-10 nucleotide 3 ',

Wherein said immunological regulation sequence does not comprise cytimidine-guanine sequence.

In preferred embodiment, the X of described hexamer sequence and Y are GpG.Other preferred embodiment in, described hexamer sequence is 5 '-GTGGTT-3 '.Other preferred embodiment in, the CC dinucleotides be described hexamer sequence 2 nucleotide 5 '.Other preferred embodiment in, described poly G zone comprises the guanine base of 3 adjacency, and be described hexamer sequence 2 nucleotide 3 '.One preferred embodiment in, improved immunological regulation sequence is 5 '-CCATGT GGTTATGGGT-3 '.

IMS also comprises the inhibition oligonucleotides that grows to few 8 nucleotide, wherein this oligonucleotides forms the G tetrad, the quadrantal circular dichroism of this G (CD) value is greater than about 2.9, and the quantity of guanosine was at least for 2 (international patent application no WO 2004/012669 integral body by reference incorporates this paper into).The difference that CD is defined as left hand and right hand circularly polarized light absorbs.The G tetrad is the dna fragmentation of G enrichment, can form complicated secondary and/or tertiary structure.More specifically, 1) the G tetrad comprises four guanosines that the plane connects, and it is arranged by the ring-type hydrogen bond, and it comprises non-Watson Crick base pairing, with 2) the G tetrad needs two the more guanosine or the hexamer zones of adjacency, and wherein surpassing 50% described base is guanosine.Example comprises having at least 1 and the oligonucleotides of 2-20 TTAGGG motif preferably.Other useful inhibition oligonucleotides include but not limited to meet one of following useful inhibition oligonucleotides: (TGGGCGGT) _X, wherein x is preferably 2-100, and more preferably is 2-20; GGGTGGGTGGGTATTACCATTA; TTAGGGTTAGGGTCAACCTTCA; Or (G) GG (C/G) AAGCTGGACCTTGGGGG (G).

Oligonucleotides can obtain from existing nucleic acid source, comprises genomic DNA, plasmid DNA, viral DNA and cDNA, but preferably by the synthetic synthetic oligonucleotide that produces of oligonucleotides.IMS can be the part of strand or double-stranded DNA, RNA and/or few nucleosides.

IMS preferably comprises the oligonucleotides of non-methylated GpG oligonucleotides.Selectable embodiment comprises that wherein one or more adenines or cytimidine residue are by methylated IMS.In eukaryotic, cytimidine and adenine residue can be methylated usually.

Few nucleosides can be merged in the interior zone and/or 5 of IMS ' and/or 3 ' end, and the few nucleosides of this class can be used as the tie point of other self molecule, described self molecule comprises self fat, oneself protein, self peptide, self polypeptide, self glycolipid, self sugar, the oneself protein of self glycoprotein and posttranslational modification, self peptide, self polypeptide or self glycoprotein are perhaps as the tie point of other immune modulating treatment agent.Can modify end, phosphate, base and sugar moieties have other performance with structure IMSs.

IMS can be stable and/or unsettled oligonucleotides.Stable oligonucleotides refers to degradation-resistant relatively in vivo oligonucleotides, and this degraded is undertaken by exonuclease, endonuclease and other degradation pathway.Preferred stable oligonucleotides has the phosphate backbone of modification, and highly preferred oligonucleotides has the phosphate backbone that thiophosphate is modified, and wherein at least a described phosphoric acid oxygen is substituted by sulphur.The skeleton phosphate group is modified and is comprised key between methyl-phosphonate, thiophosphate, phosphoramidate and phosphorodithioate nucleotide, and it can provide antibacterial properties to IMS.The oligonucleotides that IMS is preferably stable preferably uses the stable oligonucleotides of thiophosphate.

Selectable stable oligonucleotides comprises: alkyl phosphotriester and di-phosphate ester, and wherein charged oxygen is by alkanisation; Aryl phosphine acid esters and phosphonate ester, they are nonionic DNA analogs, wherein charged phosphonic acids oxygen is substituted by aryl or alkyl; Or/and at one end or two ends contain the oligonucleotides of six polyethylene glycol or four polyethylene glycol or another glycol.Can use selectable steric configuration that sugar moieties is invested on the nucleoside base of IMS.

The nucleotide base that is positioned at the IMS of competitive dinucleotides flank can be known naturally occurring base or synthetic non-natural base.Use routine techniques few nucleosides can be incorporated into interior zone and/or the terminal tie point of IMS-ON as other compounds, described compound comprises self fat, oneself protein, self peptide, self polypeptide, self glycolipid, self sugar, the oneself protein of self glycoprotein and posttranslational modification, self peptide, self polypeptide or self glycoprotein are perhaps as the tie point of other immune modulating treatment agent.Can also adopt the known any-mode of those of ordinary skills to modify base, sugar moieties, phosphate and the end of IMS-ON, the IMS-ON that has the required character except that IMS-ON regulates activity with structure.For example, sugar moieties can adopt any steric configuration to be connected in the nucleotide base of IMS-ON.

The technology of oligonucleotides being carried out these phosphate groups modifications is known in this field, and does not need detailed explanation.For looking back so useful technology, preparation is as the phosphotriester intermediate of target nucleotide product, and uses moisture iodine or such as other reagent of anhydrous amine it is oxidized to naturally occurring phosphotriester.The oligonucleotides phosphoramidate that produces can use sulphuring treatment to produce thiophosphate.Can use same routine techniques (outside the sulphur removal treatment step) to produce the methyl phosphoramidite from methyl-phosphonate.United States Patent (USP) the 4th, 425, No. 732, the 4th, 458, No. 066, the 5th, 218, No. 103 and the 5th, 453, No. 496, and Tetrahedron Lett, at 21:414925 (1995), 7:5575 (1986) and 25:1437 (1984) and Journal Am.ChemSoc., 93:6657 (1987) has further described the details about the phosphate group modification technique, those of ordinary skills may wish reference, incorporate these disclosure into this paper, to reach the purpose of explanation this area about the know-how of the composition of IMS and preparation.

It is thiophosphate or the phosphordithiic acid ester-formin that is converted into this IMS-ON oligonucleotides that useful especially phosphate group is modified.Thiophosphate and phosphorodithioate more can be resisted degraded in vivo than its not modified oligonucleotides homologue, and this makes described host more can obtain IMS-ON of the present invention.

Can use technology well known in the art and nucleic acid synthesis device to synthesize IMS-ON.The document of this respect can referring to, for example, Ausubel, et al, Current Protocols in Molecular Biology, Chs.2 and 4 (the current experimental implementation of molecular biology, the 2nd Zhanghe 4 chapters) (Wiley Interscience, (1989)); Maniatis, et al., Molecular Cloning:A Laboratory Manual (molecular cloning: laboratory manual) (Cold Spring Harbor Lab., New York, (1982)); United States Patent (USP) the 4th, 458, No. 066; With United States Patent (USP) the 4th, 650, No. 675.In order to prove the know-how of this area, incorporate these documents into this paper by reference about the preparation synthetic oligonucleotide.

Selectively, the microorganism immunostimulating sequence (ISS) by sudden change is separated to replaces naturally occurring CpG motif and flanking nucleotide with competitive dinucleotides, can obtain IMS-ON.The screening step that relies on nucleic acid hybridization has realized separating any polynucleotide sequence from any organism, and prerequisite is to obtain described suitable probe or antibody.Can the chemical synthetic oligonucleotide probe, the part of the sequence of the corresponding encoding said proteins of this oligonucleotide probe.This needs the oligopeptides segment of known amino acid sequence.Can also still must consider the degeneracy of described codon from the dna sequence dna of this albumen of genetic code derivation coding.

For example, can screen the cDNA library, described cDNA library it is believed that and comprises the polynucleotides that contain ISS, described screening is passed through to the various mRNAs of egg mother cell infusion source from cDNA, reserve the enough time, make described cDNA gene outcome begin to express, and finish by the existence of testing required cDNA expression product, described test case as, be specific to the antibody of the peptide of the polynucleotide encoding of paying close attention to by use, perhaps by using at by the repetition motif of the peptide of concern polynucleotide encoding and the probe of tissue expression type feature.Selectively, use the antibody that is specific to this peptide can screen the cDNA library indirectly, seek the expression of the peptide of being paid close attention to at least one epi-position.Described antibody can be that polyclone is originated or the monoclonal source, and can be used for detecting expression product, the existence of this expression product indication cDNA that pays close attention to.

In case obtain the polynucleotides of the described ISS of comprising, just can use routine techniques to cut it is foreshortened to required length by for example enzyme.With the sudden change of the CpG motif in the ISS-ODN oligonucleotide product, replace this CpG motif subsequently with " inhibition " dinucleotides (using the inventive method to identify).The technology that specific site in having the DNA of known array replaces sudden change is known, and for example the M13 primer by PCR suddenlys change.This IMS is non-coding, when therefore replacing sudden change, need not to be concerned about and keeps open reading frame.Yet, for using in vivo, should make this polynucleotides starting material, ISS-ODN oligonucleotides intermediate or IMS sudden change product is pure basically (that is, when using the known and available techniques selected of those of ordinary skills, not containing naturally occurring pollutant and LPS as far as possible).

Can use IMS of the present invention separately, perhaps with this IMS with cis or trans self carrier (plasmid, clay, virus or retrovirus) of reorganization of incorporating into, its any oneself protein that can carry by recombinant expression carrier of can encoding conversely, self polypeptide or self peptide.For simplicity, preferably, give not incorporate into the IMS of expression vector.Yet, incorporate expression vector if desired into, this incorporating into can use the known routine techniques of those of ordinary skills to realize.For the purpose of looking back, those of ordinary skill can be with reference to Ausubel, Current Protocols in MolecularBiology (the current experimental implementation of molecular biology), above.In some embodiments, IMS can give altogether with a kind of or bivalent cation that surpasses physiological level.

In simple terms, the structure of recombinant expression carrier uses the standard interconnection technique.In order analyzing, can to transform host T cell with connecting mixture, and select successful transformant by suitable antibiotic resistance to confirm correct sequence in the carrier construction.Preparation is from the carrier of transformant, with its method (Nucleic AcidsRes. by people such as for example Messing, 9:309 (1981)), the method of Maxam etc. (Methods in Enzymology, 65:499 (1980)) or other appropriate method well known by persons skilled in the art, carry out restriction analysis and/or order-checking.(Molecular Cloning (molecular cloning), pp.133-134 (1982) are cut the size separation of fragment to utilize the conventional gel electrophoresis that Maniatis etc. describes.

Can transform host T cell with expression vector of the present invention, and it is cultivated in the conventional nutrient medium that is modified to suitable evoked promoter, screening transformant or amplification gene.Condition of culture such as temperature, pH or the like are employed the same with the expression of selecting host T cell before, and this is conspicuous to those of ordinary skill.

If recombinant expression carrier is used as the carrier of IMS-ON of the present invention, plasmid and clay are particularly preferred, and be pathogenic because they do not have.But plasmid and clay are degraded sooner than virus in vivo, and the IMS-ON that therefore may not can carry sufficient dosage is with prevention or treatment inflammatory or autoimmune disease.

The technology of most of carrier construction and transfection and infection T cell is extensively implemented in this area, and most of practitioner is familiar with describing the standard resource material of specified conditions and step.

" plasmid " and " carrier " connects letter after with small letter p and/or numeral is named.Initial plasmid is a commercialized supply, and the public can unrestrictedly obtain, perhaps can be according to the existing plasmid construction of disclosed step utilization.In addition, the plasmid that is equal to the plasmid of those descriptions is known in the art, and is conspicuous to those of ordinary skill." carrier " or " plasmid " is meant genetic constitution, when it is present in host T cell, can duplicate by comprising suitable control and controlling element.Be purpose of the present invention, the example of carrier or plasmid includes, but not limited to plasmid, phage, and transposons, clay, virus, or the like.

The structure use standard of carrier of the present invention connects and restricted technology, this is well known in the art (referring to Ausubel et al., Current Protocols in Molecular Biology (the current experimental implementation of molecular biology), (1987), Wiley-Interscience or Maniatis et al., Molecular Cloning:Alaboratory Manual (molecular cloning: laboratory manual) (Cold Spring Harbor Laboratory, N.Y.), (1992)).The plasmid, dna sequence dna or the synthetic oligonucleotides that separate are cut, customize and degrade (relegate) with desired form.Confirm that by dna sequence analysis (Sanger et al., Proc.Natl.Acad.Sci, 74:5463-5467 (1977)) all incorporate the sequence of the DNA construct of synthetic DNA into.

" digestion " of DNA is meant the catalyze cleavage of Restriction Enzyme to DNA, and described Restriction Enzyme only acts on some sequence of DNA, i.e. restriction site.Various Restriction Enzyme used herein is a commercialized supply, and their reaction condition, co-factor and other requirements are that those of ordinary skill is known.For analysis purpose, 1 μ g plasmid or dna fragmentation use the about 2 unit enzymes that are dissolved in about 20 μ l buffer solutions usually.Selectively, use excessive Restriction Enzyme to guarantee the catapepsis of DNA substrate.At about 37 ℃ of about incubation times of 1 hour to 2 hours is feasible, also is acceptable but change.After hatching, remove albumen by phenol/chloroform extraction, that can continue uses extracted with diethyl ether at every turn, by precipitation with alcohol from the partially recycled nucleic acid of water-based.If desired, can utilize standard technique to carry out the size separation of cutting fragment by polyacrylamide gel electrophoresis or agarose gel electrophoresis.At MethodsofEnzymology (Enzymology method), can find the general introduction of size separation among the 65:499-560 (1980).

Under the condition that 4 kinds of triphosphate deoxy-nucleotides (dNTPs) exist, at 50mM Tris (ph7.6), 50mM NaCl, 6mM MgCl ₂, among 6mM DTT and the 5-10 μ M dNTP 20 ℃ hatched about 15-25 minute, utilize the big fragment (Klenow) of Escherichia coli (E.coli) dna polymerase i to handle restricted cutting fragment is become flat terminal.Even there are 4 kinds of dNTP, the Klenow fragment is still filled 5 ' cohesive end, but 3 outstanding ' strand of digestion.If desired,, perhaps provide the dNTP that selects, can carry out the selectivity reparation, but this is subjected to the restriction of cohesive end characteristic by a kind of of dNTP only is provided.After Klenow handled, described mixture extracted with phenol/chloroform, and uses precipitation with alcohol.Appropraite condition is handled the hydrolysis that causes the strand part with S1 nuclease or Bal-31 down.

In the 15-50 μ of following standard conditions and temperature l volume, be connected: 20mM Tris-Cl pH7.5,10mM MgCl ₂10mM DTT, 33mg/ml BSA, 10mM-50mM NaCl, and 40um ATP, 0.01-0.02 (Weiss) T4DNA of unit ligase, under 0 ℃ (for " cohesive end " connects), perhaps 1mM ATP, 0.3-0.6 (Weiss) T4DNA of unit ligase is under 14 ℃ (for " flat terminal " connects).Usually carrying out intermolecular " cohesive end " in the total DNA concentration of 33-100 μ g/ml (the total terminal concentration of 5-100mM) connects.Carry out intermolecular flat terminal the connection (using the doubly excessive connexon of mole of 10-30 usually) in the total terminal concentration of 1 μ M.

Express self box and will use the promotor that in host T cell, works.Usually, for the carrier that specific host T cell uses, promotor that it comprises and regulating and controlling sequence are derived from the species with host T cytocompatibility.The promotor that is applicable to prokaryotic hosts for example comprises beta-lactamase and lactose promoter systems, and alkaline phosphatase, tryptophan (trp) promoter systems and hybrid promoters are such as the tac promotor.But other functional bacterium promotors also are suitable.Except that prokaryotes, can also use eukaryotic microorganisms such as yeast culture.Saccharomyces cerevisiae (Saccharomyces cerevisiae) or common Saccharomyces cerevisiae are to use the most general eukaryotic microorganisms, although a large amount of other bacterial strains also are provided usually.The promotor that the control carrier is transcribed in mammalian hosts T cell can obtain from various sources, for example, the genome of virus such as polyomavirus, simian virus 40 (SV40), adenovirus, retrovirus, hepatitis type B virus and preferred cytomegalovirus, perhaps from the allos mammalian promoter, for example, the beta-actin promotor.Early stage and the late promoter of SV40 virus can obtain as the SV40 restriction fragment easily, and described SV40 restriction fragment also comprises SV40 virus replication initial point.The instant early promoter of human cytomegalovirus can obtain as the HindIII restriction fragment easily.Certainly, also can use in this article from the promotor of host T cell or relevant species.

Carrier used herein can comprise the selection gene, and the selective key thing is otherwise known as.Select gene coded protein, this albumen is essential to the survival or the growth of described carrier host transformed T cell.The example that is used for the suitable selective key thing of mammalian cell comprises dihydrofolate reductase gene (DHFR), ornithine decarboxylase gene, MDRG (mdr), adenosine deaminase gene and glutamine synthase gene.When this class selective key thing was successfully changed over to mammalian hosts T cell, if be placed under the selection pressure, the mammalian hosts T cell that is transformed can be survived.There are two kinds of widely used dissimilar selection modes.First type of T cell-line that is based on cellular metabolism and uses sudden change, described mutation T cell-line lacks the ability that is independent of the supplementing culture medium growth.Second type is known as the dominance selection, is meant the selection scheme of using in any cell type, does not need to use the T cell-line of sudden change.These schemes use medicine to suppress the growth of host T cell usually.Those cells with new gene have drug-fast albumen with expression, and will survive in selection.The example that this class dominance is selected uses medicine neomycin (Southern and Berg, J.Molec.Appl.Genet., 1:327 (1982)), mycophenolic acid (Mulligan and Berg, Science, 209:1422 (1980)) or hygromycin (Sugden et al., Mol Cell.Bio., 5:410-413 (1985)).3 examples that above provide use the bacterial gene that is subjected to eucaryon control to transmit the resistance at suitable medicine neomycin (G418 or gentamicin), xgpt (mycophenolic acid) or hygromycin respectively.

Selectively utilize based on the antibiotic-free of mortifier titration and select, carrier used herein is bred (Cranenburgh et al., 2001) in host T cell.For comprising the lac operon, or it is as the part of lac promotor with described carrier modification, or have take the most just now every lacO1 and lacO3 operator, described the most just now every being in the pUC of plasmid vector series, to find.Selectively, the palindrome form of lacO1 operator or lacO can be used for separating as single or a plurality of copies (Cranenburgh et al., 2004).The lac operon sequence can be incorporated into single or a plurality of sites of optional position in the described carrier, so that do not disturb other function ingredients of described carrier.In preferred embodiment, use synthetic Escherichia coli lac operon dimer operator (Genbank accession number K02913).The lac operon can be added to do not contain suitable selective key thing carrier so that selectivity to be provided, can outside another selective key thing, be added again, perhaps be used to replace the selective key thing, especially the antibiotic resistance mark is more suitable for treating application carrier with preparation.Utilize key gene in the Escherichia coli of genetic modification, to select to comprise the carrier of lac operon, described key gene comprises dapD, it is subjected to lac promotor (lacOP) control, therefore can express the host T cell survival that makes modification by lac inhibition and the permission dapD of titration lacOP.Suitable coli strain comprises DH1lacdapD and DH1lacP2dapD (Cranenburgh et al., 2001).

The specially suitable a kind of nucleic acid carrier that can be used for methods described herein is a nucleic acid expression vector, wherein with non-CpG dinucleotides replace formula 5 '-purine-pyrimidine-C-G-pyrimidine-pyrimidine-3 ' or 5 '-purine-purine-C-G-pyrimidine-pyrimidine-3 ' shown in one or more CpG dinucleotides, thereby produce the carrier that immunostimulatory activity reduces.For example, the cytimidine of CpG dinucleotides can replace with guanine, thus produce have formula 5 '-purine-pyrimidine-G-G-pyrimidine-pyrimidine-3 ' or 5 '-purine-purine-G-G-pyrimidine-pyrimidine-3 ' shown in the IMS district of GpG motif.Can also replace described cytimidine with any other non-cytidylic acid.Replacement for example can utilize direct mutagenesis to realize.Normally those are not positioned at the CpGs of carrier important regulating and controlling district (for example, promoter region) to substituted CpG motif.In addition, when described CpG was positioned at the coding region of expression vector, non-cytimidine replaced usually through selecting with the generation silent mutation or corresponding to the conservative codon that replaces of coded amino acid.

For example, in some embodiments, the carrier that is used to make up self carrier is modified pVAX1 carrier (SEQ ID NO:1), wherein by cytimidine with non-cytidylic acid replacement CpG dinucleotides, come sudden change formula 5 '-purine-pyrimidine-C-G-pyrimidine-pyrimidine-3 ' shown in one or more CpG dinucleotides.The pVAX1 carrier is known in the art, by Invitrogen (Carlsbad, CA) commercialized supply.In an exemplary embodiment, modified pVAX1 carrier has the replacement of following cytimidine to non-cytimidine in the CpG motif: nucleotide 784,1161,1218 and 1966 cytimidine become guanine; Nucleotide 1264,1337,1829,1874,1940 and 1997 cytimidine become adenine; And the cytimidine of nucleotide 1963 and 1987 becomes thymidine; Also have the sudden change of other cytimidines of nucleotide 1831,1876,1942 and 1999 to guanine.(the pVAX1 numbering system that the name of above-described nucleotide numeral provides according to Invitrogen.) remaining 4 prototype CpG elements are positioned at the important regulating and controlling district of this carrier among the pVAX1, therefore do not modified.With the carrier called after BHT-1 (SEQ ID NO:2) that so makes up.WO 2004/047734 has described preparation and the use of BHT-1.

In some embodiments, the invention provides self carrier that comprises BHT-1 expression vector skeleton and polynucleotides, the oneself protein that described polynucleotide encoding is relevant with multiple sclerosis, self polynucleotides or self peptide.In some embodiments, the polynucleotide encoding people proteolipin albumen (PLP) of described self carrier.In other embodiments, the glycoprotein (MAG) of the polynucleotide encoding people myelin combination of described self carrier.In other other embodiments, the polynucleotide encoding people myelin oligodendrocyte albumen (MOG) of described self carrier.In preferred embodiment, the polynucleotide encoding people myelin basic protein (MBP) of described self carrier.In the most preferred embodiment of the present invention, described self carrier is BHT-3009 (SEQ ID NO:3), and wherein BHT-3009 comprises the polynucleotides of BHT-1 expression vector skeleton and coding people myelin basic protein.

Whether " transfection " expression is introduced host T cell so that described DNA is expressed with DNA, no matter be functional expression; Described DNA can also duplicate as extra-chromosomal element or by chromosomal integration.Unless otherwise prescribed, the method for the conversion host T cell that uses among this paper embodiment is the coprecipitation of calcium phosphate method of Graham and van der Eb (Virology, 52:456-457 (1973)).Can utilize known in the art being suitable for that any means of the outer nucleic acid introducing of born of the same parents host T cell is carried out transfection, described method includes but not limited to, use transfection promoter or step, described step is coprecipitation of calcium phosphate for example, (metal cation produces the deposited particles of phosphate or hydroxide to the precipitation that zinc or other associated metal cations are induced, DNA has strong affinity to this particle, cause DNA: zinc or other metals of concentration that the inferior milli of metal phosphate co-precipitation-needs rubs (submillimolar) or milli rubs) (referring to Kejnovsky and Kypr, Nucleic Acids Research, 26:5295-99 (1998)), hyperconcetration solution precipitates with inducing DNA, DNA is combined with gold or other particles, the virus transduction, protoplast merges, the transfection of DEAE-glucan or the mediation of its analog, the transfection of polybrene (polybrene) mediation, liposome merges, microinjection, microparticle bombardment (particle gun (biolistics)) or electroporation (Kriegler, Gene Transfer and Expression:A Laboratory Manual (gene transfer and expression: laboratory manual), Stockton Press (1990)).

In preferred embodiment, interested nucleic acid and total concentration are prepared greater than one or more bivalent cations of physiological level, be used to inject animal so that by the host T cellular uptake of this animal.In some embodiments, can use one or more physiologically acceptable bivalent cations, for example, Ca ²⁺, Mg ²⁺, Mn2 ⁺, Zn ²⁺, Al ²⁺, Cu ²⁺, Ni ²⁺, Ba ²⁺, Sr ²⁺, perhaps other bivalent cations, and composition thereof.In some embodiments, described bivalent cation is independent calcium.In some embodiments, magnesium, calcium or its mixture can be present in the extracellular with about 1.5mM and 1mM respectively.In preferred embodiment, be that about 0.9mM (1 *)-approximately the nucleic acid of transfection is treated in the calcium preparation of 2M with concentration; In preferred embodiment, calcium concentration is the about 8.1mM of about 2mM-(9 *); In most preferred embodiments, calcium concentration is the about 5.4mM of about 2mM-(6 *).The mixture of two or more bivalent cations can be used in combination, and its total concentration is about 0.9mM, 2mM, 4mM, 5mM, 6mM, 7mM, 8mM, 9mM, 10mM, 12mM, 15mM, 20mM, 45mM, 65mM, 90mM, 130mM, 170mM, 220mM, 280mM, 320mM, 350mM, 500mM, 750mM, 1000mM, 1500mM, or the like, and reach about 2M.

Some preferred embodiment in, counterion can comprise PO4, Cl, OH, CO2 or its mixture.In other embodiments, described preparation can cause DNA to form particulate or sediment, and it is about 0.1,0.3,0.5,1,3,5,8,15 that mean size that its particle diameter distributes or 80% particle surpass, 20,35,50,70 or 100 microns.Can be by centrifugal, flow cytometry, propidium iodide or similar dye marker, perhaps dynamic light scattering is assessed the size of these particulates.

Working concentration is suitable for using with any DNA vaccine inoculation carrier framework greater than the bivalent cation of physiological level.For method of the present invention, find that also concentration can use with any inhibitive ability of immunity carrier framework greater than the bivalent cation of physiological level.Exemplary inhibitive ability of immunity carrier framework comprises that those (i) compare with the parental generation carrier framework, (for example has immunostimulating sequence (ISS) that quantity reduces, " CpG " sequence that quantity reduces), (ii) comprise one or more inhibitive ability of immunity sequences (IIS) and (iii) have ISS and the one or more IIS that quantity reduces.Exemplary inhibitive ability of immunity carrier framework comprises the BHT-1 carrier framework.

Method for transformation is known in the art, is similar to following reported method: Bishop (referring to Bio.com), Jordan et al. (1996) Nucleic Acids Research 15:24 (4): 596-601; United States Patent (USP) 5593875; Chen and Okayama (1987) Mol.Cell Biol.7 (8): 2745-2752; And Welzel, et al. (2004) ＂ Transfection of cells with custom-made calcium phosphatenanoparticles coated with DNA ＂ (bag of using customization is by the calcium phosphate nanoparticles transfectional cell of DNA) J.Mater.Chem.14:2213-2217.Can also use other components, for example, histone, various salt, liposome, charged entity be such as poly-D-lysine, spermine, and spermidine, or the like.Referring to, for example, Simonson, et al. (2005) ＂ Bioplex technology:novel synthetic gene deliverypharmaceutical based on peptides anchored to nucleic acids ＂ (the bioplex technology: the new synthetic gene based on the peptide that anchors to nucleic acid is carried medicine) Curr.Pharm.Des.11 (28): 3671-680; Roche, et al. (2003) ＂ Glycofection:facilitated gene transfer bycationic glycopolyme rs ＂ (Glycofection :) CellMol.Life Sci.60 (2): 288-297 by the gene transfer of cation sugar-containing polymer promotion; Pichon, et al. (2001) ＂ Histidine-richpeptides and polymers for nucleic acids delivery ＂ (being used for histidine enrichment peptide and polymer that nucleic acid is carried) Adv.Drug Deliv.Rev.53 (1): 75-94; Mahat, et al. (1999) ＂ Peptide-based gene delivery ＂ (gene based on peptide is carried) Curr.Opin.Mol.Ther. (2): 226-243; And Lee and Kim (2005) ＂ Polyethylene glycol-conjugatedcopolymers for plasmid DNA delivery ＂ (being used for the polyethylene glycol conjugation copolymer that plasmid DNA is carried) Pharm.Res.22 (1): 1-10.Also can be referring to, Pack, et al. (2005) ＂ Design andDevelopment of Polymersfor Gene Delivery ＂ (being used for the design and the development of the polymer that gene carries) NatureDrug Discovery 4:581-493.

The combination of specific bivalent cation, specific anion or counterion, different bivalent cation mixtures and the effect of Combination of bivalent cation and counterion can be measured at least 3 varying levels: (i) transfection level, (ii) expression (promptly, transcribe or translate) and (iii) immune response or immunosupress level.In the transfection level, can utilize any means known in the art (for example, utilizing quantitative PCR analysis) to measure transfection efficiency external or that body is interior.On expression, can utilize any means known in the art to transcribe or translate at external or in-vivo measurement.For example, in ELISA or western blot analysis, can use antibody test (for example from target cell in cultured cell or the body, the myocyte, dendritic cell, keratinocyte, fibroblast, epithelial cell, and the cell of other target cell types or target organ) autoantigen or the translation of oneself protein.In the immune response level, can utilize any means known in the art in immunoreactive raising, inhibition or prevention external or that in-vivo measurement is caused by this class transfection or injection.For example, can measure the propagation of activated lymphocyte, the lymphocytic existence of autoreaction, the generation of autoantibody, perhaps lymphocyte or the cell factor that is exposed to other immunocytes (for example thick liquid cell sample dendritic cell) of transfection target cell generate.With after one or more bivalent cation transfection of excusing from death reason concentration or injecting self carrier, can also measure (for example, inflammation, the tissue damage of autoimmune disease symptom in the animal model, the lymphocytic existence of auto-antibody or autoreaction), perhaps its improvement.This paper has described the animal model that is used for multiple autoimmune disease.

Self carrier of the present invention can be formulated as polynucleotides salt as medicine.Can prepare polynucleotides salt with nontoxic inorganic or organic base.Inorganic base salts comprises sodium, potassium, and zinc, calcium, aluminium, magnesium, or the like.Nontoxic organic base comprises primary amine, secondary amine and tertiary ammonium salt, or the like.This class self DNA polynucleotides salt can be mixed with lyophilized form so that become original state before carrying, such as with sterile water or salting liquid.Selectively, self DNA polynucleotides salt can be mixed with solution, the suspension that is used to carry, perhaps comprise emulsion based on the media of water or oil.One preferred embodiment in, with DNA freeze-drying in phosphate buffer, before giving, make it become original state then with sterile water with the calcium of physiological level (0.9mM) or another kind of bivalent cation.In some embodiments, with the solution preparation DNA that contains one or more bivalent cations that are higher than physiological amount, according to description above, with for example one or more bivalent cations of total concentration 1 μ M-2M.In some embodiments, with containing the Ca that is higher than physiological amount ⁺⁺The solution preparation DNA of (for example, 1 μ M-2M).Under the situation that does not have the specific ion material, also can prepare DNA.

Those of ordinary skills are clear, have the method for multiple individual delivery of polynucleotide to this paper definition." individuality " means any animal, such as, for example, people, non-human primate, horse, milk cow, dog, cat, mouse, rat, cavy or rabbit.Can be with the polynucleotides of the cationic polymer preparation coding oneself protein that comprises cationic-liposome, self polypeptide or self peptide.The effective means that other liposomes are also represented preparation and carried self polynucleotides.Selectively, this self DNA can incorporate into and be used for viral vectors, virion or the bacterium that pharmacology is carried.Viral vectors can be to have (having the sudden change that reduces the disease inducibility) or replication defect type infection activity, attenuation.Particle is also represented the effective ways of carrying DNA, and DNA can joining gold or other particle, is injected into individuality then or carries by particle gun.Use self DNA preventing pathogenic oneself protein precipitation, to gather or active method can strengthen by using viral vectors or other induction systems, described induction system strengthens the humoral response to the oneself protein of coding.In other embodiments, this DNA can be coupled to solid support, and described solid support comprises gold grain, based on the holder of polysaccharide, other particles or the pearl that perhaps can inject, suck or carry by particle bombardment (particle gun conveying).

It is known in the art being used to carry the method for nucleic acid preparation.Referring to, for example, United States Patent (USP) the 5th, 399, No. 346, the 5th, 580, No. 859 and the 5th, 589, No. 466.Developed a large amount of systems, be used to be transferred to mammalian cell based on virus.For example, retrovirus system (United States Patent (USP) the 5th, 219, No. 740 have been described; Miller et al, Biotechniques 7:980-990, (1989); Miller, Human Gene Therapy 1:5-14, (1990); Scarpa et al, Virology 180:849-852, (1991); Burns et al, Proc.Natl.Acad.Sci.USA90:8033-8037,1993; With Boris-Lawrie and Temin, Cur.Opin.Genet.Develop.3:102-109,1993).Also described a large amount of adenovirus vectors (referring to, for example, Haj-Ahmad et al., J.Virol.57:267-274, (1986); Bett et al, J.Virol.67:5911-5921,1993; Mittereder et al, HumanGene Therapy 5:717-729, (1994); Seth et al, J.Virol.68:933-940, (1994); Barr et al, Gene Therapy 1:51-58, (1994); Berkner, Bio Techniques 6:616-629, (1988); And, Rich etal, Human Gene Therapy 4:461-476,1993).Also developed and be used for adeno-associated virus (AAV) carrier system that nucleic acid is carried.Use techniques well known can easily make up the AAV carrier (referring to, for example, United States Patent (USP) the 5th, 173, No. 414 and the 5th, 139, No. 941; International publication number WO 92/01070 and WO 93/03769; Lebkowski et al, Molec.Cell.Biol.8:3988-3996, (1988); Vincent et al, Vaccines, 90 (Cold SpringHarbor Laboratory Press) (1990); Carter, B.J., Current Opinion inBiotechnology 3:533-539, (1992); Muzyczka, N., Current Topics in Microbiol.And Immunol.158:97-129, (1992); Kotin, R.M., Human Gene Therapy5:793-801, (1994); Shelling et al, Gene Therapy 1:165-169, (1994); And Zhouetal., J.Exp.Med.179:1867-1875, (1994)).

Carry polynucleotides of the present invention also can need not viral vectors.For example, can before carrying, individuality pack this molecule with liposome.Usually the liposome of use combination stably or embedding and stranded nucleic acid is finished the lipid encapsulation.Be to understand the application that liposome is carried nucleic acid as carrier, can referring to, for example, Hug et al, Biochim.Biophys.Acta.1097:1-17, (1991); Straubinger et al, Methods of Enzymology, 101:512-527, (1983).Also can be referring to, Pack, et al. (2005) ＂ Design and Development of Polymers for Gene Delivery ＂ (being used for the design and the development of the polymer that gene carries) Nature Drug Discovery 4:581-493.

The giving separately or giving of " treatment (treating) " of disease or illness, " treatment (treatment) " or " therapy (therapy) " expression polynucleotides by coding oneself protein, self polypeptide or self peptide with uniting of another kind of compound described herein, slow down, stop or reverse the progress of this disease, this termination or elimination by clinical or diagnostic symptom proves.In preferred embodiment, the treatment disease represents to reverse or stop the progress of this disease, reaches the degree of eliminating this disease itself ideally.The disease of improving used herein is equal to the treatment disease.

Within the scope of the present invention, " prevention (preventing) " of disease or illness, " prevention (prophylaxis) " or " prevention (prevention) " are meant the giving separately or giving with uniting of another kind of compound described herein of polynucleotides of coding oneself protein, self polypeptide or self peptide, thereby the existence of prevent disease or illness or generation, perhaps some of prevent disease or illness or symptomatology perhaps reduce the possibility that disease or illness take place.

According to instruction of the present invention, give self carrier of " treatment effective dose ", this is enough to treat or prevent disease is for example improved or eliminated this sick symptom and/or cause of disease, and described self carrier comprises the polynucleotides of one or more oneself proteins of coding, self polypeptide or self peptide.For example, the treatment effective dose belongs to the scope of broad, can determine by clinical testing,, can determine the treatment effective dose according to the known factor that comprises severity of disease, weight in patients, age and other factors of experienced common clinician for particular patient.Self carrier of treatment effective dose is the scope of about 0.001 μ g to about 1g.Self carrier of preferred therapeutic dose is the scopes of about 10 μ g to about 5mg.Self carrier of highly preferred therapeutic dose is the scope of about 0.025mg to 5mg.Every month delivery of polynucleotide therapy continues 6-12 month, and every subsequently 3-12 month delivery of polynucleotide therapy is as maintenance dose.Can develop selectable therapeutic scheme, and the scope of described selectable therapeutic scheme can from every day to weekly, to every January, to annual, to single administration, this depends on severity of disease, patient age, the oneself protein that is given, self polypeptide or self peptide, and these type of other factors that will consider of common treatment doctor.

In one embodiment, carry this polynucleotides by intramuscular injection.In another embodiment, the conveying of described polynucleotides by in the nose, oral, subcutaneous, intracutaneous, intravenous, mucous membrane carry out, push these polynucleotides and pass skin, perhaps it is attached to goldc grains be transported to or pass corium (referring to, for example WO 97/46253).Selectively, topical application that can be by using or do not use liposome or charged lipids with nucleic acid be delivered into Skin Cell (referring to, for example, United States Patent (USP) the 6th, 087, No. 341).The another kind of selection is that this nucleic acid is carried as inhalant.

Can in the phosphate buffer that contains physiological level calcium (0.9mM), prepare polynucleotides, described polynucleotides be do not contain endotoxic.Selectively, can be with the solution preparation polynucleotides that contain one or more bivalent cations, perhaps described polynucleotides can give altogether with the solution that contains one or more bivalent cations, described bivalent cation such as, Ca ²⁺, Mg ²⁺, Mn ²⁺, Zn ²⁺, Al ²⁺, Cu ²⁺, Ni ²⁺, Ba ²⁺, Sr ²⁺, with and composition thereof, their concentration is higher than physiological concentration, for example, and as the description of this paper, 2mM-2M.When giving or giving continuously self carrier and one or more cations simultaneously altogether, can improve the efficient that one or more transfections, self-antigen are expressed, and strengthen result of treatment.When giving continuously, can at first give self carrier, perhaps one or more bivalent cations.

Selectively, or in addition, can use cationic polymer, form the compound of cationic-liposome or in the non-cationic liposome, prepare polynucleotides.The example that is used for the cationic-liposome of DNA conveying comprises use 1, the liposome that two (oleoyl oxygen)-3-(trimethyl ammonium) propane (DOTAP) of 2-and other this quasi-molecules produce.

Before carrying these polynucleotides, can the preliminary treatment delivery site, it maybe can strengthen other reagent of polynucleotide therapy conveying subsequently by using Bupivacaine (bupivicane), cardiotoxin.The conveying of this type of pretreating scheme was carried out before the delivering therapeutic polynucleotides usually in 12-96 hour; More common, before delivering therapeutic DNA, carried out in 24-48 hour.Selectively, before the DNA therapy, do not carry out preliminary treatment.In some embodiments, by giving one or more bivalent cation preliminary treatment delivery site greater than physiological concentration.

Self carrier can be united with other materials and given, such as, for example, pharmacological agents, adjuvant, cell factor, the perhaps carrier of the Codocyte factor.In addition, when utilizing cell factor to carry altogether,, can also use the activity form of chemo-immunity conditioning agent such as cholecalciferol in order to prevent to cause the possibility of harmful anti-self cell factor reaction.About this point, shown 1, the 25-dihydroxyvitamin D3 is by intramuscular dna immunization performance adjuvant effect.

Self carrier polynucleotides with a kind of albumen of coding can be given altogether, known described albumen (for example, cell factor) is regulated host's immune response.Therefore, can use coding immunomodulating cytokines (for example, interleukin, interferon or colony stimulating factor) gene, perhaps its function fragment according to the present invention.The gene order of a large amount of these cell factors is known.Therefore, in an embodiment of the invention, at least a coupling: the IL-4 that gives altogether in the conveying of self carrier and the polynucleotides of following immune modulator or encoding said proteins; IL-10; IL-13; TGF-β; Perhaps IFN-γ.

Can for example, use standard technique derived from known source through selecting to be used for nucleotide sequence of the present invention by from the cell that comprises required gene or nucleotide sequence, separating this nucleic acid.Similarly, use the synthetic mode standard of polynucleotides well known in the art to synthesize to produce described nucleotide sequence (referring to, for example, Edge et al., Nature 292:756, (1981); Nambair et al., Science223:1299, (1984); Jay et al., J.Biol.Chem.259:6311, (1984)).Usually, can be by people (Nucleic Acids Res.9:1691 such as people such as Edge (above) and Duckworth, (1981)) the phosphotriester method of Miao Shuing or by people such as Beaucage (Tet.Letts.22:1859, and the synthetic oligonucleotides of phosphoramidite method preparation described of people (J.Am.Chem.Soc.103:3185, (1981)) such as Matteucci (1981)).Also can use the synthetic oligonucleotides of commercially available oligonucleotides automatic synthesizer preparation.Thereby can use the suitable codon that is used for the specific amino acids sequence to design described nucleotide sequence.In general, can select to be used at the preferred codon of specifying the host to express.Assemble this complete sequence from the overlapping oligonucleotides of standard method preparation, and be assembled into complete coded sequence.Referring to, for example, Edge et al. (above); Nambair et al. (above) and Jay etal. (above).

The another kind of method of acquisition nucleotide sequence used herein is to pass through recombinant means.Thereby, can use criteria limit enzyme and step to downcut required nucleotide sequence from the plasmid that carries this nucleic acid.By using suitable restriction enzyme and step to handle, finish site specific DNA cutting.Under the condition of this area common sense, handle by using one or more suitable restriction enzymes, carry out locus specificity DNA cutting, the special feature of described condition is specified by commercially available restriction enzyme producer.If desired, use standard technique can carry out the size separation of the section of section by polyacrylamide gel or agarose gel electrophoresis.

Be used to separate the specific nucleic acid molecule one to make things convenient for method be by polymerase chain reaction (PCR) (PCR) (Mullis et al., Methods Enzymol.155:335-350, (1987)) or reverse transcription PCR (RT-PCR) again.Can separate specific nucleic acid sequence from RNA by RT-PCR.By technology well known by persons skilled in the art isolation of RNA from for example cell, tissue or whole organism.Use poly dT subsequently or hexamer primer, deoxynucleotide and suitable reverse transcriptase produce complementary DNA (cDNA) at random.Subsequently by PCR can be from the cDNA that produces the required polynucleotides of amplification.Selectively, the polynucleotides that can directly increase and be paid close attention to from suitable cDNA library.The primer that hybridize at 5 ' and 3 ' the two ends synthetic and polynucleotide sequence of paying close attention to also is used for described PCR.The specificity restriction enzyme sites of the plasmid vector after described primer can also comprise the easy digestion that is positioned at 5 ' end and easily extension increasing sequence is connected to similar restrictive diges-tion.

The following example is for realizing the specific embodiment of the present invention.Provide described embodiment only for purpose of explanation, and limit the scope of the invention never in any form.

Embodiment

Embodiment 1

The DNA grain diameter measurement

Obtain the DNA sample (BHT-3021) that dry ice is preserved from Bayhill Therapeutics, it is used until next step-80 ℃ of preservations.The DNA sample concentration is 2mg/ml.Existing and not existing under the condition of calcium chloride, adopt two kinds of different DNA concentration to carry out the dynamic light scattering analysis.Use 4 kinds of different calcium chloride concentrations (0.9mM, 3mM, 5.4mM and 8mM) to analyze.With phosphate buffer dilution DNA mother liquor, obtain the DNA (0.25mg/ml and 1.5mg/ml) of two kinds of variable concentrations.50mW diode-pumped laser (light scattering device (the BrookhavenInstruments Corp of λ=532nm) has been equipped in utilization, Holtszille, NY), 20 ℃ of hydrodynamic diameter of measuring the DNA sample, described laser instrument incides the sample room (sample cell) that is dipped in the decahydronaphthalenes bath.By becoming 90 ° PMT (EMI9863) monitoring scattered light with incident beam, and produce auto-correlation function by digital correlator (BI-9000AT).For each sample, collect data continuously, totally 5 intervals of 30 seconds, and calculating mean value.Analyze data by the whole bag of tricks, the information of the relative size of the various components of relevant described goods polydispersity of acquisition and existence.By the described auto-correlation function of cumulant method match, obtain the average diffusion coefficient of DNA and/or compound.According to Si-Ai Shi equation (Stokes-Einstein equation), from described diffusion coefficient, obtain effective fluid power and learn diameter.In addition, described data fitting is distributed to produce multi-modal to nonnegativity restrictions least square algorithm.In addition, in order more fully to analyze, utilize the number average value of colony and strength mean value to carry out these methods.

By grain count device analysis particle size

Experiment: use the size of population scope to carry out the state of aggregation analysis of DNA/ calcium phosphate complex as the Ku Erte grain count instrument 3 (CoulterMultisizer3) (Beckman CoulterInc.) of 0.4-1200 μ m.All DNA samples are all used 560 μ m mouth pipes.

Embodiment 2

Utilize BHT-3009 treatment multiple sclerosis with the establishment safety and at the immunoreactive entry evaluation of hMBP

The medicament that has gone through at present to treat MS is the nospecific immunity conditioning agent.Usually utilize heavy dose of cortin of short-term course of treatment to treat and control acute relapse, the speed of improving behind acute relapse is accelerated in this treatment, but compares with placebo, not have obviously total rehabilitation rate (the Brusaferri et al. of increase, J.Neurol., 247:435-42 (2000)).Be used to reduce the immunomodulator of attacking frequency and seriousness comprise interferon beta 1B (Betaseron, Berlex), interferon beta 1A (Avonex, Biogen; Rebif, Serono), the acetic acid lattice draw for thunder (Copaxone, Teva Neuroscience), natalizumab (Tysabri, B iogenIdec) and mitoxantrone (Novantrone, Amgen).But there is not the basic autoimmune response of a kind of direct solution in these medicaments.On the contrary, they regulate one or more by the shared effect approach of the normal immunologic process of the tissue damage that causes disease association.In addition, these products are at most medium (Goodin et al., Neurol, 58:169-78 (2002) to the effect of progression of disease; Filippini et al., Lancet, 361:545-52 (2003); Scott ﹠amp; Friggitt, CNS Drugs, 18:379-96 (2004); Simpson et al., CNSDrugs, 16:825-50 (2002); Miller et al., N.Engl.J.Med., 348:15-23 (2003)), and significant side effects is all arranged.Specifically, interferon often causes patient's influenza-like symptom (Goodin etal., Neurol., 58:169-78 (2002); Filippini et al., Lancet, 361:545-52 (2003)); Mitoxantrone causes bone marrow suppression, and the concomitant infections risk increases (Scott ﹠amp; Friggitt, CNS Drugs, 18:379-96 (2004)); The acetic acid lattice draw for thunder and cause allergic reaction (Simpson et al., CNS Drugs, 16:825-50 (2002)), and natalizumab (Tysabri) reduces lymphocyte migration (Miller et al., N.Engl.J.Med., 348:15-23 (2003)) also can increase the infection risk that comprises gradual many focuses leukoencephalopathy.Opposite with these nonspecific immunosuppressive agents, BHT-3009 is through designing the immune response that optionally reduces at myelin basic protein.Wish that the immunosupress of antigentic specificity is more safe and effective than existing therapy.

Recruit MS patient and participate in multicenter, randomization, double blinding, 3 groups, the I clinical trial phase of placebo, with assessment BHT-3009 (SEQ ID NO:3) single with or with the safety of the immunization therapy of Atorvastatin coupling.BHT-3009 is a plasmid vector, and it comprises the polynucleotides of BHT-1 expression vector skeleton and coding total length people's myelin basic protein (hMBP), and wherein said polynucleotides are inserted into the EcoR I and the Xba I site of BHT-1 polyclone sequence.The critical function of BHT-3009 and regulation and control feature comprise human cytomegalovirus (CMV) instant early gene promoter/enhancer, bovine growth hormone gene polyadenylation signal, kalamycin resistance gene and are used for the pUC replication origin that carrier is bred Escherichia coli.Fig. 1 is the schematic diagram that shows BHT-3009 primary structure feature.The intramuscular of BHT-3009 causes hMBP albumen in the injection site and the intracellular instantaneous low expression level of moving to draining lymph node.Verified in the mouse of experimental autoimmune encephalomyelitis and rat animal model (preclinical models of MS), this limited expression of autoantigen weakens ongoing autoimmune reaction under the new immune environment.The target group of this research is the patient who suffers from the recurrence disease, comprises the remission form MS (RRMS) and the metastable patient of the course of disease that suffer from recurrence, and the secondary-gradual MS (SPMS) and the metastable patient of the course of disease that suffer from recurrence.Concrete comprising with exclusion standard is as follows:

Comprise standard:

Multiple sclerosis according to the McDonald standard is made a definite diagnosis

Recurrence disease shown in following one or more: at acute relapse in two years before; In the clinical deterioration rates of biennium before; Gadolinium among the MRI strengthens infringement (gadolinium enhancing lesions)

Clinical stable〉3 months.

At least one gadolinium among the brain MRI strengthens infringement

Inactive interferon before baseline estimate〉3 months.

Stop using inhibitive ability of immunity and cytotoxicity therapy (for example mitoxantrone, Cladribine)〉12 months or 6 months, and the CD4 counting 400.

·EDSS<7

Age 〉=18 year old.

Can sign Informed Consent Form.

WBC and blood platelet in normal range (NR), haemoglobin〉10.0g/dl.

AST, ALT, the bili＜normal value upper limit.

Creatinine＜normal value the upper limit.

Exclusion standard:

Used high dose cortin (for example〉500mg medrat or equivalent) in 3 months before.

Any time accepted vaccine therapy, stem cell transplantation or total nodal irradiation before, and perhaps in 12 months before, accepted lattice and draw for thunder and treat.

Pregnancy or nursing women.

Be unwilling to use medically acceptable birth control form.

Known infection or suspection infected by HIV, hepatitis B or third liver.

Clinical significant ECG is unusual.

The researcher thinks that medical condition or social environment have stoped participation test or evaluation studies terminal point fully.

The body surface of MRI scanning or other metal objects in the body are carried out in pace maker, defibrillator or the restriction of implanting.

30 MS patients are assigned to one of 3 BHT-3009 dosage groups.For each dosage group, 10 patients are assigned randomly to one of following treatment group: A group: BHT-placebo+Atorvastatin-placebo (4 patients); B group: BHT-3009+ Atorvastatin-placebo (3 patients); C group: BHT-3009+ Atorvastatin (3 patients).With the patient that assigns to A group at random again Random assignment accept one of following open treatment: D group: independent BHT-3009 (2 patients) or E group: BHT-3009+ Atorvastatin (2 patients), it is received treatment, and the patient who is assigned to B group or C group respectively to start with at random assesses (Fig. 2) as mentioned below.Baseline the whole patients of week in-2 weeks to 0 assessment is observed, and comprises the MRI that utilizes gadolinium.Be randomized the treatment that distributes acceptance the 1st week beginning the 0th all patients.Give BHT-3009 and BHT-placebo according to 0.5mg, 1.5mg and 3.0mg dosage at the 1st, 3,5 and 9 all intramusculars (IM).According to GMP standard fabrication BHT-3009 active bio preparation.The final preparation of BHT-3009 is aseptic, the no endotoxic PBS isotonic solution (1 *) that contains 0.9mM calcium, and its concentration is 1.5mg/mL.In other embodiment of the present invention, be the bivalent cation preparation BHT-3009 of the about 2M of about 2mM-such as calcium with concentration; In preferred embodiment, calcium concentration is the about 8.1mM of about 2mM-(9 *); In most preferred embodiments, the concentration of calcium is the about 5.4mM of about 2mM-(6 *).The BHT-placebo is aseptic, the no endotoxic PBS isotonic solution that contains 0.9mM calcium.Atorvastatin at BHT-3009/BHT-placebo injection oral 80mg tablet beginning in the preceding 2 days every day first time

And Atorvastatin-placebo, last till that always this treatment separates blind (unblinded).At baseline and carry out MRI and other safety evaluations the 5th and 9 weeks.In the 13rd week, every patient accepts comprehensive assessment, after this assessment, makes known blind treatment.The patient who is assigned to B and C group at random stops whole experimental programs-specific treatment in the 14th week, follows the trail of its safety in the 26th, 38 and 50 weeks.

The dosage of table 3.BHT-3009 and Atorvastatin

Dosage level	Patient's number	BHT-3009 dosage	The dosage of Atorvastatin
Dosage level	Patient's number	BHT-3009 dosage	The dosage of Atorvastatin	1	10	500μg	80mg
2	10	1500μg	80mg	1	10	500μg	80mg
2	10	1500μg	80mg	3	10	3000μg	80mg

Table 4. treatment and the guide look of evaluation time table

All patients-2 are to 0 week: baseline is observed, and comprises the 0th week of MRI of utilizing gadolinium: Random assignment
	A, B or C organized for the 1st, 3,5,9 weeks: BHT-3009/BHT-placebo injection 1-14 week (separating blind): every day Atorvastatin/Atorvastatin-placebo tablet the 5th and the 9th week: the MRI that utilizes gadolinium, middle the 13rd week of safety evaluation: the 14th week of comprehensive security assessment: separate blind, Random assignment A group patient again

A organized the patient is assigned randomly to D again or E organizes the 14th, 16,18,22 week: BHT-3009 injection-open 14-26 week: Atorvastatin (only at E group patient) the 18th and 22 weeks every day: utilize the MRI of gadolinium, middle the 26th week of safety evaluation: comprehensive security assessment the 38th, 50 and 62 weeks: comprehensive security evaluation
	B group and C group patient the 26th, 38 and 50 weeks: comprehensive security assessment

Assess following safety variable:

Clinical

O medical history and physical examination comprise comprehensive neurologic examination

O problem guiding record (problem-oriented history) and physical examination

The o vital sign

The o concomitant drugs

The assessment of o injection site

The disability status scale (EDSS) of o Kurtzke expansion

The laboratory

O chemical property (expansion): glucose, BUN, creatinine, AST, ALT, alkaline phosphatase, total bilirubin, electrolyte (sodium, potassium, chloride, heavy carbonate, calcium and magnesium), LDH, amylase, albumin, total protein.

O chemical property: glucose, BUN, creatinine, AST, ALT, alkaline phosphatase, total bilirubin.

O ANA, anti-DNA antibody.

The o SCK.

The o cholesterol.

O CBC: hematocrit, haemoglobin, the WBC of differentiation (automatically), blood platelet

O urinalysis:, utilize quick test paper to add microexamination if test paper (dipstick) is upward clinical significantly unusual fast

O only carries out urine pregnancy test to the women that conceived potentiality are arranged

O is for OCB and IgG index, cell counting and protein level, optional carries out lumbar puncture

O SPEP (serum protein electrophoresis)-have only when carrying out LP

The EKG-12 that o has the rhythm of the heart paper tape figure that leads

Radiophotography

O chest PA and side

The brain magnetic resonance imaging (MRI) that the o gadolinium strengthens

Special survey

Vector expression in the o blood

MBP albumen in the o blood

The individual preliminary data of safety of preceding 10 examples shows the serious harmful incident of 2 examples.Although 1 routine incident is irrelevant with the research medicine, another incident has increased the weight of existing depressed individual depression, and being considered to may be that treatment is relevant.Harmful incident that every other research medicine is relevant be slight/medium serious, similar with incidence in placebo and research medicine group.Specifically, injection placebo (n=2) and BHT-3009 (erythema, n=1) after, observe slight anaphylactic type injection site reaction with similar frequency.Do not observe the delayed injection site reaction of prompting delayed allergy.In addition, there is not the anaphylactoid anaphylactic type general reaction of prompting, after this research, do not have tangible delayed general reaction yet.Have the relevant adverse events of 3 routine BHT-3009: diarrhoea, indigestion and night sweat, all these is 1 grade of of short duration incident.There is not the clinical significant laboratory abnormalities relevant with BHT-3009.

Except safety, also estimate following immune response variable: 1) comprise that at specific antigen MBP, PLP, MOG, tetanolysin and acetic acid lattice draw T cell proliferation and intracellular cytokine for thunder to generate; 2) comprise that at specific antigen the B cell antibody of MBP, PLP and MOG reacts; 3) peripheral blood lymphocytes (PBMC) phenotype of estimating by flow cytometry; With 4) the whole blood mark of the inflammation estimated by quantitative PCR.Analyze for major part, collection and preservation cell and blood serum sample are finished described treatment until individuality.The PRELIMINARY RESULTS explanation, the individuality of accepting the BHT-3009 treatment shows that the Th1 at MBP reacts, this is by coming indication at the cell proliferation (analyzing by the CSFE dye-dilution) of MBP and the generation (by intracellular cytokine dyeing) of IFN γ.

BHT-3009 is safe, and is well tolerable, and favourable tendency is provided in brain MRI, and produces useful antigen specific immune variation.These immunity change to be made up of following: the propagation of the myelin reactivity CD4+T cell (from peripheral blood) of generation interferon gamma significantly descends, and from titre (by the arrays of immobilized protein evaluation) reduction of the myelin specificity auto-antibody of celiolymph.We do not observe the Atorvastatin combination substantial benefit of BHT-3009 relatively separately.

In MS patient, BHT-3009 is safe, and the immune tolerance of inducing antigen-specific, and the inflammatory damage that is accompanied by among the brain MRI reduces in phase.

Embodiment 3

Utilize BHT-3009 treatment multiple sclerosis alleviating with assessment CNS inflammation

Recruit MS patient add multicenter, at random, the 2b clinical trial phase of double blinding, placebo to be to estimate safety, tolerance and the effect of BHT-3009.Assess effect according to alleviating of CNS inflammation, and the alleviating the infringement that strengthens by gadolinium and indicate other MRI measurements of possible clinical benefit to estimate of CNS inflammation.Positive findings will support to carry out other tests of Direct Test BHT-3009 clinical efficacy.Although described test is not enough to support this second purpose, should test the primary evidence that also will seek clinical efficacy (i.e. the raising of recurrence minimizing and function mark).

The target group of this test is an individuality of suffering from recurrence remission form MS, its EDSS＜3.5, and accept the disease modulators for treatment and be lower than 6 months, and they most possibly benefit from the immunotherapy of antigentic specificity.Concrete comprising with exclusion standard is as follows:

Comprise standard:

MS makes a definite diagnosis by McDonald standard (34).

Examination shows the cranium MRI infringement that meets MS.

In the previous year, once or repeatedly recur.

Before beginning examination program and during the examination clinical stable (not having recurrence)〉50 days.

EDSS comprises 0 to 3.5.

Age〉18 years old and＜55 years old.

Be ready and can sign Informed Consent Form.

WBC〉3,000; Blood platelet〉100,000; Haemoglobin〉10.0g/dl

AST, ALT, bilirubin＜2.0 * normal value upper limit

Creatinine＜2.0 * normal value upper limit.

HIV checks negative.

Exclusion standard:

Formerly send out gradual, secondary is gradual or gradual recurrence MS.

Surpassing 15 gadoliniums on examination first time MRI strengthens.

In preceding 50 days of beginning examination program, and the high dose cortin (for example every day〉500mg hydrogenated methyl Bo Nisong or equivalent, continue 3 days or more days).

Previous stem cell transplantation, total nodal irradiation or cytotoxic treatments.

Utilize interferon, acetic acid lattice to draw disease modulators for treatment for thunder or other approvals〉180 days (useful life that all medicaments are whole).

Utilize the disease modulators for treatment of approval in 180 days in beginning examination program.

Before utilize experimental pharmaceutical treatment MS, comprised the off-label use (offlabel) of ratifying medicine.(obtaining the medical control approval).

Utilize the treatment formerly of natalizumab (Tysabri).

Pregnancy or nursing women.

Be unwilling to use medically acceptable birth control form (for example hormonal contraceptive, intrauterine device (IUD), double barrier, self or companion's sterilization).

Significant clinically ECG unusual (for example acute ischemic or life-threatening cardiac arrhythmia).

Pace maker, the defibrillator of implanting or limited the body surface that carries out MRI scanning or body in other metal objects.

Known hypersensitivity or allergy to gadolinium.

Qualified patient (n=252) is assigned to 3 groups at random according to equal number: A group: 0.5mgBHT-3009; B group: 1.5mg BHT-3009; Organize with C: the BHT-placebo.According to GMP standard fabrication BHT-3009 active biological product.The final preparation of BHT-3009 is aseptic, the no endotoxic PBS isotonic solution (1 *) that contains 0.9mM calcium, and its concentration is 1.5mg/mL.In other embodiments of the present invention, with concentration be the bivalent cation preparation BHT-3009 of the about 2M of about 0.05mM-such as calcium; In preferred embodiment, the concentration of calcium is the about 8.1mM of about 2mM-(9 *); In most preferred embodiments, calcium concentration is the about 5.4mM of about 2mM-(6 *).Study medicine at the 0th, 2,4 all intramusculars, give every 4 weeks then, until the 44th week, totally 13 dosage.Studying medicine by two syringes at two independent injection sites, is 0.33mL among the syringe #1, is 0.67mL among the syringe #2.Arm is preferred injection site, because lymph node drainage is widely arranged on the arm.If can not be expelled to deltoid muscle, then can be expelled to the second or the 3rd candidate position.The second candidate injection site is the musculus quadriceps muscle central authorities of preceding thigh, and the 3rd candidate position then is a buttocks.

The dosage of table 5.BHT-3009

Main terminal point is that cranium MRIs goes up average 4 all speed that new Gd strengthens the infringement generation, from the 28th week carrying out described cranium MRIs (6 MRIs altogether) per 4 weeks until the 48th week.Secondary endpoints comprises following:

·MRI

O is from the T2 infringement Volume Changes in 48 weeks of baseline to the.

The cranium MRIs that o carries out during the 28th thoughtful the 48th week in per 4 weeks goes up average 4 all speed of new T2 infringement.

O is from the T1 low-intensity infringement Volume Changes and the chronic T1 low-intensity infringement Volume Changes in 48 weeks of baseline to the.

The cranium MRIs that o carried out during the 28th thoughtful the 48th week goes up average Gd and strengthens the infringement volume.

Recurrence

The recurrence rate that o is annualized.

O checks the experimenter who withdraws to the time of recurring for the first time.

Function mark (EDSS and MSFC)

O compares with baseline, the individual ratio that EDSS worsens in the assessment of the 48th week.

O compares with baseline, the individual ratio that the MSFC that confirms in the assessment of the 48th week worsens.

MRI carries out twice during examination, and carries out in the 8th, 16,28,32,36,40,44 and 48 weeks.Obtain all images (unless obtaining sponsor's approval) of this test by 1.5 teslas or higher magnet, it utilizes the custom sequence parameter group that calculates each position during the dry run (dummy run).Individuality will utilize identical sequence to carry out MRI scanning on the same scan instrument, to comprise that complete brain cover degree, minimum individuality move and the uniformity of time.Standard dose according to research provides contrast.The volunteer is carried out 1-3 simulation MRIs confirming enough picture quality, and set up transmission and data administrator.

After recurrence, should assess as early as possible, and must confirm by the check doctor.Recurrence is defined as unusual appearance of one or more significant neurologies or reproduction, and it continues at least 48 hours, and directly is at least 30 days disease relatively stable period or upward swing before this.Individual MS symptom normally self do not constitute recurrence repeatedly, with tangible accident such as infecting or appearance that the neurology of fever is unusual or reproduce and also be not considered to recurrence.When the disability situation scale (EDSS) that is attended by the objective variation of neurologic examination and Kurtzke expansion when the symptom of individuality increases at least 1.0 points, think that recurrence obtains confirming.The variation of intestines/bladder function, the variation of the existing somatesthesia defective order of severity or the variation of cognitive function can not be used for confirming recurrence separately.

Utilize two kinds of different conventional study evaluation criterions to estimate the disability status scale (EDSS of disabled state: Kurtzke expansion; Kurtzke, Neurol, 33:1444-52 (1983)) and the compound scoring (MSFC of multiple sclerosis function; Cutter et al., Brain, 122:871-82 (1999)) estimate.During examination and the 40th and 48 weeks carried out EDSS and MSFC.Carry out EDSS by " check doctor ", described " check doctor " is not " treatment doctor " and the clinical state of not understanding individuality.MSFC can be undertaken by qualified medical personnel, treatment doctor or the check doctor through training.The EDSS that worsened in the 48th week is defined as the initial increase of EDSS, and this deterioration with the 40th week is consistent, and it promptly obtained confirming after 8 weeks in the 48th week.The individuality that is not considered to just to experience recurrence has the EDSS of deterioration, and is stable up to their situation.The MSFC that worsens is defined as MSFC z mark and reduces by 1 unit or more, and this obtained confirming after at least 8 weeks.The MSFC that the 48th week worsened is defined as, and compares with the examination MSFC z mark that the 48th week was confirmed, the z mark in the 40th week reduces by 1 unit or more.The individuality that is not considered to just to experience recurrence has the MSFC of deterioration, and is stable up to their situation.

Utilize the generalized linear model of supposing poisson distribution and the logarithm correlation function (linkfunction) that utilizes ITT group, with treatment group and set center (pooled center) as the factor, and strengthen the logarithm value of infringement quantity as covariant with the gadolinium (Gd) in the baseline MRI scanning, by detecting the difference of primary variables between the treatment group, carry out in two kinds of dosage of BHT-3009 any and be better than the preliminary test of placebo.When the quantity of baseline place infringement was zero, it will be near log (0.1).To consider excessively to disperse, and estimate by deviant.BHT-3009 will test by the null hypothesis of following form to the advantage of placebo: H0:BHT-3009 and placebo are as broad as long, have any different with respect to H1:BHT-3009 and placebo.These two kinds of null hypothesiss and their respective selection will be specified the BHT-3009:0.5mg and the 1.5mg of various dose respectively.By Wald Chi-square Test, check described null hypothesis to difference valuation in the method for least squares (least-squares means) of treatment group.These valuations and their 95% confidence interval (CIs) will be provided.To use Hochberg multiple check method that the multiplicity (multiplicity) of CIs in calculating is described.Suppose that described primary variables meets the poisson distribution of the excessive dispersion with deviant estimation.Utilize Hosmer-Lemeshow statistical fit degree, estimate the degree of fitting of described model.Utilize the Q-Q curve can also estimate the validity of described supposition intuitively.If poisson distribution significant discomfort usefulness is carried out bilateral Wilcoxon check, the quantity by Gd+ infringement in set center and the baseline MRI scanning (0,1-5,〉5 infringements) carry out layering; And will provide the Hodges-Lehmann valuation of the not layering for the treatment of difference and their CIs.

289 patients of picked at random.272 patients have finished calculated 44 weeks treatment.Treatment is well tolerable.Up to the present 199 patients (68.9%) have reported that one or more treat acute harmful incident (AEs).Only feel that in 44 patients (15.2%) these AEs may be correlated with, may be relevant in 39 patients (13.5%) with the research medicine.Most of AEs is slight/medium order of severity.Also there is not significant clinical labororatory unusual up to now.The imbalance that between 3 treatment groups, does not have AEs.Baseline ELISPOT to 77 patients analyzes demonstration, and it is positive that 63 patients (81.8%) generate the interferon-at one or more MBP peptides, and 58 (75.3%) is positive to the PLP peptide and 53 (68.8%) are positive to the MOG peptide.Following up a case by regular visits to ELISPOT and CSF analysis the 44th week.

The test data of I/II phase shows that BHT-3009 is safe, and can suppress immune response in the mode of antigentic specificity.

Embodiment 4

The sign of BHT-3021 high-calcium preparation activity

In order to estimate the biologically active of the BHT-3021 preparation that comprises the calcium concentration increase, can use various external and body inner analysis methods.At first, plasmid DNA directly can be added to transfection competent cell system (HEK293 for example, HeLa, CHO, or the like), and measure the level (Fig. 3) of the proinsulin albumen that described cell produces by business-like ELISA.Secondly, can give mouse with the different formulation delivered of BHT-3021 by the IM injection, the different time after injection utilizes BHT-3021 specificity quantitative PCR analysis then, measures the plasmid quantity (table 6) of incorporating muscle into.At last, can be according to various dose and the frequency different preparation of diabetes (pre-diabetic) NOD mouse IM injection forward, and the progress of the inflammation of check prevention auto-antibody, ART, pancreas and the tangible ability of diabetes outbreak.In addition, can suffer from the mouse of hyperglycemia, to determine whether described disease can obtain stopping or reversing by injection BHT-3021 preparation for treating.

After table 6-injects the high-calcium preparation of BHT-3021 plasmid DNA at IM, the analysis of accounts of muscle plasmid.

Sample ID	BHT-3021 copy number/μ gDNA	Average C _TValue	Sample ID	BHT-3021 copy number/μ gDNA	Average C _TValue
Sample ID	BHT-3021 copy number/μ gDNA	Average C _TValue	Sample ID	BHT-3021 copy number/μ gDNA	Average C _TValue	2D1X-1	>1×10 ⁶	16.06	2D?6X-1	NA	4.51
2D1X-2	>1×10 ⁶	16.89	2D?6X-2	NA	5.90	2D1X-1	>1×10 ⁶	16.06	2D?6X-1	NA	4.51
2D1X-2	>1×10 ⁶	16.89	2D?6X-2	NA	5.90	2D1X-3	>1×10 ⁶	17.49	2D?6X-3	NA	5.36
2D1X-4	>1×10 ⁶	17.70	2D?6X-4	NA	7.17	2D1X-3	>1×10 ⁶	17.49	2D?6X-3	NA	5.36
2D1X-4	>1×10 ⁶	17.70	2D?6X-4	NA	7.17	7D1X-1	1161	29.52	7D?6X-1	NA	5.42
7D1X-2	582	27.99	7D?6X-2	NA	6.18	7D1X-1	1161	29.52	7D?6X-1	NA	5.42
7D1X-2	582	27.99	7D?6X-2	NA	6.18	7D1X-3	1986	28.24	7D?6X-3	NA	5.98
7D1X-4	422	31.28	7D?6X-4	NA	5.87	7D1X-3	1986	28.24	7D?6X-3	NA	5.98
7D1X-4	422	31.28	7D?6X-4	NA	5.87	14D1X-1	26899	24.74	14D?6X-1	>1×10 ⁶	14.50
14D1X-2	16590	25.70	14D?6X-2	>1×10 ⁶	16.35	14D1X-1	26899	24.74	14D?6X-1	>1×10 ⁶	14.50
14D1X-2	16590	25.70	14D?6X-2	>1×10 ⁶	16.35	14D1X-3	297	31.74	14D?6X-3	>1×10 ⁶	15.66
14D1X-4	1403	29.54	14D?6X-4	NA	5.73	14D1X-3	297	31.74	14D?6X-3	>1×10 ⁶	15.66

Preparation BHT-3021 plasmid in the Du Shi PBS that contains 0.9mM calcium chloride (1 *) or 5.4mM calcium chloride (6 *).Various preparations are expelled to the back musculus quadriceps of 6 C57B1/6 mouse, and collect muscle (n=4 piece muscle) from 2 mouse at the 2nd day (2D), the 7th day (7D) and the 14th day (14D), utilize BHT-3021 plasmid specificity quantitative PCR analysis, the copy number of plasmid in the every muscle is carried out quantitatively.All there is the much higher plasmid DNA of level in institute's injection muscles from 6 * preparation group at all time points in its muscle, show that DNA stability and persistence in vivo is better when preparing with high calcium.Abbreviation: it is too high that NA-is used for quantitative plasmid #; CT (cycle threshold)-PCR circulation, in described circulation, sample reaches the quantitatively level that is higher than analysis background.

Although with reference to one or more embodiments, basically, describe the present invention in detail, but one skilled in the art will appreciate that to change the concrete disclosed embodiment of the application, but described changes and improvements are positioned at the scope of the invention and spirit described in subsequently the claim.All publications or patent document that this specification is quoted are incorporated this paper by reference into, as each described publication or file are pointed out to incorporate into by reference this paper particularly and individually.Quoting above-mentioned publication or file is not to be intended to admit that any aforementioned publication or file are related art, does not constitute admitting interior perhaps date of described publication or file yet.

Sequence table

SEQ?ID?NO：1(pVAX1)

SEQ?ID?NO：2(BHT-1)

SEQ?ID?NO：3(BHT-3009)

Claims

1. treat the method for individual autoimmune disease, it is relevant that described disease and non-physiology are present in one or more oneself proteins in the described individuality, self polypeptide or self peptide, described method comprises to described individuality and gives self carrier and the concentration bivalent cation greater than physiological level, and described self carrier comprises the polynucleotides of inhibitive ability of immunity carrier framework and the coding oneself protein relevant with described autoimmune disease, self polypeptide or self peptide.

2. the method for claim 1, wherein said self carrier comprises the BHT-1 carrier framework.

3. the method for claim 1, wherein said autoimmune disease is a multiple sclerosis.

4. the method for claim 1, wherein said autoimmune disease is a rheumatic arthritis.

5. the method for claim 1, wherein said autoimmune disease is a lupus.

6. the method for claim 1, wherein said self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's myelin basic protein (MBP).

7. the method for claim 1, wherein said self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's proteolipin albumen (PLP).

8. the method for claim 1, wherein said self carrier comprises the polynucleotides of the glycoprotein (MAG) of BHT-1 carrier framework and the combination of coding people myelin.

9. the method for claim 1, wherein said self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's myelin oligodendrocyte albumen (MOG).

10. method as claimed in claim 3, wherein said self carrier is BHT-3009 (SEQ IDNO:3).

11. method as claimed in claim 10, wherein said self carrier B HT-3009 be do not contain endotoxic.

12. the method for claim 1, wherein said bivalent cation is a calcium.

13. method as claimed in claim 12, the concentration of wherein said calcium is greater than about 2mM.

14. method as claimed in claim 12, the concentration of wherein said calcium are about 5.4mM.

15. treat the method for individual multiple sclerosis, comprise to described individuality comprising self carrier and concentration pharmaceutical composition that described self carrier comprises the inhibitive ability of immunity carrier framework greater than the bivalent cation of physiological level.

16. method as claimed in claim 15, wherein said self carrier comprises the BHT-1 carrier framework.

17. method as claimed in claim 15, wherein said self carrier is BHT-3009 (SEQ IDNO:3).

18. method as claimed in claim 17, wherein said pharmaceutical composition be do not contain endotoxic.

19. method as claimed in claim 15, wherein said bivalent cation is a calcium.

20. method as claimed in claim 19, the concentration of wherein said calcium is greater than about 2mM.

21. method as claimed in claim 19, the concentration of wherein said calcium are about 5.4mM.

22. pharmaceutical composition, comprise self carrier and the concentration bivalent cation greater than physiological level, described self carrier comprises the polynucleotides of inhibitive ability of immunity carrier framework and coding one or more oneself proteins relevant with autoimmune disease, self polypeptide or self peptide.

23. pharmaceutical composition as claimed in claim 22, wherein said self carrier comprises the BHT-1 carrier framework.

24. pharmaceutical composition as claimed in claim 22, wherein said self carrier is BHT-3009 (SEQ ID NO:3).

25. pharmaceutical composition as claimed in claim 22, wherein said autoimmune disease is a multiple sclerosis.

26. pharmaceutical composition as claimed in claim 22, wherein said autoimmune disease is a rheumatic arthritis.

27. pharmaceutical composition as claimed in claim 22, wherein said autoimmune disease is a lupus.

28. pharmaceutical composition as claimed in claim 22, wherein said self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's myelin basic protein (MBP).

29. pharmaceutical composition as claimed in claim 22, wherein said self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's proteolipin albumen (PLP).

30. pharmaceutical composition as claimed in claim 22, wherein said self carrier comprise the polynucleotides of the glycoprotein (MAG) of BHT-1 carrier framework and the combination of coding people myelin.

31. pharmaceutical composition as claimed in claim 22, wherein said self carrier comprises the polynucleotides of BHT-1 carrier framework and coding people's myelin oligodendrocyte albumen (MOG).

32. pharmaceutical composition as claimed in claim 25, wherein said self carrier is BHT-3009 (SEQ ID NO:3).

33. pharmaceutical composition as claimed in claim 32, wherein said pharmaceutical composition be do not contain endotoxic.

34. pharmaceutical composition as claimed in claim 22, wherein said bivalent cation is a calcium.

35. pharmaceutical composition as claimed in claim 34, the concentration of wherein said calcium is greater than about 2mM.

36. pharmaceutical composition as claimed in claim 34, the concentration of wherein said calcium are about 5.4mM.

37. pharmaceutical composition comprises BHT-3009 (SEQ ID NO:3) and the concentration bivalent cation greater than physiological level.

38. pharmaceutical composition as claimed in claim 37, wherein BHT-3009 be do not contain endotoxic.

39. self carrier B HT3009 (SEQ ID NO:3).