CN101487054B - Cloning and use of pig immunity related molecular marker - Google Patents
Cloning and use of pig immunity related molecular marker Download PDFInfo
- Publication number
- CN101487054B CN101487054B CN200910060794XA CN200910060794A CN101487054B CN 101487054 B CN101487054 B CN 101487054B CN 200910060794X A CN200910060794X A CN 200910060794XA CN 200910060794 A CN200910060794 A CN 200910060794A CN 101487054 B CN101487054 B CN 101487054B
- Authority
- CN
- China
- Prior art keywords
- pig
- genotype
- gene
- ile
- days
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of preparation of livestock molecular markers, and particularly relates to preparation and application of a molecular marker that is related to porcine immunity and used in porcine marker assisted selection. The molecular marker is cloned from a porcine Cav1 gene and has a cDNA sequence that is shown in SEQ ID NO.1 of the sequence table. The sequence shown in SEQ ID NO.1 of the sequence table has a G387-C387 basic group mutation in a 387bp position that causes HaeIII-RFLP polymorphism, an A474-G474 basic group mutation in a 474bp position that causes MbiI-RFLP polymorphism, and a G512-A512 basic group mutation in a 512bp position that causes AciI-RFLP polymorphism. The invention further discloses a primer that is used for augmenting partial encoding region of the Cav1 gene and a detection method that is used for molecular marking. The invention provides three new molecular markers for porcine marker assisted selection.
Description
Technical field
The invention belongs to the domestic animal gene engineering technology field, be specifically related to a kind of clone and application of the molecule marker of using as the pig marker assisted selection relevant with pig immunity.
Background technology
China is that Swine Production and pork are consumed first big country in the world, pig industry has been one of rural area mainstay industry, the disease of domestic animal is the formidable enemy that herding is produced, because the financial loss that disease causes accounts for 12%～15% of the livestock industry output value, it is serious that practical situation are also wanted.Abuse of antibiotics causes exporting the embarrassment of pork drug residue, and advanced vaccine is still kept out incessantly the periodically outburst of swine disease.Simultaneously, both at home and abroad consumption has proposed new requirement to pork, and as " green pig " " environmental protection pig " etc., these new problems have proposed new requirement for the breeding work in the rain of pig.In recent years, GENERALIZATION OF MODERN BREEDING TECHNIQUE is being made very big contribution in improvement aspect the pig production character, but also very limited to the genetic improvement of the ability of healthy and resist the disease.Therefore, press for the disease resistance that improves pig from genetic angle, match with existing measure and solve these problems.
Adopting the molecular genetics method is to improve the immunizing power of pig from the core that improves pig self resistance against diseases in essence.Immunizing power is to weigh the important indicator of animal health level, it belongs to quantitative character, be subjected to polygenic regulation and control, molecular mechanism is very complicated, to the parsing of pig immunity and molecular mechanism thereof is a research focus in herding field, and the breeding work that is intended to improve pig immunity also is known as breeding for disease resistance.The exploitation of the clone of Ia important gene and related molecular marker is again the most important thing of research with using in the breeding for disease resistance working process.
The Cav1 gene that the present invention chooses is one of gene of so most important effect of performance in bacterium and virus attack host process.Cav1 belongs to Caveolin family, coding Caveolin1 albumen (middle translated name caveolin protein).Caveolin1 albumen is the main component that constitutes Lipid Rafts and cell cellar for storing things, and it is distributed in many dissimilar cells.Discover that this gene participates in the various kinds of cell vital movement, generate as cell endocytic, cholesterol transportation, after birth formation, signal conduction, tumour.And in these vital processes, Caveolin1 is bringing into play very important effect, therefore the research of its function has been become a focus of present life science.
Along with going deep into of research, it is found that Caveolin1 albumen also participates in the process of various bacteria and viral pathogens invasion host cell, as virus and bacteriums such as Mycobacteria, E.coli such as HIV-1.Foreign study shows that the transmembrane glycoprotein gp41 of HIV21 has a conservative Caveolin binding motif (CBD).It should be noted that, in the cell that HIV infects, have a stable gp41 and the proteic mixture of Caveolin1, therefore the antibody of anti-CBD may be able to suppress the interaction of gp41 and caveolin protein, utilizes this principle can develop the vaccine of treatment acquired immune deficiency syndrome (AIDS).
Moreover, Caveolin-1 also plays a significant role in the pathogenic agent breeding, and Marjomaki etc. have analyzed Echovirus1 (EV1) early infection and enter the approach of host cell after being attached to acceptor.After EV1 was attached to host cell surface, the viral capsid conformation changed.This discovers that EV1 exists in perinuclear vesica structure, Electronic Speculum shows that the EV1 virion is present in the caveola.The cell of not expressing Caveolin1 can not infect EV1, and this explanation Caveolin1 albumen is very important in EV1 virus replication propagation.
But the Cav1 gene studies is mainly concentrated on the physianthropy field both at home and abroad at present, less to pig Cav1 gene studies.And still do not utilize pig Cav1 gene to seek the report of the molecule marker relevant up to now with pig immunity.Therefore, the applicant has cloned the cDNA of relevant Cav1 gene with pig immunity, utilizes this cDNA sequence to carry out researchs such as polymorphism and association analysis, and is new for the relevant molecule marker of pig immunity in the hope of obtaining.
Summary of the invention
The objective of the invention is to clone the molecule marker relevant, utilize of the application of this molecule marker as the pig marker-assisted breeding with pig immunity.
The present invention is achieved through the following technical solutions:
The applicant clone obtains a kind of molecule marker relevant with pig immunity, and it is the nucleotide sequence shown in the sequence table SEQ ID NO:1.There is 1 base mutation by G387-C387 at 387bp place at sequence table SEQ ID NO:1, causes the HaeIII-RFLP polymorphism; There is 1 base mutation by A474-G474 at 474bp place at sequence table SEQ ID NO:1, causes the MbiI-RFLP polymorphism.There is 1 base mutation by G512-A512 at 512bp place at sequence table SEQ ID NO:1, causes the AciI-RFLP polymorphism.
Wherein, the right dna sequence dna of the primer of clone pig Cav1 gene is as follows:
Forward primer: 5 ' AATCTCCTCAGAGCCTTCATCC 3 ', reverse primer: 5 ' CGCTGTACTGGCAAATTGAAAC 3 '.
It is as follows to detect the right dna sequence dna of the used primer of the described molecule marker of SEQ ID NO:1 (promptly detecting base mutation):
Forward primer: 5 '-ACTGGTTTTACCGTTTGC-3 ', reverse primer: 5 '-GAAACTCGAAATTGGCAC-3 '.
The applicant sets up the above-mentioned molecule marker of a kind of preparation and detects above-mentioned molecular marker method, and the step of this method is as follows:
Using the pig Cav1 gene cDNA by people Cav1 predictive genes is the information probe, does the homologous sequence screening, obtains the expressed sequence tag of homology more than 80%; Splice pig expressed sequence tag-contig then; According to expressed sequence tag-contig design primer, amplification obtains the purpose fragment; From the pig variety ear tissue, extract genomic dna, with pig Cav1 gene cDNA sequence is template design primer, pcr amplification, PCR product purification and cloning and sequencing, the nucleotide sequence of acquisition shown in sequence table SEQ ID NO:1 used the polymorphism that the PCR-RFLP method detects pig Cav1 gene.
More detailed technical scheme is referring to " embodiment ".
Description of drawings
Fig. 1: be techniqueflow chart of the present invention.
Fig. 2: the present invention clone's pig Cav1 Gene Partial cDNA Sequence, underscore partly is coding region (CDS) among the figure, square frame is labeled as the mutational site of base, from left to right is successively: G387-C387, A474-G474 and G512-A512.
Fig. 3: be the pig Cav1 Gene Partial sequence of being cloned that is used for the detection molecules mark among the present invention, square frame is labeled as the mutational site of 3 bases among the figure, from left to right be successively: G387-C387, A474-G474 and G512-A512, the shadow zone of sequence head and the tail is that primer is right.
Fig. 4: be the electrophoretogram of pig Cav1 gene C DS partial sequence amplification among the present invention, clip size is 324bp (agarose gel concentration is 2%).Among the figure: the Marker swimming lane is a dna molecular amount standard (DL2000).
Fig. 5: be 3 mutational sites finding after the pig Cav1 gene sequencing, from left to right be successively: G387-C387, A474-G474 and G512-A512.
Fig. 6: three kinds of genotype (GG, CG and the CC) electrophoretogram that is pig Cav1 gene PCR-HaeIII-RFLP among the present invention.
Fig. 7: three kinds of genotype (AA, AG and the GG) electrophoretogram that is pig Cav1 gene PCR-MbiI-RFLP among the present invention.
Embodiment
Embodiment 1:
One, the clone of Cav1 gene
1. design of primers
Utilizing primer-design software Primer 5.0, is the information probe with the pig Cav1 gene cDNA (Genebank accession number NM 214438) by people Cav1 predictive genes, does the homologous sequence screening, obtains the expressed sequence tag of homology more than 80%; Splice pig expressed sequence tag-contig then; Design the amplimer that comprises complete coding region according to expressed sequence tag-contig.Primer is synthetic by Beijing AudioCodes biotech company, and the right dna sequence dna of primer is as follows:
Forward primer: 5 ' AATCTCCTCAGAGCCTTCATCC 3 ',
Reverse primer: 5 ' CGCTGTACTGGCAAATTGAAAC 3 '.
2.PCR the purifying of product and order-checking
(1) pcr amplification
Add cDNA template 0.5 μ L in the reaction system of 10uL, distilled water 7.5 μ L, 10 * PCRbuffer, 1 μ L, each 0.3 μ L before and after the dNTP0.3 μ L, 10mM primer, Taq enzyme 1U.The PCR reaction conditions is: behind 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30s, 55 ℃ of annealing 30s, 72 ℃ of extension 25s, 33 circulations, last 72 ℃ are extended 5min.The PCR product detects through 2% agarose gel electrophoresis.
(2) purifying of PCR product and order-checking:
The quick glue of the Type B miniprep dna fragment of utilizing vast Tyke, Beijing biological gene technology company to produce reclaims test kit and carries out the purifying recovery, concrete grammar is with reference to the process specifications of this test kit, step is as follows: collect sample electrophoresis on enough PCR products, downcut the purpose band, blob of viscose is as far as possible little.The concentration of sepharose is 1%; Add the ratio of 700 μ l sol solutionses in 100 μ l blob of viscoses, in 55 ℃ baking oven, gel is dissolved fully; The 3S post of packing into after dissolving, removes waste liquid at 9000rpm centrifugal 30 seconds; The rinsing of C500 μ l rinsing liquid, repeats rinsing once at 12000rpm centrifugal 30 seconds.After outwelling waste liquid, again in the centrifugal 2Min of 12000rpm; The centrifugal wash-out of elution buffer 12000rmp that in the 3S post, adds 30 μ l.The purpose fragment that purifying reclaims is just in the liquid of wash-out gained; Send Beijing AudioCodes biotech firm directly to check order portion of product.
(3) the dna sequence dna homology search is identified
By NCBI-BLAST (Basic Local Alignment Search Tool) instrument, the reference sequences of announcing in back sequence that obtains of order-checking and the GenBank database is compared, and the result shows that successfully the clone obtains the part fragment (see figure 2) that pig cav1 gene contains the CDS district.
Two, the scanning in Cav1 gene coding region mutational site
1. design of primers
Utilizing primer-design software Primer 5.0, is template sequence with above-mentioned sequencing result, and with reference to the potential polymorphic site that obtains by expressed sequence tag-contig compare of analysis, it is right to design the pcr amplification primer that is used for polymorphic site scanning.Primer is synthetic by Beijing AudioCodes biotech company, and the right dna sequence dna of described primer is as follows:
Forward primer: 5 ' ACTGGTTTTACCGTTTGC 3 ',
Reverse primer: 5 ' GAAACTCGAAATTGGCAC 3 '.
2.PCR the purifying of product and order-checking
(1) pcr amplification
4 pig kinds of pcr amplification DNA is respectively plum mountain pig and Tongcheng pig (place of china pig blood relationship), Large White and landrace (external pig or external pig blood relationship, down together).
Add dna profiling 0.5 μ L in the reaction system of 10uL, distilled water 7.5 μ L, 10 * PCR buffer, 1 μ L, each 0.3 μ L before and after the dNTP 0.3 μ L, 10mM primer, Taq enzyme 1U.The PCR reaction conditions is: behind 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30s, 59 ℃ of annealing 30s, 72 ℃ of extension 25s, 33 circulations, last 72 ℃ are extended 5min.
The PCR product detects (see figure 4) through 2% agarose gel electrophoresis, has obtained 324bp specific amplification fragment with primer amplification, is used for reclaiming order-checking.
(2) purifying of PCR product and order-checking:
The quick glue of the Type B miniprep dna fragment of utilizing vast Tyke, Beijing biological gene technology company to produce reclaims test kit and carries out the purifying recovery, concrete grammar reference reagent box specification sheets, step is as follows: collect sample electrophoresis on enough PCR products, downcut the purpose band, blob of viscose is as far as possible little.The concentration of sepharose is 1%; Add the ratio of 700 μ l sol solutionses in 100 μ l blob of viscoses, in 55 ℃ baking oven, gel is dissolved fully; The 3S post of packing into after dissolving, removes waste liquid at 9000rpm centrifugal 30 seconds; The rinsing of C500 μ l rinsing liquid, repeats rinsing once at 12000rpm centrifugal 30 seconds.After outwelling waste liquid, again in the centrifugal 2Min of 12000rpm; The centrifugal wash-out of elution buffer 12000rmp that in the 3S post, adds 30 μ l.The purpose fragment that purifying reclaims is just in the liquid of wash-out gained; Send the order-checking of Beijing AudioCodes biotech firm with portion of product.
(3) the determining of mutational site in the dna sequence dna
By NCBI-BLAST (Basic Local Alignment Search Tool) instrument, the reference sequences of announcing in sequence that order-checking back is obtained and the GenBank database is compared, and the result shows 4 cloning and sequencings in kind (see figure 3) of all succeeing.
The order-checking peak figure of 4 pig varieties is imported SeqMan software to compare, the result shows that sequencing quality is very high, there have 3 sites to occur at pig Cav1 gene coding region to be significantly bimodal, and this illustrates that this gene in these 3 site the base mutation (see figure 5) has taken place.These 3 sites are respectively: the base mutation in that there is 1 G387-C387 at the 387bp place of sequence table SEQ ID NO:1 causes the HaeIII-RFLP polymorphism; The base mutation of 1 A474-G474 is arranged at the 474bp place of sequence table SEQ ID NO:1, cause the MbiI-RFLP polymorphism.The base mutation of 1 G512-A512 is arranged at the 512bp place of sequence table SEQ ID NO:1, cause the AciI-RFLP polymorphism.
Three, the foundation of PCR-RFLP genotype detection method
1. design of primers
Still the primer that uses above-mentioned experimental design is to (be used to detect described molecule marker or be called and detect base mutation), and its dna sequence dna is as follows:
Forward primer: 5 ' ACTGGTTTTACCGTTTGC 3 ',
Reverse primer: 5 ' GAAACTCGAAATTGGCAC 3 '.
2.PCR amplification
Add dna profiling 0.5 μ L in the reaction system of 10uL, distilled water 7.5 μ L, 10 * PCR buffer, 1 μ L, each 0.3 μ L before and after the dNTP 0.3 μ L, 10mM primer, Taq enzyme 1U.The PCR reaction conditions is: behind 94 ℃ of pre-sex change 5min, and 94 ℃ of sex change 30s, 59 ℃ of annealing 30s, 72 ℃ of extension 25s, 33 circulations, last 72 ℃ are extended 5min.2 μ L PCR products detect through 2% agarose gel electrophoresis, and positive is used for next step enzyme and cuts detection.
3.RFLP detect
(1) HaeIII-RFLP detection molecules mark G387-C387
With PCR product 3 μ L, 10 * Buffer, 1 μ L, restriction enzyme HaeIII is 0.2 μ L (2U), add distilled water and mend to 10 μ L, with centrifugal behind the sample mixing, 37 ℃ of incubators are placed 10-12h, detect enzyme with 2% agarose gel electrophoresis and cut the result, take pictures under ultraviolet lamp, the record genotype the results are shown in Figure 6.
Molecular marker gene type analysis: as shown in Figure 6, three kinds of genotype wherein the GG type for homozygous (the having only DNA band of 324bp during electrophoresis detection) that enzyme is cut do not taken place, homozygous (the occurring two DNA bands of 228bp and 96bp during electrophoresis detection) that enzyme is cut for taking place in the CC type, CG is heterozygous (occurring 324bp during electrophoresis detection, three DNA bands of 228bp and 96bp).
(2) MbiI-RFLP detection molecules mark A474-G474
With PCR product 3 μ L, 10 * Buffer, 1 μ L, restriction enzyme MbiI are 0.2 μ L (2U), add distilled water and mend to 10 μ L, with centrifugal behind the sample mixing, 37 ℃ of incubators are placed 12h, detect enzyme with 2% agarose gel electrophoresis and cut the result, take pictures under ultraviolet lamp, the record genotype is as Fig. 7.
Molecular marker gene type analysis: as shown in Figure 7, homozygous (the having only DNA band of 324bp during electrophoresis detection) that enzyme is cut for not taking place in three kinds of its medium-sized AA of genotype, homozygous (the occurring two DNA bands of 185bp and 139bp during electrophoresis detection) that enzyme is cut for taking place in the GG type, AG is heterozygous (occurring 324bp during electrophoresis detection, three DNA bands of 185bp and 139bp).
Embodiment 2:
The distribution of PCR-MbiI-RFLP polymorphism in different pig kinds detects
(1) PCR-MbiI-RFLP detects
Utilizing PCR-MbiI-RFLP to detect 5 pig kinds, comprising the Chinese native pig breed blood relationship, is respectively painted face in Beijing opera pig and peaceful pig, and external pig or external pig blood relationship are respectively landrace, Large White and duroc.
(2) detected result analysis
Genotype and the gene frequency of this sudden change in different pig kinds is as shown in table 1.The result is presented at that allelotrope G preponderates in the place of china pig blood relationship, promptly 474 main forms with bases G exist in the coding region, the equipotential gene A is preponderated in the pig blood relationship abroad, and promptly 474 main forms with base A exist in the coding region, but not obvious at external pig blood relationship landrace.
Table 474 (A474G) allelotrope of 1.Cav1 gene coding region and genotype frequency are in the distribution of different varieties
Embodiment 3:
The present invention clone's the application of molecule marker in the immune character association analysis
(1) makes up the scanning of family and genotype
The immune character resource family that is used for association analysis is the purebred landrace colony (external pig blood relationship) by Wuhan City Hua Zhong Agriculture University and Guangdong Province Hua Nongwenshi herding limited-liability company amalgamated consolidation, the parent is 17 landrace boars and 36 landrace sows, and F1 is for totally 302 of long white piglets.F1 adopts ordinary method that 3 kinds of antiviral antibody levels (pig breeding and breathing syndrome virus antibody horizontal, Pestivirus suis antibody horizontal, Pseudorabies virus antibody horizontal) and 18 routine blood tests are detected for gathering anticoagulation and non-anticoagulation at 0,17,32 ages in days.
Group structure and influence factor according to immune character resource family, the applicant uses mixed linear model to analyze the influence of Cav1 gene different genotype to the immune indexes of mensuration, Mixed Models program is carried out data processing and statistical study in employing SAS (Version 8.1) software, and model is as follows:
Y
ijklmn＝μ+Genotype
i+Sex
j+Parity
k+Environment
l+Sire
m+Dam
n(Sire
m)+ε
ijklmn
Wherein Y represents above-mentioned immune indexes; μ represents the average of each proterties; Genotype represents the genotype effect, (i=3:1 sudden change produces 3 kinds of genotype), sex represents sex (j=2), and parity represents parity (k=2 :), and environment represents environmental effect (l=2), and these all are fixed effects; Sire represents male animal effect (m=17), and dam represents dam effect (n=36), and these are stochastic effect; ε represents random residual.
(2) association analysis of Cav1 gene molecule marker proterties and immune character
(1) molecule marker G387-C387 (being Cav1 gene HaeIII-RFLP)
Use PCR-HaeIII-RFLP detection molecules mark G387-C387 genotype and carry out association analysis, the result shows: in detecting colony, CC genotype individuality has 90, and CG genotype individuality has 145, and GG genotype individuality has 62.This mark is to the pig breeding and breathing syndrome virus (reproductive and respiratory syndrome virus) antibody horizontal of 17 ages in days, and white corpuscle counts, and lymphocyte per-cent and big thrombocyte ratio influence are significantly.Wherein GG genotype individuality has better immunizing power and health level, G allelotrope is the beneficial gene of pig immunity, be in particular in carry this allelic individuality can be at white corpuscle, immune indexes such as lymphocyte and thrombocyte aspect shows more vigorous vigor, and its body can produce the reproductive and respiratory syndrome virus positive antibody of appropriate level.G allelotrope also is the beneficial gene of the Erythrocyte hemoglobin distribution width of pig 0 age in days simultaneously.Concrete outcome sees Table shown in the 2-6:
The association analysis result of table 2:Cav1 gene HaeIII-RFLP polymorphism and 0 age in days immune character
*The expression significant difference, P＜0.05;
*Expression difference is P＜0.01 (same in the following form) extremely significantly
As shown in Table 2, Cav1 gene HaeIII-RFLP polymorphism and 0 age in days Erythrocyte hemoglobin distribution width remarkable related (p=0.0354＜0.05), this site has no significant effect other immune character of this age in days.
The least square average of table 3:Cav1 gene HaeIII-RFLP different genotype piglet 0 age in days Erythrocyte hemoglobin distribution width
As shown in Table 3, the Erythrocyte hemoglobin distribution width of CC genotype piglet is significantly higher than CG genotype (p＜0.05), also is higher than the GG genotype.Erythrocyte hemoglobin distribution width is more little, illustrates that erythrocytic function is normal more, and abnormal erythrocyte is few more, so G allelotrope is the beneficial gene of the Erythrocyte hemoglobin distribution width of 0 age in days.
The association analysis result of table 4:Cav1 gene HaeIII-RFLP polymorphism and 17 age in days immune characters
*The expression significant difference, P＜0.05;
*Expression difference is P＜0.01 (same in the following form) extremely significantly
As shown in Table 4, the reproductive and respiratory syndrome of Cav1 gene HaeIII-RFLP polymorphism and piglet 17 age in days pigs (blue otopathy) antibody, total white blood cells, lymphocyte absolute value and big thrombocyte ratio significant correlation (p＜0.05), this site has no significant effect other immune character.
The blue otopathy antibody of table 5:Cav1 gene HaeIII-RFLP different genotype piglet 17 ages in days, total white blood cells, the least square average of lymphocyte absolute value and big thrombocyte ratio
As shown in Table 5, the pig breeding of 17 ages in days of GG genotype individuality is 0.80 ± 0.18 with breathing syndrome virus (reproductive and respiratory syndrome virus) antibody horizontal, significantly be lower than CG genotype 1.01 ± 0.17 (p＜0.05), also be lower than simultaneously CC genotype 0.95 ± 0.17, but all be in the antibody positive threshold range, this explanation GG genotype can produce enough antibody, but its immune response is too not hyperfunction again; The leukocyte count of 17 ages in days of GG genotype individuality is 11.51 ± 0.56, is significantly higher than CG genotype 9.93 ± 0.37 (p＜0.05), and also is higher than CC genotype 10.07 ± 0.48; The lymphocyte number of 17 ages in days of GG genotype individuality is 8.34 ± 0.60 simultaneously, is significantly higher than CG genotype 6.78 ± 0.43 (p＜0.05), and also is higher than CC genotype 7.28 ± 0.53, and the immunizing power of this explanation GG genotype 17 age in days piglets is stronger; The big thrombocyte ratio of 17 ages in days of GG genotype individuality is 31.04 ± 1.39, be significantly higher than CG genotype 28.71 ± 1.11 (p＜0.05), also be higher than CC genotype 30.38 ± 1.28, enough big thrombocytes are the essential of blood normal function, the big thrombocyte ratio of the piglet of GG genotype 17 ages in days is higher, and its blood is more healthy.The above results shows that G allelotrope is the favourable mark of the pigling immunity of 17 ages in days.
The association analysis result of table 6:Cav1 gene HaeIII-RFLP polymorphism and 32 age in days immune characters
*The expression significant difference, P＜0.05;
*Expression difference is P＜0.01 (same in the following form) extremely significantly
As shown in Table 6, Cav1 gene HaeIII-RFLP polymorphism and 32 immune characters that age in days is surveyed have no significant effect.
(2) molecule marker A474-G474 (being Cav1 gene M biI-RFLP)
Use PCR-MbiI-RFLP detection molecules mark A474-G474 genotype and carry out association analysis, the result shows: in detecting colony, AA genotype individuality has 30, and AG genotype individuality has 118, and GG genotype individuality has 147.This mark is to the average content of hemoglobin of red corpuscle and the lymphocyte per-cent of piglet 0 age in days, and the influence of the hemoglobin concentration of the platelet count of 17 ages in days and 32 ages in days significantly.No matter be that GG genotype piglet all has better immunizing power and health level than other genotype piglets at 0 age in days or 17 and 32 ages in days, G allelotrope is the beneficial gene of pig immunity and health level.Concrete outcome sees Table 7-12:
The association analysis result of table 7:Cav1 gene M biI-RFLP polymorphism and 0 age in days immune character
*The expression significant difference, P＜0.05;
*Expression difference is P＜0.01 (same in the following form) extremely significantly
As shown in Table 7, Cav1 gene M biI-RFLP polymorphism and 0 age in days mean corpuscular hemoglobin and lymphocyte per-cent remarkable related (p=＜0.05), this site is not remarkable to other immune character influence of this age in days.
The least square average of table 8:Cav1 gene M biI-RFLP different genotype piglet 0 age in days mean corpuscular hemoglobin and lymphocyte per-cent
As shown in Table 8, the mean corpuscular hemoglobin of GG genotype piglet 0 age in days is 276.15 ± 3.82, is significantly higher than AA genotype 267.47 ± 4.98 (p＜0.05) and is higher than AG genotype 277.94 ± 3.84.The lymphocyte per-cent of 0 age in days of GG genotype piglet is 86.0835 ± 4.70 simultaneously, be significantly higher than AG genotype 75.3248 ± 4.78 (p＜0.05), also be higher than AA genotype 81.78 ± 7.11, the oxygen content of blood of this prompting GG genotype 0 age in days piglet is higher, immunizing power is stronger, more healthy, G allelotrope is beneficial gene.
The association analysis result of table 9:Cav1 gene M biI-RFLP polymorphism and 17 age in days immune characters
*The expression significant difference, P＜0.05;
*Expression difference is P＜0.01 (same in the following form) extremely significantly
As shown in Table 9, the platelet count significant correlation (p＜0.05) of Cav1 gene M biI-RFLP polymorphism and piglet 17 ages in days, this site has no significant effect other immune character.
The least square average of table 10:Cav1 gene M biI-RFLP different genotype piglet 17 age in days platelet counts
As shown in Table 10, the platelet count of 17 ages in days of GG genotype individuality is 470.2 ± 23.08, be higher than the AA genotype 422.08 ± 33.94 and the utmost point and be significantly higher than AG genotype 417.78 ± 23.15 (p＜0.05), hematoblastic minimizing is the sign of organism disease normally, so GG genotype piglet is higher more healthy because of its platelet content, G allelotrope is beneficial gene.
The association analysis result of table 11:Cav1 gene M biI-RFLP polymorphism and 32 age in days immune characters
*The expression significant difference, P＜0.05;
*Expression difference is P＜0.01 (same in the following form) extremely significantly
As shown in Table 11, Cav1 gene M biI-RFLP polymorphism and 32 immune characters that age in days is surveyed have no significant effect.
The least square average of table 12:Cav1 gene M biI-RFLP different genotype piglet 32 age in days content of hemoglobin
As shown in Table 12, the content of hemoglobin of GG genotype piglet 32 ages in days is 122.67 ± 2.98, be significantly higher than AA genotype 113.69 ± 4.09 (p＜0.05), also be higher than AG genotype 123.35 ± 2.95, the blood oxygen carrying capacity of this prompting GG genotype 32 age in days piglets is stronger, more healthy, G allelotrope is beneficial gene.
Sequence table
＜110〉Hua Zhong Agriculture University
＜120〉pig immunity related molecular marker clone and application
<130>
<141>2009-02-18
<160>2
<170>PatentIn?version?3.1
<210>1
<211>620
<212>DNA
＜213〉pig (Sus scrofa)
<220>
<221>gene
<222>(1)..(620)
<223>
<220>
<221>mutation
<222>(512)..(512)
<223>
<220>
<221>mutation
<222>(474)..(474)
<223>
<220>
<221>mutation
<222>(387)..(387)
<223>
<220>
<221>CDS
<222>(1)..(537)
<223>
<400>1
atg?tcg?ggg?ggg?caa?tac?gta?gac?tca?gag?gga?cat?ctc?tac?acc?gtc 48
Met?Ser?Gly?Gly?Gln?Tyr?Val?Asp?Ser?Glu?Gly?His?Leu?Tyr?Thr?Val
1 5 10 15
ccc?atc?cgg?gaa?cag?ggc?aac?atc?tac?aag?ccc?aac?aac?aag?gcc?atg 96
Pro?Ile?Arg?Glu?Gln?Gly?Asn?Ile?Tyr?Lys?Pro?Asn?Asn?Lys?Ala?Met
20 25 30
gca?gag?gaa?atg?aac?gag?aag?caa?gtg?tat?gac?gcg?cac?acc?aag?gag 144
Ala?Glu?Glu?Met?Asn?Glu?Lys?Gln?Val?Tyr?Asp?Ala?His?Thr?Lys?Glu
35 40 45
ata?gac?ttg?gtc?aac?cgc?gat?ccc?aag?cat?ctc?aac?gac?gac?gtt?gtc 192
Ile?Asp?Leu?Val?Asn?Arg?Asp?Pro?Lys?His?Leu?Asn?Asp?Asp?Val?Val
50 55 60
aag?att?gat?ttt?gaa?gat?gtg?att?gca?gaa?cca?gaa?ggg?aca?cac?agt 240
Lys?Ile?Asp?Phe?Glu?Asp?Val?Ile?Ala?Glu?Pro?Glu?Gly?Thr?His?Ser
65 70 75 80
ttc?gat?ggc?atc?tgg?aag?gcc?agc?ttc?acc?acc?ttc?act?gtg?acg?aag 288
Phe?Asp?Gly?Ile?Trp?Lys?Ala?Ser?Phe?Thr?Thr?Phe?Thr?Val?Thr?Lys
85 90 95
tac?tgg?ttt?tac?cgt?ttg?ctg?tct?gcc?ctc?ttt?ggc?atc?cca?atg?gcg 336
Tyr?Trp?Phe?Tyr?Arg?Leu?Leu?Ser?Ala?Leu?Phe?Gly?Ile?Pro?Met?Ala
100 105 110
ctc?atc?tgg?ggc?att?tac?ttt?gcc?att?ctc?tcc?ttc?ctg?cac?atc?tgg 384
Leu?Ile?Trp?Gly?Ile?Tyr?Phe?Ala?Ile?Leu?Ser?Phe?Leu?His?Ile?Trp
115 120 125
gcg?gtt?gta?ccc?tgc?att?aag?agt?ttc?ctg?att?gag?att?cag?tgc?atc 432
Ala?Val?Val?Pro?Cys?Ile?Lys?Ser?Phe?Leu?Ile?Glu?Ile?Gln?Cys?Ile
130 135 140
agc?cgt?gtc?tat?tcc?atc?tac?gtc?cac?acc?ttc?tgt?gac?cca?ctc?ttt 480
Ser?Arg?Val?Tyr?Ser?Ile?Tyr?Val?His?Thr?Phe?Cys?Asp?Pro?Leu?Phe
145 150 155 160
gag?gct?att?ggc?aaa?ata?ttc?agc?aat?atc?cac?atc?aac?atg?cag?aaa 528
Glu?Ala?Ile?Gly?Lys?Ile?Phe?Ser?Asn?Ile?His?Ile?Asn?Met?Gln?Lys
165 170 175
gaa?ata?taa?gtgacatttc?aagggtataa?gtatacccaa?ttcttctttg 577
Glu?Ile
tcccttttaa?ttttcttggt?gccaatttcg?agtttcaatt?tga 620
<210>2
<211>178
<212>PRT
＜213〉pig (Sus scrofa)
<400>2
Met?Ser?Gly?Gly?Gln?Tyr?Val?Asp?Ser?Glu?Gly?His?Leu?Tyr?Thr?Val
1 5 10 15
Pro?Ile?Arg?Glu?Gln?Gly?Asn?Ile?Tyr?Lys?Pro?Asn?Asn?Lys?Ala?Met
20 25 30
Ala?Glu?Glu?Met?Asn?Glu?Lys?Gln?Val?Tyr?Asp?Ala?His?Thr?Lys?Glu
35 40 45
Ile?Asp?Leu?Val?Asn?Arg?Asp?Pro?Lys?His?Leu?Asn?Asp?Asp?Val?Val
50 55 60
Lys?Ile?Asp?Phe?Glu?Asp?Val?Ile?Ala?Glu?Pro?Glu?Gly?Thr?His?Ser
65 70 75 80
Phe?Asp?Gly?Ile?Trp?Lys?Ala?Ser?Phe?Thr?Thr?Phe?Thr?Val?Thr?Lys
85 90 95
Tyr?Trp?Phe?Tyr?Arg?Leu?Leu?Ser?Ala?Leu?Phe?Gly?Ile?Pro?Met?Ala
100 105 110
Leu?Ile?Trp?Gly?Ile?Tyr?Phe?Ala?Ile?Leu?Ser?Phe?Leu?His?Ile?Trp
115 120 125
Ala?Val?Val?Pro?Cys?Ile?Lys?Ser?Phe?Leu?Ile?Glu?Ile?Gln?Cys?Ile
130 135 140
Ser?Arg?Val?Tyr?Ser?Ile?Tyr?Val?His?Thr?Phe?Cys?Asp?Pro?Leu?Phe
145 150 155 160
Glu?Ala?Ile?Gly?Lys?Ile?Phe?Ser?Asn?Ile?His?Ile?Asn?Met?Gln?Lys
165 170 175
Glu?Ile
Claims (4)
1. molecule marker relevant with pig immunity, its nucleotide sequence is shown in sequence table SEQ ID NO:1.
2. molecule marker according to claim 1 is characterized in that: there is 1 base mutation by G387-C387 at the 387bp place of sequence table SEQ ID NO:1, causes the HaeIII-RFLP polymorphism.
3. molecule marker according to claim 1 is characterized in that: there is 1 base mutation by A474-G474 at the 474bp place of sequence table SEQ ID NO:1, causes the MbiI-RFLP polymorphism.
4. each described molecule marker application in the pig assisted selection of claim 1-3.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910060794XA CN101487054B (en) | 2009-02-19 | 2009-02-19 | Cloning and use of pig immunity related molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910060794XA CN101487054B (en) | 2009-02-19 | 2009-02-19 | Cloning and use of pig immunity related molecular marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101487054A CN101487054A (en) | 2009-07-22 |
| CN101487054B true CN101487054B (en) | 2011-06-22 |
Family
ID=40890114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910060794XA Expired - Fee Related CN101487054B (en) | 2009-02-19 | 2009-02-19 | Cloning and use of pig immunity related molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101487054B (en) |
-
2009
- 2009-02-19 CN CN200910060794XA patent/CN101487054B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 陈慧勇，吴珍芳.BF、DRB……可行性初步分析.《生物技术通报》.2009,(第1期),103-106. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101487054A (en) | 2009-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hornberg et al. | Genetic diversity of pestivirus isolates in cattle from Western Austria | |
| Beka et al. | Low-level antimicrobials in the medicinal leech select for resistant pathogens that spread to patients | |
| CN101503688B (en) | CD163 gene fragment clone related to pig immune trait and use thereof as molecular marker | |
| CN101570789B (en) | Identification and application of pig MHC II TA gene as immunity related molecular labels | |
| Chen et al. | MHC II α polymorphism of Nile tilapia, Oreochromis niloticus, and its association with the susceptibility to Gyrodactylus cichlidarum (Monogenea) infection | |
| CN101392254A (en) | Clone of molecular marker relating to pig immune trait and uses thereof | |
| CN101921857B (en) | PCR-RFLP test method for mononucleotide polymorphism of Chinese local cattle Pax7 gene | |
| CN108998543B (en) | SNP molecular marker related to pig red blood cell number character | |
| CN102296074B (en) | Pig immune trait associated CD169 gene and preparation method and use thereof | |
| CN101487054B (en) | Cloning and use of pig immunity related molecular marker | |
| CN102703440A (en) | Goat SH2B1 gene single nucleotide polymorphism loci and detection method thereof | |
| CN106521000B (en) | Molecular marker related to piglet weaning weight and diarrhea resistance and application of molecular marker in pig breeding | |
| CN102329885B (en) | Kit for detecting polymorphism of VKORC1 and CYP2C9 genes | |
| Ularamu et al. | Genetic characterization of bovine viral diarrhoea (BVD) viruses: confirmation of the presence of BVD genotype 2 in Africa | |
| CN105838798A (en) | Chicken MHC B-G seat complete sequence determination and SNP detection method and kit | |
| CN102031304B (en) | Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof | |
| CN101693919B (en) | PCR amplification primer for chondriosome cytb gene segment of Marsupenaeus japonicus and identification method thereof | |
| CN103898104A (en) | Molecular marker applied as pig marker assisted selection and related to immune traits and application thereof | |
| CN106399531B (en) | One influences molecular labeling, detection method and its application of pig growth and PRRSV resistance | |
| CN104450933A (en) | Detection method and kit for single nucleotide polymorphism site of goat LYRM1 (LYR motif-containing protein 1) gene | |
| CN103289993B (en) | AP3D1 gene used as porcine birth weight character related molecular marker | |
| CN106399532B (en) | One influences the SLA-DRB1 promoter region molecular marker and primer thereof and application of pig growth and PRRSV resistance | |
| CN106520930B (en) | One influences pig growth and SLA-DRB1 promoter region molecular labeling and its application of PRRSV resistance | |
| CN107760792B (en) | SNP marker of goat NOD1 gene and application | |
| CN103289992A (en) | ABCF1 gene used as porcine birth weight character related molecular marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110622 Termination date: 20130219 |