CN101475980B - Reagent kit for predicting plateau pneumochysis pathogenesis risk via NOS3 gene copy number - Google Patents
Reagent kit for predicting plateau pneumochysis pathogenesis risk via NOS3 gene copy number Download PDFInfo
- Publication number
- CN101475980B CN101475980B CN2008102329164A CN200810232916A CN101475980B CN 101475980 B CN101475980 B CN 101475980B CN 2008102329164 A CN2008102329164 A CN 2008102329164A CN 200810232916 A CN200810232916 A CN 200810232916A CN 101475980 B CN101475980 B CN 101475980B
- Authority
- CN
- China
- Prior art keywords
- nos3
- primer
- plateau
- beta
- copy number
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a reagent box using NOS3 gene copy number for the risk prediction of plateau pulmonary edema, including the separation of the packaged NOS3 primers mixture, Beta-actin primer mixture, PCR reaction solution, sterile deionized water, fixed value standard, and healthy contradistinguish DNA, which is characterized in that the upstream and downstream primer sequences in the NOS3 primer mixture are F: 5'-TGTCCAGAGGCTGCAAGG-3' and R: 5'-AAGAAACAGGAAGCGGGTG-3'; the upstream and downstream primer sequences in the Beta-actin primer mixture are F: 5'-CGGGAAATCGTGCGTGACAT-3' and R: 5'-GAAGGAAGGCTGGAAGAGTG-3'. The present invention can be used for screening of susceptible people who will enter into plateau from the plain, advising prevention and treatment of plateau pulmonary edema and in favor of the health of people accessing to the plateau; the reagent box has simple use, easy operations and rapid detection.
Description
Technical field
The present invention relates to detect the test kit of usefulness, be specifically related to a kind ofly predict the test kit of high pulmonary edema onset risk, be used for the susceptibility of the former pulmonary edema of adjuster's height by the NOS3 gene copy number.
Background technology
Plateau pneumochysis (high altitude pulmonary edema, abbreviation HAPE) be that a kind of spy sends out the pulmonary edema in environment of low oxygen plateau, onset is anxious, progress is fast, harm is big, if give treatment to untimelyly, can be developed to respiratory insufficiency in the short period of time, even dead, be the acute severe altitude sickness that serious threat enters plateau population health and life.In recent years investigation shows that among the crowds of Han nationality who enters height above sea level plateau more than 3000 meters from the Plain, the sickness rate of plateau pneumochysis is up to 0.4%-2%.The plateau pneumochysis morbidity has tangible family and individual susceptible tendency, and environmental factors and inherited genetic factors all can influence the generation of plateau pneumochysis.In recent years, come into one's own gradually [Zhang Xuefeng, the acute heavy altitude sickness prevalence survey of plateau construction crowd, " plateau medicine magazine ", 2005 of the effect of inherited genetic factors in the plateau pneumochysis pathogenesis; 15 (3): 7-8; Old have, plateau pneumochysis pathogenesis progress, " plateau medicine magazine ", 2005,15 (2): 62-64; Gao Yuqi, the pathogenesis of plateau pneumochysis and control, " the medical officer people ", 2005; 482 (2): 108-111].
At present, think that the fundamental mechanism that plateau pneumochysis takes place has: Ppa pulmonary artery pressure excessively raises; Vascular permeability and pulmonary strengthens; The removing obstacles of alveolar epithelium heap water; Plasma colloid osmotic pressure reduces.Wherein excessive rising of Ppa pulmonary artery pressure is the key link of plateau pneumochysis morbidity.NO (nitrogen protoxide) has vasorelaxation action, can reduce the pulmonary hypertension that anoxic causes rapidly, reduces the generation of plateau pneumochysis.Nitric oxide synthetase (nitric oxide synthase is abbreviated as NOS3) is a topmost rate-limiting factor in the NO generative process, is NO synthetic key enzyme.The single nucleotide polymorphism of report such as Ahsan A NOS3 and the generation of plateau pneumochysis are closely related, [Ahsan A, eNOS allelic variants at the same locus associatewith HAPE and adaptation, " Thorax ", 2004; 59 (11): 1000-1002].Bibliographical information is arranged at present, the copy number of some genes is relevant with the susceptibility of disease, be genetic marker [the Braude I of some diseases, Largesca lecopy number variation (CNV) at 14q12 isassociated with the presence of genomic abnormalities in neoplasia, " BMC Genomics ", 20067:138.], still there is not report about the dependency of NOS3 copy number and plateau pneumochysis susceptible.
Method by SYBR (being SYBR GREEN dyestuff, abbreviation SYBR) quantitative PCR (polymerase chain reaction) detects the NOS3 copy number, finds to have dependency between NOS3 copy number and the elevated plain pneumochysis susceptibility.Specific practice is:
(1) normal healthy controls group sample (25 example): gather to intend entering plateau personnel's venous blood 2ml (EDTA anti-freezing) in Chengdu, reach Lhasa (3658 meters of height above sea level) by air, by plane with them then, and observe them and in one week plateau pneumochysis does not take place in Lhasa;
(2) plateau pneumochysis case group sample (25 example): for normal healthy controls group sample age-matched, by altitude sickness Case definition [China's altitude sickness name, somatotype and Case definition, " plateau medicine magazine ", 1996:2-4] meet the case of plateau pneumochysis Case definition.Follow " Helsinki " declaration in the sample collection process, this research has obtained the informed consent of intelligence-collecting object, gathers venous blood 2ml (EDTA anti-freezing).
(3) give birth to the worker's biotechnology UNIQ-10 of Services Co., Ltd pillar clinical sample genome extraction agent box (article No. SK1342) with Shanghai respectively and extract normal healthy controls group sample and plateau pneumochysis case group sample blood leucocyte DNA, adopt the method for quantitative PCR (SYBR dye method) increase respectively normal healthy controls group sample and the NOS3 gene of plateau pneumochysis case group sample and the house-keeping gene Beta-actin of nuclear gene encoding then; Calculate the ratio of the copy number of the NOS3 copy number of every routine sample and Beta-actin more respectively, the independent sample T check of result in SPSS12.0 (a kind of statistical software) tested, with P＜0.05 for differing remarkable, and the credibility interval by this computed in software 95%, to obtain the reference value of normal healthy controls group and plateau pneumochysis case group NOS3/Beta-actin copy number respectively, the copy number ratio that found that NOS3/Beta-actin in plateau pneumochysis case group significantly raise (table 1).
NOS3/Beta-actin copy number ratio in table 1 plateau pneumochysis case group and the normal healthy controls group
| Normal healthy controls group (n=25) plateau pneumochysis case group (n=25) |
| NOS3/Beta-actin 0.1086±0.0366 0.0667±0.0307 ▲ |
| 95% credibility interval 0.0872-0.1239 0.0497-0.0837 |
▲Plateau pneumochysis case group vs normal healthy controls group: P=0.001
Summary of the invention
The purpose of this invention is to provide a kind of test kit of predicting high pulmonary edema onset risk by the NOS3 gene copy number, can be used for people from Plain and enter before the plateau screening the plateau pneumochysis susceptible person, instruct the prevention and the treatment of plateau pneumochysis, the threat that alleviates acute severe altitude sickness.
Of the present inventionly a kind ofly predict the test kit of high pulmonary edema onset risk, comprise the NOS3 primer mixed solution that separates packing, Beta-actin primer mixed solution by the NOS3 gene copy number, the PCR reaction solution, aseptic deionized water, numeraire product, normal healthy controls DNA is characterized in that
The upstream primer (F) in the described NOS3 primer mixed solution and the sequence of downstream primer (R) are:
F:5 '-TGTCCAGAGGCTGCAAGG-3 ' and R:5 '-AAGAAACAGGAAGCGGGTG-3 ';
The upstream primer in the described Beta-actin primer mixed solution and the sequence of downstream primer are:
F:5 '-CGGGAAATCGTGCGTGACAT-3 ' and R:5 '-GAAGGAAGGCTGGAAGAGTG-3 ';
Described PCR reaction solution contains PCR damping fluid, MgCl
2, dNTPs (deoxynucleoside triphosphate), SYBR dyestuff, Ex Taq enzyme;
Described numeraire product are that the upstream and downstream primer with Beta-actin carries out the segmental amplification of purpose in the PTC-200PCR instrument, obtain containing the segmental PCR product of purpose, then with among the purpose fragment inserting clone carrier pMD18-T, and positive colony increased sequence verification behind the bacterium; From the bacterium liquid that confirms to contain the Beta-actin gene fragment, extract plasmid.
Described a kind of test kit of predicting high pulmonary edema onset risk by the NOS3 gene copy number, its described normal healthy controls DNA is the venous blood 2ml (EDTA anti-freezing) that gather to intend entering the personnel before the plateau, and behind the plateau plateau pneumochysis did not take place in a week, then, extract blood leucocyte DNA, again DNA concentration is adjusted to 50ng/ μ l.
Describedly a kind ofly predict the test kit of high pulmonary edema onset risk by the NOS3 gene copy number, its described NOS3 primer mixed solution is 100 μ l; Each 50 μ l of upstream primer and downstream primer wherein, concentration is 10pmol/ μ l.
Describedly a kind ofly predict the test kit of high pulmonary edema onset risk by the NOS3 gene copy number, its described Beta-actin primer mixed solution is 400 μ l; Each 200 μ l of upstream primer and downstream primer wherein, concentration is 10pmol/ μ l.
Describedly a kind ofly predict the test kit of high pulmonary edema onset risk by the NOS3 gene copy number, its described numeraire product are 5 pipes with the aseptic deionized water doubling dilution, every pipe volume 200 μ l, and concentration is respectively 1 * 10
4, 1 * 10
5, 1 * 10
6, 1 * 10
7, 1 * 10
8Copy/μ l.
Describedly a kind ofly predict the test kit of high pulmonary edema onset risk by the NOS3 gene copy number, its described aseptic deionized water is 1500 μ l.
The present invention has set up and has utilized quantitative PCR (SYBR dye method) method to detect the method for NOS3 copy number, can be used for people from Plain and enter before the plateau screening the plateau pneumochysis susceptible person, instruct the prevention and the treatment of plateau pneumochysis, alleviate the threat of acute severe altitude sickness, help entering the plateau population health; This test kit uses simple, and is easy to operate, detects fast.
Embodiment
Of the present inventionly a kind ofly predict the test kit of high pulmonary edema onset risk, comprise the NOS3 primer mixed solution that separates packing, Beta-actin primer mixed solution by the NOS3 gene copy number, the PCR reaction solution, aseptic deionized water, numeraire product, normal healthy controls DNA;
The upstream primer in the NOS3 primer mixed solution in the test kit and the sequence of downstream primer are:
F:5 '-TGTCCAGAGGCTGCAAGG-3 ' and R:5 '-AAGAAACAGGAAGCGGGTG-3 ';
The upstream primer in the described Beta-actin primer mixed solution and the sequence of downstream primer are:
F:5 '-CGGGAAATCGTGCGTGACAT-3 ' and R:5 '-GAAGGAAGGCTGGAAGAGTG-3 ';
PCR reaction solution in the test kit contains PCR damping fluid, MgCl
2, dNTPs (deoxynucleoside triphosphate), SYBR dyestuff, Ex Taq enzyme, all directly purchase in precious biotechnology (Dalian) company limited, article No. DRR041S.
Numeraire product in the test kit are that the upstream and downstream primer with Beta-actin carries out the segmental amplification of purpose in the PTC-200PCR instrument, obtain containing the segmental PCR product of purpose, then with among the purpose fragment inserting clone carrier pMD18-T, and positive colony increased sequence verification behind the bacterium; From the bacterium liquid that confirms to contain the Beta-actin gene fragment, extract plasmid.
Normal healthy controls DNA in the test kit is the venous blood 2ml (EDTA anti-freezing) that gather to intend entering the personnel before the plateau, and behind the plateau plateau pneumochysis does not take place in a week, and then, extraction blood leucocyte DNA is adjusted to DNA concentration 50ng/ μ l again.
NOS3 primer mixed solution in the test kit is 100 μ l; Each 50 μ l of upstream primer and downstream primer wherein, concentration is 10pmol/ μ l.
Beta-actin primer mixed solution in the test kit is 400 μ l; Each 200 μ l of upstream primer and downstream primer wherein, concentration is 10pmol/ μ l.
Numeraire product in the test kit are 5 pipes with the aseptic deionized water doubling dilution, every pipe volume 200 μ l, and concentration is respectively 1 * 10
4, 1 * 10
5, 1 * 10
6, 1 * 10
7, 1 * 10
8Copy/μ l.
Aseptic deionized water in the test kit is 1500 μ l.
Numeraire product in test kit Beta-actin upstream and downstream primer, in the PTC-200PCR instrument, increase, condition is 94 ℃ of pre-sex change 5min, 94 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 45s, 94 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended wherein 94 ℃ of sex change 30s of 45s......, 60 ℃ of annealing 30s, 72 ℃ are extended 45s circulation 29 times, 72 ℃ eventually the end extend 8min, the PCR product inserts purpose fragment (amplified production) among the cloning vector pMD18-T (purchase in precious biotechnology company limited) through using after the electrophoresis detection, and positive colony is increased sequence verification behind the bacterium;
From the bacterium liquid that confirms to contain the Beta-actin gene fragment, extract plasmid, adopt spectrophotometer to record plasmid concentration, calculate volumetric molar concentration (quality is counted ÷ 324.5 ÷ 10 divided by base) again, multiply by sieve constant (6.02 * 10 that Ah stroking adds again
23), the concentration that obtains plasmid is 1 * 10
8Copy/μ l.Plasmid is carried out doubling dilution (diluting five gradients altogether).After the dilution standard substance (being above-mentioned plasmid) are contained in respectively in the 200 μ l tubules, in-20 ℃ refrigerator, preserve, avoid the plasmid multigelation to cause degraded;
Normal healthy controls DNA, gather plan in Chengdu and enter plateau personnel's venous blood 2ml, then, reach Lhasa by air, by plane with them, and observe they one the week and plateau pneumochysis did not take place in this week, venous blood samples 2ml (EDTA anti-freezing) also extracts blood leucocyte DNA.
The operation instruction of this test kit:
The first step, individual sample to be measured is prepared, adopt Shanghai to give birth to the worker's biotechnology UNIQ-10 of Services Co., Ltd pillar clinical sample genome extraction agent box (article No. SK1342) and extract white corpuscle genome DNA in the individual venous blood to be measured, with the uv-spectrophotometric instrument DNA is carried out quantitatively then;
In second step, ten pipes are prepared in the preparation of PCR reaction system altogether;
First pipe to the, five pipes are the numeraire product, totally 5 manage, and concentration is respectively:
Getting 10 μ l concentration is 1 * 10
8The plasmid of copy/μ l;
Getting 10 μ l concentration is 1 * 10
8The plasmid of copy/μ l adds 90 μ l aseptic deionized waters, and it is 1 * 10 that mixing obtains concentration
7The plasmid of copy/μ l;
Getting 10 μ l concentration is 1 * 10
7The plasmid of copy/μ l adds 90 μ l aseptic deionized waters, and it is 1 * 10 that mixing obtains concentration
6The plasmid of copy/μ l;
Getting 10 μ l concentration is 1 * 10
6The plasmid of copy/μ l adds 90 μ l aseptic deionized waters, and it is 1 * 10 that mixing obtains concentration
5The plasmid of copy/μ l;
Getting 10 μ l concentration is 1 * 10
5The plasmid of copy/μ l adds 90 μ l aseptic deionized waters, and it is 1 * 10 that mixing obtains concentration
4The plasmid of copy/μ l;
Respectively get 0.5 μ l concentration from 1 * 10
4To 1 * 10
8The standard substance of copy/μ l, then, every pipe all adds Beta-actin primer mixed solution 1 μ l successively, PCR reaction solution 12.5 μ l, aseptic deionized water 11 μ l, mixing;
The 6th pipe is the amplification of individual NOS3 to be measured, gets DNA of individual 0.5 μ l to be measured, adds NOS3 primer mixed solution 1 μ l then successively, PCR reaction solution 12.5 μ l, aseptic deionized water 11 μ l, mixing;
The 7th pipe is the amplification of individual house-keeping gene Beta-actin to be measured, gets DNA of individual 0.5 μ l to be measured, adds Beta-actin primer mixed solution 1 μ l then successively, PCR reaction solution 12.5 μ l, aseptic deionized water 11 μ l, mixing;
The 8th pipe is got Beta-actin primer mixed solution 1 μ l respectively, PCR reaction solution 12.5 μ l, aseptic deionized water 11.5 μ l, mixing for blank;
The 9th pipe is the amplification of normal healthy controls sample NOS3, gets contrast DNA 0.5 μ l, adds NOS3 primer mixed solution 1 μ l then successively, PCR reaction solution 12.5 μ l, aseptic deionized water 11 μ l, mixing;
The tenth pipe is the amplification of normal healthy controls sample house-keeping gene Beta-actin, gets contrast DNA 0.5 μ l, adds Beta-actin primer mixed solution 1 μ l then successively, and PCR reacts 12.5 μ l, aseptic deionized water 11 μ l, mixing;
In the 3rd step, the pcr amplification condition is managed the material of mixing with ten of second step and is put into Opticonmonitor1 quantitative PCR instrument respectively, all carries out the PCR reaction by following condition: 95 ℃ of pre-sex change 10s; 95 ℃ of sex change 5s, 20s is extended in 60 ℃ of annealing, reads plate, repeats 39 circulations;
Wherein, NOS3 primer extension product length is 163bp, and sequence is as follows:
tgtccagaggctgcaaggattcagcattattcctccaggaaggagcaaaacgcctcttttccctctctaggcctgttgcctcgggcctgggtccgcctta
Beta-actin primer extension product length is 180bp, and sequence is as follows:
cgggaaatcgtgcgtgacatcaagaagctgtgctacgtcgccctggacttcgagcgggagatggccatggtggccyccagctcctccctggagaagagct
The 4th step, data analysis, after the PCR reaction finishes, the quantitative PCR instrument is by the Ct value and the typical curve Ct value of sample more to be measured, automatically generate the copy number of every routine sample NOS3 and Beta-actin, then, with the NOS3 copy number divided by the Beta-actin copy number, try to achieve the NOS3/Beta-actin copy number ratio of individuality to be measured and contrast respectively, if NOS3/Beta-actin (the 9th pipe/the ten pipe) the copy number ratio of contrast is between 0.0872-0.1239 the time, point out us to test accuracy and sensitivity is credible, when the copy number ratio of individual NOS3/Beta-actin to be measured this moment (the 6th pipe/the seven pipe) was positioned between this gene copy number (0.0497-0.0837) of plateau pneumochysis susceptible person, pointing out our this individuality might be exactly the susceptible individual of plateau pneumochysis.
First to the 5th pipe is the amplification of numeraire product, to obtain typical curve;
Six, seven pipes are for the NOS3 gene that obtains individuality to be measured and the copy number of Beta-actin gene;
The 8th pipe is for the blank pipe, to detect whether pollution is arranged in the whole PCR process; Nine, ten pipes are for the NOS3 gene of contrast and the copy number of Beta-actin gene of securing good health.
Sequence table
＜110〉Military Medical Univ No.3, P.L.A
＜120〉a kind of test kit by NOS3 gene copy number prediction plateau pneumochysis onset risk
<130>
<140>200810232916.4
<141>2008-10-24
<160>6
<170>PatentIn?3.3
<210>1
<211>18
<212>DNA
＜213〉synthetic
＜221〉NOS3 upstream primer
<400>1
tgtccagagg?ctgcaagg 18
<210>2
<211>19
<212>DNA
＜213〉synthetic
＜221〉NOS3 downstream primer
<400>2
aagaaacagg?aagcgggtg 19
<210>3
<211>20
<212>DNA
＜213〉synthetic
＜221〉Beta-actin upstream primer
<400>3
cgggaaatcg?tgcgtgacat 20
<210>4
<211>20
<212>DNA
＜213〉synthetic
＜221〉Beta-actin downstream primer
<400>4
gaaggaaggc?tggaagagtg 20
<210>5
<211>163
<212>DNA
＜213〉NOS3 nucleotide sequence
＜221〉NOS3 pcr amplification product
<400>5
tgtccagagg?ctgcaaggat?tcagcattat?tcctccagga?aggagcaaaa?cgcctctttt 60
ccctctctag?gcctgttgcc?tcgggcctgg?gtccgcctta?atctggaagg?cccctcccag 120
cagcggtacc?ccagggccta?ctgccacccg?cttcctgttt?ctt 163
<210>6
<211>180
<212>DNA
＜213〉Beta-actin nucleotide sequence
＜221〉Beta-actin pcr amplified fragment
<400>6
cgggaaatcg?tgcgtgacat?caagaagctg?tgctacgtcg?ccctggactt?cgagcgggag 60
atggccatgg?tggccyccag?ctcctccctg?gagaagagct?acaagctgct?cgatggccag 120
gtcatcacca?tcggcaacga?gcggttccac?tgccccgagg?cgctcttcca?gccttccttc 180
Claims (5)
1. predict the test kit of high pulmonary edema onset risk by the NOS3 gene copy number for one kind, comprise the NOS3 primer mixed solution that separates packing, Beta-actin primer mixed solution, the PCR reaction solution, aseptic deionized water, the numeraire product, normal healthy controls DNA is characterized in that,
The upstream primer in the described NOS3 primer mixed solution and the sequence of downstream primer are:
F:5 '-TGTCCAGAGGCTGCAAGG-3 ' and R:5 '-AAGAAACAGGAAGCGGGTG-3 ';
The upstream primer in the described Beta-act in primer mixed solution and the sequence of downstream primer are:
F:5 '-CGGGAAATCGTGCGTGACAT-3 ' and R:5 '-GAAGGAAGGCTGGAAGAGTG-3 ';
Described PCR reaction solution contains PCR damping fluid, MgCl
2, dNTPs, SYBR dyestuff, Ex Taq enzyme;
Described numeraire product are that the upstream and downstream primer with Beta-act in carries out the segmental amplification of purpose in the PTC-200PCR instrument, obtain containing the segmental PCR product of purpose, then, in purpose fragment inserting clone carrier pMD18-T, and positive colony increased sequence verification behind the bacterium; From the bacterium liquid that confirms to contain the Beta-actin gene fragment, extract plasmid;
Described normal healthy controls DNA is the venous blood 2ml that gather to intend entering the personnel before the plateau, and behind the plateau plateau pneumochysis does not take place in a week, and then, extraction blood leucocyte DNA is adjusted to DNA concentration 50ng/ μ l again.
2. a kind of the prediction by the NOS3 gene copy number according to claim 1 is characterized in that described NOS 3 primer mixed solutions are 100 μ l at the test kit of high pulmonary edema onset risk; Each 50 μ l of upstream primer and downstream primer wherein, concentration is 10pmol/ μ l.
3. a kind of the prediction by the NOS3 gene copy number according to claim 1 is characterized in that described Beta-actin primer mixed solution is 400 μ l at the test kit of high pulmonary edema onset risk; Each 200 μ l of upstream primer and downstream primer wherein, concentration is 10pmol/ μ l.
4. according to claim 1ly a kind ofly predict the test kit of high pulmonary edema onset risk, it is characterized in that described numeraire product are 5 pipes with the aseptic deionized water doubling dilution by NOS 3 gene copy numbers, every pipe volume 200 μ l, concentration is respectively 1 * 10
4, 1 * 10
5, 1 * 10
6, 1 * 10
7, 1 * 10
8Copy/μ l.
5. a kind of the prediction by the NOS3 gene copy number according to claim 1 is characterized in that described aseptic deionized water is 1500 μ l at the test kit of high pulmonary edema onset risk.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102329164A CN101475980B (en) | 2008-10-24 | 2008-10-24 | Reagent kit for predicting plateau pneumochysis pathogenesis risk via NOS3 gene copy number |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2008102329164A CN101475980B (en) | 2008-10-24 | 2008-10-24 | Reagent kit for predicting plateau pneumochysis pathogenesis risk via NOS3 gene copy number |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101475980A CN101475980A (en) | 2009-07-08 |
| CN101475980B true CN101475980B (en) | 2011-09-21 |
Family
ID=40836759
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2008102329164A Expired - Fee Related CN101475980B (en) | 2008-10-24 | 2008-10-24 | Reagent kit for predicting plateau pneumochysis pathogenesis risk via NOS3 gene copy number |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101475980B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1898394A (en) * | 2003-11-14 | 2007-01-17 | 科学工业研究委员会 | Method of detecting predisposition to high altitude pulmonary edema |
-
2008
- 2008-10-24 CN CN2008102329164A patent/CN101475980B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1898394A (en) * | 2003-11-14 | 2007-01-17 | 科学工业研究委员会 | Method of detecting predisposition to high altitude pulmonary edema |
Non-Patent Citations (2)
| Title |
|---|
| 余军，等.高原高血压患者血清一氧化氮水平的变化及意义.《临床军医杂志》.2003,第31卷(第4期),11－12. * |
| 耿东升,等.高原肺水肿和脑水肿的发病机制及其药物治疗.《医学综述》.2007,第13卷(第21期),1623-1625. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101475980A (en) | 2009-07-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104212904B (en) | A kind of kit and using method thereof for fast detecting mankind CYP2C19 gene pleiomorphism | |
| CN102337338B (en) | Method for simultaneously and quickly detecting number of five types of chromosomes, and kit and application thereof | |
| CN103436631B (en) | A kind of test kit and method detecting CYP3A5 gene pleiomorphism | |
| CN101157954A (en) | Concretion mycobacterium nucleic acid screening method based on loop-mediated isothermal amplification technique | |
| CN102586473B (en) | Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit | |
| CN102912028A (en) | Amplification composite for detecting microdeletion of Y-chromosome and detection kit | |
| CN103451268B (en) | A kind of standard substance of detection line plastochondria A3243G heterozygous mutant rate, test kit and detection method thereof | |
| CN109097463B (en) | Specific primer probe combination, kit and detection method for detecting HLA-A24: 02 allele | |
| CN104789672A (en) | Bar code magnetic bead liquid chip detection kit for thalassemia gene | |
| CN106399560A (en) | Primer, probe and kit for detecting gene polymorphism of CYP2C9 and VKORC1 | |
| CN103695531A (en) | ABCB 1 gene polymorphism pyrosequencing detection method and kit | |
| CN108456726A (en) | Spinal muscular atrophy genetic test probe, primer and kit | |
| CN106834434B (en) | Nucleic acid, kit and method for detecting COX-1, COX-2 and GPIIIa gene polymorphism | |
| CN106755360A (en) | Nucleic acid, kit and method for detecting mankind's CYP2D6 gene pleiomorphisms | |
| CN102925558B (en) | Kit for detecting mRNA expression level of PML-RARa fusion gene | |
| CN102943116B (en) | Gene detection kit for Thailand type alpha-thalassemia | |
| CN103540676B (en) | Kit for detecting mutations of A-G at 1555th site and C-T at 1494th site of mitochondrial gene | |
| CN101475980B (en) | Reagent kit for predicting plateau pneumochysis pathogenesis risk via NOS3 gene copy number | |
| CN102154487A (en) | Reagent for detecting francisella tularensis and complex probe and fluorescent quantitative polymerase chain reaction (PCR) method for detecting francisella tularensis | |
| CN103502469B (en) | Ankylosing spondylitis susceptibility and mononucleotide polymorphism detection method, kit and use thereof | |
| CN103911462A (en) | Identification and detection method for yellow fever, Japanese encephalitis, chikungunya fever and west Nile fever, primers and probes | |
| CN101135665B (en) | Reagent kit detecting elevated plain pneumochysis susceptibility based on mitochondria DNA T6680C mononucleotide polymorphism | |
| CN101418344B (en) | Kit for predicting risk of high altitude pulmonary edema through AGT gene copy number | |
| CN101624622A (en) | Kit for quantitatively detecting PML/RARalpha mRNA level | |
| CN101418345B (en) | Kit for predicting risk of high altitude pulmonary edema through SFTPA1 gene copy number |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110921 Termination date: 20141024 |
|
| EXPY | Termination of patent right or utility model |