CN101463362A - Expression vector for fusion expression of green fluorescent protein, construction method and use thereof - Google Patents
Expression vector for fusion expression of green fluorescent protein, construction method and use thereof Download PDFInfo
- Publication number
- CN101463362A CN101463362A CNA2009100771037A CN200910077103A CN101463362A CN 101463362 A CN101463362 A CN 101463362A CN A2009100771037 A CNA2009100771037 A CN A2009100771037A CN 200910077103 A CN200910077103 A CN 200910077103A CN 101463362 A CN101463362 A CN 101463362A
- Authority
- CN
- China
- Prior art keywords
- fragment
- green fluorescent
- fluorescent protein
- pgbd
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an expression vector expressing green fluorescent protein by fusion and a construction method and application thereof. The vector is in ring shape , comprising a procaryon replication origin, two eucaryon replication origins and selective marker genes, and two green fluorescent protein gene expression cassettes; the green fluorescent protein gene expression cassettes, from upstream to downstream, consist of two promoters with the same transcription direction, junction fragments, green fluorescent protein encoding genes and polyadenylic acid AATAAA; the green fluorescent protein encoding gene lacks an initiation codon. The junction fragment comprises an EcoRV recognition sequence; the first place and the second place of the green fluorescent protein encoding gene from the end of 5' overlaps the last two places from the end of 5' of the EcoRV recognition sequence; the junction fragment comprises or does not comprise the initiation codon; when the junction fragment comprises the initiation codon, the initiation codon has a space of 2+3n or 1+3n from the first place from the end of 5' of the EcoRV recognition sequence, wherein, n is a positive integer. The vector comprises a green fluorescent protein gene, and can only express the green fluorescent protein on the condition that the gene is correctly expressed, therefore, the interference due to the expression of fluorescence by an initial vector can be effectively excluded.
Description
Technical field
The present invention relates to expression vector and the construction process and the application of fusion expression of green fluorescent protein.
Background technology
The mammalian cell carrier for expression of eukaryon is one of modal expression vector, is widely used in scientific research, fields such as production.The marker that green fluorescent protein (EGFP) also more and more is used as genetic expression is used for the every field of scientific research, its product EGFP pair cell nontoxicity, and detect simple, need not any substrate or other subsidiaries both can under fluorescent microscope, observe directly fluorescence, be very easy to the detection of gene expression dose and location etc.At present, eukaryotic protein green fluorescent protein co-expression plasmid is of many uses in scientific research, as the research protein expression level, to the location of eukaryotic protein in mammalian cell etc.But in the market in the process of the eukaryotic expression albumen plasmid construction expression foreign gene plasmid of Shi Yonging, be to connect by traditional method of attachment, at first to select proper restriction site, there is not selected restriction enzyme site in the exogenous genetic fragment that requires to connect, use digestion with restriction enzyme carrier and exogenous genetic fragment then, use T again
4Dna ligase connects into a complete plasmid with carrier and purpose fragment.The method of attachment that traditional this kind of enzyme is cut exists step more loaded down with trivial details, cost height (need buy restriction endonuclease and ligase enzyme), problem such as joint efficiency is lower, PCR product and carrier all will be cut by enzyme repeatedly in building process, electrophoresis, steps such as recovery just can further connect.
Summary of the invention
The purpose of this invention is to provide a kind of expression vector and construction process and application of fusion expression of green fluorescent protein.
The expression vector of fusion expression of green fluorescent protein provided by the present invention, called after pGBD-EGFP-Vector is a kind of circular vectors, comprises protokaryon replication orgin, eucaryon replication orgin, selection markers gene and green fluorescent protein gene expression; Described green fluorescent protein gene expression is made up of two identical promotor, junction fragment, green fluorescent protein coding region gene and polyadenylic acid tailing signals of transcriptional orientation to the downstream successively from the upstream; Described green fluorescent protein coding region gene disappearance initiator codon, described junction fragment contains the EcoRV recognition sequence, and described green fluorescent protein coding region gene is from 5 ' terminal the 1st and the 2nd and EcoR
The V recognition sequence from 5 ' terminal last two overlapping; Described junction fragment contains or does not contain initiator codon; When described junction fragment contains the initiation codon period of the day from 11 p.m. to 1 a.m, described initiator codon and described EcoRV recognition sequence are from 5 ' terminal first bit interval 2+3n or 1+3n position, and n is a positive integer.
Wherein, described EcoRV recognition sequence is sequence 15 ' terminal 713-718 position in the sequence table, and the nucleotides sequence of described green fluorescent protein coding region gene is classified in the sequence table sequence 1 as from 5 ' terminal 717-1436 position.
When described junction fragment does not contain initiator codon, described green fluorescent protein coding region gene also lacks initiator codon, green fluorescent protein in the carrier is not expressed, the pGBD-EGFP-Vector carrier can not produce fluorescence in cell, help distinguishing empty carrier and the carrier that inserts foreign gene.
When described junction fragment contains initiator codon, described green fluorescent protein coding region gene disappearance initiator codon, in order to make the pGBD-EGFP-Vector carrier in the host bacterium, can not produce fluorescence, described initiator codon and described EcoRV recognition sequence (GATATC) are from 5 ' terminal primary " G " interval 2+3n or 1+3n position, and n is a positive integer; The ORF frame that can guarantee the ORF frame of described initiator codon and green fluorescent protein coding region gene like this is inconsistent, the green fluorescent protein coding region gene is not expressed, the pGBD-EGFP-Vector carrier can not produce fluorescence in cell, can distinguish empty carrier and the carrier that inserts foreign gene.
When the external source goal gene by EcoRV recognition sequence (GATATC) homologous recombination in the pGBD-EGFP-Vector carrier time, the external source goal gene has initiator codon, but do not contain terminator, and the initiator codon of external source goal gene and described EcoRV recognition sequence (GATATC) are from 5 ' terminal primary " G " 3n position, interval, n is a positive integer, the ORF frame of external source goal gene is consistent with the ORF frame of green fluorescent protein coding region gene, thereby the purpose of achieve the goal gene and fluorescin coexpression can detect fluorescence in cell.
The nucleotide sequence of described junction fragment specifically can be in the sequence table sequence 1 from 5 ' terminal 649-718 position.
Described two identical promotors of transcriptional orientation can be multiple promotor, specifically can be cytomegalovirus promoter and T7 phage promoter.Described eucaryon replication orgin can be the starting point that any existing known eukaryote carries out dna replication dna, specifically can be SV40 virus replication starting point.Described polyadenylic acid tailing signal can be has all dna fragmentations that stop Transcription, specifically can be the bovine growth hormone gene polyadenylic acid and adds tailer sequence.Described protokaryon replication origin can be the starting point that any existing known prokaryotic organism carry out dna replication dna, specifically can be escherichia coli plasmid CoIE1 replication origin.
The nucleotide sequence of pGBD-EGFP-Vector carrier specifically can be the sequence 1 in the sequence table.
Cut the linear carrier that the expression vector of described fusion expression of green fluorescent protein obtains with the EcoRV enzyme and also belong to protection scope of the present invention.
Another object of the present invention provides the construction process of the expression vector of described fusion expression of green fluorescent protein.
The construction process of the expression vector of fusion expression of green fluorescent protein provided by the present invention comprises the steps:
1) be template with the pEGFP-N1 plasmid, use following primer: 5 ' ACATGTTCTTTCCTGCGCCGCTACAGGG3 ' and 5 ' GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3 ' carry out pcr amplification, obtain Segment A;
2) be template with the pCDNA3.0 plasmid, use following primer: 5 ' CTCGAGGATATCTGCA
GATATCCAGCACAC3 ' and 5 ' CCCTGTAGCGGCGCAGGAAAGAACATGT3 ' carry out pcr amplification, obtain fragment B;
3) Segment A and fragment B are imported in the competent escherichia coli cell, Segment A is connected with fragment B, obtain recombinant vectors pGBD by homologous recombination;
4) be template with recombinant vectors pGBD, use following primer: 5 ' GGAGGCCTAGGCTTTTGGACGTCAGGTGGCAC 3 ' and 5 ' GAGTTAGGGGCGGGATACATTGATTATTGACTAG 3 ' carry out pcr amplification, obtain fragment D;
5) be template with the pEGFP-N1 plasmid, use following primer:
5 ' GTGCCACCTGACGTCCAAAAGCCTAGGCCTCC 3 ' or 5 ' CTAGTCAATAATCAATGTATCCCGCCCCTAACTC 3 ' carry out pcr amplification, obtain fragment C;
6) fragment C and fragment D are imported in the competent escherichia coli cell, fragment C is connected with fragment D, obtain recombinant vectors pGBD-SV40 by homologous recombination;
7) be template with the pEGFP-N1 plasmid, use following primer: 5 ' CGCCCTGTAGCGGCGATCCCGCCCCTAACTC; 3 ' and 5 ' CTCACATGTTCTTTCCTGCAAAAGCCTAGGCCTCC3 ' carries out pcr amplification, obtains fragment E;
8) be template with recombinant vectors pGBD-SV40, use following primer: 5 ' GAGTTAGGGGCGGGATCGCCGCTACAGGGCG3 ' and 5 ' GGAGGCCTAGGCTTTTGCAGGAAAGAACATGTGAG3 ' carry out pcr amplification, obtain fragment F;
9) fragment E and fragment F are imported in the competent escherichia coli cell, fragment E is connected with fragment F, obtain carrier pGBD-SV40-EGFP-Vector by homologous recombination;
10) be template with carrier pGBD-SV40-EGFP-Vector, use following primer: 5 ' GGAATTCTGCAGATATCGTGAGCAAGGGCG3 ' and 5 ' CGCCCTTGCTCACGATATCTGCAGAATTCC3 ' carry out pcr amplification, obtain fragment G, fragment G is imported in the competent escherichia coli cell, obtain the expression vector of described fusion expression of green fluorescent protein by homologous recombination.
PGBD-EGFP-Vector of the present invention contains green fluorescence protein gene, and this gene only could be expressed under the correct situation about expressing of the foreign gene that inserts, thereby can effectively get rid of the interference problem of setting out vector expression fluorescence and occurring.And pGBD-EGFP-Vector contains an eucaryon replication orgin, can in expressing the antigenic cell of T, rise in value in a large number, thus the level of raising protein expression.Be the carrier that sets out with pGBD-EGFP-Vector of the present invention, utilize the recombinant vectors of homologous recombination construction expression alien gene, avoided traditional enzyme to cut, links such as connection, do not use any restriction endonuclease and ligase enzyme in the whole building process, and omitted 2-3 step than traditional connection procedure, the efficient of connection is also more satisfactory.Use the process of recombinant vectors of pGBD-EGFP-Vector construction expression foreign gene of the present invention easy, quick, economical, efficient, can finish the structure of a large amount of expression of exogenous gene carriers fast.
Description of drawings
Fig. 1 is the structural representation of pGBD-EGFP-Vector.
Fig. 2 observes the expression of results of fluorescin down for fluorescent microscope.
Embodiment
Among the following embodiment if no special instructions method therefor be ordinary method, agents useful for same all can obtain from commercial channels.
The structure of embodiment 1, pGBD-EGFP-Vector
1) structure of pGBD
Design primer pGBD Vector1 upstream and pGBD Vector1 downstream, pGBD Vector2 upstream and pGBDVector2 downstream, the nucleotide sequence in primer pGBD Vector1 upstream and pGBD Vector1 downstream, pGBD Vector2 upstream and pGBD Vector2 downstream is as follows:
PGBD Vector 1 upstream: 5 ' ACATGTTCTTTCCTGCGCCGCTACAGGG 3 ';
PGBD Vector 1 downstream: 5 ' GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3 '.
PGBD Vector 2 upstreams: 5 ' CTCGAGGATATCTGCA
GATATC(the line part is CAGCACAC 3 '
EcoR V enzyme recognition site);
PGBD Vector 2 downstreams: 5 ' CCCTGTAGCGGCGCAGGAAAGAACATGT 3 '.
With pEGFP-N1 (Invitrogen) plasmid is template, with primer pGBD Vector1 upstream and pGBDVector1 downstream PCR amplified fragments A, with the pCDNA3.0 plasmid is template, with primer pGBD Vector2 upstream and pGBD Vector2 downstream PCR amplified fragments B.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind adding Segment A and the B in the 50 μ l competent cells, Segment A and B mass ratio are 100ng:500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, this plasmid called after pGBD.
2) structure of pGBD-EGFP-Vector
Design primer SV (40) upstream and SV (40) downstream, pGBD Vector (1) upstream and pGBD Vector (1) downstream, sequence is as follows:
SV (40) upstream: 5 ' GTGCCACCTGACGTCCAAAAGCCTAGGCCTCC 3 ';
SV (40) downstream: 5 ' CTAGTCAATAATCAATGTATCCCGCCCCTAACTC 3 '.
PGBD Vector (1) upstream: 5 ' GGAGGCCTAGGCTTTTGGACGTCAGGTGGCAC 3 ';
PGBD Vector (1) downstream: 5 ' GAGTTAGGGGCGGGATACATTGATTATTGACTAG 3 '.
With pEGFP-N1 is template, with primer SV (40) upstream and SV (40) downstream PCR amplified fragments C; With pGBD is template, with primer pGBD Vector (1) upstream and pGBD Vector (1) downstream PCR amplified fragments D.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind adding fragment C and the D in the 50 μ l competent cells, fragment C and D mass ratio are 100ng:500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, this plasmid called after pGBD-SV40.
3) structure of pGBD-SV40-EGFP-Vector
Design primer EGFP upstream and EGFP downstream, pGBD-SV40 Vector (2) upstream and pGBD-SV40Vector (2) downstream, primer sequence is as follows:
EGFP upstream: 5 ' CGCCCTGTAGCGGCGATCCCGCCCCTAACTC 3 ';
EGFP downstream: 5 ' CTCACATGTTCTTTCCTGCAAAAGCCTAGGCCTCC 3 '.
PGBD-SV40 Vector (2) upstream: 5 ' GAGTTAGGGGCGGGATCGCCGCTACAGGGCG 3 ';
PGBD-SV40 Vector (2) downstream: 5 ' GGAGGCCTAGGCTTTTGCAGGAAAGAACATGTGAG 3 '.
With the pEGFP-N1 plasmid is template, with primer EGFP upstream and EGFP downstream PCR amplified fragments E; With pGBD-SV40 is template, with primer pGBD-SV40 Vector (2) upstream and pGBD-SV40 Vector (2) downstream PCR amplified fragments F.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind adding fragment E and the F in the 50 μ l competent cells, fragment E and F mass ratio are 100ng:500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, this carrier called after pGBD-SV40-EGFP-Vector.
4) structure of pGBD-EGFP-Vector
Design primer pGBD-EGFP-Vector upstream and pGBD-EGFP-Vector downstream, the nucleotide sequence of pGBD-EGFP-Vector upstream and pGBD-EGFP-Vector downstream primer is as follows:
PGBD-EGFP-Vector upstream: 5 ' GGAATTCTGCAGATATCGTGAGCAAGGGCG 3 ';
PGBD-EGFP-Vector downstream: 5 ' CGCCCTTGCTCACGATATCTGCAGAATTCC 3 '.
With pGBD-SV40-EGFP-Vector is template amplification fragment G.
PCR reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 53 ℃ of annealing 45s, 72 ℃ are extended 6min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
Mixing behind the adding fragment G in the 50 μ l competent cells.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, this carrier called after pGBD-EGFP-Vector.The pGBD-EGFP-Vector collection of illustrative plates as shown in Figure 1.
PGBD-EGFP-Vector is checked order, sequencing result shows, the nucleotide sequence of pGBD-EGFP-Vector such as the sequence in the sequence table 1, sequence 1 is the CMV promotor from 5 ' terminal 1-629 position, from 5 ' terminal 630-648 position is the T7 promotor, from 5 ' terminal 713-718 position is the recognition sequence of EcoR V enzyme, from 5 ' terminal 717-1436 is green fluorescence protein gene, from 5 ' terminal 1437-1791 position is BGH Ploy A, from 5 ' terminal 1792-1993 position is SV40 Origin, from 5 ' terminal 1994-2563 position is COIE1 Origin, is ampicillin resistance gene from 5 ' terminal 2564-3745 position.
Sequence 1 from 5 ' nucleotide sequence of end 700-715 position and the nucleotides sequence from 5 ' end 716-730 position of sequence 1 classify as can with the sequence of pcr amplification product generation homologous sequence reorganization on the foreign gene.
The ability of embodiment 2, pGBD-EGFP-Vector expressing protein
1) structure of the pGBD-M-EGFP-Vector of the M albumen of expression H5N1 and green fluorescent protein
Design primer M upstream and M downstream, primer sequence is as follows:
M upstream: 5 ' GGAATTCTGCAGATCGCCACCATGAGTCTTCTAACCG 3 ';
M downstream: 5 ' GCCCTTGCTCACGATCTTGAATCGTTGCATCTG 3 '.
In the primer GGAATTCTGCAGAT and GCCCTTGCTCACGA sequence be can with sequence 1 from 5 ' sequence from the nucleotide sequence generation homologous recombination of 5 ' end 716-730 position of the nucleotide sequence of end 700-715 position and sequence 1.
With H3 subtype influenza virus (Genetic analysis of H3 subtype influenza virusesisolated from domestic ducks in northern China during 2004-2005, VirusGenes, I10.1007/s 11262-008-0300-7) cDNA of (China Agricultural University) is a template, with primer M upstream and M downstream PCR amplification M gene fragment.
Reaction system: 10 * PCR Buffer, 5 μ L, upstream, each 1 μ L of downstream primer, dna profiling 1 μ L, MgCl
2(25mM) 3 μ L, dNTPs (each 2.5mM) 3 μ L, Pfu-Taq (5U/ μ L) 0.5 μ L, last moisturizing to 50 μ L.
Reaction conditions: 94 ℃ of thermally denature 5min; 94 ℃ of sex change 45s, 50 ℃ of annealing 45s, 72 ℃ are extended 1min, totally 30 circulations; 72 ℃ of last 10min that extend.
The PCR product reclaims test kit with DNA and reclaims, and method is with reference to its specification sheets.
PGBD-EGFP-Vector reclaims linearizing pGBD-EGFP-Vector with the linearizing of EcorV endonuclease digestion.
It is as follows that enzyme is cut system:
10 * D buffer10 μ l, BSA 1 μ l, EcoR V 2 μ l (20U PROMEGA company), pGBD-EGFP-Vector 50 μ l, moisturizing to 100 μ l, 37 ℃ of enzymes are cut and are spent the night.
Enzyme is cut product electrophoresis in the sepharose of 1 * TAE preparation, 120v, and electrophoresis 30 minutes, DNA reclaims test kit and reclaims the purpose fragment.
Mixing after linearizing pGBD-EGFP-Vector of adding and the M gene fragment in the 50 μ l competent cells, linearizing pGBD-EGFP-Vector and M gene fragment mass ratio are 100ng:500ng.System ice bath 30min behind the mixing.3min is placed in 42 ℃ of water-bath heat shocks 90 seconds then on ice, adds the LB substratum 900 μ l of preheating, place under 37 ℃, 180rpm jolting 90min collects thalline, with the resuspended thalline of LB liquid nutrient medium, get on the resuspended liquid coating of the 200 μ l LB plate (containing penbritin), cultivate 12h for 37 ℃.The picking mono-clonal extracts plasmid, this plasmid called after pGBD-M-EGFP-Vector.
2) green fluorescent protein detection
Get in the OPTI-MEMI substratum (Invitrogen company) that 10ul lipofectamine 2000 (Invitrogen company) joins 250ul, room temperature was placed 5 minutes, obtained solution 1; 5ugpGBD-M-EGFP-Vector plasmid and pGBD-EGFP-Vector plasmid are joined respectively in the OPTI-MEMI substratum of 250ul, obtain solution 2 and solution 3; Solution 1 and 2 is mixed, and incubated at room 20 minutes adds the OPTI-MEMI substratum of 500ul again, obtains solution 4; Solution 1 and 3 is mixed, and incubated at room 20 minutes adds the OPTI-MEMI substratum of 500ul again, obtains solution 5.
Place 6 porocyte plates to cultivate in the 293T cell, wait for that cell grows at 60% o'clock with cell PBS washed twice, add solution 4 and 5,37 ℃ then respectively and hatched 5 hours, sucking-off solution 4 and 5 adds fresh OPTI-MEMI substratum respectively, the continuation cultivation.After cultivating 24h, under fluorescent microscope, observe the expression of fluorescin.
As positive control, do not transfer the possession of the negative contrast of 293T of any plasmid with the 293T cell of pEGFP-N1 plasmid transfection.
The fluorescent microscope result as shown in Figure 2, after the pGBD-M-EGFP-Vector transfection 24 hours the 293T cell (Fig. 2 A) stronger fluorescent signal is arranged, positive control (Fig. 2 B) also has fluorescence to occur, and the cell (Fig. 2 C) of negative control group (Fig. 2 D) and transfection pGBD-EGFP-Vector plasmid does not have fluorescence, illustrate that pGBD-M-EGFP-Vector can coexpression foreign protein and green fluorescent protein, has good protein expression ability, but the pGBD-EGFP-Vector plasmid can expressing green fluorescent protein, having only behind the gene that inserts external source and do not have terminator could expressing green fluorescent protein, helps distinguishing empty carrier and the carrier that inserts foreign gene.
Sequence table
＜110〉China Agricultural University
＜120〉expression vector of fusion expression of green fluorescent protein and construction process thereof and application
<130>CGGNARW92032
<160>1
<210>1
<211>3745
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
Claims (10)
1, a kind of circular vectors comprises protokaryon replication orgin, eucaryon replication orgin, selection markers gene and green fluorescent protein gene expression; Described green fluorescent protein gene expression is made up of two identical promotor, junction fragment, green fluorescent protein coding region gene and polyadenylic acid tailing signals of transcriptional orientation to the downstream successively from the upstream; Described green fluorescent protein coding region gene disappearance initiator codon, described junction fragment contains the EcoRV recognition sequence, described green fluorescent protein coding region gene from 5 ' terminal the 1st and the 2nd and EcoRV recognition sequence from 5 ' end last two overlapping; Described junction fragment contains or does not contain initiator codon; When described junction fragment contains the initiation codon period of the day from 11 p.m. to 1 a.m, described initiator codon and described EcoRV recognition sequence are from 5 ' terminal first bit interval 2+3n or 1+3n position, and n is a positive integer.
2, carrier according to claim 1, it is characterized in that: described EcoRV recognition sequence is that sequence 1 is from 5 ' terminal 713-718 position in the sequence table, and the nucleotides sequence of described green fluorescent protein coding region gene is classified in the sequence table sequence 1 as from 5 ' terminal 717-1436 position.
3, carrier according to claim 1 and 2 is characterized in that: the nucleotides sequence of described junction fragment is classified in the sequence table sequence 1 as from 5 ' terminal 649-718 position.
4, carrier according to claim 3 is characterized in that: the identical promotor of described two transcriptional orientations is cytomegalovirus promoter and T7 phage promoter;
5, carrier according to claim 4 is characterized in that: described polyadenylic acid tailing signal adds tailer sequence for the bovine growth hormone gene polyadenylic acid.
6, carrier according to claim 5 is characterized in that: described protokaryon replication origin is an escherichia coli plasmid CoIE1 replication origin, and described eucaryon replication orgin is a SV40 virus replication starting point.
7, carrier according to claim 6 is characterized in that: the nucleotides sequence of described carrier is classified the sequence 1 in the sequence table as.
8, a kind of carrier of linearity is to cut the linear carrier that arbitrary described carrier obtains in the claim 1 to 7 with the EcoRV enzyme.
9, in the tumour cell of expressing the SV40 large T antigen, the application of arbitrary described carrier in expressing foreign protein in the claim 1 to 7.
10, the described construction of carrier of claim 7 comprises the steps:
1) be template with the pEGFP-N1 plasmid, use following primer: 5 ' ACATGTTCTTTCCTGCGCCGCTACAGGG 3 ' and 5 ' GAATTCTGCAGATATCCTCGAGCATGCATCTAG 3 ' carry out pcr amplification, obtain Segment A;
2) be template with the pCDNA3.0 plasmid, use following primer: 5 ' CTCGAGGATATCTGCA
GATATCCAGCACAC3 ' and 5 ' CCCTGTAGCGGCGCAGGAAAGAACATGT3 ' carry out pcr amplification, obtain fragment B;
3) Segment A and fragment B are imported in the competent escherichia coli cell, Segment A is connected with fragment B, obtain recombinant vectors pGBD by homologous recombination;
4) be template with recombinant vectors pGBD, use following primer: 5 ' GGAGGCCTAGGCTTTTGGACGTCAGGTGGCAC3 ' and 5 ' GAGTTAGGGGCGGGATACATTGATTATTGACTAG3 ' carry out pcr amplification, obtain fragment D;
5) be template with the pEGFP-N1 plasmid, use following primer:
5 ' GTGCCACCTGACGTCCAAAAGCCTAGGCCTCC3 ' or 5 ' CTAGTCAATAATCAATGTATCCCGCCCCTAACTC3 ' carry out pcr amplification, obtain fragment C;
6) fragment C and fragment D are imported in the competent escherichia coli cell, fragment C is connected with fragment D, obtain recombinant vectors pGBD-SV40 by homologous recombination;
7) be template with the pEGFP-N1 plasmid, use following primer: 5 ' CGCCCTGTAGCGGCGATCCCGCCCCTAACTC; 3 ' and 5 ' CTCACATGTTCTTTCCTGCAAAAGCCTAGGCCTCC3 ' carries out pcr amplification, obtains fragment E;
8) be template with recombinant vectors pGBD-SV40, use following primer: 5 ' GAGTTAGGGGCGGGATCGCCGCTACAGGGCG3 ' and 5 ' GGAGGCCTAGGCTTTTGCAGGAAAGAACATGTGAG3 ' carry out pcr amplification, obtain fragment F;
9) fragment E and fragment F are imported in the competent escherichia coli cell, fragment E is connected with fragment F, obtain carrier pGBD-SV40-EGFP-Vector by homologous recombination;
10) be template with carrier pGBD-SV40-EGFP-Vector, use following primer: 5 ' GGAATTCTGCAGATATCGTGAGCAAGGGCG3 ' and 5 ' CGCCCTTGCTCACGATATCTGCAGAATTCC3 ' carry out pcr amplification, obtain fragment G, fragment G is imported in the competent escherichia coli cell, obtain the described carrier of claim 7 by homologous recombination.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100771037A CN101463362B (en) | 2009-01-15 | 2009-01-15 | Expression vector for fusion expression of green fluorescent protein, construction method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009100771037A CN101463362B (en) | 2009-01-15 | 2009-01-15 | Expression vector for fusion expression of green fluorescent protein, construction method and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101463362A true CN101463362A (en) | 2009-06-24 |
| CN101463362B CN101463362B (en) | 2011-07-20 |
Family
ID=40804153
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009100771037A Expired - Fee Related CN101463362B (en) | 2009-01-15 | 2009-01-15 | Expression vector for fusion expression of green fluorescent protein, construction method and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101463362B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948872A (en) * | 2010-08-24 | 2011-01-19 | 中国农业科学院哈尔滨兽医研究所 | Swine promoter protein expression vector and construction method and application thereof |
| CN101985634A (en) * | 2010-11-04 | 2011-03-16 | 中国人民解放军第四军医大学 | GFP membrane type expression vector and method for sorting vector-transfected positive cells |
| CN106148379A (en) * | 2016-07-26 | 2016-11-23 | 中国水产科学研究院珠江水产研究所 | A kind of method of labeled with green fluorescent protein gene murrel source Aeromonas schubertii |
| CN109734815A (en) * | 2019-02-22 | 2019-05-10 | 武汉巴菲尔生物技术服务有限公司 | A kind of enhanced fluorescin |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1263860C (en) * | 2002-09-30 | 2006-07-12 | 华南农业大学 | Construction method of multigene carrier and its application |
| WO2006077101A2 (en) * | 2005-01-18 | 2006-07-27 | Abbott Gmbh & Co. Kg | Ager-peptides and use thereof |
-
2009
- 2009-01-15 CN CN2009100771037A patent/CN101463362B/en not_active Expired - Fee Related
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948872A (en) * | 2010-08-24 | 2011-01-19 | 中国农业科学院哈尔滨兽医研究所 | Swine promoter protein expression vector and construction method and application thereof |
| CN101948872B (en) * | 2010-08-24 | 2013-03-20 | 中国农业科学院哈尔滨兽医研究所 | Swine promoter protein expression vector and construction method and application thereof |
| CN101985634A (en) * | 2010-11-04 | 2011-03-16 | 中国人民解放军第四军医大学 | GFP membrane type expression vector and method for sorting vector-transfected positive cells |
| CN101985634B (en) * | 2010-11-04 | 2012-06-13 | 中国人民解放军第四军医大学 | GFP membrane type expression vector and method for sorting vector-transfected positive cells |
| CN106148379A (en) * | 2016-07-26 | 2016-11-23 | 中国水产科学研究院珠江水产研究所 | A kind of method of labeled with green fluorescent protein gene murrel source Aeromonas schubertii |
| CN109734815A (en) * | 2019-02-22 | 2019-05-10 | 武汉巴菲尔生物技术服务有限公司 | A kind of enhanced fluorescin |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101463362B (en) | 2011-07-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109929839A (en) | Detatching single base gene editing system and its application | |
| CN101463362A (en) | Expression vector for fusion expression of green fluorescent protein, construction method and use thereof | |
| CN110981968B (en) | Fusion protein containing rabies virus G protein, preparation method, application and vaccine thereof | |
| CN101120093B (en) | Vectors comprising novel regulatory elements | |
| WO2023093007A1 (en) | Site for stably expressing protein in cho cell gene nw_003614889.1, and use thereof | |
| CN110184287B (en) | Method for preparing recombinant virus and application thereof | |
| CN111363727A (en) | Recombinant influenza virus carrying helicobacter pylori, host cell, preparation method and application thereof | |
| CN110438128A (en) | Utilize the method for CRISPR/Cas9 system knock-out pig CCAR1 gene | |
| CN105695494A (en) | Three-cistron expression vector, preparation method and application | |
| CN109072251A (en) | promoter | |
| Luke et al. | Development of antibiotic-free selection system for safer DNA vaccination | |
| CN110205308A (en) | It is a kind of express HA gene recombinant herpesvirus of turkeys and its application | |
| CN112779262B (en) | Application of pig RagC gene | |
| CN101463361A (en) | Expression vector of double expression boxes, as well as preparation method and application thereof | |
| CN103540587A (en) | Method of target-integrating foreign DNA (Deoxyribonucleic Acid) sequence to Rosa26 sites of rat and mouse as well as application thereof | |
| CN104232676A (en) | Parental plasmid for obtaining minicircle DNA, and application thereof | |
| CN101343639B (en) | Eukaryon expression shuttle vector, construction method and application | |
| JP6099075B2 (en) | Method for promoting transport of target mRNA from nucleus to cytoplasm, protein expression method and production method, and kit used therefor | |
| EP0851917A1 (en) | Heterologous protein production system using avian cells | |
| CN101948872B (en) | Swine promoter protein expression vector and construction method and application thereof | |
| CN109402096A (en) | A kind of AID enzyme mutant and its application | |
| CN107881174B (en) | Method for regulating and controlling translation level gene expression and application | |
| CN105219802A (en) | The specific expressed GIPR of islet tissue dnlentiviral vectors and application thereof | |
| CN102660552B (en) | Establishment and establishing method of molecular cloned/stably transfected cell line of cattle interleukins 32 gamma subtype | |
| CN111228292B (en) | Application of human TPT1/TCTP gene in preparation of antitumor drugs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20110720 Termination date: 20150115 |
|
| EXPY | Termination of patent right or utility model |